>Feature sequence01 1050 220 gene locus_tag LOCUS_00010 gene pgeF 1050 220 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799068.1 protein_id gnl|my_center|LOCUS_00010 1913 1050 gene locus_tag LOCUS_00020 1913 1050 CDS product Tab2/Atab2 family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124683.1 protein_id gnl|my_center|LOCUS_00020 3166 1910 gene locus_tag LOCUS_00030 3166 1910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3225 4016 gene locus_tag LOCUS_00040 3225 4016 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124685.1 protein_id gnl|my_center|LOCUS_00040 4120 4785 gene locus_tag LOCUS_00050 4120 4785 CDS product aldehyde oxygenase (deformylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124686.1 protein_id gnl|my_center|LOCUS_00050 4823 5875 gene locus_tag LOCUS_00060 4823 5875 CDS product long-chain acyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124687.1 protein_id gnl|my_center|LOCUS_00060 5884 6876 gene locus_tag LOCUS_00070 5884 6876 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124688.1 protein_id gnl|my_center|LOCUS_00070 6961 7662 gene locus_tag LOCUS_00080 6961 7662 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124689.1 protein_id gnl|my_center|LOCUS_00080 7673 8473 gene locus_tag LOCUS_00090 7673 8473 CDS product GTP cyclohydrolase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011128594.1 protein_id gnl|my_center|LOCUS_00090 9159 8470 gene locus_tag LOCUS_00100 9159 8470 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866401.1 protein_id gnl|my_center|LOCUS_00100 9227 10519 gene locus_tag LOCUS_00110 9227 10519 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124693.1 protein_id gnl|my_center|LOCUS_00110 10605 11327 gene locus_tag LOCUS_00120 10605 11327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11511 11741 gene locus_tag LOCUS_00130 11511 11741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11981 12406 gene locus_tag LOCUS_00140 11981 12406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 14589 12409 gene locus_tag LOCUS_00150 gene selD 14589 12409 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891662.1 protein_id gnl|my_center|LOCUS_00150 14650 15723 gene locus_tag LOCUS_00160 gene galE 14650 15723 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920997.1 protein_id gnl|my_center|LOCUS_00160 15727 17037 gene locus_tag LOCUS_00170 gene hisS 15727 17037 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124931.1 protein_id gnl|my_center|LOCUS_00170 17249 17052 gene locus_tag LOCUS_00180 17249 17052 CDS product photosystem II reaction center protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124486.1 protein_id gnl|my_center|LOCUS_00180 17800 17540 gene locus_tag LOCUS_00190 gene psbE 17800 17540 CDS product cytochrome b559 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124483.1 protein_id gnl|my_center|LOCUS_00190 18922 17894 gene locus_tag LOCUS_00200 18922 17894 CDS product photosynthesis system II assembly factor Ycf48 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124482.1 protein_id gnl|my_center|LOCUS_00200 19293 18958 gene locus_tag LOCUS_00210 19293 18958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19551 19913 gene locus_tag LOCUS_00220 19551 19913 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124480.1 protein_id gnl|my_center|LOCUS_00220 20000 20767 gene locus_tag LOCUS_00230 gene nuoB 20000 20767 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124479.1 protein_id gnl|my_center|LOCUS_00230 20764 21303 gene locus_tag LOCUS_00240 20764 21303 CDS product NAD(P)H-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124478.1 protein_id gnl|my_center|LOCUS_00240 21908 21336 gene locus_tag LOCUS_00250 21908 21336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 22618 22133 gene locus_tag LOCUS_00260 22618 22133 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328877.1 protein_id gnl|my_center|LOCUS_00260 24140 22797 gene locus_tag LOCUS_00270 gene gorA 24140 22797 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124722.1 protein_id gnl|my_center|LOCUS_00270 24323 24703 gene locus_tag LOCUS_00280 24323 24703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 24768 25106 gene locus_tag LOCUS_00290 24768 25106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00290 25488 25829 gene locus_tag LOCUS_00300 25488 25829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 26373 26098 gene locus_tag LOCUS_00310 26373 26098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 26372 28663 gene locus_tag LOCUS_00320 26372 28663 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957294.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00320 28754 29395 gene locus_tag LOCUS_00330 28754 29395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00330 29744 29950 gene locus_tag LOCUS_00340 29744 29950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 31091 30234 gene locus_tag LOCUS_00350 31091 30234 CDS product major capsid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989953.1 protein_id gnl|my_center|LOCUS_00350 31417 32004 gene locus_tag LOCUS_00360 gene hemJ 31417 32004 CDS product protoporphyrinogen oxidase HemJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125107.1 protein_id gnl|my_center|LOCUS_00360 32129 32659 gene locus_tag LOCUS_00370 32129 32659 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125108.1 protein_id gnl|my_center|LOCUS_00370 32764 33258 gene locus_tag LOCUS_00380 32764 33258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 36875 33255 gene locus_tag LOCUS_00390 gene cobN 36875 33255 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143069.1 protein_id gnl|my_center|LOCUS_00390 38031 39338 gene locus_tag LOCUS_00400 38031 39338 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125302.1 protein_id gnl|my_center|LOCUS_00400 39476 39703 gene locus_tag LOCUS_00410 39476 39703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 39690 41303 gene locus_tag LOCUS_00420 39690 41303 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125304.1 protein_id gnl|my_center|LOCUS_00420 41312 42334 gene locus_tag LOCUS_00430 41312 42334 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125305.1 protein_id gnl|my_center|LOCUS_00430 44197 42368 gene locus_tag LOCUS_00440 44197 42368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 45531 44218 gene locus_tag LOCUS_00450 45531 44218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00450 46051 46422 gene locus_tag LOCUS_00460 46051 46422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 49426 46445 gene locus_tag LOCUS_00470 49426 46445 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228378.1 protein_id gnl|my_center|LOCUS_00470 49964 49602 gene locus_tag LOCUS_00480 49964 49602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 51752 51150 gene locus_tag LOCUS_00490 51752 51150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 55285 54131 gene locus_tag LOCUS_00500 55285 54131 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_00500 56453 55269 gene locus_tag LOCUS_00510 56453 55269 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202567.1 protein_id gnl|my_center|LOCUS_00510 57714 56542 gene locus_tag LOCUS_00520 57714 56542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968622.1 protein_id gnl|my_center|LOCUS_00520 58214 57714 gene locus_tag LOCUS_00530 58214 57714 CDS product DUF4365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968621.1 protein_id gnl|my_center|LOCUS_00530 58667 58215 gene locus_tag LOCUS_00540 58667 58215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 61726 58664 gene locus_tag LOCUS_00550 61726 58664 CDS product DUF499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228376.1 protein_id gnl|my_center|LOCUS_00550 61710 61859 gene locus_tag LOCUS_00560 61710 61859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 62091 62591 gene locus_tag LOCUS_00570 62091 62591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 63027 62560 gene locus_tag LOCUS_00580 63027 62560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 63638 64129 gene locus_tag LOCUS_00590 63638 64129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 64217 64786 gene locus_tag LOCUS_00600 64217 64786 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124472.1 protein_id gnl|my_center|LOCUS_00600 64783 66225 gene locus_tag LOCUS_00610 64783 66225 CDS product deoxyribodipyrimidine photo-lyase, 8-HDF type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056280.1 protein_id gnl|my_center|LOCUS_00610 67398 68009 gene locus_tag LOCUS_00620 67398 68009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 68364 68615 gene locus_tag LOCUS_00630 68364 68615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00630 68685 69455 gene locus_tag LOCUS_00640 68685 69455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 71027 70533 gene locus_tag LOCUS_00650 71027 70533 CDS product allophycocyanin subunit alpha-B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920894.1 protein_id gnl|my_center|LOCUS_00650 73506 71149 gene locus_tag LOCUS_00660 gene pheT 73506 71149 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920733.1 protein_id gnl|my_center|LOCUS_00660 73684 73878 gene locus_tag LOCUS_00670 gene rpmG 73684 73878 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057895.1 protein_id gnl|my_center|LOCUS_00670 73939 74157 gene locus_tag LOCUS_00680 gene rpsR 73939 74157 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125120.1 protein_id gnl|my_center|LOCUS_00680 74244 75494 gene locus_tag LOCUS_00690 74244 75494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 75533 76270 gene locus_tag LOCUS_00700 gene phnC 75533 76270 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368503.1 protein_id gnl|my_center|LOCUS_00700 76302 77195 gene locus_tag LOCUS_00710 76302 77195 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892069.1 protein_id gnl|my_center|LOCUS_00710 77209 77976 gene locus_tag LOCUS_00720 77209 77976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 78091 79017 gene locus_tag LOCUS_00730 78091 79017 CDS product RpoD/SigA family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126012.1 protein_id gnl|my_center|LOCUS_00730 79029 79679 gene locus_tag LOCUS_00740 79029 79679 CDS product dolichol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923313.1 protein_id gnl|my_center|LOCUS_00740 80757 79669 gene locus_tag LOCUS_00750 80757 79669 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126014.1 protein_id gnl|my_center|LOCUS_00750 80820 83414 gene locus_tag LOCUS_00760 gene acnB 80820 83414 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126015.1 protein_id gnl|my_center|LOCUS_00760 83433 84839 gene locus_tag LOCUS_00770 83433 84839 CDS product ClC family H(+)/Cl(-) exchange transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126016.1 protein_id gnl|my_center|LOCUS_00770 86040 84814 gene locus_tag LOCUS_00780 86040 84814 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126018.1 protein_id gnl|my_center|LOCUS_00780 86187 86837 gene locus_tag LOCUS_00790 86187 86837 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056138.1 protein_id gnl|my_center|LOCUS_00790 87629 87006 gene locus_tag LOCUS_00800 87629 87006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 87820 87626 gene locus_tag LOCUS_00810 87820 87626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 88160 88690 gene locus_tag LOCUS_00820 88160 88690 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125631.1 protein_id gnl|my_center|LOCUS_00820 88761 89159 gene locus_tag LOCUS_00830 88761 89159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 89152 90174 gene locus_tag LOCUS_00840 89152 90174 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124185.1 protein_id gnl|my_center|LOCUS_00840 91629 90439 gene locus_tag LOCUS_00850 91629 90439 CDS product FAD/NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558755.1 protein_id gnl|my_center|LOCUS_00850 91776 92036 gene locus_tag LOCUS_00860 91776 92036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 93523 92819 gene locus_tag LOCUS_00870 93523 92819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 94586 93687 gene locus_tag LOCUS_00880 gene bchL 94586 93687 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) iron-sulfur ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124698.1 protein_id gnl|my_center|LOCUS_00880 96313 94643 gene locus_tag LOCUS_00890 96313 94643 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124699.1 protein_id gnl|my_center|LOCUS_00890 97648 96338 gene locus_tag LOCUS_00900 97648 96338 CDS product ferredoxin:protochlorophyllide reductase (ATP-dependent) subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124700.1 protein_id gnl|my_center|LOCUS_00900 98013 98564 gene locus_tag LOCUS_00910 98013 98564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 98578 99945 gene locus_tag LOCUS_00920 98578 99945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 100825 100061 gene locus_tag LOCUS_00930 100825 100061 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124349.1 protein_id gnl|my_center|LOCUS_00930 101340 101744 gene locus_tag LOCUS_00940 101340 101744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00940 101774 103081 gene locus_tag LOCUS_00950 gene eno 101774 103081 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124390.1 protein_id gnl|my_center|LOCUS_00950 104810 103110 gene locus_tag LOCUS_00960 104810 103110 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892179.1 protein_id gnl|my_center|LOCUS_00960 105193 104807 gene locus_tag LOCUS_00970 105193 104807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 105740 105297 gene locus_tag LOCUS_00980 105740 105297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 107121 105886 gene locus_tag LOCUS_00990 gene argJ 107121 105886 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124209.1 protein_id gnl|my_center|LOCUS_00990 107198 107851 gene locus_tag LOCUS_01000 gene coaE 107198 107851 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023172233.1 protein_id gnl|my_center|LOCUS_01000 108038 108391 gene locus_tag LOCUS_01010 108038 108391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 108427 108669 gene locus_tag LOCUS_01020 108427 108669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 >Feature sequence02 457 113 gene locus_tag LOCUS_01030 457 113 CDS product PAM68 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124904.1 protein_id gnl|my_center|LOCUS_01030 884 567 gene locus_tag LOCUS_01040 gene rpsO 884 567 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124905.1 protein_id gnl|my_center|LOCUS_01040 1558 884 gene locus_tag LOCUS_01050 gene ruvA 1558 884 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056382.1 protein_id gnl|my_center|LOCUS_01050 1843 2391 gene locus_tag LOCUS_01060 1843 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 2375 2917 gene locus_tag LOCUS_01070 2375 2917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 3002 2931 gene locus_tag LOCUS_t00010 3002 2931 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3822 3076 gene locus_tag LOCUS_01080 3822 3076 CDS product photosystem II S4 domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057995.1 protein_id gnl|my_center|LOCUS_01080 4313 3822 gene locus_tag LOCUS_01090 4313 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125588.1 protein_id gnl|my_center|LOCUS_01090 4370 5956 gene locus_tag LOCUS_01100 gene serA 4370 5956 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125587.1 protein_id gnl|my_center|LOCUS_01100 6000 6866 gene locus_tag LOCUS_01110 gene prmA 6000 6866 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125586.1 protein_id gnl|my_center|LOCUS_01110 7087 7386 gene locus_tag LOCUS_01120 7087 7386 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125585.1 protein_id gnl|my_center|LOCUS_01120 7461 7865 gene locus_tag LOCUS_01130 7461 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 8460 7924 gene locus_tag LOCUS_01140 gene psbV 8460 7924 CDS product photosystem II cytochrome c-550 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057125.1 protein_id gnl|my_center|LOCUS_01140 9531 8560 gene locus_tag LOCUS_01150 gene rnz 9531 8560 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125581.1 protein_id gnl|my_center|LOCUS_01150 9584 9805 gene locus_tag LOCUS_01160 9584 9805 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125734.1 protein_id gnl|my_center|LOCUS_01160 9849 10208 gene locus_tag LOCUS_01170 9849 10208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 10285 11007 gene locus_tag LOCUS_01180 10285 11007 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141257.1 protein_id gnl|my_center|LOCUS_01180 11146 12519 gene locus_tag LOCUS_01190 gene thiC 11146 12519 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892565.1 protein_id gnl|my_center|LOCUS_01190 12728 12609 gene locus_tag LOCUS_01200 12728 12609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 12953 13168 gene locus_tag LOCUS_01210 12953 13168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 13528 13719 gene locus_tag LOCUS_01220 13528 13719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 13780 14544 gene locus_tag LOCUS_01230 13780 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892573.1 protein_id gnl|my_center|LOCUS_01230 15496 14531 gene locus_tag LOCUS_01240 15496 14531 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921038.1 protein_id gnl|my_center|LOCUS_01240 15619 16884 gene locus_tag LOCUS_01250 15619 16884 CDS product methionine gamma-lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143008.1 protein_id gnl|my_center|LOCUS_01250 16930 17346 gene locus_tag LOCUS_01260 gene gcvH 16930 17346 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057515.1 protein_id gnl|my_center|LOCUS_01260 17343 18527 gene locus_tag LOCUS_01270 gene thiO 17343 18527 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124206.1 protein_id gnl|my_center|LOCUS_01270 19048 18503 gene locus_tag LOCUS_01280 gene ndk 19048 18503 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892097.1 protein_id gnl|my_center|LOCUS_01280 19212 22625 gene locus_tag LOCUS_01290 19212 22625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 23195 22761 gene locus_tag LOCUS_01300 23195 22761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 24009 23518 gene locus_tag LOCUS_01310 gene ndk 24009 23518 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892097.1 protein_id gnl|my_center|LOCUS_01310 25205 24111 gene locus_tag LOCUS_01320 gene dprA 25205 24111 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920872.1 protein_id gnl|my_center|LOCUS_01320 25361 26176 gene locus_tag LOCUS_01330 25361 26176 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920890.1 protein_id gnl|my_center|LOCUS_01330 26179 27549 gene locus_tag LOCUS_01340 26179 27549 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891691.1 protein_id gnl|my_center|LOCUS_01340 28521 28300 gene locus_tag LOCUS_01350 28521 28300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 29357 29815 gene locus_tag LOCUS_01360 29357 29815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 30301 32811 gene locus_tag LOCUS_01370 30301 32811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 32873 33235 gene locus_tag LOCUS_01380 32873 33235 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055973.1 protein_id gnl|my_center|LOCUS_01380 33242 33520 gene locus_tag LOCUS_01390 33242 33520 CDS product DUF3143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055972.1 protein_id gnl|my_center|LOCUS_01390 33561 35147 gene locus_tag LOCUS_01400 33561 35147 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929181.1 protein_id gnl|my_center|LOCUS_01400 36203 35166 gene locus_tag LOCUS_01410 36203 35166 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892408.1 protein_id gnl|my_center|LOCUS_01410 36507 37163 gene locus_tag LOCUS_01420 36507 37163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 37984 37097 gene locus_tag LOCUS_01430 37984 37097 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125263.1 protein_id gnl|my_center|LOCUS_01430 38634 37981 gene locus_tag LOCUS_01440 gene cbiT 38634 37981 CDS product precorrin-6Y C5,15-methyltransferase subunit CbiT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057353.1 protein_id gnl|my_center|LOCUS_01440 40089 38656 gene locus_tag LOCUS_01450 40089 38656 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920942.1 protein_id gnl|my_center|LOCUS_01450 40572 41030 gene locus_tag LOCUS_01460 40572 41030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 42132 41086 gene locus_tag LOCUS_01470 42132 41086 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058107.1 protein_id gnl|my_center|LOCUS_01470 42068 42805 gene locus_tag LOCUS_01480 42068 42805 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125824.1 protein_id gnl|my_center|LOCUS_01480 42886 43851 gene locus_tag LOCUS_01490 42886 43851 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_01490 44284 43790 gene locus_tag LOCUS_01500 44284 43790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 44736 44491 gene locus_tag LOCUS_01510 44736 44491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 44666 45154 gene locus_tag LOCUS_01520 44666 45154 CDS product photosystem I reaction center protein subunit XI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125828.1 protein_id gnl|my_center|LOCUS_01520 45210 46832 gene locus_tag LOCUS_01530 45210 46832 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125098.1 protein_id gnl|my_center|LOCUS_01530 46941 46851 gene locus_tag LOCUS_t00020 46941 46851 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 48088 46958 gene locus_tag LOCUS_01540 gene alr 48088 46958 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056313.1 protein_id gnl|my_center|LOCUS_01540 48983 48492 gene locus_tag LOCUS_01550 gene ribH 48983 48492 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125952.1 protein_id gnl|my_center|LOCUS_01550 49249 49016 gene locus_tag LOCUS_01560 49249 49016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 49312 51945 gene locus_tag LOCUS_01570 gene mutS 49312 51945 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058073.1 protein_id gnl|my_center|LOCUS_01570 51967 52770 gene locus_tag LOCUS_01580 51967 52770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393727.1 protein_id gnl|my_center|LOCUS_01580 52777 53337 gene locus_tag LOCUS_01590 52777 53337 CDS product DUF1788 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393726.1 protein_id gnl|my_center|LOCUS_01590 53334 56834 gene locus_tag LOCUS_01600 gene brxC 53334 56834 CDS product BREX system P-loop protein BrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393725.1 protein_id gnl|my_center|LOCUS_01600 56873 60442 gene locus_tag LOCUS_01610 56873 60442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 60507 60875 gene locus_tag LOCUS_01620 60507 60875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 60868 61959 gene locus_tag LOCUS_01630 60868 61959 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_01630 61956 62615 gene locus_tag LOCUS_01640 61956 62615 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141840.1 protein_id gnl|my_center|LOCUS_01640 62679 65051 gene locus_tag LOCUS_01650 gene pglZ 62679 65051 CDS product BREX-1 system phosphatase PglZ type B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393722.1 protein_id gnl|my_center|LOCUS_01650 65063 67108 gene locus_tag LOCUS_01660 gene brxL 65063 67108 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152948297.1 protein_id gnl|my_center|LOCUS_01660 67152 69197 gene locus_tag LOCUS_01670 gene mutS 67152 69197 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058073.1 protein_id gnl|my_center|LOCUS_01670 71227 69683 gene locus_tag LOCUS_01680 71227 69683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390741.1 protein_id gnl|my_center|LOCUS_01680 72591 71224 gene locus_tag LOCUS_01690 72591 71224 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390742.1 protein_id gnl|my_center|LOCUS_01690 73076 72588 gene locus_tag LOCUS_01700 73076 72588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390743.1 protein_id gnl|my_center|LOCUS_01700 73532 73317 gene locus_tag LOCUS_01710 73532 73317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 75648 73630 gene locus_tag LOCUS_01720 75648 73630 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124234.1 protein_id gnl|my_center|LOCUS_01720 76044 75706 gene locus_tag LOCUS_01730 76044 75706 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124235.1 protein_id gnl|my_center|LOCUS_01730 76440 76153 gene locus_tag LOCUS_01740 76440 76153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 76515 77522 gene locus_tag LOCUS_01750 76515 77522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 77599 77817 gene locus_tag LOCUS_01760 77599 77817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 78246 77860 gene locus_tag LOCUS_01770 78246 77860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 78699 78547 gene locus_tag LOCUS_01780 78699 78547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 78732 79463 gene locus_tag LOCUS_01790 gene pyrH 78732 79463 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124676.1 protein_id gnl|my_center|LOCUS_01790 79483 80049 gene locus_tag LOCUS_01800 gene frr 79483 80049 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056114.1 protein_id gnl|my_center|LOCUS_01800 81235 80060 gene locus_tag LOCUS_01810 81235 80060 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056320.1 protein_id gnl|my_center|LOCUS_01810 82394 81486 gene locus_tag LOCUS_01820 82394 81486 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057121.1 protein_id gnl|my_center|LOCUS_01820 84085 82424 gene locus_tag LOCUS_01830 gene ribBA 84085 82424 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920923.1 protein_id gnl|my_center|LOCUS_01830 84145 85212 gene locus_tag LOCUS_01840 gene argC 84145 85212 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125096.1 protein_id gnl|my_center|LOCUS_01840 85877 85203 gene locus_tag LOCUS_01850 gene purN 85877 85203 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524113.1 protein_id gnl|my_center|LOCUS_01850 86178 85894 gene locus_tag LOCUS_01860 86178 85894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124395.1 protein_id gnl|my_center|LOCUS_01860 87192 86182 gene locus_tag LOCUS_01870 87192 86182 CDS product sodium-dependent bicarbonate transport family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124396.1 protein_id gnl|my_center|LOCUS_01870 87291 87878 gene locus_tag LOCUS_01880 87291 87878 CDS product non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124703.1 protein_id gnl|my_center|LOCUS_01880 88103 87852 gene locus_tag LOCUS_01890 88103 87852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 88411 88181 gene locus_tag LOCUS_01900 88411 88181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 88588 90045 gene locus_tag LOCUS_01910 88588 90045 CDS product circularly permuted type 2 ATP-grasp protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057806.1 protein_id gnl|my_center|LOCUS_01910 90072 91016 gene locus_tag LOCUS_01920 90072 91016 CDS product alpha-E domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920827.1 protein_id gnl|my_center|LOCUS_01920 91013 91906 gene locus_tag LOCUS_01930 91013 91906 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057619.1 protein_id gnl|my_center|LOCUS_01930 92427 91969 gene locus_tag LOCUS_01940 92427 91969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 93128 92424 gene locus_tag LOCUS_01950 93128 92424 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125508.1 protein_id gnl|my_center|LOCUS_01950 94239 93220 gene locus_tag LOCUS_01960 94239 93220 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125509.1 protein_id gnl|my_center|LOCUS_01960 94523 94248 gene locus_tag LOCUS_01970 94523 94248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 96117 94645 gene locus_tag LOCUS_01980 gene ffh 96117 94645 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125511.1 protein_id gnl|my_center|LOCUS_01980 98360 96228 gene locus_tag LOCUS_01990 98360 96228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 98529 99581 gene locus_tag LOCUS_02000 gene pdhA 98529 99581 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125513.1 protein_id gnl|my_center|LOCUS_02000 100489 99563 gene locus_tag LOCUS_02010 gene lipA 100489 99563 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141031.1 protein_id gnl|my_center|LOCUS_02010 100517 100591 gene locus_tag LOCUS_t00030 100517 100591 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 102417 100582 gene locus_tag LOCUS_02020 gene cobJ 102417 100582 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057147.1 protein_id gnl|my_center|LOCUS_02020 102754 105060 gene locus_tag LOCUS_02030 gene psaA 102754 105060 CDS product photosystem I core protein PsaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920748.1 protein_id gnl|my_center|LOCUS_02030 105082 107295 gene locus_tag LOCUS_02040 gene psaB 105082 107295 CDS product photosystem I core protein PsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125822.1 protein_id gnl|my_center|LOCUS_02040 107752 107420 gene locus_tag LOCUS_02050 107752 107420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 >Feature sequence03 205 450 gene locus_tag LOCUS_02060 205 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 529 744 gene locus_tag LOCUS_02070 529 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 1049 711 gene locus_tag LOCUS_02080 1049 711 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125818.1 protein_id gnl|my_center|LOCUS_02080 1975 1088 gene locus_tag LOCUS_02090 gene truB 1975 1088 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125579.1 protein_id gnl|my_center|LOCUS_02090 1919 2794 gene locus_tag LOCUS_02100 1919 2794 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839717.1 protein_id gnl|my_center|LOCUS_02100 3058 2723 gene locus_tag LOCUS_02110 3058 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02110 3245 4159 gene locus_tag LOCUS_02120 3245 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 4363 6387 gene locus_tag LOCUS_02130 4363 6387 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124578.1 protein_id gnl|my_center|LOCUS_02130 7780 6404 gene locus_tag LOCUS_02140 7780 6404 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124577.1 protein_id gnl|my_center|LOCUS_02140 8144 7773 gene locus_tag LOCUS_02150 8144 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 8192 9271 gene locus_tag LOCUS_02160 gene queA 8192 9271 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124557.1 protein_id gnl|my_center|LOCUS_02160 9916 9302 gene locus_tag LOCUS_02170 9916 9302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 11211 9913 gene locus_tag LOCUS_02180 11211 9913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 11167 11331 gene locus_tag LOCUS_02190 11167 11331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 13018 11561 gene locus_tag LOCUS_02200 13018 11561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 13132 13323 gene locus_tag LOCUS_02210 13132 13323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 15050 13410 gene locus_tag LOCUS_02220 gene groL 15050 13410 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125739.1 protein_id gnl|my_center|LOCUS_02220 15418 15107 gene locus_tag LOCUS_02230 gene groES 15418 15107 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125740.1 protein_id gnl|my_center|LOCUS_02230 15685 17148 gene locus_tag LOCUS_02240 gene atpD 15685 17148 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125741.1 protein_id gnl|my_center|LOCUS_02240 17230 17643 gene locus_tag LOCUS_02250 gene atpC 17230 17643 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125742.1 protein_id gnl|my_center|LOCUS_02250 17735 17935 gene locus_tag LOCUS_02260 17735 17935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 18046 18246 gene locus_tag LOCUS_02270 18046 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 18922 18344 gene locus_tag LOCUS_02280 18922 18344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125272.1 protein_id gnl|my_center|LOCUS_02280 19137 20267 gene locus_tag LOCUS_02290 19137 20267 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125273.1 protein_id gnl|my_center|LOCUS_02290 20342 20415 gene locus_tag LOCUS_t00040 20342 20415 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20562 21122 gene locus_tag LOCUS_02300 20562 21122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 21331 22518 gene locus_tag LOCUS_02310 21331 22518 CDS product agmatinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243172.1 protein_id gnl|my_center|LOCUS_02310 22522 22971 gene locus_tag LOCUS_02320 22522 22971 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889575.1 protein_id gnl|my_center|LOCUS_02320 22944 23681 gene locus_tag LOCUS_02330 22944 23681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 23718 24770 gene locus_tag LOCUS_02340 23718 24770 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_191315613.1 protein_id gnl|my_center|LOCUS_02340 24767 25564 gene locus_tag LOCUS_02350 24767 25564 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140177.1 protein_id gnl|my_center|LOCUS_02350 25582 26370 gene locus_tag LOCUS_02360 25582 26370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140178.1 protein_id gnl|my_center|LOCUS_02360 29719 26378 gene locus_tag LOCUS_02370 29719 26378 CDS product Swt1 family HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258561.1 protein_id gnl|my_center|LOCUS_02370 32549 29739 gene locus_tag LOCUS_02380 32549 29739 CDS product DUF1156 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968624.1 protein_id gnl|my_center|LOCUS_02380 33420 32581 gene locus_tag LOCUS_02390 33420 32581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 33668 33417 gene locus_tag LOCUS_02400 33668 33417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 33820 34173 gene locus_tag LOCUS_02410 33820 34173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 34253 34606 gene locus_tag LOCUS_02420 34253 34606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 34686 35006 gene locus_tag LOCUS_02430 34686 35006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 38641 35201 gene locus_tag LOCUS_02440 38641 35201 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258557.1 protein_id gnl|my_center|LOCUS_02440 38679 38966 gene locus_tag LOCUS_02450 38679 38966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 39547 38963 gene locus_tag LOCUS_02460 gene rsmD 39547 38963 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_02460 40206 39556 gene locus_tag LOCUS_02470 gene hisH 40206 39556 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125292.1 protein_id gnl|my_center|LOCUS_02470 41228 40203 gene locus_tag LOCUS_02480 41228 40203 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057667.1 protein_id gnl|my_center|LOCUS_02480 41589 41263 gene locus_tag LOCUS_02490 gene trxA 41589 41263 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125291.1 protein_id gnl|my_center|LOCUS_02490 42800 41637 gene locus_tag LOCUS_02500 42800 41637 CDS product GuaB3 family IMP dehydrogenase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058024.1 protein_id gnl|my_center|LOCUS_02500 42821 44056 gene locus_tag LOCUS_02510 42821 44056 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124678.1 protein_id gnl|my_center|LOCUS_02510 44053 44703 gene locus_tag LOCUS_02520 44053 44703 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057443.1 protein_id gnl|my_center|LOCUS_02520 44700 45338 gene locus_tag LOCUS_02530 gene cobO 44700 45338 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124677.1 protein_id gnl|my_center|LOCUS_02530 47493 46471 gene locus_tag LOCUS_02540 47493 46471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 48629 47490 gene locus_tag LOCUS_02550 48629 47490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 51418 48656 gene locus_tag LOCUS_02560 51418 48656 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931302.1 protein_id gnl|my_center|LOCUS_02560 51604 51419 gene locus_tag LOCUS_02570 51604 51419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 52056 51784 gene locus_tag LOCUS_02580 52056 51784 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869621.1 protein_id gnl|my_center|LOCUS_02580 53511 52882 gene locus_tag LOCUS_02590 53511 52882 CDS product DUF6338 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087038.1 protein_id gnl|my_center|LOCUS_02590 54403 53621 gene locus_tag LOCUS_02600 54403 53621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 56839 54986 gene locus_tag LOCUS_02610 56839 54986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02610 58083 56881 gene locus_tag LOCUS_02620 58083 56881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02620 58483 58091 gene locus_tag LOCUS_02630 58483 58091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 58533 59048 gene locus_tag LOCUS_02640 58533 59048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 59105 59755 gene locus_tag LOCUS_02650 59105 59755 CDS product urease accessory protein UreF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057205.1 protein_id gnl|my_center|LOCUS_02650 59761 60372 gene locus_tag LOCUS_02660 gene ureG 59761 60372 CDS product urease accessory protein UreG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084276.1 protein_id gnl|my_center|LOCUS_02660 60617 61810 gene locus_tag LOCUS_02670 gene urtA 60617 61810 CDS product urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056962.1 protein_id gnl|my_center|LOCUS_02670 61890 63035 gene locus_tag LOCUS_02680 61890 63035 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056963.1 protein_id gnl|my_center|LOCUS_02680 63039 64181 gene locus_tag LOCUS_02690 gene urtC 63039 64181 CDS product urea ABC transporter permease subunit UrtC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056964.1 protein_id gnl|my_center|LOCUS_02690 64185 64955 gene locus_tag LOCUS_02700 gene urtD 64185 64955 CDS product urea ABC transporter ATP-binding protein UrtD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056965.1 protein_id gnl|my_center|LOCUS_02700 64952 65665 gene locus_tag LOCUS_02710 gene urtE 64952 65665 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_02710 67879 66755 gene locus_tag LOCUS_02720 67879 66755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 67993 68289 gene locus_tag LOCUS_02730 67993 68289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 68286 68999 gene locus_tag LOCUS_02740 gene urtE 68286 68999 CDS product urea ABC transporter ATP-binding subunit UrtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056966.1 protein_id gnl|my_center|LOCUS_02740 69226 70761 gene locus_tag LOCUS_02750 gene ilvA 69226 70761 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064913.1 protein_id gnl|my_center|LOCUS_02750 70799 71278 gene locus_tag LOCUS_02760 gene scpB 70799 71278 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923281.1 protein_id gnl|my_center|LOCUS_02760 72739 73251 gene locus_tag LOCUS_02770 72739 73251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 75751 73235 gene locus_tag LOCUS_02780 75751 73235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 76137 77336 gene locus_tag LOCUS_02790 76137 77336 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058173.1 protein_id gnl|my_center|LOCUS_02790 77437 79848 gene locus_tag LOCUS_02800 77437 79848 CDS product phosphoketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057028.1 protein_id gnl|my_center|LOCUS_02800 80728 79862 gene locus_tag LOCUS_02810 80728 79862 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057545.1 protein_id gnl|my_center|LOCUS_02810 81561 80869 gene locus_tag LOCUS_02820 gene dcd 81561 80869 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124429.1 protein_id gnl|my_center|LOCUS_02820 82251 81577 gene locus_tag LOCUS_02830 82251 81577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 82536 83243 gene locus_tag LOCUS_02840 gene ntcA 82536 83243 CDS product global nitrogen regulator NtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866410.1 protein_id gnl|my_center|LOCUS_02840 83341 84513 gene locus_tag LOCUS_02850 83341 84513 CDS product DUF3084 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057621.1 protein_id gnl|my_center|LOCUS_02850 84506 84958 gene locus_tag LOCUS_02860 gene ruvX 84506 84958 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920731.1 protein_id gnl|my_center|LOCUS_02860 85208 84948 gene locus_tag LOCUS_02870 85208 84948 CDS product DUF3146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124435.1 protein_id gnl|my_center|LOCUS_02870 85839 85210 gene locus_tag LOCUS_02880 gene pth 85839 85210 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124436.1 protein_id gnl|my_center|LOCUS_02880 86178 85882 gene locus_tag LOCUS_02890 86178 85882 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057225.1 protein_id gnl|my_center|LOCUS_02890 86505 86305 gene locus_tag LOCUS_02900 gene psbH 86505 86305 CDS product photosystem II reaction center protein PsbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057226.1 protein_id gnl|my_center|LOCUS_02900 86595 86744 gene locus_tag LOCUS_02910 gene psbN 86595 86744 CDS product photosystem II reaction center protein PsbN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124439.1 protein_id gnl|my_center|LOCUS_02910 89608 86741 gene locus_tag LOCUS_02920 89608 86741 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928424.1 protein_id gnl|my_center|LOCUS_02920 89715 89864 gene locus_tag LOCUS_02930 89715 89864 CDS product photosystem II reaction center protein I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124440.1 protein_id gnl|my_center|LOCUS_02930 89923 92049 gene locus_tag LOCUS_02940 89923 92049 CDS product DUF3769 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124441.1 protein_id gnl|my_center|LOCUS_02940 92627 92019 gene locus_tag LOCUS_02950 gene leuD 92627 92019 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057076.1 protein_id gnl|my_center|LOCUS_02950 94066 92624 gene locus_tag LOCUS_02960 gene leuC 94066 92624 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143406.1 protein_id gnl|my_center|LOCUS_02960 95478 94165 gene locus_tag LOCUS_02970 95478 94165 CDS product IctB family putative bicarbonate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058082.1 protein_id gnl|my_center|LOCUS_02970 96713 95811 gene locus_tag LOCUS_02980 96713 95811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 97627 97995 gene locus_tag LOCUS_02990 97627 97995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 100330 98378 gene locus_tag LOCUS_03000 gene mnmG 100330 98378 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125985.1 protein_id gnl|my_center|LOCUS_03000 100894 100412 gene locus_tag LOCUS_03010 100894 100412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 101636 101145 gene locus_tag LOCUS_03020 101636 101145 CDS product DUF2214 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124734.1 protein_id gnl|my_center|LOCUS_03020 101925 101665 gene locus_tag LOCUS_03030 101925 101665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 102688 101864 gene locus_tag LOCUS_03040 gene ubiE 102688 101864 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124582.1 protein_id gnl|my_center|LOCUS_03040 103469 102693 gene locus_tag LOCUS_03050 gene hisF 103469 102693 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124581.1 protein_id gnl|my_center|LOCUS_03050 103538 103765 gene locus_tag LOCUS_03060 103538 103765 CDS product DUF2862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056374.1 protein_id gnl|my_center|LOCUS_03060 103765 104724 gene locus_tag LOCUS_03070 gene chlG 103765 104724 CDS product chlorophyll synthase ChlG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124579.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence04 286 489 gene locus_tag LOCUS_03080 286 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2359 554 gene locus_tag LOCUS_03090 gene pyk 2359 554 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058108.1 protein_id gnl|my_center|LOCUS_03090 2926 2618 gene locus_tag LOCUS_03100 2926 2618 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125077.1 protein_id gnl|my_center|LOCUS_03100 2984 4075 gene locus_tag LOCUS_03110 gene ychF 2984 4075 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125384.1 protein_id gnl|my_center|LOCUS_03110 4619 4801 gene locus_tag LOCUS_03120 4619 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5429 6349 gene locus_tag LOCUS_03130 5429 6349 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125110.1 protein_id gnl|my_center|LOCUS_03130 6376 9996 gene locus_tag LOCUS_03140 gene metH 6376 9996 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921137.1 protein_id gnl|my_center|LOCUS_03140 10695 10054 gene locus_tag LOCUS_03150 10695 10054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 11492 10839 gene locus_tag LOCUS_03160 11492 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03160 12102 11818 gene locus_tag LOCUS_03170 12102 11818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 12758 12102 gene locus_tag LOCUS_03180 12758 12102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 13306 12755 gene locus_tag LOCUS_03190 13306 12755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 13500 14315 gene locus_tag LOCUS_03200 13500 14315 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125339.1 protein_id gnl|my_center|LOCUS_03200 14326 15783 gene locus_tag LOCUS_03210 14326 15783 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124465.1 protein_id gnl|my_center|LOCUS_03210 16032 15808 gene locus_tag LOCUS_03220 16032 15808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 17362 16148 gene locus_tag LOCUS_03230 17362 16148 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124879.1 protein_id gnl|my_center|LOCUS_03230 17426 19183 gene locus_tag LOCUS_03240 17426 19183 CDS product sugar phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124880.1 protein_id gnl|my_center|LOCUS_03240 19191 20042 gene locus_tag LOCUS_03250 19191 20042 CDS product mannosyl-3-phosphoglycerate phosphatase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124881.1 protein_id gnl|my_center|LOCUS_03250 23190 20134 gene locus_tag LOCUS_03260 23190 20134 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368424.1 protein_id gnl|my_center|LOCUS_03260 23718 23200 gene locus_tag LOCUS_03270 23718 23200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 24872 23715 gene locus_tag LOCUS_03280 24872 23715 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_03280 26037 25330 gene locus_tag LOCUS_03290 26037 25330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 27668 26382 gene locus_tag LOCUS_03300 27668 26382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 29441 28389 gene locus_tag LOCUS_03310 29441 28389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 31615 29438 gene locus_tag LOCUS_03320 31615 29438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 32142 31789 gene locus_tag LOCUS_03330 32142 31789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 33746 32325 gene locus_tag LOCUS_03340 33746 32325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 35393 33855 gene locus_tag LOCUS_03350 35393 33855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 36085 35408 gene locus_tag LOCUS_03360 36085 35408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 38230 36698 gene locus_tag LOCUS_03370 38230 36698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 40678 38678 gene locus_tag LOCUS_03380 gene acs 40678 38678 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125193.1 protein_id gnl|my_center|LOCUS_03380 41056 40859 gene locus_tag LOCUS_03390 41056 40859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 41534 41343 gene locus_tag LOCUS_03400 41534 41343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 41866 41555 gene locus_tag LOCUS_03410 41866 41555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 42165 41881 gene locus_tag LOCUS_03420 42165 41881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 43284 42313 gene locus_tag LOCUS_03430 gene sds 43284 42313 CDS product solanesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125194.1 protein_id gnl|my_center|LOCUS_03430 44148 43309 gene locus_tag LOCUS_03440 gene murI 44148 43309 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056314.1 protein_id gnl|my_center|LOCUS_03440 44868 44158 gene locus_tag LOCUS_03450 44868 44158 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125197.1 protein_id gnl|my_center|LOCUS_03450 46870 45017 gene locus_tag LOCUS_03460 46870 45017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 47546 47016 gene locus_tag LOCUS_03470 47546 47016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 49741 47579 gene locus_tag LOCUS_03480 49741 47579 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921160.1 protein_id gnl|my_center|LOCUS_03480 51298 49751 gene locus_tag LOCUS_03490 51298 49751 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_03490 51689 52225 gene locus_tag LOCUS_03500 51689 52225 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530085.1 protein_id gnl|my_center|LOCUS_03500 52362 53411 gene locus_tag LOCUS_03510 gene moaA 52362 53411 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275431.1 protein_id gnl|my_center|LOCUS_03510 53463 55829 gene locus_tag LOCUS_03520 gene nrdJ 53463 55829 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892211.1 protein_id gnl|my_center|LOCUS_03520 55932 56016 gene locus_tag LOCUS_t00050 55932 56016 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 56277 56474 gene locus_tag LOCUS_03530 56277 56474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 57507 56851 gene locus_tag LOCUS_03540 gene upp 57507 56851 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920929.1 protein_id gnl|my_center|LOCUS_03540 57576 58085 gene locus_tag LOCUS_03550 57576 58085 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125002.1 protein_id gnl|my_center|LOCUS_03550 58199 58798 gene locus_tag LOCUS_03560 58199 58798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 58837 59952 gene locus_tag LOCUS_03570 gene cobW 58837 59952 CDS product cobalamin biosynthesis protein CobW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125003.1 protein_id gnl|my_center|LOCUS_03570 59998 60258 gene locus_tag LOCUS_03580 59998 60258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 60323 60583 gene locus_tag LOCUS_03590 gene purS 60323 60583 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125005.1 protein_id gnl|my_center|LOCUS_03590 60585 61256 gene locus_tag LOCUS_03600 gene purQ 60585 61256 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125006.1 protein_id gnl|my_center|LOCUS_03600 61839 61249 gene locus_tag LOCUS_03610 61839 61249 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057294.1 protein_id gnl|my_center|LOCUS_03610 61976 62239 gene locus_tag LOCUS_03620 61976 62239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 62373 63752 gene locus_tag LOCUS_03630 62373 63752 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065824.1 protein_id gnl|my_center|LOCUS_03630 64170 64883 gene locus_tag LOCUS_03640 64170 64883 CDS product 15,16-dihydrobiliverdin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015424.1 protein_id gnl|my_center|LOCUS_03640 64880 65629 gene locus_tag LOCUS_03650 64880 65629 CDS product phycoerythrobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125897.1 protein_id gnl|my_center|LOCUS_03650 65663 65962 gene locus_tag LOCUS_03660 65663 65962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 66690 65971 gene locus_tag LOCUS_03670 66690 65971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 66689 66907 gene locus_tag LOCUS_03680 66689 66907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 66993 67250 gene locus_tag LOCUS_03690 66993 67250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 67478 67281 gene locus_tag LOCUS_03700 67478 67281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 67780 67454 gene locus_tag LOCUS_03710 67780 67454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 67906 68562 gene locus_tag LOCUS_03720 67906 68562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 68648 69142 gene locus_tag LOCUS_03730 68648 69142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 70254 69202 gene locus_tag LOCUS_03740 70254 69202 CDS product Fe(3+) ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056364.1 protein_id gnl|my_center|LOCUS_03740 70606 71829 gene locus_tag LOCUS_03750 70606 71829 CDS product FAD-dependent hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921015.1 protein_id gnl|my_center|LOCUS_03750 72320 71778 gene locus_tag LOCUS_03760 72320 71778 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058171.1 protein_id gnl|my_center|LOCUS_03760 72773 73354 gene locus_tag LOCUS_03770 72773 73354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 73369 74082 gene locus_tag LOCUS_03780 73369 74082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 75927 76946 gene locus_tag LOCUS_03790 gene psbA 75927 76946 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_03790 77114 78202 gene locus_tag LOCUS_03800 gene aroC 77114 78202 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124408.1 protein_id gnl|my_center|LOCUS_03800 80155 78227 gene locus_tag LOCUS_03810 gene recJ 80155 78227 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125136.1 protein_id gnl|my_center|LOCUS_03810 80453 80710 gene locus_tag LOCUS_03820 80453 80710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 81553 80795 gene locus_tag LOCUS_03830 81553 80795 CDS product DUF1350 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124928.1 protein_id gnl|my_center|LOCUS_03830 82002 81550 gene locus_tag LOCUS_03840 82002 81550 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_03840 82072 82764 gene locus_tag LOCUS_03850 82072 82764 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124929.1 protein_id gnl|my_center|LOCUS_03850 83521 83276 gene locus_tag LOCUS_03860 83521 83276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 83415 85181 gene locus_tag LOCUS_03870 83415 85181 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125444.1 protein_id gnl|my_center|LOCUS_03870 86713 85895 gene locus_tag LOCUS_03880 86713 85895 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947828.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03880 87938 87066 gene locus_tag LOCUS_03890 87938 87066 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124601.1 protein_id gnl|my_center|LOCUS_03890 88956 87949 gene locus_tag LOCUS_03900 88956 87949 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124600.1 protein_id gnl|my_center|LOCUS_03900 89328 89516 gene locus_tag LOCUS_03910 89328 89516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 89977 91590 gene locus_tag LOCUS_03920 89977 91590 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964265.1 protein_id gnl|my_center|LOCUS_03920 91590 94124 gene locus_tag LOCUS_03930 91590 94124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 94133 94345 gene locus_tag LOCUS_03940 94133 94345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 >Feature sequence05 986 69 gene locus_tag LOCUS_03950 986 69 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124495.1 protein_id gnl|my_center|LOCUS_03950 1064 2386 gene locus_tag LOCUS_03960 1064 2386 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141188.1 protein_id gnl|my_center|LOCUS_03960 2814 2365 gene locus_tag LOCUS_03970 2814 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3926 2796 gene locus_tag LOCUS_03980 3926 2796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 4471 3926 gene locus_tag LOCUS_03990 4471 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 4876 4484 gene locus_tag LOCUS_04000 4876 4484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04000 4999 6768 gene locus_tag LOCUS_04010 4999 6768 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057893.1 protein_id gnl|my_center|LOCUS_04010 6804 7574 gene locus_tag LOCUS_04020 gene tatC 6804 7574 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124617.1 protein_id gnl|my_center|LOCUS_04020 7913 7602 gene locus_tag LOCUS_04030 7913 7602 CDS product DUF3067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056802.1 protein_id gnl|my_center|LOCUS_04030 8052 8588 gene locus_tag LOCUS_04040 8052 8588 CDS product cytochrome b6-f complex iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124615.1 protein_id gnl|my_center|LOCUS_04040 8631 9566 gene locus_tag LOCUS_04050 gene petA 8631 9566 CDS product apocytochrome f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056804.1 protein_id gnl|my_center|LOCUS_04050 9600 10499 gene locus_tag LOCUS_04060 gene lgt 9600 10499 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124613.1 protein_id gnl|my_center|LOCUS_04060 10526 11347 gene locus_tag LOCUS_04070 gene cobM 10526 11347 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124612.1 protein_id gnl|my_center|LOCUS_04070 14974 12239 gene locus_tag LOCUS_04080 14974 12239 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125771.1 protein_id gnl|my_center|LOCUS_04080 15034 17904 gene locus_tag LOCUS_04090 15034 17904 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_04090 18030 19778 gene locus_tag LOCUS_04100 18030 19778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 20425 19886 gene locus_tag LOCUS_04110 20425 19886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 20778 20533 gene locus_tag LOCUS_04120 20778 20533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 21247 20786 gene locus_tag LOCUS_04130 21247 20786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 21437 22909 gene locus_tag LOCUS_04140 21437 22909 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939558.1 protein_id gnl|my_center|LOCUS_04140 22906 23859 gene locus_tag LOCUS_04150 22906 23859 CDS product BsuBI/PstI family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064714.1 protein_id gnl|my_center|LOCUS_04150 23971 26778 gene locus_tag LOCUS_04160 23971 26778 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_04160 27812 26775 gene locus_tag LOCUS_04170 27812 26775 CDS product CBASS cGAMP-activated phospholipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062610134.1 protein_id gnl|my_center|LOCUS_04170 29541 27802 gene locus_tag LOCUS_04180 29541 27802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 29923 29660 gene locus_tag LOCUS_04190 29923 29660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 30662 29898 gene locus_tag LOCUS_04200 30662 29898 CDS product DUF5131 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899455.1 protein_id gnl|my_center|LOCUS_04200 32226 30751 gene locus_tag LOCUS_04210 32226 30751 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545535.1 protein_id gnl|my_center|LOCUS_04210 32256 32471 gene locus_tag LOCUS_04220 32256 32471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 32488 33135 gene locus_tag LOCUS_04230 gene thyX 32488 33135 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124428.1 protein_id gnl|my_center|LOCUS_04230 33810 33148 gene locus_tag LOCUS_04240 gene larB 33810 33148 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125503.1 protein_id gnl|my_center|LOCUS_04240 34346 33807 gene locus_tag LOCUS_04250 34346 33807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 35805 34573 gene locus_tag LOCUS_04260 35805 34573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 36703 36182 gene locus_tag LOCUS_04270 36703 36182 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_04270 37562 36720 gene locus_tag LOCUS_04280 37562 36720 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124635.1 protein_id gnl|my_center|LOCUS_04280 37701 37982 gene locus_tag LOCUS_04290 37701 37982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 38055 38855 gene locus_tag LOCUS_04300 38055 38855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 39016 39705 gene locus_tag LOCUS_04310 39016 39705 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405133.1 protein_id gnl|my_center|LOCUS_04310 40596 39682 gene locus_tag LOCUS_04320 gene trpC 40596 39682 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125522.1 protein_id gnl|my_center|LOCUS_04320 42057 40618 gene locus_tag LOCUS_04330 gene lpdA 42057 40618 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125523.1 protein_id gnl|my_center|LOCUS_04330 42960 42145 gene locus_tag LOCUS_04340 42960 42145 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891908.1 protein_id gnl|my_center|LOCUS_04340 43011 44099 gene locus_tag LOCUS_04350 43011 44099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 44087 44503 gene locus_tag LOCUS_04360 44087 44503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 45436 47115 gene locus_tag LOCUS_04370 45436 47115 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125246.1 protein_id gnl|my_center|LOCUS_04370 47199 50015 gene locus_tag LOCUS_04380 gene ileS 47199 50015 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124423.1 protein_id gnl|my_center|LOCUS_04380 50051 50707 gene locus_tag LOCUS_04390 gene hisB 50051 50707 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124468.1 protein_id gnl|my_center|LOCUS_04390 50989 53070 gene locus_tag LOCUS_04400 50989 53070 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070743.1 protein_id gnl|my_center|LOCUS_04400 53063 54229 gene locus_tag LOCUS_04410 53063 54229 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083500625.1 protein_id gnl|my_center|LOCUS_04410 54891 54355 gene locus_tag LOCUS_04420 54891 54355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 55230 54895 gene locus_tag LOCUS_04430 55230 54895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 55513 58488 gene locus_tag LOCUS_04440 55513 58488 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070740.1 protein_id gnl|my_center|LOCUS_04440 58485 59198 gene locus_tag LOCUS_04450 58485 59198 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070739.1 protein_id gnl|my_center|LOCUS_04450 59672 59445 gene locus_tag LOCUS_04460 59672 59445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 60427 61572 gene locus_tag LOCUS_04470 gene thrC 60427 61572 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406172.1 protein_id gnl|my_center|LOCUS_04470 62529 61606 gene locus_tag LOCUS_04480 62529 61606 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693969.1 protein_id gnl|my_center|LOCUS_04480 62652 63830 gene locus_tag LOCUS_04490 62652 63830 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125543.1 protein_id gnl|my_center|LOCUS_04490 63881 64597 gene locus_tag LOCUS_04500 63881 64597 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125542.1 protein_id gnl|my_center|LOCUS_04500 65610 64627 gene locus_tag LOCUS_04510 gene cbiB 65610 64627 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011128515.1 protein_id gnl|my_center|LOCUS_04510 66631 65636 gene locus_tag LOCUS_04520 gene ilvC 66631 65636 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125540.1 protein_id gnl|my_center|LOCUS_04520 67107 66679 gene locus_tag LOCUS_04530 67107 66679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 67830 67234 gene locus_tag LOCUS_04540 67830 67234 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125539.1 protein_id gnl|my_center|LOCUS_04540 68579 67869 gene locus_tag LOCUS_04550 68579 67869 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125538.1 protein_id gnl|my_center|LOCUS_04550 69525 68995 gene locus_tag LOCUS_04560 69525 68995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 70011 69532 gene locus_tag LOCUS_04570 70011 69532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 71300 70182 gene locus_tag LOCUS_04580 71300 70182 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125537.1 protein_id gnl|my_center|LOCUS_04580 71448 71651 gene locus_tag LOCUS_04590 71448 71651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 71639 72913 gene locus_tag LOCUS_04600 gene hemW 71639 72913 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125536.1 protein_id gnl|my_center|LOCUS_04600 73631 72816 gene locus_tag LOCUS_04610 gene panB 73631 72816 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125535.1 protein_id gnl|my_center|LOCUS_04610 74983 73802 gene locus_tag LOCUS_04620 gene ftsZ 74983 73802 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923238.1 protein_id gnl|my_center|LOCUS_04620 74912 75079 gene locus_tag LOCUS_04630 74912 75079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 76096 75365 gene locus_tag LOCUS_04640 76096 75365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 76632 76222 gene locus_tag LOCUS_04650 76632 76222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125532.1 protein_id gnl|my_center|LOCUS_04650 77688 76639 gene locus_tag LOCUS_04660 77688 76639 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_04660 79091 77760 gene locus_tag LOCUS_04670 gene miaB 79091 77760 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125530.1 protein_id gnl|my_center|LOCUS_04670 79241 80308 gene locus_tag LOCUS_04680 79241 80308 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202993.1 protein_id gnl|my_center|LOCUS_04680 80302 81393 gene locus_tag LOCUS_04690 80302 81393 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903345.1 protein_id gnl|my_center|LOCUS_04690 81937 81599 gene locus_tag LOCUS_04700 81937 81599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 82304 82014 gene locus_tag LOCUS_04710 82304 82014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 82482 82625 gene locus_tag LOCUS_04720 82482 82625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 83259 82690 gene locus_tag LOCUS_04730 83259 82690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 83434 83288 gene locus_tag LOCUS_04740 83434 83288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 >Feature sequence06 602 1102 gene locus_tag LOCUS_04750 602 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193487403.1 protein_id gnl|my_center|LOCUS_04750 4476 1144 gene locus_tag LOCUS_04760 gene carB 4476 1144 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125049.1 protein_id gnl|my_center|LOCUS_04760 4587 5222 gene locus_tag LOCUS_04770 4587 5222 CDS product DUF3318 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125048.1 protein_id gnl|my_center|LOCUS_04770 5215 5637 gene locus_tag LOCUS_04780 5215 5637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 5643 6155 gene locus_tag LOCUS_04790 5643 6155 CDS product CGLD27 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140851.1 protein_id gnl|my_center|LOCUS_04790 6181 7167 gene locus_tag LOCUS_04800 6181 7167 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125045.1 protein_id gnl|my_center|LOCUS_04800 7323 7398 gene locus_tag LOCUS_t00060 7323 7398 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7543 8607 gene locus_tag LOCUS_04810 7543 8607 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124828.1 protein_id gnl|my_center|LOCUS_04810 8604 9512 gene locus_tag LOCUS_04820 8604 9512 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124827.1 protein_id gnl|my_center|LOCUS_04820 9505 10548 gene locus_tag LOCUS_04830 9505 10548 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124826.1 protein_id gnl|my_center|LOCUS_04830 10587 11360 gene locus_tag LOCUS_04840 10587 11360 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124825.1 protein_id gnl|my_center|LOCUS_04840 12089 12355 gene locus_tag LOCUS_04850 12089 12355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 12370 12786 gene locus_tag LOCUS_04860 12370 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 14147 13074 gene locus_tag LOCUS_04870 14147 13074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 14677 14144 gene locus_tag LOCUS_04880 14677 14144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 15805 16458 gene locus_tag LOCUS_04890 15805 16458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 16455 19124 gene locus_tag LOCUS_04900 16455 19124 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964263.1 protein_id gnl|my_center|LOCUS_04900 19759 19337 gene locus_tag LOCUS_04910 19759 19337 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_04910 21482 20076 gene locus_tag LOCUS_04920 gene fumC 21482 20076 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057374.1 protein_id gnl|my_center|LOCUS_04920 22149 21475 gene locus_tag LOCUS_04930 gene bioD 22149 21475 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084893.1 protein_id gnl|my_center|LOCUS_04930 23903 25141 gene locus_tag LOCUS_04940 23903 25141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 25248 31559 gene locus_tag LOCUS_04950 25248 31559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 31572 34757 gene locus_tag LOCUS_04960 31572 34757 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_04960 38212 34730 gene locus_tag LOCUS_04970 gene addA 38212 34730 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336808.1 protein_id gnl|my_center|LOCUS_04970 41268 38209 gene locus_tag LOCUS_04980 gene addB 41268 38209 CDS product double-strand break repair protein AddB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336807.1 protein_id gnl|my_center|LOCUS_04980 42051 41431 gene locus_tag LOCUS_04990 42051 41431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 42415 43614 gene locus_tag LOCUS_05000 42415 43614 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125074.1 protein_id gnl|my_center|LOCUS_05000 43732 45642 gene locus_tag LOCUS_05010 gene ftsH 43732 45642 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125073.1 protein_id gnl|my_center|LOCUS_05010 45699 45980 gene locus_tag LOCUS_05020 45699 45980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 46618 46022 gene locus_tag LOCUS_05030 gene clpP 46618 46022 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125965.1 protein_id gnl|my_center|LOCUS_05030 46731 47504 gene locus_tag LOCUS_05040 gene psb29 46731 47504 CDS product photosystem II biogenesis protein Psp29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056976.1 protein_id gnl|my_center|LOCUS_05040 49040 47529 gene locus_tag LOCUS_05050 gene purF 49040 47529 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057521.1 protein_id gnl|my_center|LOCUS_05050 51352 49091 gene locus_tag LOCUS_05060 gene purL 51352 49091 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057520.1 protein_id gnl|my_center|LOCUS_05060 51871 51509 gene locus_tag LOCUS_05070 51871 51509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 51870 52163 gene locus_tag LOCUS_05080 51870 52163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 52866 52138 gene locus_tag LOCUS_05090 52866 52138 CDS product GUN4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124925.1 protein_id gnl|my_center|LOCUS_05090 52927 53961 gene locus_tag LOCUS_05100 gene mnmH 52927 53961 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124924.1 protein_id gnl|my_center|LOCUS_05100 53986 54321 gene locus_tag LOCUS_05110 gene psb28 53986 54321 CDS product photosystem II reaction center protein Psb28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124923.1 protein_id gnl|my_center|LOCUS_05110 54332 55429 gene locus_tag LOCUS_05120 54332 55429 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892200.1 protein_id gnl|my_center|LOCUS_05120 56538 55579 gene locus_tag LOCUS_05130 gene secF 56538 55579 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056057.1 protein_id gnl|my_center|LOCUS_05130 58154 56673 gene locus_tag LOCUS_05140 gene secD 58154 56673 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124919.1 protein_id gnl|my_center|LOCUS_05140 59178 58156 gene locus_tag LOCUS_05150 59178 58156 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124918.1 protein_id gnl|my_center|LOCUS_05150 59698 59384 gene locus_tag LOCUS_05160 59698 59384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 60656 59727 gene locus_tag LOCUS_05170 gene ispE 60656 59727 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124916.1 protein_id gnl|my_center|LOCUS_05170 61510 60653 gene locus_tag LOCUS_05180 gene rsmA 61510 60653 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124915.1 protein_id gnl|my_center|LOCUS_05180 61943 61557 gene locus_tag LOCUS_05190 61943 61557 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005081582.1 protein_id gnl|my_center|LOCUS_05190 62326 62009 gene locus_tag LOCUS_05200 62326 62009 CDS product DUF2488 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057339.1 protein_id gnl|my_center|LOCUS_05200 63063 62326 gene locus_tag LOCUS_05210 63063 62326 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125241.1 protein_id gnl|my_center|LOCUS_05210 63561 63094 gene locus_tag LOCUS_05220 63561 63094 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124736.1 protein_id gnl|my_center|LOCUS_05220 63633 64346 gene locus_tag LOCUS_05230 gene hisIE 63633 64346 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056088.1 protein_id gnl|my_center|LOCUS_05230 64381 64740 gene locus_tag LOCUS_05240 64381 64740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 64813 64884 gene locus_tag LOCUS_t00070 64813 64884 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 65077 66156 gene locus_tag LOCUS_05250 65077 66156 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_05250 67152 66574 gene locus_tag LOCUS_05260 67152 66574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05260 67315 67620 gene locus_tag LOCUS_05270 67315 67620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 69257 69541 gene locus_tag LOCUS_05280 69257 69541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 70625 69723 gene locus_tag LOCUS_05290 70625 69723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 71132 70698 gene locus_tag LOCUS_05300 71132 70698 CDS product DCC1-like thiol-disulfide oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124847.1 protein_id gnl|my_center|LOCUS_05300 72140 71142 gene locus_tag LOCUS_05310 72140 71142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 72311 73135 gene locus_tag LOCUS_05320 72311 73135 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124635.1 protein_id gnl|my_center|LOCUS_05320 74377 73136 gene locus_tag LOCUS_05330 gene moeA 74377 73136 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704836.1 protein_id gnl|my_center|LOCUS_05330 74721 74401 gene locus_tag LOCUS_05340 74721 74401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 74938 75669 gene locus_tag LOCUS_05350 74938 75669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 75941 75678 gene locus_tag LOCUS_05360 75941 75678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 76849 75941 gene locus_tag LOCUS_05370 gene rsmI 76849 75941 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866376.1 protein_id gnl|my_center|LOCUS_05370 76827 77762 gene locus_tag LOCUS_05380 76827 77762 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125459.1 protein_id gnl|my_center|LOCUS_05380 78133 77879 gene locus_tag LOCUS_05390 78133 77879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 79072 80610 gene locus_tag LOCUS_05400 79072 80610 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124646.1 protein_id gnl|my_center|LOCUS_05400 81536 81757 gene locus_tag LOCUS_05410 81536 81757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence07 2674 4110 gene locus_tag LOCUS_05420 2674 4110 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920904.1 protein_id gnl|my_center|LOCUS_05420 4206 5582 gene locus_tag LOCUS_05430 4206 5582 CDS product PucC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124501.1 protein_id gnl|my_center|LOCUS_05430 5591 6406 gene locus_tag LOCUS_05440 5591 6406 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124270.1 protein_id gnl|my_center|LOCUS_05440 7404 6409 gene locus_tag LOCUS_05450 gene obgE 7404 6409 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124401.1 protein_id gnl|my_center|LOCUS_05450 7488 9851 gene locus_tag LOCUS_05460 7488 9851 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124372.1 protein_id gnl|my_center|LOCUS_05460 10685 9891 gene locus_tag LOCUS_05470 gene pstB 10685 9891 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124749.1 protein_id gnl|my_center|LOCUS_05470 11634 10711 gene locus_tag LOCUS_05480 gene pstA 11634 10711 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124750.1 protein_id gnl|my_center|LOCUS_05480 12727 11639 gene locus_tag LOCUS_05490 gene pstC 12727 11639 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124751.1 protein_id gnl|my_center|LOCUS_05490 13722 12775 gene locus_tag LOCUS_05500 gene pstS 13722 12775 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125725.1 protein_id gnl|my_center|LOCUS_05500 15300 14011 gene locus_tag LOCUS_05510 gene arsJ 15300 14011 CDS product organoarsenical effux MFS transporter ArsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125726.1 protein_id gnl|my_center|LOCUS_05510 16328 15315 gene locus_tag LOCUS_05520 16328 15315 CDS product ArsJ-associated glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125727.1 protein_id gnl|my_center|LOCUS_05520 16628 18871 gene locus_tag LOCUS_05530 gene dnaK 16628 18871 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125090.1 protein_id gnl|my_center|LOCUS_05530 18877 19869 gene locus_tag LOCUS_05540 18877 19869 CDS product DnaJ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125091.1 protein_id gnl|my_center|LOCUS_05540 19898 21670 gene locus_tag LOCUS_05550 gene argS 19898 21670 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124367.1 protein_id gnl|my_center|LOCUS_05550 21667 21948 gene locus_tag LOCUS_05560 21667 21948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 21945 22133 gene locus_tag LOCUS_05570 21945 22133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 22121 23185 gene locus_tag LOCUS_05580 22121 23185 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124366.1 protein_id gnl|my_center|LOCUS_05580 23500 24534 gene locus_tag LOCUS_05590 23500 24534 CDS product chlorophyll a/b binding light-harvesting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921141.1 protein_id gnl|my_center|LOCUS_05590 25110 24637 gene locus_tag LOCUS_05600 25110 24637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 26241 25822 gene locus_tag LOCUS_05610 26241 25822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 26597 26938 gene locus_tag LOCUS_05620 26597 26938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 27220 27534 gene locus_tag LOCUS_05630 27220 27534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 28354 28821 gene locus_tag LOCUS_05640 28354 28821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 29235 28795 gene locus_tag LOCUS_05650 29235 28795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 29382 29882 gene locus_tag LOCUS_05660 29382 29882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 30421 30816 gene locus_tag LOCUS_05670 30421 30816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 30846 31154 gene locus_tag LOCUS_05680 30846 31154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 31219 32607 gene locus_tag LOCUS_05690 31219 32607 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058172.1 protein_id gnl|my_center|LOCUS_05690 33626 32622 gene locus_tag LOCUS_05700 gene hemB 33626 32622 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124398.1 protein_id gnl|my_center|LOCUS_05700 34661 33696 gene locus_tag LOCUS_05710 34661 33696 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_05710 36668 34758 gene locus_tag LOCUS_05720 36668 34758 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124211.1 protein_id gnl|my_center|LOCUS_05720 36738 37925 gene locus_tag LOCUS_05730 gene gmd 36738 37925 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257005.1 protein_id gnl|my_center|LOCUS_05730 39026 37932 gene locus_tag LOCUS_05740 39026 37932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 41686 40304 gene locus_tag LOCUS_05750 41686 40304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 42346 42008 gene locus_tag LOCUS_05760 42346 42008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 42909 42421 gene locus_tag LOCUS_05770 42909 42421 CDS product DUF883 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124222.1 protein_id gnl|my_center|LOCUS_05770 43046 46645 gene locus_tag LOCUS_05780 gene smc 43046 46645 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011127215.1 protein_id gnl|my_center|LOCUS_05780 46771 47655 gene locus_tag LOCUS_05790 46771 47655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 48978 47665 gene locus_tag LOCUS_05800 48978 47665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892089.1 protein_id gnl|my_center|LOCUS_05800 49059 48978 gene locus_tag LOCUS_t00080 49059 48978 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 49172 50530 gene locus_tag LOCUS_05810 gene accC 49172 50530 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124229.1 protein_id gnl|my_center|LOCUS_05810 50864 50523 gene locus_tag LOCUS_05820 50864 50523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 51054 52724 gene locus_tag LOCUS_05830 51054 52724 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479694.1 protein_id gnl|my_center|LOCUS_05830 53238 52714 gene locus_tag LOCUS_05840 53238 52714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038870.1 protein_id gnl|my_center|LOCUS_05840 54293 53238 gene locus_tag LOCUS_05850 54293 53238 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939306.1 protein_id gnl|my_center|LOCUS_05850 54367 54822 gene locus_tag LOCUS_05860 gene cynS 54367 54822 CDS product cyanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000616241.1 protein_id gnl|my_center|LOCUS_05860 54874 56313 gene locus_tag LOCUS_05870 54874 56313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 57340 56930 gene locus_tag LOCUS_05880 57340 56930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 57529 57359 gene locus_tag LOCUS_05890 57529 57359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 59146 57770 gene locus_tag LOCUS_05900 gene mnmE 59146 57770 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124369.1 protein_id gnl|my_center|LOCUS_05900 59283 60446 gene locus_tag LOCUS_05910 59283 60446 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039736.1 protein_id gnl|my_center|LOCUS_05910 60779 60456 gene locus_tag LOCUS_05920 60779 60456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 61830 60745 gene locus_tag LOCUS_05930 gene tilS 61830 60745 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125960.1 protein_id gnl|my_center|LOCUS_05930 61899 62672 gene locus_tag LOCUS_05940 61899 62672 CDS product DUF561 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057089.1 protein_id gnl|my_center|LOCUS_05940 62672 64690 gene locus_tag LOCUS_05950 gene uvrB 62672 64690 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125958.1 protein_id gnl|my_center|LOCUS_05950 65288 64758 gene locus_tag LOCUS_05960 65288 64758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 66355 65291 gene locus_tag LOCUS_05970 66355 65291 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215055.1 protein_id gnl|my_center|LOCUS_05970 66954 66568 gene locus_tag LOCUS_05980 66954 66568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 67964 67137 gene locus_tag LOCUS_05990 67964 67137 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124201.1 protein_id gnl|my_center|LOCUS_05990 71086 67961 gene locus_tag LOCUS_06000 71086 67961 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124202.1 protein_id gnl|my_center|LOCUS_06000 71268 73988 gene locus_tag LOCUS_06010 gene alaS 71268 73988 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124203.1 protein_id gnl|my_center|LOCUS_06010 73985 74626 gene locus_tag LOCUS_06020 73985 74626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 74808 74735 gene locus_tag LOCUS_t00090 74808 74735 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 75542 74877 gene locus_tag LOCUS_06030 75542 74877 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124300.1 protein_id gnl|my_center|LOCUS_06030 75801 75535 gene locus_tag LOCUS_06040 75801 75535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence08 230 973 gene locus_tag LOCUS_06050 gene fabG 230 973 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124607.1 protein_id gnl|my_center|LOCUS_06050 1570 977 gene locus_tag LOCUS_06060 1570 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2357 1572 gene locus_tag LOCUS_06070 2357 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2521 4020 gene locus_tag LOCUS_06080 2521 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 4305 3970 gene locus_tag LOCUS_06090 4305 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4405 4884 gene locus_tag LOCUS_06100 4405 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4791 5264 gene locus_tag LOCUS_06110 4791 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 6025 5372 gene locus_tag LOCUS_06120 6025 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 8663 6369 gene locus_tag LOCUS_06130 8663 6369 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022632.1 protein_id gnl|my_center|LOCUS_06130 10221 8836 gene locus_tag LOCUS_06140 10221 8836 CDS product aminopeptidase P N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125745.1 protein_id gnl|my_center|LOCUS_06140 10286 11290 gene locus_tag LOCUS_06150 10286 11290 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125746.1 protein_id gnl|my_center|LOCUS_06150 11287 12657 gene locus_tag LOCUS_06160 11287 12657 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125747.1 protein_id gnl|my_center|LOCUS_06160 12681 13289 gene locus_tag LOCUS_06170 12681 13289 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125748.1 protein_id gnl|my_center|LOCUS_06170 13258 15042 gene locus_tag LOCUS_06180 13258 15042 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125749.1 protein_id gnl|my_center|LOCUS_06180 16013 15048 gene locus_tag LOCUS_06190 16013 15048 CDS product putative 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119289.1 protein_id gnl|my_center|LOCUS_06190 16554 16042 gene locus_tag LOCUS_06200 16554 16042 CDS product DUF721 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056696.1 protein_id gnl|my_center|LOCUS_06200 16764 17474 gene locus_tag LOCUS_06210 16764 17474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 17573 18322 gene locus_tag LOCUS_06220 17573 18322 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057529.1 protein_id gnl|my_center|LOCUS_06220 19049 18438 gene locus_tag LOCUS_06230 19049 18438 CDS product TIGR03943 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172597933.1 protein_id gnl|my_center|LOCUS_06230 20123 19155 gene locus_tag LOCUS_06240 20123 19155 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056460.1 protein_id gnl|my_center|LOCUS_06240 20754 21209 gene locus_tag LOCUS_06250 20754 21209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 25245 21718 gene locus_tag LOCUS_06260 25245 21718 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124903.1 protein_id gnl|my_center|LOCUS_06260 25386 26144 gene locus_tag LOCUS_06270 25386 26144 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892378.1 protein_id gnl|my_center|LOCUS_06270 26969 26157 gene locus_tag LOCUS_06280 26969 26157 CDS product RNA polymerase sigma factor SigF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056585.1 protein_id gnl|my_center|LOCUS_06280 28227 27061 gene locus_tag LOCUS_06290 28227 27061 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_06290 28317 28700 gene locus_tag LOCUS_06300 28317 28700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 28733 29455 gene locus_tag LOCUS_06310 28733 29455 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057791.1 protein_id gnl|my_center|LOCUS_06310 29439 29978 gene locus_tag LOCUS_06320 29439 29978 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057399.1 protein_id gnl|my_center|LOCUS_06320 31195 29984 gene locus_tag LOCUS_06330 gene bioA 31195 29984 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125776.1 protein_id gnl|my_center|LOCUS_06330 31996 31331 gene locus_tag LOCUS_06340 gene msrA 31996 31331 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_06340 33279 31993 gene locus_tag LOCUS_06350 gene lpxB 33279 31993 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125566.1 protein_id gnl|my_center|LOCUS_06350 34060 33233 gene locus_tag LOCUS_06360 gene lpxA 34060 33233 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125567.1 protein_id gnl|my_center|LOCUS_06360 34544 34062 gene locus_tag LOCUS_06370 gene fabZ 34544 34062 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125568.1 protein_id gnl|my_center|LOCUS_06370 35401 34541 gene locus_tag LOCUS_06380 gene lpxC 35401 34541 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866382.1 protein_id gnl|my_center|LOCUS_06380 38244 35413 gene locus_tag LOCUS_06390 38244 35413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 39083 38295 gene locus_tag LOCUS_06400 39083 38295 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125571.1 protein_id gnl|my_center|LOCUS_06400 39154 40452 gene locus_tag LOCUS_06410 gene purD 39154 40452 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125572.1 protein_id gnl|my_center|LOCUS_06410 40479 42479 gene locus_tag LOCUS_06420 40479 42479 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125573.1 protein_id gnl|my_center|LOCUS_06420 44007 42454 gene locus_tag LOCUS_06430 gene kaiC 44007 42454 CDS product circadian clock protein KaiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125574.1 protein_id gnl|my_center|LOCUS_06430 44350 44012 gene locus_tag LOCUS_06440 gene kaiB 44350 44012 CDS product circadian clock protein KaiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125575.1 protein_id gnl|my_center|LOCUS_06440 44733 44350 gene locus_tag LOCUS_06450 44733 44350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 44888 45307 gene locus_tag LOCUS_06460 44888 45307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 45349 45612 gene locus_tag LOCUS_06470 gene rpmA 45349 45612 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125577.1 protein_id gnl|my_center|LOCUS_06470 47754 46459 gene locus_tag LOCUS_06480 gene purB 47754 46459 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125769.1 protein_id gnl|my_center|LOCUS_06480 47861 48706 gene locus_tag LOCUS_06490 47861 48706 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143173.1 protein_id gnl|my_center|LOCUS_06490 49060 48722 gene locus_tag LOCUS_06500 49060 48722 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125766.1 protein_id gnl|my_center|LOCUS_06500 49698 49456 gene locus_tag LOCUS_06510 49698 49456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 49959 50354 gene locus_tag LOCUS_06520 gene queF 49959 50354 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125764.1 protein_id gnl|my_center|LOCUS_06520 51658 50348 gene locus_tag LOCUS_06530 51658 50348 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125763.1 protein_id gnl|my_center|LOCUS_06530 52417 51662 gene locus_tag LOCUS_06540 52417 51662 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125762.1 protein_id gnl|my_center|LOCUS_06540 53552 52437 gene locus_tag LOCUS_06550 53552 52437 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866423.1 protein_id gnl|my_center|LOCUS_06550 53918 53637 gene locus_tag LOCUS_06560 53918 53637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 54366 53878 gene locus_tag LOCUS_06570 gene apcB 54366 53878 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056800.1 protein_id gnl|my_center|LOCUS_06570 54909 54424 gene locus_tag LOCUS_06580 gene apcA 54909 54424 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056801.1 protein_id gnl|my_center|LOCUS_06580 58889 55458 gene locus_tag LOCUS_06590 58889 55458 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058198.1 protein_id gnl|my_center|LOCUS_06590 59031 60269 gene locus_tag LOCUS_06600 59031 60269 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057783.1 protein_id gnl|my_center|LOCUS_06600 60263 60910 gene locus_tag LOCUS_06610 60263 60910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 60914 61687 gene locus_tag LOCUS_06620 gene atpB 60914 61687 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125759.1 protein_id gnl|my_center|LOCUS_06620 61827 62072 gene locus_tag LOCUS_06630 61827 62072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 62158 62625 gene locus_tag LOCUS_06640 62158 62625 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125757.1 protein_id gnl|my_center|LOCUS_06640 62634 63167 gene locus_tag LOCUS_06650 62634 63167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 63171 63728 gene locus_tag LOCUS_06660 gene atpH 63171 63728 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892505.1 protein_id gnl|my_center|LOCUS_06660 63782 65299 gene locus_tag LOCUS_06670 gene atpA 63782 65299 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125754.1 protein_id gnl|my_center|LOCUS_06670 65332 66279 gene locus_tag LOCUS_06680 65332 66279 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125753.1 protein_id gnl|my_center|LOCUS_06680 66289 66609 gene locus_tag LOCUS_06690 66289 66609 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056338.1 protein_id gnl|my_center|LOCUS_06690 66625 66822 gene locus_tag LOCUS_06700 66625 66822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 66825 67877 gene locus_tag LOCUS_06710 66825 67877 CDS product DUF3326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892609.1 protein_id gnl|my_center|LOCUS_06710 67891 68616 gene locus_tag LOCUS_06720 67891 68616 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932199.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence09 686 294 gene locus_tag LOCUS_06730 686 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 1141 782 gene locus_tag LOCUS_06740 1141 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1545 1240 gene locus_tag LOCUS_06750 1545 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 1735 1992 gene locus_tag LOCUS_06760 1735 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1985 3721 gene locus_tag LOCUS_06770 gene ilvD 1985 3721 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_06770 4262 3699 gene locus_tag LOCUS_06780 4262 3699 CDS product CIA30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124997.1 protein_id gnl|my_center|LOCUS_06780 5056 4349 gene locus_tag LOCUS_06790 5056 4349 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029031.1 protein_id gnl|my_center|LOCUS_06790 6957 5113 gene locus_tag LOCUS_06800 gene ftsH 6957 5113 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892144.1 protein_id gnl|my_center|LOCUS_06800 8199 7036 gene locus_tag LOCUS_06810 gene sat 8199 7036 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124411.1 protein_id gnl|my_center|LOCUS_06810 9145 8327 gene locus_tag LOCUS_06820 9145 8327 CDS product photosystem II manganese-stabilizing polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056297.1 protein_id gnl|my_center|LOCUS_06820 9303 9572 gene locus_tag LOCUS_06830 9303 9572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056902.1 protein_id gnl|my_center|LOCUS_06830 10875 9589 gene locus_tag LOCUS_06840 gene coaBC 10875 9589 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124413.1 protein_id gnl|my_center|LOCUS_06840 11092 10862 gene locus_tag LOCUS_06850 11092 10862 CDS product DUF2555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124414.1 protein_id gnl|my_center|LOCUS_06850 11148 11220 gene locus_tag LOCUS_t00100 11148 11220 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 11259 11462 gene locus_tag LOCUS_06860 11259 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124415.1 protein_id gnl|my_center|LOCUS_06860 12944 12555 gene locus_tag LOCUS_06870 12944 12555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 13768 12977 gene locus_tag LOCUS_06880 gene gloB 13768 12977 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939287.1 protein_id gnl|my_center|LOCUS_06880 13919 19051 gene locus_tag LOCUS_06890 13919 19051 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041670058.1 protein_id gnl|my_center|LOCUS_06890 19400 20002 gene locus_tag LOCUS_06900 19400 20002 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866406.1 protein_id gnl|my_center|LOCUS_06900 20289 19999 gene locus_tag LOCUS_06910 20289 19999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 21419 20418 gene locus_tag LOCUS_06920 gene nadA 21419 20418 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056086.1 protein_id gnl|my_center|LOCUS_06920 21456 22310 gene locus_tag LOCUS_06930 21456 22310 CDS product TIGR04168 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235619519.1 protein_id gnl|my_center|LOCUS_06930 22618 23376 gene locus_tag LOCUS_06940 22618 23376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 24331 23402 gene locus_tag LOCUS_06950 24331 23402 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124335.1 protein_id gnl|my_center|LOCUS_06950 25224 24775 gene locus_tag LOCUS_06960 25224 24775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 25666 25346 gene locus_tag LOCUS_06970 gene nuoK 25666 25346 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124336.1 protein_id gnl|my_center|LOCUS_06970 26289 25663 gene locus_tag LOCUS_06980 26289 25663 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124337.1 protein_id gnl|my_center|LOCUS_06980 26885 26286 gene locus_tag LOCUS_06990 gene ndhI 26885 26286 CDS product NAD(P)H-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124338.1 protein_id gnl|my_center|LOCUS_06990 28079 26928 gene locus_tag LOCUS_07000 gene nuoH 28079 26928 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328865.1 protein_id gnl|my_center|LOCUS_07000 29286 28117 gene locus_tag LOCUS_07010 29286 28117 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058225.1 protein_id gnl|my_center|LOCUS_07010 29426 30454 gene locus_tag LOCUS_07020 gene hrcA 29426 30454 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056606.1 protein_id gnl|my_center|LOCUS_07020 30951 31697 gene locus_tag LOCUS_07030 30951 31697 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057843.1 protein_id gnl|my_center|LOCUS_07030 31728 33896 gene locus_tag LOCUS_07040 31728 33896 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057632.1 protein_id gnl|my_center|LOCUS_07040 36358 33881 gene locus_tag LOCUS_07050 36358 33881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 36817 36996 gene locus_tag LOCUS_07060 36817 36996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 37035 37106 gene locus_tag LOCUS_t00110 37035 37106 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 37123 40761 gene locus_tag LOCUS_07070 37123 40761 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039974.1 protein_id gnl|my_center|LOCUS_07070 45016 41042 gene locus_tag LOCUS_07080 45016 41042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 45831 46613 gene locus_tag LOCUS_07090 gene fabI 45831 46613 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124469.1 protein_id gnl|my_center|LOCUS_07090 46625 47233 gene locus_tag LOCUS_07100 46625 47233 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338681.1 protein_id gnl|my_center|LOCUS_07100 47680 47255 gene locus_tag LOCUS_07110 47680 47255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125900.1 protein_id gnl|my_center|LOCUS_07110 48037 49119 gene locus_tag LOCUS_07120 48037 49119 CDS product anthranilate phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126008.1 protein_id gnl|my_center|LOCUS_07120 49110 49571 gene locus_tag LOCUS_07130 49110 49571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 51000 49558 gene locus_tag LOCUS_07140 51000 49558 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125528.1 protein_id gnl|my_center|LOCUS_07140 52550 50997 gene locus_tag LOCUS_07150 52550 50997 CDS product carotenoid oxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124467.1 protein_id gnl|my_center|LOCUS_07150 53103 52699 gene locus_tag LOCUS_07160 53103 52699 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124656.1 protein_id gnl|my_center|LOCUS_07160 53271 54101 gene locus_tag LOCUS_07170 53271 54101 CDS product precorrin-6A/cobalt-precorrin-6A reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923208.1 protein_id gnl|my_center|LOCUS_07170 54098 54442 gene locus_tag LOCUS_07180 54098 54442 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035769.1 protein_id gnl|my_center|LOCUS_07180 55455 54394 gene locus_tag LOCUS_07190 55455 54394 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014625876.1 protein_id gnl|my_center|LOCUS_07190 56765 55452 gene locus_tag LOCUS_07200 56765 55452 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124660.1 protein_id gnl|my_center|LOCUS_07200 57242 56841 gene locus_tag LOCUS_07210 gene psb27 57242 56841 CDS product photosystem II protein Psb27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058295.1 protein_id gnl|my_center|LOCUS_07210 59107 57278 gene locus_tag LOCUS_07220 59107 57278 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124662.1 protein_id gnl|my_center|LOCUS_07220 59223 59594 gene locus_tag LOCUS_07230 59223 59594 CDS product resolvase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866414.1 protein_id gnl|my_center|LOCUS_07230 59961 60224 gene locus_tag LOCUS_07240 59961 60224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 61164 60457 gene locus_tag LOCUS_07250 61164 60457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 62342 61161 gene locus_tag LOCUS_07260 62342 61161 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857221.1 protein_id gnl|my_center|LOCUS_07260 62845 62537 gene locus_tag LOCUS_07270 62845 62537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 63691 63023 gene locus_tag LOCUS_07280 63691 63023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence10 732 304 gene locus_tag LOCUS_07290 732 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2403 1045 gene locus_tag LOCUS_07300 2403 1045 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000842701.1 protein_id gnl|my_center|LOCUS_07300 3457 2441 gene locus_tag LOCUS_07310 3457 2441 CDS product imelysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527912.1 protein_id gnl|my_center|LOCUS_07310 4232 3831 gene locus_tag LOCUS_07320 4232 3831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 4390 4187 gene locus_tag LOCUS_07330 4390 4187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 4831 5649 gene locus_tag LOCUS_07340 4831 5649 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836413.1 protein_id gnl|my_center|LOCUS_07340 5737 6819 gene locus_tag LOCUS_07350 gene bchI 5737 6819 CDS product magnesium chelatase ATPase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125298.1 protein_id gnl|my_center|LOCUS_07350 6831 7316 gene locus_tag LOCUS_07360 gene ruvC 6831 7316 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125299.1 protein_id gnl|my_center|LOCUS_07360 7294 7881 gene locus_tag LOCUS_07370 7294 7881 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140761.1 protein_id gnl|my_center|LOCUS_07370 7974 8162 gene locus_tag LOCUS_07380 7974 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8247 8678 gene locus_tag LOCUS_07390 8247 8678 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125301.1 protein_id gnl|my_center|LOCUS_07390 8675 10546 gene locus_tag LOCUS_07400 8675 10546 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103418.1 protein_id gnl|my_center|LOCUS_07400 10619 10957 gene locus_tag LOCUS_07410 10619 10957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 10973 11464 gene locus_tag LOCUS_07420 10973 11464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 11848 12261 gene locus_tag LOCUS_07430 11848 12261 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258723.1 protein_id gnl|my_center|LOCUS_07430 12258 13859 gene locus_tag LOCUS_07440 12258 13859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 13859 15118 gene locus_tag LOCUS_07450 13859 15118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 15512 16684 gene locus_tag LOCUS_07460 15512 16684 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257682.1 protein_id gnl|my_center|LOCUS_07460 16681 17184 gene locus_tag LOCUS_07470 16681 17184 CDS product DUF4411 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257683.1 protein_id gnl|my_center|LOCUS_07470 17540 18544 gene locus_tag LOCUS_07480 gene rhuM 17540 18544 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_07480 18644 19882 gene locus_tag LOCUS_07490 18644 19882 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_07490 19884 20189 gene locus_tag LOCUS_07500 19884 20189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 20223 20501 gene locus_tag LOCUS_07510 20223 20501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 20771 21868 gene locus_tag LOCUS_07520 20771 21868 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_07520 21872 22552 gene locus_tag LOCUS_07530 21872 22552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 22613 25726 gene locus_tag LOCUS_07540 22613 25726 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103421.1 protein_id gnl|my_center|LOCUS_07540 25829 25741 gene locus_tag LOCUS_t00120 25829 25741 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 27539 25845 gene locus_tag LOCUS_07550 27539 25845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 27670 28125 gene locus_tag LOCUS_07560 27670 28125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 29388 29630 gene locus_tag LOCUS_07570 29388 29630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 30184 30681 gene locus_tag LOCUS_07580 30184 30681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 32408 30861 gene locus_tag LOCUS_07590 32408 30861 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125564.1 protein_id gnl|my_center|LOCUS_07590 33001 32429 gene locus_tag LOCUS_07600 33001 32429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125563.1 protein_id gnl|my_center|LOCUS_07600 33711 32998 gene locus_tag LOCUS_07610 33711 32998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 33697 34146 gene locus_tag LOCUS_07620 33697 34146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 34186 35421 gene locus_tag LOCUS_07630 gene tyrS 34186 35421 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125561.1 protein_id gnl|my_center|LOCUS_07630 35421 36203 gene locus_tag LOCUS_07640 gene pyrF 35421 36203 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125560.1 protein_id gnl|my_center|LOCUS_07640 36271 39234 gene locus_tag LOCUS_07650 gene uvrA 36271 39234 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866392.1 protein_id gnl|my_center|LOCUS_07650 40167 39238 gene locus_tag LOCUS_07660 40167 39238 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206177.1 protein_id gnl|my_center|LOCUS_07660 40711 40157 gene locus_tag LOCUS_07670 40711 40157 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312755.1 protein_id gnl|my_center|LOCUS_07670 41830 41264 gene locus_tag LOCUS_07680 41830 41264 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125988.1 protein_id gnl|my_center|LOCUS_07680 41898 42314 gene locus_tag LOCUS_07690 41898 42314 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125989.1 protein_id gnl|my_center|LOCUS_07690 42334 45162 gene locus_tag LOCUS_07700 42334 45162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 45162 46073 gene locus_tag LOCUS_07710 45162 46073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 46116 46310 gene locus_tag LOCUS_07720 46116 46310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 46928 46311 gene locus_tag LOCUS_07730 46928 46311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 50091 46993 gene locus_tag LOCUS_07740 50091 46993 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125993.1 protein_id gnl|my_center|LOCUS_07740 50551 50186 gene locus_tag LOCUS_07750 50551 50186 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124728.1 protein_id gnl|my_center|LOCUS_07750 50760 50689 gene locus_tag LOCUS_t00130 50760 50689 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 51463 50912 gene locus_tag LOCUS_07760 51463 50912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 55199 51540 gene locus_tag LOCUS_07770 55199 51540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 55198 56058 gene locus_tag LOCUS_07780 gene nadC 55198 56058 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124368.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence11 270 1160 gene locus_tag LOCUS_07790 270 1160 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124887.1 protein_id gnl|my_center|LOCUS_07790 2589 1135 gene locus_tag LOCUS_07800 2589 1135 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125901.1 protein_id gnl|my_center|LOCUS_07800 2962 2639 gene locus_tag LOCUS_07810 2962 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 3076 4239 gene locus_tag LOCUS_07820 3076 4239 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126019.1 protein_id gnl|my_center|LOCUS_07820 5058 4609 gene locus_tag LOCUS_07830 5058 4609 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523721.1 protein_id gnl|my_center|LOCUS_07830 5697 5065 gene locus_tag LOCUS_07840 5697 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125893.1 protein_id gnl|my_center|LOCUS_07840 6826 5789 gene locus_tag LOCUS_07850 gene purM 6826 5789 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125894.1 protein_id gnl|my_center|LOCUS_07850 6856 8421 gene locus_tag LOCUS_07860 6856 8421 CDS product bifunctional pantoate--beta-alanine ligase/(d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125895.1 protein_id gnl|my_center|LOCUS_07860 9035 8448 gene locus_tag LOCUS_07870 9035 8448 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057990.1 protein_id gnl|my_center|LOCUS_07870 9740 9063 gene locus_tag LOCUS_07880 9740 9063 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057797.1 protein_id gnl|my_center|LOCUS_07880 10608 9754 gene locus_tag LOCUS_07890 10608 9754 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009454959.1 protein_id gnl|my_center|LOCUS_07890 11172 10684 gene locus_tag LOCUS_07900 gene cpcA 11172 10684 CDS product phycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057793.1 protein_id gnl|my_center|LOCUS_07900 11733 11215 gene locus_tag LOCUS_07910 11733 11215 CDS product phycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057792.1 protein_id gnl|my_center|LOCUS_07910 12580 11957 gene locus_tag LOCUS_07920 12580 11957 CDS product chromophore lyase CpcT/CpeT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141193.1 protein_id gnl|my_center|LOCUS_07920 13143 12613 gene locus_tag LOCUS_07930 13143 12613 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141192.1 protein_id gnl|my_center|LOCUS_07930 13667 13353 gene locus_tag LOCUS_07940 13667 13353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 14239 13838 gene locus_tag LOCUS_07950 14239 13838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 14775 14122 gene locus_tag LOCUS_07960 14775 14122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07960 16054 14840 gene locus_tag LOCUS_07970 16054 14840 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798964.1 protein_id gnl|my_center|LOCUS_07970 17937 16060 gene locus_tag LOCUS_07980 17937 16060 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055977.1 protein_id gnl|my_center|LOCUS_07980 18104 19030 gene locus_tag LOCUS_07990 18104 19030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 20490 19027 gene locus_tag LOCUS_08000 gene dnaB 20490 19027 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125984.1 protein_id gnl|my_center|LOCUS_08000 21206 20751 gene locus_tag LOCUS_08010 gene rplI 21206 20751 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125983.1 protein_id gnl|my_center|LOCUS_08010 22065 21178 gene locus_tag LOCUS_08020 22065 21178 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125982.1 protein_id gnl|my_center|LOCUS_08020 22243 23979 gene locus_tag LOCUS_08030 22243 23979 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124200.1 protein_id gnl|my_center|LOCUS_08030 24009 25787 gene locus_tag LOCUS_08040 24009 25787 CDS product diflavin flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124199.1 protein_id gnl|my_center|LOCUS_08040 26785 28353 gene locus_tag LOCUS_08050 26785 28353 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125802.1 protein_id gnl|my_center|LOCUS_08050 28366 29493 gene locus_tag LOCUS_08060 28366 29493 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124379.1 protein_id gnl|my_center|LOCUS_08060 30021 29578 gene locus_tag LOCUS_08070 30021 29578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08070 30297 30452 gene locus_tag LOCUS_08080 30297 30452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 30677 31603 gene locus_tag LOCUS_08090 gene argF 30677 31603 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125488.1 protein_id gnl|my_center|LOCUS_08090 31716 32345 gene locus_tag LOCUS_08100 gene lexA 31716 32345 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125487.1 protein_id gnl|my_center|LOCUS_08100 33146 32394 gene locus_tag LOCUS_08110 33146 32394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 33935 33573 gene locus_tag LOCUS_08120 33935 33573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 34206 35138 gene locus_tag LOCUS_08130 34206 35138 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891701.1 protein_id gnl|my_center|LOCUS_08130 35207 35461 gene locus_tag LOCUS_08140 35207 35461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 35531 35740 gene locus_tag LOCUS_08150 35531 35740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 36051 35842 gene locus_tag LOCUS_08160 36051 35842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 36836 36117 gene locus_tag LOCUS_08170 36836 36117 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058093.1 protein_id gnl|my_center|LOCUS_08170 37385 37573 gene locus_tag LOCUS_08180 37385 37573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 37857 38408 gene locus_tag LOCUS_08190 37857 38408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 38923 38471 gene locus_tag LOCUS_08200 38923 38471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 39019 40830 gene locus_tag LOCUS_08210 gene thrS 39019 40830 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058036.1 protein_id gnl|my_center|LOCUS_08210 40827 41885 gene locus_tag LOCUS_08220 gene glk 40827 41885 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125217.1 protein_id gnl|my_center|LOCUS_08220 41876 42847 gene locus_tag LOCUS_08230 gene thrB 41876 42847 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125218.1 protein_id gnl|my_center|LOCUS_08230 42945 44486 gene locus_tag LOCUS_08240 42945 44486 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125219.1 protein_id gnl|my_center|LOCUS_08240 45624 44476 gene locus_tag LOCUS_08250 45624 44476 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_08250 46375 45626 gene locus_tag LOCUS_08260 46375 45626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 46817 47941 gene locus_tag LOCUS_08270 46817 47941 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125385.1 protein_id gnl|my_center|LOCUS_08270 48723 47965 gene locus_tag LOCUS_08280 48723 47965 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141265.1 protein_id gnl|my_center|LOCUS_08280 50287 48803 gene locus_tag LOCUS_08290 50287 48803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 51227 50343 gene locus_tag LOCUS_08300 51227 50343 CDS product phycobilisome rod-core linker polypeptide inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_023175909.1 protein_id gnl|my_center|LOCUS_08300 51891 51394 gene locus_tag LOCUS_08310 51891 51394 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_08310 52526 51945 gene locus_tag LOCUS_08320 52526 51945 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_08320 53083 53157 gene locus_tag LOCUS_t00140 53083 53157 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 54680 53130 gene locus_tag LOCUS_08330 54680 53130 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125517.1 protein_id gnl|my_center|LOCUS_08330 54908 55681 gene locus_tag LOCUS_08340 54908 55681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 56091 55813 gene locus_tag LOCUS_08350 56091 55813 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057662.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence12 1248 94 gene locus_tag LOCUS_08360 gene recF 1248 94 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071820854.1 protein_id gnl|my_center|LOCUS_08360 1271 1345 gene locus_tag LOCUS_t00150 1271 1345 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1855 1298 gene locus_tag LOCUS_08370 1855 1298 CDS product GNAT family acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125878.1 protein_id gnl|my_center|LOCUS_08370 4849 1862 gene locus_tag LOCUS_08380 gene ppc 4849 1862 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125879.1 protein_id gnl|my_center|LOCUS_08380 6033 4846 gene locus_tag LOCUS_08390 gene gshA 6033 4846 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056177.1 protein_id gnl|my_center|LOCUS_08390 7544 6030 gene locus_tag LOCUS_08400 7544 6030 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125881.1 protein_id gnl|my_center|LOCUS_08400 8092 7580 gene locus_tag LOCUS_08410 8092 7580 CDS product photosystem I reaction center subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125882.1 protein_id gnl|my_center|LOCUS_08410 9474 8134 gene locus_tag LOCUS_08420 9474 8134 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125883.1 protein_id gnl|my_center|LOCUS_08420 11009 9474 gene locus_tag LOCUS_08430 gene rodA 11009 9474 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125884.1 protein_id gnl|my_center|LOCUS_08430 12138 11095 gene locus_tag LOCUS_08440 12138 11095 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125885.1 protein_id gnl|my_center|LOCUS_08440 12194 13264 gene locus_tag LOCUS_08450 gene hemF 12194 13264 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125886.1 protein_id gnl|my_center|LOCUS_08450 14182 13271 gene locus_tag LOCUS_08460 14182 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 14762 14199 gene locus_tag LOCUS_08470 14762 14199 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125888.1 protein_id gnl|my_center|LOCUS_08470 15119 14862 gene locus_tag LOCUS_08480 15119 14862 CDS product DUF6447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125050.1 protein_id gnl|my_center|LOCUS_08480 16933 15200 gene locus_tag LOCUS_08490 16933 15200 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125051.1 protein_id gnl|my_center|LOCUS_08490 17018 17575 gene locus_tag LOCUS_08500 17018 17575 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057625.1 protein_id gnl|my_center|LOCUS_08500 17582 18763 gene locus_tag LOCUS_08510 17582 18763 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124471.1 protein_id gnl|my_center|LOCUS_08510 18924 18739 gene locus_tag LOCUS_08520 18924 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 20541 19729 gene locus_tag LOCUS_08530 20541 19729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 22501 20606 gene locus_tag LOCUS_08540 22501 20606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08540 23394 22501 gene locus_tag LOCUS_08550 23394 22501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08550 23536 24396 gene locus_tag LOCUS_08560 gene folP 23536 24396 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057362.1 protein_id gnl|my_center|LOCUS_08560 25034 24375 gene locus_tag LOCUS_08570 25034 24375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125057.1 protein_id gnl|my_center|LOCUS_08570 25951 25028 gene locus_tag LOCUS_08580 gene dapB 25951 25028 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125056.1 protein_id gnl|my_center|LOCUS_08580 26047 27501 gene locus_tag LOCUS_08590 26047 27501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 29008 27551 gene locus_tag LOCUS_08600 29008 27551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 29429 29100 gene locus_tag LOCUS_08610 29429 29100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 30829 29465 gene locus_tag LOCUS_08620 30829 29465 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892595.1 protein_id gnl|my_center|LOCUS_08620 31089 31940 gene locus_tag LOCUS_08630 31089 31940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 31958 33169 gene locus_tag LOCUS_08640 gene larC 31958 33169 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058129.1 protein_id gnl|my_center|LOCUS_08640 33166 34071 gene locus_tag LOCUS_08650 33166 34071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 34923 34183 gene locus_tag LOCUS_08660 34923 34183 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_08660 36650 34920 gene locus_tag LOCUS_08670 36650 34920 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089418476.1 protein_id gnl|my_center|LOCUS_08670 37409 36831 gene locus_tag LOCUS_08680 37409 36831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 38055 37834 gene locus_tag LOCUS_08690 38055 37834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 40059 38521 gene locus_tag LOCUS_08700 40059 38521 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923207.1 protein_id gnl|my_center|LOCUS_08700 41137 40067 gene locus_tag LOCUS_08710 41137 40067 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124643.1 protein_id gnl|my_center|LOCUS_08710 42521 41229 gene locus_tag LOCUS_08720 42521 41229 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029184.1 protein_id gnl|my_center|LOCUS_08720 42564 43142 gene locus_tag LOCUS_08730 42564 43142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 43169 43411 gene locus_tag LOCUS_08740 43169 43411 CDS product BolA/IbaG family iron-sulfur metabolism protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125238.1 protein_id gnl|my_center|LOCUS_08740 43489 43812 gene locus_tag LOCUS_08750 gene grxD 43489 43812 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024125804.1 protein_id gnl|my_center|LOCUS_08750 44101 43838 gene locus_tag LOCUS_08760 44101 43838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125236.1 protein_id gnl|my_center|LOCUS_08760 44319 45089 gene locus_tag LOCUS_08770 44319 45089 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866420.1 protein_id gnl|my_center|LOCUS_08770 45206 45940 gene locus_tag LOCUS_08780 45206 45940 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564604.1 protein_id gnl|my_center|LOCUS_08780 46021 46167 gene locus_tag LOCUS_08790 46021 46167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 47482 46187 gene locus_tag LOCUS_08800 47482 46187 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125166.1 protein_id gnl|my_center|LOCUS_08800 47978 47667 gene locus_tag LOCUS_08810 47978 47667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 48050 48817 gene locus_tag LOCUS_08820 48050 48817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 48938 49216 gene locus_tag LOCUS_08830 48938 49216 CDS product DUF2839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106498686.1 protein_id gnl|my_center|LOCUS_08830 51910 49259 gene locus_tag LOCUS_08840 gene clpB 51910 49259 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057229.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence13 1028 1234 gene locus_tag LOCUS_08850 1028 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124402.1 protein_id gnl|my_center|LOCUS_08850 3255 1276 gene locus_tag LOCUS_08860 gene dnaG 3255 1276 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124909.1 protein_id gnl|my_center|LOCUS_08860 3348 5528 gene locus_tag LOCUS_08870 gene glyS 3348 5528 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124983.1 protein_id gnl|my_center|LOCUS_08870 6868 5486 gene locus_tag LOCUS_08880 gene chlP 6868 5486 CDS product geranylgeranyl reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124984.1 protein_id gnl|my_center|LOCUS_08880 7011 7751 gene locus_tag LOCUS_08890 7011 7751 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124985.1 protein_id gnl|my_center|LOCUS_08890 7765 9564 gene locus_tag LOCUS_08900 gene typA 7765 9564 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124986.1 protein_id gnl|my_center|LOCUS_08900 9576 10019 gene locus_tag LOCUS_08910 9576 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 10016 10507 gene locus_tag LOCUS_08920 10016 10507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 10504 11232 gene locus_tag LOCUS_08930 gene lptB 10504 11232 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124988.1 protein_id gnl|my_center|LOCUS_08930 11232 12389 gene locus_tag LOCUS_08940 11232 12389 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923226.1 protein_id gnl|my_center|LOCUS_08940 13810 12386 gene locus_tag LOCUS_08950 gene glmU 13810 12386 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920683.1 protein_id gnl|my_center|LOCUS_08950 14782 13847 gene locus_tag LOCUS_08960 gene queG 14782 13847 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124162.1 protein_id gnl|my_center|LOCUS_08960 15480 15175 gene locus_tag LOCUS_08970 15480 15175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125910.1 protein_id gnl|my_center|LOCUS_08970 15627 15550 gene locus_tag LOCUS_t00160 15627 15550 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16100 16876 gene locus_tag LOCUS_08980 gene rnc 16100 16876 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125911.1 protein_id gnl|my_center|LOCUS_08980 16887 19829 gene locus_tag LOCUS_08990 gene polA 16887 19829 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125386.1 protein_id gnl|my_center|LOCUS_08990 19930 21372 gene locus_tag LOCUS_09000 gene cysS 19930 21372 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125387.1 protein_id gnl|my_center|LOCUS_09000 22134 24209 gene locus_tag LOCUS_09010 22134 24209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 24714 24415 gene locus_tag LOCUS_09020 24714 24415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 25687 25923 gene locus_tag LOCUS_09030 25687 25923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 26086 26493 gene locus_tag LOCUS_09040 26086 26493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 26537 27658 gene locus_tag LOCUS_09050 gene cas7e 26537 27658 CDS product type I-E CRISPR-associated protein Cas7/Cse4/CasC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229114.1 protein_id gnl|my_center|LOCUS_09050 27658 28311 gene locus_tag LOCUS_09060 gene cas5e 27658 28311 CDS product type I-E CRISPR-associated protein Cas5/CasD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229113.1 protein_id gnl|my_center|LOCUS_09060 28308 28952 gene locus_tag LOCUS_09070 gene cas6e 28308 28952 CDS product type I-E CRISPR-associated protein Cas6/Cse3/CasE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229112.1 protein_id gnl|my_center|LOCUS_09070 28967 29899 gene locus_tag LOCUS_09080 gene cas1e 28967 29899 CDS product type I-E CRISPR-associated endonuclease Cas1e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229111.1 protein_id gnl|my_center|LOCUS_09080 29880 30257 gene locus_tag LOCUS_09090 gene cas2e 29880 30257 CDS product type I-E CRISPR-associated endoribonuclease Cas2e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926117.1 protein_id gnl|my_center|LOCUS_09090 30267 31043 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctgttccccgcacacgcggggatggcccg 31147 32163 gene locus_tag LOCUS_09100 31147 32163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 32275 33690 gene locus_tag LOCUS_09110 32275 33690 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124669.1 protein_id gnl|my_center|LOCUS_09110 33690 35006 gene locus_tag LOCUS_09120 33690 35006 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124668.1 protein_id gnl|my_center|LOCUS_09120 35834 34977 gene locus_tag LOCUS_09130 35834 34977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 35978 37348 gene locus_tag LOCUS_09140 35978 37348 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056513.1 protein_id gnl|my_center|LOCUS_09140 37357 37893 gene locus_tag LOCUS_09150 37357 37893 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971093.1 protein_id gnl|my_center|LOCUS_09150 37950 38426 gene locus_tag LOCUS_09160 37950 38426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 38423 39181 gene locus_tag LOCUS_09170 38423 39181 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125296.1 protein_id gnl|my_center|LOCUS_09170 39283 40368 gene locus_tag LOCUS_09180 39283 40368 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125297.1 protein_id gnl|my_center|LOCUS_09180 40372 41928 gene locus_tag LOCUS_09190 40372 41928 CDS product DUF3370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921041.1 protein_id gnl|my_center|LOCUS_09190 44860 41948 gene locus_tag LOCUS_09200 44860 41948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 45056 46543 gene locus_tag LOCUS_09210 gene gatB 45056 46543 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124207.1 protein_id gnl|my_center|LOCUS_09210 46720 47004 gene locus_tag LOCUS_09220 46720 47004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 48322 47060 gene locus_tag LOCUS_09230 48322 47060 CDS product RpoD/SigA family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125940.1 protein_id gnl|my_center|LOCUS_09230 49999 48626 gene locus_tag LOCUS_09240 gene mgtE 49999 48626 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125941.1 protein_id gnl|my_center|LOCUS_09240 50432 50028 gene locus_tag LOCUS_09250 50432 50028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 50863 50429 gene locus_tag LOCUS_09260 50863 50429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 51869 50853 gene locus_tag LOCUS_09270 51869 50853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124527.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence14 952 230 gene locus_tag LOCUS_09280 952 230 CDS product DevA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124974.1 protein_id gnl|my_center|LOCUS_09280 2125 953 gene locus_tag LOCUS_09290 gene devC 2125 953 CDS product ABC transporter permease DevC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124973.1 protein_id gnl|my_center|LOCUS_09290 3084 2131 gene locus_tag LOCUS_09300 3084 2131 CDS product ABC exporter membrane fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124972.1 protein_id gnl|my_center|LOCUS_09300 3882 3148 gene locus_tag LOCUS_09310 3882 3148 CDS product phycocyanobilin:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058141.1 protein_id gnl|my_center|LOCUS_09310 4068 5354 gene locus_tag LOCUS_09320 4068 5354 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866418.1 protein_id gnl|my_center|LOCUS_09320 5402 5854 gene locus_tag LOCUS_09330 5402 5854 CDS product DUF3110 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125092.1 protein_id gnl|my_center|LOCUS_09330 6720 6283 gene locus_tag LOCUS_09340 gene smpB 6720 6283 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125925.1 protein_id gnl|my_center|LOCUS_09340 7335 6838 gene locus_tag LOCUS_09350 7335 6838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 7853 7401 gene locus_tag LOCUS_09360 7853 7401 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124290.1 protein_id gnl|my_center|LOCUS_09360 9321 7855 gene locus_tag LOCUS_09370 gene zds 9321 7855 CDS product 9,9'-di-cis-zeta-carotene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124291.1 protein_id gnl|my_center|LOCUS_09370 9440 14599 gene locus_tag LOCUS_09380 9440 14599 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883981.1 protein_id gnl|my_center|LOCUS_09380 14643 17396 gene locus_tag LOCUS_09390 14643 17396 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883982.1 protein_id gnl|my_center|LOCUS_09390 17533 21585 gene locus_tag LOCUS_09400 17533 21585 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256730.1 protein_id gnl|my_center|LOCUS_09400 21748 22164 gene locus_tag LOCUS_09410 21748 22164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 22136 23146 gene locus_tag LOCUS_09420 22136 23146 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000342501.1 protein_id gnl|my_center|LOCUS_09420 23285 23073 gene locus_tag LOCUS_09430 23285 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 23392 23928 gene locus_tag LOCUS_09440 23392 23928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 24081 24677 gene locus_tag LOCUS_09450 gene rdgB 24081 24677 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057634.1 protein_id gnl|my_center|LOCUS_09450 24721 25308 gene locus_tag LOCUS_09460 24721 25308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 25475 25918 gene locus_tag LOCUS_09470 25475 25918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 27033 26263 gene locus_tag LOCUS_09480 27033 26263 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125652.1 protein_id gnl|my_center|LOCUS_09480 27789 27085 gene locus_tag LOCUS_09490 27789 27085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125654.1 protein_id gnl|my_center|LOCUS_09490 27918 29129 gene locus_tag LOCUS_09500 27918 29129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 29730 29554 gene locus_tag LOCUS_09510 29730 29554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 31092 29983 gene locus_tag LOCUS_09520 31092 29983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 32367 33482 gene locus_tag LOCUS_09530 32367 33482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 34170 33517 gene locus_tag LOCUS_09540 34170 33517 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403999.1 protein_id gnl|my_center|LOCUS_09540 34183 35556 gene locus_tag LOCUS_09550 gene hcuB 34183 35556 CDS product hydrophobic compound transporter HcuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112500.1 protein_id gnl|my_center|LOCUS_09550 35900 35682 gene locus_tag LOCUS_09560 35900 35682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 36516 35881 gene locus_tag LOCUS_09570 36516 35881 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125955.1 protein_id gnl|my_center|LOCUS_09570 36500 37495 gene locus_tag LOCUS_09580 gene holA 36500 37495 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140070.1 protein_id gnl|my_center|LOCUS_09580 37519 39324 gene locus_tag LOCUS_09590 37519 39324 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125957.1 protein_id gnl|my_center|LOCUS_09590 39432 39767 gene locus_tag LOCUS_09600 39432 39767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 39658 39966 gene locus_tag LOCUS_09610 39658 39966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 40056 41135 gene locus_tag LOCUS_09620 40056 41135 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891711.1 protein_id gnl|my_center|LOCUS_09620 42268 41132 gene locus_tag LOCUS_09630 42268 41132 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124592.1 protein_id gnl|my_center|LOCUS_09630 42830 42282 gene locus_tag LOCUS_09640 42830 42282 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920972.1 protein_id gnl|my_center|LOCUS_09640 42899 43627 gene locus_tag LOCUS_09650 42899 43627 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124593.1 protein_id gnl|my_center|LOCUS_09650 43978 43616 gene locus_tag LOCUS_09660 43978 43616 CDS product AbrB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124594.1 protein_id gnl|my_center|LOCUS_09660 44650 44027 gene locus_tag LOCUS_09670 44650 44027 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124595.1 protein_id gnl|my_center|LOCUS_09670 46352 44718 gene locus_tag LOCUS_09680 gene ctaD 46352 44718 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124596.1 protein_id gnl|my_center|LOCUS_09680 47284 46433 gene locus_tag LOCUS_09690 47284 46433 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891713.1 protein_id gnl|my_center|LOCUS_09690 47417 48325 gene locus_tag LOCUS_09700 47417 48325 CDS product heme A synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057731.1 protein_id gnl|my_center|LOCUS_09700 48373 49530 gene locus_tag LOCUS_09710 48373 49530 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124599.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence15 1781 1248 gene locus_tag LOCUS_09720 1781 1248 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142170.1 protein_id gnl|my_center|LOCUS_09720 1960 2031 gene locus_tag LOCUS_t00170 1960 2031 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2164 3237 gene locus_tag LOCUS_09730 gene fba 2164 3237 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125007.1 protein_id gnl|my_center|LOCUS_09730 3431 3943 gene locus_tag LOCUS_09740 3431 3943 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892330.1 protein_id gnl|my_center|LOCUS_09740 5183 6523 gene locus_tag LOCUS_09750 gene aroA 5183 6523 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923230.1 protein_id gnl|my_center|LOCUS_09750 6429 6716 gene locus_tag LOCUS_09760 6429 6716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 7939 7703 gene locus_tag LOCUS_09770 7939 7703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 8145 7936 gene locus_tag LOCUS_09780 8145 7936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 9020 8196 gene locus_tag LOCUS_09790 gene cobA 9020 8196 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126007.1 protein_id gnl|my_center|LOCUS_09790 9208 10755 gene locus_tag LOCUS_09800 9208 10755 CDS product ferredoxin--nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057189.1 protein_id gnl|my_center|LOCUS_09800 10871 11770 gene locus_tag LOCUS_09810 10871 11770 CDS product formate/nitrite transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480256.1 protein_id gnl|my_center|LOCUS_09810 11792 12631 gene locus_tag LOCUS_09820 11792 12631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 13706 12660 gene locus_tag LOCUS_09830 13706 12660 CDS product protochlorophyllide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056423.1 protein_id gnl|my_center|LOCUS_09830 14066 13776 gene locus_tag LOCUS_09840 14066 13776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 14429 14734 gene locus_tag LOCUS_09850 14429 14734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 14741 15244 gene locus_tag LOCUS_09860 14741 15244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 15241 16029 gene locus_tag LOCUS_09870 15241 16029 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124694.1 protein_id gnl|my_center|LOCUS_09870 17636 15996 gene locus_tag LOCUS_09880 17636 15996 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125286.1 protein_id gnl|my_center|LOCUS_09880 17766 19346 gene locus_tag LOCUS_09890 17766 19346 CDS product DUF1957 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125287.1 protein_id gnl|my_center|LOCUS_09890 19316 20278 gene locus_tag LOCUS_09900 gene arsS 19316 20278 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257184.1 protein_id gnl|my_center|LOCUS_09900 22527 20275 gene locus_tag LOCUS_09910 22527 20275 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125140.1 protein_id gnl|my_center|LOCUS_09910 23001 22702 gene locus_tag LOCUS_09920 23001 22702 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125139.1 protein_id gnl|my_center|LOCUS_09920 23365 23054 gene locus_tag LOCUS_09930 23365 23054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 24768 23809 gene locus_tag LOCUS_09940 24768 23809 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125494.1 protein_id gnl|my_center|LOCUS_09940 25814 24801 gene locus_tag LOCUS_09950 gene pheS 25814 24801 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125495.1 protein_id gnl|my_center|LOCUS_09950 25901 26725 gene locus_tag LOCUS_09960 gene surE 25901 26725 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125496.1 protein_id gnl|my_center|LOCUS_09960 27254 26691 gene locus_tag LOCUS_09970 27254 26691 CDS product DUF3611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125497.1 protein_id gnl|my_center|LOCUS_09970 27306 28265 gene locus_tag LOCUS_09980 27306 28265 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125498.1 protein_id gnl|my_center|LOCUS_09980 28689 33713 gene locus_tag LOCUS_09990 28689 33713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 33961 35058 gene locus_tag LOCUS_10000 33961 35058 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920956.1 protein_id gnl|my_center|LOCUS_10000 35055 35294 gene locus_tag LOCUS_10010 gene thiS 35055 35294 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140405.1 protein_id gnl|my_center|LOCUS_10010 35339 36292 gene locus_tag LOCUS_10020 35339 36292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 36325 37005 gene locus_tag LOCUS_10030 36325 37005 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125518.1 protein_id gnl|my_center|LOCUS_10030 39830 37935 gene locus_tag LOCUS_10040 39830 37935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124211.1 protein_id gnl|my_center|LOCUS_10040 40379 42586 gene locus_tag LOCUS_10050 40379 42586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 42853 43872 gene locus_tag LOCUS_10060 42853 43872 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188583328.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10060 44459 44061 gene locus_tag LOCUS_10070 44459 44061 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056577.1 protein_id gnl|my_center|LOCUS_10070 46114 44525 gene locus_tag LOCUS_10080 46114 44525 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125181.1 protein_id gnl|my_center|LOCUS_10080 46562 46723 gene locus_tag LOCUS_10090 46562 46723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 46745 46915 gene locus_tag LOCUS_10100 46745 46915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 47265 46981 gene locus_tag LOCUS_10110 47265 46981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10110 47686 47429 gene locus_tag LOCUS_10120 47686 47429 CDS product NAD(P)H-quinone oxidoreductase subunit O inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124296.1 protein_id gnl|my_center|LOCUS_10120 48915 47974 gene locus_tag LOCUS_10130 gene pheA 48915 47974 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125810.1 protein_id gnl|my_center|LOCUS_10130 48965 49546 gene locus_tag LOCUS_10140 48965 49546 CDS product DUF1997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892520.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence16 1224 325 gene locus_tag LOCUS_10150 1224 325 CDS product prephenate/arogenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921244.1 protein_id gnl|my_center|LOCUS_10150 1266 2717 gene locus_tag LOCUS_10160 1266 2717 CDS product helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125867.1 protein_id gnl|my_center|LOCUS_10160 2824 3069 gene locus_tag LOCUS_10170 2824 3069 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124572.1 protein_id gnl|my_center|LOCUS_10170 3129 4511 gene locus_tag LOCUS_10180 gene serS 3129 4511 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125455.1 protein_id gnl|my_center|LOCUS_10180 4367 4270 gene locus_tag LOCUS_t00180 4367 4270 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5970 4486 gene locus_tag LOCUS_10190 5970 4486 CDS product malate:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124573.1 protein_id gnl|my_center|LOCUS_10190 6018 7112 gene locus_tag LOCUS_10200 6018 7112 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125456.1 protein_id gnl|my_center|LOCUS_10200 7112 7777 gene locus_tag LOCUS_10210 gene nth 7112 7777 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_10210 8634 7825 gene locus_tag LOCUS_10220 8634 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 9725 8748 gene locus_tag LOCUS_10230 9725 8748 CDS product RpoD/SigA family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126012.1 protein_id gnl|my_center|LOCUS_10230 10298 9876 gene locus_tag LOCUS_10240 10298 9876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 10785 12929 gene locus_tag LOCUS_10250 10785 12929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 13017 13289 gene locus_tag LOCUS_10260 13017 13289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 13434 13748 gene locus_tag LOCUS_10270 13434 13748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 14122 14454 gene locus_tag LOCUS_10280 14122 14454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 14460 14975 gene locus_tag LOCUS_10290 14460 14975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 15017 15214 gene locus_tag LOCUS_10300 15017 15214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 15541 16005 gene locus_tag LOCUS_10310 15541 16005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 15966 17072 gene locus_tag LOCUS_10320 15966 17072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 17062 18567 gene locus_tag LOCUS_10330 17062 18567 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704239.1 protein_id gnl|my_center|LOCUS_10330 18564 21563 gene locus_tag LOCUS_10340 18564 21563 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_10340 21652 23697 gene locus_tag LOCUS_10350 gene bchD 21652 23697 CDS product magnesium chelatase ATPase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891654.1 protein_id gnl|my_center|LOCUS_10350 24239 23994 gene locus_tag LOCUS_10360 24239 23994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 24692 24426 gene locus_tag LOCUS_10370 24692 24426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 25446 26243 gene locus_tag LOCUS_10380 25446 26243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 26325 26720 gene locus_tag LOCUS_10390 26325 26720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 27125 28498 gene locus_tag LOCUS_10400 27125 28498 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141064.1 protein_id gnl|my_center|LOCUS_10400 29530 28547 gene locus_tag LOCUS_10410 29530 28547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 30309 29536 gene locus_tag LOCUS_10420 30309 29536 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124476.1 protein_id gnl|my_center|LOCUS_10420 30554 31912 gene locus_tag LOCUS_10430 30554 31912 CDS product YvcK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124477.1 protein_id gnl|my_center|LOCUS_10430 32436 32363 gene locus_tag LOCUS_t00190 32436 32363 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 32522 34228 gene locus_tag LOCUS_10440 32522 34228 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124260.1 protein_id gnl|my_center|LOCUS_10440 35348 34242 gene locus_tag LOCUS_10450 35348 34242 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140935.1 protein_id gnl|my_center|LOCUS_10450 35442 35371 gene locus_tag LOCUS_t00200 35442 35371 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 35527 35446 gene locus_tag LOCUS_t00210 35527 35446 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 35595 36041 gene locus_tag LOCUS_10460 gene aroQ 35595 36041 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035767.1 protein_id gnl|my_center|LOCUS_10460 36120 36425 gene locus_tag LOCUS_10470 36120 36425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 37741 36536 gene locus_tag LOCUS_10480 37741 36536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 38611 37844 gene locus_tag LOCUS_10490 38611 37844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 39375 38608 gene locus_tag LOCUS_10500 39375 38608 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228850.1 protein_id gnl|my_center|LOCUS_10500 39693 40754 gene locus_tag LOCUS_10510 39693 40754 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259475.1 protein_id gnl|my_center|LOCUS_10510 40880 40653 gene locus_tag LOCUS_10520 40880 40653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 41186 40917 gene locus_tag LOCUS_10530 41186 40917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 42496 41336 gene locus_tag LOCUS_10540 42496 41336 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172598138.1 protein_id gnl|my_center|LOCUS_10540 42725 43177 gene locus_tag LOCUS_10550 42725 43177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 44022 43264 gene locus_tag LOCUS_10560 44022 43264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 45020 44022 gene locus_tag LOCUS_10570 45020 44022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 45904 45593 gene locus_tag LOCUS_10580 45904 45593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence17 269 1342 gene locus_tag LOCUS_10590 gene murG 269 1342 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124378.1 protein_id gnl|my_center|LOCUS_10590 1448 1378 gene locus_tag LOCUS_t00220 1448 1378 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1507 2781 gene locus_tag LOCUS_10600 1507 2781 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866390.1 protein_id gnl|my_center|LOCUS_10600 2748 3014 gene locus_tag LOCUS_10610 2748 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4039 3044 gene locus_tag LOCUS_10620 4039 3044 CDS product sirohydrochlorin chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124958.1 protein_id gnl|my_center|LOCUS_10620 4727 4065 gene locus_tag LOCUS_10630 4727 4065 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125889.1 protein_id gnl|my_center|LOCUS_10630 4826 5341 gene locus_tag LOCUS_10640 4826 5341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 6075 6001 gene locus_tag LOCUS_t00230 6075 6001 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6115 6417 gene locus_tag LOCUS_10650 6115 6417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 9054 6448 gene locus_tag LOCUS_10660 gene infB 9054 6448 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125799.1 protein_id gnl|my_center|LOCUS_10660 10914 10600 gene locus_tag LOCUS_10670 10914 10600 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057771.1 protein_id gnl|my_center|LOCUS_10670 12227 10911 gene locus_tag LOCUS_10680 gene nusA 12227 10911 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125797.1 protein_id gnl|my_center|LOCUS_10680 12506 12276 gene locus_tag LOCUS_10690 12506 12276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 12393 12731 gene locus_tag LOCUS_10700 12393 12731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 12924 13691 gene locus_tag LOCUS_10710 gene cpdA 12924 13691 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098742.1 protein_id gnl|my_center|LOCUS_10710 13752 14957 gene locus_tag LOCUS_10720 13752 14957 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125795.1 protein_id gnl|my_center|LOCUS_10720 15023 15748 gene locus_tag LOCUS_10730 gene rpiA 15023 15748 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125794.1 protein_id gnl|my_center|LOCUS_10730 17082 15745 gene locus_tag LOCUS_10740 gene hisD 17082 15745 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125793.1 protein_id gnl|my_center|LOCUS_10740 17148 17465 gene locus_tag LOCUS_10750 gene rpsT 17148 17465 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125792.1 protein_id gnl|my_center|LOCUS_10750 17458 18345 gene locus_tag LOCUS_10760 17458 18345 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125791.1 protein_id gnl|my_center|LOCUS_10760 18588 21875 gene locus_tag LOCUS_10770 gene rpoB 18588 21875 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125790.1 protein_id gnl|my_center|LOCUS_10770 21956 24796 gene locus_tag LOCUS_10780 21956 24796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 24848 32707 gene locus_tag LOCUS_10790 24848 32707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 32923 34005 gene locus_tag LOCUS_10800 gene rlmN 32923 34005 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058257.1 protein_id gnl|my_center|LOCUS_10800 35885 34032 gene locus_tag LOCUS_10810 gene glmS 35885 34032 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125915.1 protein_id gnl|my_center|LOCUS_10810 36239 35994 gene locus_tag LOCUS_10820 gene psaC 36239 35994 CDS product photosystem I iron-sulfur center protein PsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125916.1 protein_id gnl|my_center|LOCUS_10820 36569 36291 gene locus_tag LOCUS_10830 36569 36291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 36474 36740 gene locus_tag LOCUS_10840 gene acpP 36474 36740 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125917.1 protein_id gnl|my_center|LOCUS_10840 36810 38036 gene locus_tag LOCUS_10850 gene fabF 36810 38036 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125918.1 protein_id gnl|my_center|LOCUS_10850 38106 40118 gene locus_tag LOCUS_10860 gene tkt 38106 40118 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125919.1 protein_id gnl|my_center|LOCUS_10860 40983 40123 gene locus_tag LOCUS_10870 40983 40123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 41049 41765 gene locus_tag LOCUS_10880 gene ispD 41049 41765 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124608.1 protein_id gnl|my_center|LOCUS_10880 41783 43186 gene locus_tag LOCUS_10890 41783 43186 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142394.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence18 735 1046 gene locus_tag LOCUS_10900 735 1046 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058102.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10900 1125 2378 gene locus_tag LOCUS_10910 gene ispG 1125 2378 CDS product (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125167.1 protein_id gnl|my_center|LOCUS_10910 4082 2406 gene locus_tag LOCUS_10920 4082 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 4716 4087 gene locus_tag LOCUS_10930 gene nusB 4716 4087 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124164.1 protein_id gnl|my_center|LOCUS_10930 5434 4721 gene locus_tag LOCUS_10940 5434 4721 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124163.1 protein_id gnl|my_center|LOCUS_10940 6019 5762 gene locus_tag LOCUS_10950 6019 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 6225 6019 gene locus_tag LOCUS_10960 6225 6019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 8255 6879 gene locus_tag LOCUS_10970 gene gltX 8255 6879 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124626.1 protein_id gnl|my_center|LOCUS_10970 8414 8339 gene locus_tag LOCUS_t00240 8414 8339 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 8973 8467 gene locus_tag LOCUS_10980 8973 8467 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124198.1 protein_id gnl|my_center|LOCUS_10980 9160 8978 gene locus_tag LOCUS_10990 9160 8978 CDS product hyperconserved protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006043540.1 protein_id gnl|my_center|LOCUS_10990 9286 9211 gene locus_tag LOCUS_t00250 9286 9211 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 9795 9331 gene locus_tag LOCUS_11000 gene rplS 9795 9331 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124627.1 protein_id gnl|my_center|LOCUS_11000 10120 9830 gene locus_tag LOCUS_11010 10120 9830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 10222 11052 gene locus_tag LOCUS_11020 gene map 10222 11052 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124629.1 protein_id gnl|my_center|LOCUS_11020 11785 11036 gene locus_tag LOCUS_11030 11785 11036 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124630.1 protein_id gnl|my_center|LOCUS_11030 11855 12244 gene locus_tag LOCUS_11040 11855 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 12281 13384 gene locus_tag LOCUS_11050 12281 13384 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891726.1 protein_id gnl|my_center|LOCUS_11050 13468 13980 gene locus_tag LOCUS_11060 13468 13980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124632.1 protein_id gnl|my_center|LOCUS_11060 15379 14141 gene locus_tag LOCUS_11070 gene hemL 15379 14141 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124636.1 protein_id gnl|my_center|LOCUS_11070 16303 15491 gene locus_tag LOCUS_11080 gene xth 16303 15491 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124637.1 protein_id gnl|my_center|LOCUS_11080 16438 16878 gene locus_tag LOCUS_11090 16438 16878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 16894 18351 gene locus_tag LOCUS_11100 16894 18351 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143062.1 protein_id gnl|my_center|LOCUS_11100 18537 18872 gene locus_tag LOCUS_11110 18537 18872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 19004 20326 gene locus_tag LOCUS_11120 19004 20326 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057500.1 protein_id gnl|my_center|LOCUS_11120 21358 20648 gene locus_tag LOCUS_11130 21358 20648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 21824 21363 gene locus_tag LOCUS_11140 21824 21363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 22261 23781 gene locus_tag LOCUS_11150 22261 23781 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056442.1 protein_id gnl|my_center|LOCUS_11150 23983 24726 gene locus_tag LOCUS_11160 23983 24726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 24723 25724 gene locus_tag LOCUS_11170 24723 25724 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057784.1 protein_id gnl|my_center|LOCUS_11170 25717 28935 gene locus_tag LOCUS_11180 25717 28935 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016371.1 protein_id gnl|my_center|LOCUS_11180 28935 32600 gene locus_tag LOCUS_11190 28935 32600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 33097 32795 gene locus_tag LOCUS_11200 33097 32795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 34100 33561 gene locus_tag LOCUS_11210 34100 33561 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_11210 34769 34278 gene locus_tag LOCUS_11220 34769 34278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 36212 34773 gene locus_tag LOCUS_11230 36212 34773 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_11230 36250 37284 gene locus_tag LOCUS_11240 36250 37284 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124295.1 protein_id gnl|my_center|LOCUS_11240 37528 37223 gene locus_tag LOCUS_11250 37528 37223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 38739 37528 gene locus_tag LOCUS_11260 38739 37528 CDS product lipid-A-disaccharide synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124294.1 protein_id gnl|my_center|LOCUS_11260 39235 38774 gene locus_tag LOCUS_11270 39235 38774 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920771.1 protein_id gnl|my_center|LOCUS_11270 39431 39228 gene locus_tag LOCUS_11280 39431 39228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 39352 39927 gene locus_tag LOCUS_11290 39352 39927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 41152 39869 gene locus_tag LOCUS_11300 41152 39869 CDS product bifunctional cobalt-precorrin-7 (C(5))-methyltransferase/cobalt-precorrin-6B (C(15))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125493.1 protein_id gnl|my_center|LOCUS_11300 42268 41168 gene locus_tag LOCUS_11310 42268 41168 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125009.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence19 326 1210 gene locus_tag LOCUS_11320 326 1210 CDS product 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124610.1 protein_id gnl|my_center|LOCUS_11320 1226 2410 gene locus_tag LOCUS_11330 1226 2410 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125162.1 protein_id gnl|my_center|LOCUS_11330 3510 2386 gene locus_tag LOCUS_11340 3510 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 5144 4188 gene locus_tag LOCUS_11350 gene hemC 5144 4188 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124648.1 protein_id gnl|my_center|LOCUS_11350 6172 5222 gene locus_tag LOCUS_11360 6172 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 7256 9493 gene locus_tag LOCUS_11370 gene priA 7256 9493 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124651.1 protein_id gnl|my_center|LOCUS_11370 9835 9533 gene locus_tag LOCUS_11380 9835 9533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 10764 9892 gene locus_tag LOCUS_11390 gene argB 10764 9892 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057248.1 protein_id gnl|my_center|LOCUS_11390 11348 10776 gene locus_tag LOCUS_11400 11348 10776 CDS product DUF2854 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124654.1 protein_id gnl|my_center|LOCUS_11400 11407 11607 gene locus_tag LOCUS_11410 11407 11607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 11756 12058 gene locus_tag LOCUS_11420 11756 12058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 12693 12364 gene locus_tag LOCUS_11430 12693 12364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 12981 14171 gene locus_tag LOCUS_11440 12981 14171 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_11440 14164 14889 gene locus_tag LOCUS_11450 14164 14889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 15450 14983 gene locus_tag LOCUS_11460 15450 14983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 16130 15765 gene locus_tag LOCUS_11470 16130 15765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 17295 16555 gene locus_tag LOCUS_11480 17295 16555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11480 17482 18687 gene locus_tag LOCUS_11490 17482 18687 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932589.1 protein_id gnl|my_center|LOCUS_11490 18684 19241 gene locus_tag LOCUS_11500 18684 19241 CDS product DUF4276 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224619.1 protein_id gnl|my_center|LOCUS_11500 19368 20351 gene locus_tag LOCUS_11510 19368 20351 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232632.1 protein_id gnl|my_center|LOCUS_11510 20362 20817 gene locus_tag LOCUS_11520 20362 20817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 20986 21693 gene locus_tag LOCUS_11530 20986 21693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124702.1 protein_id gnl|my_center|LOCUS_11530 21950 22270 gene locus_tag LOCUS_11540 21950 22270 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006169870.1 protein_id gnl|my_center|LOCUS_11540 22309 23718 gene locus_tag LOCUS_11550 22309 23718 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_11550 23820 24161 gene locus_tag LOCUS_11560 23820 24161 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_11560 24198 26717 gene locus_tag LOCUS_11570 24198 26717 CDS product CsoS2 family carboxysome shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124706.1 protein_id gnl|my_center|LOCUS_11570 26721 28268 gene locus_tag LOCUS_11580 26721 28268 CDS product carboxysome shell carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124707.1 protein_id gnl|my_center|LOCUS_11580 28269 28655 gene locus_tag LOCUS_11590 28269 28655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 28655 28906 gene locus_tag LOCUS_11600 28655 28906 CDS product carboxysome peptide B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124709.1 protein_id gnl|my_center|LOCUS_11600 29241 29062 gene locus_tag LOCUS_11610 29241 29062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 29210 29485 gene locus_tag LOCUS_11620 29210 29485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 29463 29963 gene locus_tag LOCUS_11630 gene bfr 29463 29963 CDS product bacterioferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310955.1 protein_id gnl|my_center|LOCUS_11630 30003 31901 gene locus_tag LOCUS_11640 30003 31901 CDS product NAD(P)H-quinone oxidoreductase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057958.1 protein_id gnl|my_center|LOCUS_11640 31901 33478 gene locus_tag LOCUS_11650 31901 33478 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921221.1 protein_id gnl|my_center|LOCUS_11650 33468 34625 gene locus_tag LOCUS_11660 33468 34625 CDS product CO2 hydration protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057960.1 protein_id gnl|my_center|LOCUS_11660 34630 34911 gene locus_tag LOCUS_11670 34630 34911 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124711.1 protein_id gnl|my_center|LOCUS_11670 34905 36347 gene locus_tag LOCUS_11680 34905 36347 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039073.1 protein_id gnl|my_center|LOCUS_11680 36344 36979 gene locus_tag LOCUS_11690 36344 36979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 37785 37537 gene locus_tag LOCUS_11700 37785 37537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 38325 38254 gene locus_tag LOCUS_t00260 38325 38254 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 39528 38350 gene locus_tag LOCUS_11710 39528 38350 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057305.1 protein_id gnl|my_center|LOCUS_11710 39599 40762 gene locus_tag LOCUS_11720 gene cbiD 39599 40762 CDS product cobalt-precorrin-5B (C(1))-methyltransferase CbiD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124192.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence20 154 1563 gene locus_tag LOCUS_11730 gene glgA 154 1563 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125204.1 protein_id gnl|my_center|LOCUS_11730 2744 1590 gene locus_tag LOCUS_11740 2744 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2989 3987 gene locus_tag LOCUS_11750 gene bciA 2989 3987 CDS product NADPH-dependent 3,8-divinyl protochlorophyllide a 8-vinyl-reductase BciA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932741.1 protein_id gnl|my_center|LOCUS_11750 3966 5510 gene locus_tag LOCUS_11760 gene malQ 3966 5510 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125268.1 protein_id gnl|my_center|LOCUS_11760 6253 5486 gene locus_tag LOCUS_11770 6253 5486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 7586 6438 gene locus_tag LOCUS_11780 gene wecB 7586 6438 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057875.1 protein_id gnl|my_center|LOCUS_11780 7871 7623 gene locus_tag LOCUS_11790 7871 7623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 8910 7849 gene locus_tag LOCUS_11800 gene tsaD 8910 7849 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124623.1 protein_id gnl|my_center|LOCUS_11800 9005 9481 gene locus_tag LOCUS_11810 9005 9481 CDS product photosystem I reaction center subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058243.1 protein_id gnl|my_center|LOCUS_11810 10222 9563 gene locus_tag LOCUS_11820 gene gmk 10222 9563 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055909.1 protein_id gnl|my_center|LOCUS_11820 10862 11050 gene locus_tag LOCUS_11830 10862 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 11293 11781 gene locus_tag LOCUS_11840 11293 11781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 13186 12053 gene locus_tag LOCUS_11850 13186 12053 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088385.1 protein_id gnl|my_center|LOCUS_11850 14475 13195 gene locus_tag LOCUS_11860 14475 13195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 15777 15040 gene locus_tag LOCUS_11870 15777 15040 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125198.1 protein_id gnl|my_center|LOCUS_11870 15793 17370 gene locus_tag LOCUS_11880 15793 17370 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125199.1 protein_id gnl|my_center|LOCUS_11880 17401 17850 gene locus_tag LOCUS_11890 17401 17850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 18192 18632 gene locus_tag LOCUS_11900 18192 18632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 20944 19535 gene locus_tag LOCUS_11910 gene dnaA 20944 19535 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124720.1 protein_id gnl|my_center|LOCUS_11910 21199 20975 gene locus_tag LOCUS_11920 21199 20975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 21469 21272 gene locus_tag LOCUS_11930 21469 21272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 21365 22363 gene locus_tag LOCUS_11940 21365 22363 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056518.1 protein_id gnl|my_center|LOCUS_11940 22424 23065 gene locus_tag LOCUS_11950 22424 23065 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923209.1 protein_id gnl|my_center|LOCUS_11950 23455 23087 gene locus_tag LOCUS_11960 23455 23087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 24174 23482 gene locus_tag LOCUS_11970 24174 23482 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124718.1 protein_id gnl|my_center|LOCUS_11970 24580 24164 gene locus_tag LOCUS_11980 24580 24164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 24464 24799 gene locus_tag LOCUS_11990 24464 24799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 24893 25135 gene locus_tag LOCUS_12000 24893 25135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 25172 25474 gene locus_tag LOCUS_12010 25172 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 25558 26436 gene locus_tag LOCUS_12020 25558 26436 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258385.1 protein_id gnl|my_center|LOCUS_12020 26433 27065 gene locus_tag LOCUS_12030 26433 27065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 27281 27496 gene locus_tag LOCUS_12040 27281 27496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 28723 27593 gene locus_tag LOCUS_12050 28723 27593 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125874.1 protein_id gnl|my_center|LOCUS_12050 28825 29007 gene locus_tag LOCUS_12060 28825 29007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 29299 29463 gene locus_tag LOCUS_12070 29299 29463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 29575 30042 gene locus_tag LOCUS_12080 29575 30042 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390442.1 protein_id gnl|my_center|LOCUS_12080 30279 30061 gene locus_tag LOCUS_12090 30279 30061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 30499 31206 gene locus_tag LOCUS_12100 30499 31206 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_12100 31203 31607 gene locus_tag LOCUS_12110 31203 31607 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920634.1 protein_id gnl|my_center|LOCUS_12110 31649 32053 gene locus_tag LOCUS_12120 31649 32053 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326173.1 protein_id gnl|my_center|LOCUS_12120 32060 32851 gene locus_tag LOCUS_12130 32060 32851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 33165 33803 gene locus_tag LOCUS_12140 33165 33803 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125031.1 protein_id gnl|my_center|LOCUS_12140 33870 34976 gene locus_tag LOCUS_12150 gene gcvT 33870 34976 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126000.1 protein_id gnl|my_center|LOCUS_12150 34992 36254 gene locus_tag LOCUS_12160 gene trpB 34992 36254 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124343.1 protein_id gnl|my_center|LOCUS_12160 36450 38084 gene locus_tag LOCUS_12170 36450 38084 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870191.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence21 558 130 gene locus_tag LOCUS_12180 558 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 841 1068 gene locus_tag LOCUS_12190 841 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1779 1111 gene locus_tag LOCUS_12200 1779 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 2510 1776 gene locus_tag LOCUS_12210 2510 1776 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003346150.1 protein_id gnl|my_center|LOCUS_12210 2837 4012 gene locus_tag LOCUS_12220 2837 4012 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125275.1 protein_id gnl|my_center|LOCUS_12220 4045 5607 gene locus_tag LOCUS_12230 gene zwf 4045 5607 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125276.1 protein_id gnl|my_center|LOCUS_12230 5636 6937 gene locus_tag LOCUS_12240 5636 6937 CDS product glucose-6-phosphate dehydrogenase assembly protein OpcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125277.1 protein_id gnl|my_center|LOCUS_12240 6954 8396 gene locus_tag LOCUS_12250 6954 8396 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125278.1 protein_id gnl|my_center|LOCUS_12250 9304 8357 gene locus_tag LOCUS_12260 9304 8357 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124374.1 protein_id gnl|my_center|LOCUS_12260 10229 9351 gene locus_tag LOCUS_12270 gene ylqF 10229 9351 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124375.1 protein_id gnl|my_center|LOCUS_12270 10615 10283 gene locus_tag LOCUS_12280 10615 10283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 10596 10757 gene locus_tag LOCUS_12290 10596 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 10747 11616 gene locus_tag LOCUS_12300 10747 11616 CDS product TIGR01548 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125744.1 protein_id gnl|my_center|LOCUS_12300 12613 11669 gene locus_tag LOCUS_12310 gene dusA 12613 11669 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124169.1 protein_id gnl|my_center|LOCUS_12310 12734 13243 gene locus_tag LOCUS_12320 gene msrB 12734 13243 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124170.1 protein_id gnl|my_center|LOCUS_12320 13250 13789 gene locus_tag LOCUS_12330 13250 13789 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119093.1 protein_id gnl|my_center|LOCUS_12330 15102 15533 gene locus_tag LOCUS_12340 15102 15533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 16162 15524 gene locus_tag LOCUS_12350 16162 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 16240 17052 gene locus_tag LOCUS_12360 16240 17052 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143673.1 protein_id gnl|my_center|LOCUS_12360 17091 17393 gene locus_tag LOCUS_12370 17091 17393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 17422 18516 gene locus_tag LOCUS_12380 17422 18516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 18656 18474 gene locus_tag LOCUS_12390 gene rpmF 18656 18474 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125133.1 protein_id gnl|my_center|LOCUS_12390 18770 20740 gene locus_tag LOCUS_12400 gene ftsH 18770 20740 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225914010.1 protein_id gnl|my_center|LOCUS_12400 21038 21598 gene locus_tag LOCUS_12410 21038 21598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 23551 21989 gene locus_tag LOCUS_12420 23551 21989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 26480 24453 gene locus_tag LOCUS_12430 26480 24453 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125458.1 protein_id gnl|my_center|LOCUS_12430 27091 26804 gene locus_tag LOCUS_12440 gene rpsN 27091 26804 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125457.1 protein_id gnl|my_center|LOCUS_12440 27581 27411 gene locus_tag LOCUS_12450 gene rpsU 27581 27411 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124743.1 protein_id gnl|my_center|LOCUS_12450 27852 27628 gene locus_tag LOCUS_12460 27852 27628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 28464 27856 gene locus_tag LOCUS_12470 gene def 28464 27856 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124236.1 protein_id gnl|my_center|LOCUS_12470 28538 30415 gene locus_tag LOCUS_12480 28538 30415 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124237.1 protein_id gnl|my_center|LOCUS_12480 30523 30801 gene locus_tag LOCUS_12490 30523 30801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 30747 31079 gene locus_tag LOCUS_12500 30747 31079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 31128 31754 gene locus_tag LOCUS_12510 gene tmk 31128 31754 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124307.1 protein_id gnl|my_center|LOCUS_12510 31761 32738 gene locus_tag LOCUS_12520 31761 32738 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141432.1 protein_id gnl|my_center|LOCUS_12520 33540 32707 gene locus_tag LOCUS_12530 33540 32707 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124305.1 protein_id gnl|my_center|LOCUS_12530 33730 34215 gene locus_tag LOCUS_12540 33730 34215 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124962.1 protein_id gnl|my_center|LOCUS_12540 34872 36665 gene locus_tag LOCUS_12550 34872 36665 CDS product NADPH-dependent assimilatory sulfite reductase hemoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124982.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence22 188 3 gene locus_tag LOCUS_12560 188 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 294 1160 gene locus_tag LOCUS_12570 294 1160 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124161.1 protein_id gnl|my_center|LOCUS_12570 1213 3750 gene locus_tag LOCUS_12580 1213 3750 CDS product DNA topoisomerase 4 subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124160.1 protein_id gnl|my_center|LOCUS_12580 4965 3910 gene locus_tag LOCUS_12590 4965 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 7353 4969 gene locus_tag LOCUS_12600 7353 4969 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124490.1 protein_id gnl|my_center|LOCUS_12600 8404 7391 gene locus_tag LOCUS_12610 8404 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 9141 8416 gene locus_tag LOCUS_12620 9141 8416 CDS product heme oxygenase (biliverdin-producing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920678.1 protein_id gnl|my_center|LOCUS_12620 10550 9465 gene locus_tag LOCUS_12630 gene acsF 10550 9465 CDS product magnesium-protoporphyrin IX monomethyl ester (oxidative) cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920870.1 protein_id gnl|my_center|LOCUS_12630 11094 10705 gene locus_tag LOCUS_12640 11094 10705 CDS product DUF2996 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125143.1 protein_id gnl|my_center|LOCUS_12640 11746 11252 gene locus_tag LOCUS_12650 11746 11252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 12384 11743 gene locus_tag LOCUS_12660 12384 11743 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198405961.1 protein_id gnl|my_center|LOCUS_12660 14969 12381 gene locus_tag LOCUS_12670 gene gyrA 14969 12381 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892286.1 protein_id gnl|my_center|LOCUS_12670 15088 16215 gene locus_tag LOCUS_12680 15088 16215 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143662.1 protein_id gnl|my_center|LOCUS_12680 16248 16667 gene locus_tag LOCUS_12690 16248 16667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 16660 16953 gene locus_tag LOCUS_12700 16660 16953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 17221 17021 gene locus_tag LOCUS_12710 17221 17021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 17353 17748 gene locus_tag LOCUS_12720 17353 17748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 17998 17690 gene locus_tag LOCUS_12730 17998 17690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 18125 19522 gene locus_tag LOCUS_12740 gene trxB 18125 19522 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125397.1 protein_id gnl|my_center|LOCUS_12740 19779 19519 gene locus_tag LOCUS_12750 gene infA 19779 19519 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125398.1 protein_id gnl|my_center|LOCUS_12750 24459 19819 gene locus_tag LOCUS_12760 gene gltB 24459 19819 CDS product glutamate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125817.1 protein_id gnl|my_center|LOCUS_12760 24943 24578 gene locus_tag LOCUS_12770 24943 24578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 24872 26416 gene locus_tag LOCUS_12780 24872 26416 CDS product phosphodiester glycosidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057687.1 protein_id gnl|my_center|LOCUS_12780 26426 26797 gene locus_tag LOCUS_12790 26426 26797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 26836 27210 gene locus_tag LOCUS_12800 gene rpsL 26836 27210 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125816.1 protein_id gnl|my_center|LOCUS_12800 27274 27744 gene locus_tag LOCUS_12810 gene rpsG 27274 27744 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125815.1 protein_id gnl|my_center|LOCUS_12810 27863 29938 gene locus_tag LOCUS_12820 gene fusA 27863 29938 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125814.1 protein_id gnl|my_center|LOCUS_12820 29986 31215 gene locus_tag LOCUS_12830 gene tuf 29986 31215 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125813.1 protein_id gnl|my_center|LOCUS_12830 31346 31666 gene locus_tag LOCUS_12840 gene rpsJ 31346 31666 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006042265.1 protein_id gnl|my_center|LOCUS_12840 31717 32370 gene locus_tag LOCUS_12850 31717 32370 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058292.1 protein_id gnl|my_center|LOCUS_12850 32382 33356 gene locus_tag LOCUS_12860 32382 33356 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057563.1 protein_id gnl|my_center|LOCUS_12860 33498 33247 gene locus_tag LOCUS_12870 33498 33247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 34709 33501 gene locus_tag LOCUS_12880 34709 33501 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125922.1 protein_id gnl|my_center|LOCUS_12880 35236 34709 gene locus_tag LOCUS_12890 35236 34709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 >Feature sequence23 1167 52 gene locus_tag LOCUS_12900 1167 52 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_12900 1329 1604 gene locus_tag LOCUS_12910 1329 1604 CDS product DUF2973 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124263.1 protein_id gnl|my_center|LOCUS_12910 1613 2050 gene locus_tag LOCUS_12920 1613 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124264.1 protein_id gnl|my_center|LOCUS_12920 2364 3311 gene locus_tag LOCUS_12930 2364 3311 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057945.1 protein_id gnl|my_center|LOCUS_12930 3378 3524 gene locus_tag LOCUS_12940 3378 3524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3590 3736 gene locus_tag LOCUS_12950 3590 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 3802 3948 gene locus_tag LOCUS_12960 3802 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 5317 4007 gene locus_tag LOCUS_12970 5317 4007 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125527.1 protein_id gnl|my_center|LOCUS_12970 6502 5321 gene locus_tag LOCUS_12980 6502 5321 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057168.1 protein_id gnl|my_center|LOCUS_12980 6668 6587 gene locus_tag LOCUS_t00270 6668 6587 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8053 6647 gene locus_tag LOCUS_12990 gene murA 8053 6647 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056623.1 protein_id gnl|my_center|LOCUS_12990 8259 8343 gene locus_tag LOCUS_t00280 8259 8343 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8616 9680 gene locus_tag LOCUS_13000 8616 9680 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040240.1 protein_id gnl|my_center|LOCUS_13000 9736 10653 gene locus_tag LOCUS_13010 9736 10653 CDS product proline/glycine betaine ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003343849.1 protein_id gnl|my_center|LOCUS_13010 10616 11683 gene locus_tag LOCUS_13020 10616 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 12129 11911 gene locus_tag LOCUS_13030 12129 11911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124403.1 protein_id gnl|my_center|LOCUS_13030 12538 12248 gene locus_tag LOCUS_13040 12538 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 13259 12591 gene locus_tag LOCUS_13050 13259 12591 CDS product DUF2301 domain-containing membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124404.1 protein_id gnl|my_center|LOCUS_13050 14227 13259 gene locus_tag LOCUS_13060 14227 13259 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124405.1 protein_id gnl|my_center|LOCUS_13060 14335 15456 gene locus_tag LOCUS_13070 14335 15456 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125393.1 protein_id gnl|my_center|LOCUS_13070 15456 15761 gene locus_tag LOCUS_13080 15456 15761 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125392.1 protein_id gnl|my_center|LOCUS_13080 15758 17170 gene locus_tag LOCUS_13090 15758 17170 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125391.1 protein_id gnl|my_center|LOCUS_13090 17241 18182 gene locus_tag LOCUS_13100 17241 18182 CDS product aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124406.1 protein_id gnl|my_center|LOCUS_13100 19821 18211 gene locus_tag LOCUS_13110 19821 18211 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891763.1 protein_id gnl|my_center|LOCUS_13110 20291 20602 gene locus_tag LOCUS_13120 gene clpS 20291 20602 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125804.1 protein_id gnl|my_center|LOCUS_13120 20599 21453 gene locus_tag LOCUS_13130 20599 21453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 21492 22628 gene locus_tag LOCUS_13140 gene dnaJ 21492 22628 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124172.1 protein_id gnl|my_center|LOCUS_13140 22647 22877 gene locus_tag LOCUS_13150 22647 22877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 23258 22911 gene locus_tag LOCUS_13160 23258 22911 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124175.1 protein_id gnl|my_center|LOCUS_13160 24226 23279 gene locus_tag LOCUS_13170 gene murB 24226 23279 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124176.1 protein_id gnl|my_center|LOCUS_13170 25656 24232 gene locus_tag LOCUS_13180 gene murC 25656 24232 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124177.1 protein_id gnl|my_center|LOCUS_13180 25819 26859 gene locus_tag LOCUS_13190 gene gap 25819 26859 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124178.1 protein_id gnl|my_center|LOCUS_13190 27931 26876 gene locus_tag LOCUS_13200 gene thiL 27931 26876 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124179.1 protein_id gnl|my_center|LOCUS_13200 28958 27924 gene locus_tag LOCUS_13210 28958 27924 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124180.1 protein_id gnl|my_center|LOCUS_13210 29230 28940 gene locus_tag LOCUS_13220 29230 28940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 29150 29707 gene locus_tag LOCUS_13230 gene efp 29150 29707 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124181.1 protein_id gnl|my_center|LOCUS_13230 29751 30206 gene locus_tag LOCUS_13240 gene accB 29751 30206 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892082.1 protein_id gnl|my_center|LOCUS_13240 31310 30288 gene locus_tag LOCUS_13250 gene pdxA 31310 30288 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124183.1 protein_id gnl|my_center|LOCUS_13250 31366 32538 gene locus_tag LOCUS_13260 gene mutT 31366 32538 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866391.1 protein_id gnl|my_center|LOCUS_13260 33057 32524 gene locus_tag LOCUS_13270 gene pgsA 33057 32524 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125026.1 protein_id gnl|my_center|LOCUS_13270 33912 33172 gene locus_tag LOCUS_13280 33912 33172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 34074 34355 gene locus_tag LOCUS_13290 34074 34355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 34270 34566 gene locus_tag LOCUS_13300 34270 34566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence24 135 338 gene locus_tag LOCUS_13310 135 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 1161 289 gene locus_tag LOCUS_13320 1161 289 CDS product ATP adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125113.1 protein_id gnl|my_center|LOCUS_13320 2084 1233 gene locus_tag LOCUS_13330 2084 1233 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920665.1 protein_id gnl|my_center|LOCUS_13330 2150 2965 gene locus_tag LOCUS_13340 2150 2965 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103227.1 protein_id gnl|my_center|LOCUS_13340 3429 3028 gene locus_tag LOCUS_13350 3429 3028 CDS product DUF2237 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125357.1 protein_id gnl|my_center|LOCUS_13350 3477 3761 gene locus_tag LOCUS_13360 3477 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125112.1 protein_id gnl|my_center|LOCUS_13360 4245 4877 gene locus_tag LOCUS_13370 4245 4877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 5011 5262 gene locus_tag LOCUS_13380 5011 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 5360 5518 gene locus_tag LOCUS_13390 5360 5518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 6653 6198 gene locus_tag LOCUS_13400 6653 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 6549 7502 gene locus_tag LOCUS_13410 6549 7502 CDS product methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124331.1 protein_id gnl|my_center|LOCUS_13410 8652 7474 gene locus_tag LOCUS_13420 8652 7474 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892127.1 protein_id gnl|my_center|LOCUS_13420 9584 8703 gene locus_tag LOCUS_13430 9584 8703 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124329.1 protein_id gnl|my_center|LOCUS_13430 11253 9625 gene locus_tag LOCUS_13440 11253 9625 CDS product NAD(P)H-quinone oxidoreductase subunit 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124328.1 protein_id gnl|my_center|LOCUS_13440 12808 11657 gene locus_tag LOCUS_13450 gene ruvB 12808 11657 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058086.1 protein_id gnl|my_center|LOCUS_13450 13224 12808 gene locus_tag LOCUS_13460 13224 12808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 13656 14234 gene locus_tag LOCUS_13470 gene moaB 13656 14234 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036101.1 protein_id gnl|my_center|LOCUS_13470 14541 14269 gene locus_tag LOCUS_13480 14541 14269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 16484 14574 gene locus_tag LOCUS_13490 16484 14574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 17968 16724 gene locus_tag LOCUS_13500 17968 16724 CDS product HhoA/HhoB/HtrA family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058268.1 protein_id gnl|my_center|LOCUS_13500 19901 18792 gene locus_tag LOCUS_13510 19901 18792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 21870 21424 gene locus_tag LOCUS_13520 21870 21424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 23264 22701 gene locus_tag LOCUS_13530 23264 22701 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530136.1 protein_id gnl|my_center|LOCUS_13530 23310 24053 gene locus_tag LOCUS_13540 23310 24053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 24046 25305 gene locus_tag LOCUS_13550 24046 25305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 25334 25528 gene locus_tag LOCUS_13560 25334 25528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 26390 25536 gene locus_tag LOCUS_13570 26390 25536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 26813 26421 gene locus_tag LOCUS_13580 26813 26421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 27196 27831 gene locus_tag LOCUS_13590 27196 27831 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058094.1 protein_id gnl|my_center|LOCUS_13590 27921 29333 gene locus_tag LOCUS_13600 27921 29333 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124253.1 protein_id gnl|my_center|LOCUS_13600 29348 30130 gene locus_tag LOCUS_13610 29348 30130 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892153.1 protein_id gnl|my_center|LOCUS_13610 31154 30192 gene locus_tag LOCUS_13620 31154 30192 CDS product NmrA family NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125400.1 protein_id gnl|my_center|LOCUS_13620 31443 31234 gene locus_tag LOCUS_13630 31443 31234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 31945 31649 gene locus_tag LOCUS_13640 31945 31649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 31833 32699 gene locus_tag LOCUS_13650 31833 32699 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125402.1 protein_id gnl|my_center|LOCUS_13650 32732 33262 gene locus_tag LOCUS_13660 gene ilvN 32732 33262 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125403.1 protein_id gnl|my_center|LOCUS_13660 33518 34117 gene locus_tag LOCUS_13670 33518 34117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence25 4278 3358 gene locus_tag LOCUS_13680 4278 3358 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017291357.1 protein_id gnl|my_center|LOCUS_13680 9059 4278 gene locus_tag LOCUS_13690 9059 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 9152 9640 gene locus_tag LOCUS_13700 9152 9640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 9695 10348 gene locus_tag LOCUS_13710 gene hisG 9695 10348 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124715.1 protein_id gnl|my_center|LOCUS_13710 10351 12177 gene locus_tag LOCUS_13720 10351 12177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124716.1 protein_id gnl|my_center|LOCUS_13720 12689 12510 gene locus_tag LOCUS_13730 12689 12510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 13345 12842 gene locus_tag LOCUS_13740 13345 12842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13740 13983 13633 gene locus_tag LOCUS_13750 13983 13633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 15956 13983 gene locus_tag LOCUS_13760 gene gyrB 15956 13983 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125945.1 protein_id gnl|my_center|LOCUS_13760 16129 17076 gene locus_tag LOCUS_13770 gene miaA 16129 17076 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056495.1 protein_id gnl|my_center|LOCUS_13770 17132 17836 gene locus_tag LOCUS_13780 gene infC 17132 17836 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125947.1 protein_id gnl|my_center|LOCUS_13780 17906 18898 gene locus_tag LOCUS_13790 17906 18898 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125948.1 protein_id gnl|my_center|LOCUS_13790 18957 19730 gene locus_tag LOCUS_13800 gene cysE 18957 19730 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125949.1 protein_id gnl|my_center|LOCUS_13800 22607 19758 gene locus_tag LOCUS_13810 gene secA 22607 19758 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125950.1 protein_id gnl|my_center|LOCUS_13810 22803 23288 gene locus_tag LOCUS_13820 22803 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 23403 23332 gene locus_tag LOCUS_t00290 23403 23332 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24835 23900 gene locus_tag LOCUS_13830 24835 23900 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125025.1 protein_id gnl|my_center|LOCUS_13830 24912 25661 gene locus_tag LOCUS_13840 gene hisA 24912 25661 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892343.1 protein_id gnl|my_center|LOCUS_13840 25713 26192 gene locus_tag LOCUS_13850 25713 26192 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055880.1 protein_id gnl|my_center|LOCUS_13850 26189 27859 gene locus_tag LOCUS_13860 26189 27859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 27874 28458 gene locus_tag LOCUS_13870 27874 28458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 28455 29639 gene locus_tag LOCUS_13880 28455 29639 CDS product F420-0:Gamma-glutamyl ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921060.1 protein_id gnl|my_center|LOCUS_13880 29636 30784 gene locus_tag LOCUS_13890 29636 30784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 31471 30722 gene locus_tag LOCUS_13900 31471 30722 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108548.1 protein_id gnl|my_center|LOCUS_13900 31800 32636 gene locus_tag LOCUS_13910 31800 32636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 32661 32906 gene locus_tag LOCUS_13920 32661 32906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence26 137 64 gene locus_tag LOCUS_t00300 137 64 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 247 1260 gene locus_tag LOCUS_13930 247 1260 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125344.1 protein_id gnl|my_center|LOCUS_13930 1267 1470 gene locus_tag LOCUS_13940 1267 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 1790 1518 gene locus_tag LOCUS_13950 gene minE 1790 1518 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124517.1 protein_id gnl|my_center|LOCUS_13950 2667 1801 gene locus_tag LOCUS_13960 gene minD 2667 1801 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124518.1 protein_id gnl|my_center|LOCUS_13960 3443 2721 gene locus_tag LOCUS_13970 gene minC 3443 2721 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124519.1 protein_id gnl|my_center|LOCUS_13970 3501 4196 gene locus_tag LOCUS_13980 gene mtnX 3501 4196 CDS product 2-hydroxy-3-keto-5-methylthiopentenyl-1-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000027474.1 protein_id gnl|my_center|LOCUS_13980 5433 4174 gene locus_tag LOCUS_13990 5433 4174 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328861.1 protein_id gnl|my_center|LOCUS_13990 5650 6297 gene locus_tag LOCUS_14000 5650 6297 CDS product cytochrome b6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056639.1 protein_id gnl|my_center|LOCUS_14000 6360 6842 gene locus_tag LOCUS_14010 gene petD 6360 6842 CDS product cytochrome b6-f complex subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124523.1 protein_id gnl|my_center|LOCUS_14010 8303 6828 gene locus_tag LOCUS_14020 8303 6828 CDS product glycoside hydrolase 100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_14020 8341 9084 gene locus_tag LOCUS_14030 8341 9084 CDS product sucrose-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143827.1 protein_id gnl|my_center|LOCUS_14030 9953 9096 gene locus_tag LOCUS_14040 9953 9096 CDS product DNA-formamidopyrimidine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124525.1 protein_id gnl|my_center|LOCUS_14040 10258 10049 gene locus_tag LOCUS_14050 10258 10049 CDS product photosystem I reaction center subunit IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124526.1 protein_id gnl|my_center|LOCUS_14050 10349 11491 gene locus_tag LOCUS_14060 gene proB 10349 11491 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057952.1 protein_id gnl|my_center|LOCUS_14060 11491 12546 gene locus_tag LOCUS_14070 gene lpxD 11491 12546 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125015.1 protein_id gnl|my_center|LOCUS_14070 12543 13655 gene locus_tag LOCUS_14080 gene leuB 12543 13655 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125014.1 protein_id gnl|my_center|LOCUS_14080 13720 14622 gene locus_tag LOCUS_14090 13720 14622 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_14090 14632 15483 gene locus_tag LOCUS_14100 14632 15483 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099799517.1 protein_id gnl|my_center|LOCUS_14100 15522 16460 gene locus_tag LOCUS_14110 gene accD 15522 16460 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125011.1 protein_id gnl|my_center|LOCUS_14110 17668 16418 gene locus_tag LOCUS_14120 17668 16418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 19023 18520 gene locus_tag LOCUS_14130 19023 18520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 19119 20555 gene locus_tag LOCUS_14140 gene ahcY 19119 20555 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125935.1 protein_id gnl|my_center|LOCUS_14140 20568 21230 gene locus_tag LOCUS_14150 20568 21230 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125934.1 protein_id gnl|my_center|LOCUS_14150 21639 21253 gene locus_tag LOCUS_14160 21639 21253 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125933.1 protein_id gnl|my_center|LOCUS_14160 21862 22908 gene locus_tag LOCUS_14170 21862 22908 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125932.1 protein_id gnl|my_center|LOCUS_14170 22935 23723 gene locus_tag LOCUS_14180 gene mreC 22935 23723 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125931.1 protein_id gnl|my_center|LOCUS_14180 23720 24319 gene locus_tag LOCUS_14190 23720 24319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125930.1 protein_id gnl|my_center|LOCUS_14190 24312 25646 gene locus_tag LOCUS_14200 24312 25646 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920974.1 protein_id gnl|my_center|LOCUS_14200 25718 26587 gene locus_tag LOCUS_14210 25718 26587 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039745.1 protein_id gnl|my_center|LOCUS_14210 26607 28133 gene locus_tag LOCUS_14220 gene lysS 26607 28133 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125928.1 protein_id gnl|my_center|LOCUS_14220 28224 28487 gene locus_tag LOCUS_14230 28224 28487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125927.1 protein_id gnl|my_center|LOCUS_14230 28976 28491 gene locus_tag LOCUS_14240 28976 28491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 29219 28983 gene locus_tag LOCUS_14250 29219 28983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 30239 29226 gene locus_tag LOCUS_14260 gene egtD 30239 29226 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035425.1 protein_id gnl|my_center|LOCUS_14260 31585 30248 gene locus_tag LOCUS_14270 gene egtB 31585 30248 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_14270 31687 32685 gene locus_tag LOCUS_14280 31687 32685 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921231.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence27 720 25 gene locus_tag LOCUS_14290 720 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 771 1133 gene locus_tag LOCUS_14300 771 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1351 2475 gene locus_tag LOCUS_14310 1351 2475 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063891.1 protein_id gnl|my_center|LOCUS_14310 2480 5146 gene locus_tag LOCUS_14320 2480 5146 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870411.1 protein_id gnl|my_center|LOCUS_14320 5961 5668 gene locus_tag LOCUS_14330 5961 5668 CDS product chlororespiratory reduction protein 7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124284.1 protein_id gnl|my_center|LOCUS_14330 6679 5921 gene locus_tag LOCUS_14340 6679 5921 CDS product glutathione S-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124285.1 protein_id gnl|my_center|LOCUS_14340 6740 6949 gene locus_tag LOCUS_14350 6740 6949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 6953 7330 gene locus_tag LOCUS_14360 gene rbfA 6953 7330 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124287.1 protein_id gnl|my_center|LOCUS_14360 7585 8598 gene locus_tag LOCUS_14370 7585 8598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 9649 9017 gene locus_tag LOCUS_14380 gene trmB 9649 9017 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057818.1 protein_id gnl|my_center|LOCUS_14380 10972 9653 gene locus_tag LOCUS_14390 10972 9653 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140828.1 protein_id gnl|my_center|LOCUS_14390 11031 11645 gene locus_tag LOCUS_14400 11031 11645 CDS product DUF3177 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892147.1 protein_id gnl|my_center|LOCUS_14400 11635 11955 gene locus_tag LOCUS_14410 11635 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 12386 12027 gene locus_tag LOCUS_14420 12386 12027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 14054 12444 gene locus_tag LOCUS_14430 gene gpmI 14054 12444 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125737.1 protein_id gnl|my_center|LOCUS_14430 14283 14837 gene locus_tag LOCUS_14440 gene pyrR 14283 14837 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042503000.1 protein_id gnl|my_center|LOCUS_14440 15084 14863 gene locus_tag LOCUS_14450 15084 14863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 16046 15207 gene locus_tag LOCUS_14460 16046 15207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 17683 16061 gene locus_tag LOCUS_14470 17683 16061 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125735.1 protein_id gnl|my_center|LOCUS_14470 18342 17686 gene locus_tag LOCUS_14480 18342 17686 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124365.1 protein_id gnl|my_center|LOCUS_14480 19126 18527 gene locus_tag LOCUS_14490 19126 18527 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124364.1 protein_id gnl|my_center|LOCUS_14490 19523 19131 gene locus_tag LOCUS_14500 19523 19131 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124363.1 protein_id gnl|my_center|LOCUS_14500 20094 19552 gene locus_tag LOCUS_14510 20094 19552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 20297 20139 gene locus_tag LOCUS_14520 20297 20139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 21228 20287 gene locus_tag LOCUS_14530 gene prfB 21228 20287 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152557459.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14530 21115 21327 gene locus_tag LOCUS_14540 21115 21327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 21386 21790 gene locus_tag LOCUS_14550 21386 21790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 21809 22777 gene locus_tag LOCUS_14560 gene gshB 21809 22777 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124358.1 protein_id gnl|my_center|LOCUS_14560 24743 22935 gene locus_tag LOCUS_14570 gene mrdA 24743 22935 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124196.1 protein_id gnl|my_center|LOCUS_14570 25123 24743 gene locus_tag LOCUS_14580 25123 24743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124195.1 protein_id gnl|my_center|LOCUS_14580 26075 25395 gene locus_tag LOCUS_14590 26075 25395 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124297.1 protein_id gnl|my_center|LOCUS_14590 27034 26075 gene locus_tag LOCUS_14600 gene cysK 27034 26075 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140800.1 protein_id gnl|my_center|LOCUS_14600 27209 27760 gene locus_tag LOCUS_14610 27209 27760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 28665 28444 gene locus_tag LOCUS_14620 28665 28444 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125411.1 protein_id gnl|my_center|LOCUS_14620 30164 28710 gene locus_tag LOCUS_14630 30164 28710 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125410.1 protein_id gnl|my_center|LOCUS_14630 30574 30188 gene locus_tag LOCUS_14640 30574 30188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057265.1 protein_id gnl|my_center|LOCUS_14640 30632 31243 gene locus_tag LOCUS_14650 30632 31243 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057142.1 protein_id gnl|my_center|LOCUS_14650 <32706 31289 gene locus_tag LOCUS_14660 <32706 31289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024124637.1:photosystem II reaction center protein CP43 >Feature sequence28 623 138 gene locus_tag LOCUS_14670 623 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4325 1044 gene locus_tag LOCUS_14680 4325 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142960.1 protein_id gnl|my_center|LOCUS_14680 5824 4322 gene locus_tag LOCUS_14690 5824 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142959.1 protein_id gnl|my_center|LOCUS_14690 6323 5829 gene locus_tag LOCUS_14700 6323 5829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 7674 6325 gene locus_tag LOCUS_14710 7674 6325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 8351 7674 gene locus_tag LOCUS_14720 8351 7674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 8961 8353 gene locus_tag LOCUS_14730 8961 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 10727 8961 gene locus_tag LOCUS_14740 10727 8961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 11429 11025 gene locus_tag LOCUS_14750 11429 11025 CDS product DUF3155 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124455.1 protein_id gnl|my_center|LOCUS_14750 11574 12740 gene locus_tag LOCUS_14760 11574 12740 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124456.1 protein_id gnl|my_center|LOCUS_14760 13522 12701 gene locus_tag LOCUS_14770 gene cobS 13522 12701 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866397.1 protein_id gnl|my_center|LOCUS_14770 13521 14642 gene locus_tag LOCUS_14780 gene tgt 13521 14642 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124458.1 protein_id gnl|my_center|LOCUS_14780 15548 14697 gene locus_tag LOCUS_14790 15548 14697 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140652.1 protein_id gnl|my_center|LOCUS_14790 16495 15548 gene locus_tag LOCUS_14800 16495 15548 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124460.1 protein_id gnl|my_center|LOCUS_14800 17927 16593 gene locus_tag LOCUS_14810 17927 16593 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124461.1 protein_id gnl|my_center|LOCUS_14810 18105 18578 gene locus_tag LOCUS_14820 18105 18578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 18644 20257 gene locus_tag LOCUS_14830 18644 20257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039710.1 protein_id gnl|my_center|LOCUS_14830 21135 20275 gene locus_tag LOCUS_14840 21135 20275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 22181 21450 gene locus_tag LOCUS_14850 gene bchM 22181 21450 CDS product magnesium protoporphyrin IX methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124348.1 protein_id gnl|my_center|LOCUS_14850 23986 22193 gene locus_tag LOCUS_14860 23986 22193 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124252.1 protein_id gnl|my_center|LOCUS_14860 24701 24009 gene locus_tag LOCUS_14870 24701 24009 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530139.1 protein_id gnl|my_center|LOCUS_14870 25870 24698 gene locus_tag LOCUS_14880 25870 24698 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920820.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence29 <1 500 gene locus_tag LOCUS_14890 <1 500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_036891794.1:carotene isomerase 625 1371 gene locus_tag LOCUS_14900 625 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 2585 1401 gene locus_tag LOCUS_14910 2585 1401 CDS product NAD(P)H-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124352.1 protein_id gnl|my_center|LOCUS_14910 2987 2721 gene locus_tag LOCUS_14920 2987 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4141 3065 gene locus_tag LOCUS_14930 gene csaB 4141 3065 CDS product polysaccharide pyruvyl transferase CsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140747.1 protein_id gnl|my_center|LOCUS_14930 5372 5611 gene locus_tag LOCUS_14940 5372 5611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 7094 6573 gene locus_tag LOCUS_14950 7094 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 7653 8066 gene locus_tag LOCUS_14960 7653 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 8548 8069 gene locus_tag LOCUS_14970 8548 8069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 9064 10236 gene locus_tag LOCUS_14980 9064 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 10237 10686 gene locus_tag LOCUS_14990 10237 10686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 12002 10788 gene locus_tag LOCUS_15000 12002 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 15608 12261 gene locus_tag LOCUS_15010 15608 12261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 16059 16385 gene locus_tag LOCUS_15020 16059 16385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 16382 16936 gene locus_tag LOCUS_15030 16382 16936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 17559 16987 gene locus_tag LOCUS_15040 17559 16987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 18370 17684 gene locus_tag LOCUS_15050 gene queC 18370 17684 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126004.1 protein_id gnl|my_center|LOCUS_15050 19093 18428 gene locus_tag LOCUS_15060 gene cysC 19093 18428 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124345.1 protein_id gnl|my_center|LOCUS_15060 19470 19144 gene locus_tag LOCUS_15070 19470 19144 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124344.1 protein_id gnl|my_center|LOCUS_15070 19811 19482 gene locus_tag LOCUS_15080 19811 19482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 22533 19864 gene locus_tag LOCUS_15090 gene leuS 22533 19864 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057933.1 protein_id gnl|my_center|LOCUS_15090 23492 23073 gene locus_tag LOCUS_15100 23492 23073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 24421 23708 gene locus_tag LOCUS_15110 24421 23708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 24951 24421 gene locus_tag LOCUS_15120 24951 24421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 25870 24944 gene locus_tag LOCUS_15130 gene era 25870 24944 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125506.1 protein_id gnl|my_center|LOCUS_15130 26047 26589 gene locus_tag LOCUS_15140 26047 26589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928632.1 protein_id gnl|my_center|LOCUS_15140 26815 27408 gene locus_tag LOCUS_15150 26815 27408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence30 1719 844 gene locus_tag LOCUS_15160 1719 844 CDS product NgoMIV family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951140.1 protein_id gnl|my_center|LOCUS_15160 2595 1726 gene locus_tag LOCUS_15170 2595 1726 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228850.1 protein_id gnl|my_center|LOCUS_15170 2657 3163 gene locus_tag LOCUS_15180 2657 3163 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056347.1 protein_id gnl|my_center|LOCUS_15180 4317 3214 gene locus_tag LOCUS_15190 gene prfA 4317 3214 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125832.1 protein_id gnl|my_center|LOCUS_15190 4610 4377 gene locus_tag LOCUS_15200 gene rpmE 4610 4377 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125833.1 protein_id gnl|my_center|LOCUS_15200 5041 4619 gene locus_tag LOCUS_15210 gene rpsI 5041 4619 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125834.1 protein_id gnl|my_center|LOCUS_15210 5487 5044 gene locus_tag LOCUS_15220 gene rplM 5487 5044 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125835.1 protein_id gnl|my_center|LOCUS_15220 6362 5520 gene locus_tag LOCUS_15230 gene truA 6362 5520 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125836.1 protein_id gnl|my_center|LOCUS_15230 6672 6322 gene locus_tag LOCUS_15240 gene rplQ 6672 6322 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055961.1 protein_id gnl|my_center|LOCUS_15240 7690 6716 gene locus_tag LOCUS_15250 7690 6716 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125838.1 protein_id gnl|my_center|LOCUS_15250 8085 7693 gene locus_tag LOCUS_15260 gene rpsK 8085 7693 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125839.1 protein_id gnl|my_center|LOCUS_15260 8514 8149 gene locus_tag LOCUS_15270 gene rpsM 8514 8149 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125840.1 protein_id gnl|my_center|LOCUS_15270 9267 8746 gene locus_tag LOCUS_15280 9267 8746 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125842.1 protein_id gnl|my_center|LOCUS_15280 10649 9321 gene locus_tag LOCUS_15290 gene secY 10649 9321 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125843.1 protein_id gnl|my_center|LOCUS_15290 11043 10711 gene locus_tag LOCUS_15300 11043 10711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 11858 11226 gene locus_tag LOCUS_15310 gene rpsE 11858 11226 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125845.1 protein_id gnl|my_center|LOCUS_15310 12256 11858 gene locus_tag LOCUS_15320 gene rplR 12256 11858 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_15320 12799 12260 gene locus_tag LOCUS_15330 gene rplF 12799 12260 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125847.1 protein_id gnl|my_center|LOCUS_15330 13232 12831 gene locus_tag LOCUS_15340 gene rpsH 13232 12831 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125848.1 protein_id gnl|my_center|LOCUS_15340 13804 13253 gene locus_tag LOCUS_15350 gene rplE 13804 13253 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125849.1 protein_id gnl|my_center|LOCUS_15350 14213 13875 gene locus_tag LOCUS_15360 gene rplX 14213 13875 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152557460.1 protein_id gnl|my_center|LOCUS_15360 14578 14213 gene locus_tag LOCUS_15370 gene rplN 14578 14213 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125851.1 protein_id gnl|my_center|LOCUS_15370 14840 14592 gene locus_tag LOCUS_15380 gene rpsQ 14840 14592 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125852.1 protein_id gnl|my_center|LOCUS_15380 15088 14846 gene locus_tag LOCUS_15390 15088 14846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 15578 15102 gene locus_tag LOCUS_15400 15578 15102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 16327 15593 gene locus_tag LOCUS_15410 gene rpsC 16327 15593 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125855.1 protein_id gnl|my_center|LOCUS_15410 16698 16342 gene locus_tag LOCUS_15420 gene rplV 16698 16342 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125856.1 protein_id gnl|my_center|LOCUS_15420 16986 16711 gene locus_tag LOCUS_15430 gene rpsS 16986 16711 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125857.1 protein_id gnl|my_center|LOCUS_15430 17876 17013 gene locus_tag LOCUS_15440 gene rplB 17876 17013 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125858.1 protein_id gnl|my_center|LOCUS_15440 18193 17888 gene locus_tag LOCUS_15450 18193 17888 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125859.1 protein_id gnl|my_center|LOCUS_15450 18821 18186 gene locus_tag LOCUS_15460 gene rplD 18821 18186 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055937.1 protein_id gnl|my_center|LOCUS_15460 19517 18849 gene locus_tag LOCUS_15470 gene rplC 19517 18849 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125861.1 protein_id gnl|my_center|LOCUS_15470 21219 20989 gene locus_tag LOCUS_15480 21219 20989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 21588 22565 gene locus_tag LOCUS_15490 21588 22565 CDS product phytoene synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892168.1 protein_id gnl|my_center|LOCUS_15490 23023 22562 gene locus_tag LOCUS_15500 23023 22562 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124320.1 protein_id gnl|my_center|LOCUS_15500 24436 23147 gene locus_tag LOCUS_15510 24436 23147 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124319.1 protein_id gnl|my_center|LOCUS_15510 24519 25013 gene locus_tag LOCUS_15520 24519 25013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 24962 25549 gene locus_tag LOCUS_15530 24962 25549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 25554 26285 gene locus_tag LOCUS_15540 25554 26285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 26670 27158 gene locus_tag LOCUS_15550 gene ruvX 26670 27158 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125019.1 protein_id gnl|my_center|LOCUS_15550 27186 27737 gene locus_tag LOCUS_15560 27186 27737 CDS product DUF3727 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125018.1 protein_id gnl|my_center|LOCUS_15560 27737 28294 gene locus_tag LOCUS_15570 27737 28294 CDS product YqeG family HAD IIIA-type phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056346.1 protein_id gnl|my_center|LOCUS_15570 28660 28839 gene locus_tag LOCUS_15580 28660 28839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124975.1 protein_id gnl|my_center|LOCUS_15580 28868 29815 gene locus_tag LOCUS_15590 28868 29815 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124976.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence31 1369 743 gene locus_tag LOCUS_15600 1369 743 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126003.1 protein_id gnl|my_center|LOCUS_15600 3006 1366 gene locus_tag LOCUS_15610 3006 1366 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126002.1 protein_id gnl|my_center|LOCUS_15610 4846 3056 gene locus_tag LOCUS_15620 gene aspS 4846 3056 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126001.1 protein_id gnl|my_center|LOCUS_15620 5868 6818 gene locus_tag LOCUS_15630 5868 6818 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125446.1 protein_id gnl|my_center|LOCUS_15630 7624 6833 gene locus_tag LOCUS_15640 7624 6833 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524138.1 protein_id gnl|my_center|LOCUS_15640 7778 8998 gene locus_tag LOCUS_15650 7778 8998 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125388.1 protein_id gnl|my_center|LOCUS_15650 9194 10027 gene locus_tag LOCUS_15660 9194 10027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 10209 9961 gene locus_tag LOCUS_15670 10209 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 11399 10440 gene locus_tag LOCUS_15680 11399 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 12169 12810 gene locus_tag LOCUS_15690 12169 12810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 12812 14314 gene locus_tag LOCUS_15700 12812 14314 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258690.1 protein_id gnl|my_center|LOCUS_15700 15393 15728 gene locus_tag LOCUS_15710 15393 15728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 15993 15736 gene locus_tag LOCUS_15720 15993 15736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 20090 16068 gene locus_tag LOCUS_15730 20090 16068 CDS product magnesium chelatase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125055.1 protein_id gnl|my_center|LOCUS_15730 23127 20986 gene locus_tag LOCUS_15740 23127 20986 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057023.1 protein_id gnl|my_center|LOCUS_15740 23489 23989 gene locus_tag LOCUS_15750 23489 23989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 23989 25392 gene locus_tag LOCUS_15760 23989 25392 CDS product D-alanyl-D-alanine carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125103.1 protein_id gnl|my_center|LOCUS_15760 26254 25361 gene locus_tag LOCUS_15770 26254 25361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 26755 26276 gene locus_tag LOCUS_15780 gene coaD 26755 26276 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057007.1 protein_id gnl|my_center|LOCUS_15780 27275 27024 gene locus_tag LOCUS_15790 27275 27024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 27183 27431 gene locus_tag LOCUS_15800 27183 27431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence32 152 1585 gene locus_tag LOCUS_15810 gene tig 152 1585 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144179.1 protein_id gnl|my_center|LOCUS_15810 1633 3033 gene locus_tag LOCUS_15820 gene clpX 1633 3033 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125966.1 protein_id gnl|my_center|LOCUS_15820 3023 4849 gene locus_tag LOCUS_15830 3023 4849 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056974.1 protein_id gnl|my_center|LOCUS_15830 6152 4860 gene locus_tag LOCUS_15840 6152 4860 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125968.1 protein_id gnl|my_center|LOCUS_15840 6283 6483 gene locus_tag LOCUS_15850 gene rpmI 6283 6483 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125970.1 protein_id gnl|my_center|LOCUS_15850 6530 6877 gene locus_tag LOCUS_15860 gene rplT 6530 6877 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125971.1 protein_id gnl|my_center|LOCUS_15860 6900 7436 gene locus_tag LOCUS_15870 6900 7436 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125972.1 protein_id gnl|my_center|LOCUS_15870 7450 8271 gene locus_tag LOCUS_15880 7450 8271 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055920.1 protein_id gnl|my_center|LOCUS_15880 8382 8564 gene locus_tag LOCUS_15890 8382 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 8603 9793 gene locus_tag LOCUS_15900 8603 9793 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125975.1 protein_id gnl|my_center|LOCUS_15900 9796 10941 gene locus_tag LOCUS_15910 9796 10941 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125976.1 protein_id gnl|my_center|LOCUS_15910 12883 11798 gene locus_tag LOCUS_15920 12883 11798 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125445.1 protein_id gnl|my_center|LOCUS_15920 13264 13004 gene locus_tag LOCUS_15930 13264 13004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 14520 13264 gene locus_tag LOCUS_15940 14520 13264 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124549.1 protein_id gnl|my_center|LOCUS_15940 15341 14532 gene locus_tag LOCUS_15950 gene recO 15341 14532 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124550.1 protein_id gnl|my_center|LOCUS_15950 16076 15354 gene locus_tag LOCUS_15960 gene deoC 16076 15354 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056922.1 protein_id gnl|my_center|LOCUS_15960 16663 16073 gene locus_tag LOCUS_15970 gene raiA 16663 16073 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124552.1 protein_id gnl|my_center|LOCUS_15970 16723 17403 gene locus_tag LOCUS_15980 gene lipB 16723 17403 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124553.1 protein_id gnl|my_center|LOCUS_15980 17375 19384 gene locus_tag LOCUS_15990 17375 19384 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923202.1 protein_id gnl|my_center|LOCUS_15990 19619 19933 gene locus_tag LOCUS_16000 19619 19933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 20304 20804 gene locus_tag LOCUS_16010 20304 20804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 21243 21479 gene locus_tag LOCUS_16020 21243 21479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 21995 23158 gene locus_tag LOCUS_16030 21995 23158 CDS product DNA repair exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124855.1 protein_id gnl|my_center|LOCUS_16030 23199 25880 gene locus_tag LOCUS_16040 23199 25880 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124854.1 protein_id gnl|my_center|LOCUS_16040 26471 27052 gene locus_tag LOCUS_16050 26471 27052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 27598 27873 gene locus_tag LOCUS_16060 27598 27873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 >Feature sequence33 <1 2369 gene locus_tag LOCUS_16070 <1 2369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256730.1:N-6 DNA methylase 2979 3440 gene locus_tag LOCUS_16080 2979 3440 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125862.1 protein_id gnl|my_center|LOCUS_16080 3445 4473 gene locus_tag LOCUS_16090 3445 4473 CDS product LdpA C-terminal domain-containing domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866389.1 protein_id gnl|my_center|LOCUS_16090 4686 6095 gene locus_tag LOCUS_16100 4686 6095 CDS product R3H domain-containing nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041244518.1 protein_id gnl|my_center|LOCUS_16100 6124 6195 gene locus_tag LOCUS_t00310 6124 6195 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6214 6813 gene locus_tag LOCUS_16110 6214 6813 CDS product phycobiliprotein lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141191.1 protein_id gnl|my_center|LOCUS_16110 6906 7667 gene locus_tag LOCUS_16120 6906 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 7814 8995 gene locus_tag LOCUS_16130 7814 8995 CDS product DUF4912 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124243.1 protein_id gnl|my_center|LOCUS_16130 9027 9227 gene locus_tag LOCUS_16140 9027 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 9512 9231 gene locus_tag LOCUS_16150 9512 9231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16150 10273 9527 gene locus_tag LOCUS_16160 10273 9527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16160 10392 12107 gene locus_tag LOCUS_16170 10392 12107 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125265.1 protein_id gnl|my_center|LOCUS_16170 12132 12602 gene locus_tag LOCUS_16180 12132 12602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 13322 12780 gene locus_tag LOCUS_16190 13322 12780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 15253 13349 gene locus_tag LOCUS_16200 15253 13349 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126032.1 protein_id gnl|my_center|LOCUS_16200 15579 17333 gene locus_tag LOCUS_16210 15579 17333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16210 17018 17027 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 18802 17324 gene locus_tag LOCUS_16220 18802 17324 CDS product cytochrome P450 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289154.1 protein_id gnl|my_center|LOCUS_16220 19675 19370 gene locus_tag LOCUS_16230 19675 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 20296 20108 gene locus_tag LOCUS_16240 20296 20108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 21062 20910 gene locus_tag LOCUS_16250 21062 20910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 21285 22400 gene locus_tag LOCUS_16260 21285 22400 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_16260 22517 23143 gene locus_tag LOCUS_16270 22517 23143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 23412 23630 gene locus_tag LOCUS_16280 23412 23630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 25977 23704 gene locus_tag LOCUS_16290 25977 23704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 26466 26227 gene locus_tag LOCUS_16300 26466 26227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 26867 26562 gene locus_tag LOCUS_16310 26867 26562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence34 1538 690 gene locus_tag LOCUS_16320 1538 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 2159 1542 gene locus_tag LOCUS_16330 2159 1542 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056726.1 protein_id gnl|my_center|LOCUS_16330 2201 3148 gene locus_tag LOCUS_16340 2201 3148 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124282.1 protein_id gnl|my_center|LOCUS_16340 3155 3856 gene locus_tag LOCUS_16350 3155 3856 CDS product RibD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124281.1 protein_id gnl|my_center|LOCUS_16350 3853 4221 gene locus_tag LOCUS_16360 gene ndhM 3853 4221 CDS product NAD(P)H-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124323.1 protein_id gnl|my_center|LOCUS_16360 4228 4830 gene locus_tag LOCUS_16370 4228 4830 CDS product DUF3172 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923256.1 protein_id gnl|my_center|LOCUS_16370 5800 4805 gene locus_tag LOCUS_16380 5800 4805 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124325.1 protein_id gnl|my_center|LOCUS_16380 5909 7918 gene locus_tag LOCUS_16390 5909 7918 CDS product NAD(P)H-quinone oxidoreductase subunit 5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124327.1 protein_id gnl|my_center|LOCUS_16390 8054 8386 gene locus_tag LOCUS_16400 8054 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 9021 8614 gene locus_tag LOCUS_16410 9021 8614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 9335 9018 gene locus_tag LOCUS_16420 9335 9018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 11183 9894 gene locus_tag LOCUS_16430 11183 9894 CDS product SufS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057903.1 protein_id gnl|my_center|LOCUS_16430 12469 11180 gene locus_tag LOCUS_16440 12469 11180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 13230 12466 gene locus_tag LOCUS_16450 gene sufC 13230 12466 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057741.1 protein_id gnl|my_center|LOCUS_16450 14786 13344 gene locus_tag LOCUS_16460 gene sufB 14786 13344 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056341.1 protein_id gnl|my_center|LOCUS_16460 15157 14804 gene locus_tag LOCUS_16470 15157 14804 CDS product ferredoxin-thioredoxin reductase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055968.1 protein_id gnl|my_center|LOCUS_16470 15276 15932 gene locus_tag LOCUS_16480 15276 15932 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707347.1 protein_id gnl|my_center|LOCUS_16480 16363 15956 gene locus_tag LOCUS_16490 16363 15956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 17386 16844 gene locus_tag LOCUS_16500 17386 16844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 17550 18734 gene locus_tag LOCUS_16510 17550 18734 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337850.1 protein_id gnl|my_center|LOCUS_16510 18888 19655 gene locus_tag LOCUS_16520 18888 19655 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384138.1 protein_id gnl|my_center|LOCUS_16520 19674 20384 gene locus_tag LOCUS_16530 19674 20384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720082.1 protein_id gnl|my_center|LOCUS_16530 20498 21562 gene locus_tag LOCUS_16540 20498 21562 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337851.1 protein_id gnl|my_center|LOCUS_16540 21559 22923 gene locus_tag LOCUS_16550 21559 22923 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337852.1 protein_id gnl|my_center|LOCUS_16550 22953 24344 gene locus_tag LOCUS_16560 gene pds 22953 24344 CDS product 15-cis-phytoene desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124322.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence35 4 4800 gene locus_tag LOCUS_16570 4 4800 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102960.1 protein_id gnl|my_center|LOCUS_16570 6334 4946 gene locus_tag LOCUS_16580 6334 4946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 7418 6876 gene locus_tag LOCUS_16590 7418 6876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 8725 7415 gene locus_tag LOCUS_16600 8725 7415 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258559.1 protein_id gnl|my_center|LOCUS_16600 8851 9060 gene locus_tag LOCUS_16610 8851 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 9097 9480 gene locus_tag LOCUS_16620 9097 9480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 9528 10331 gene locus_tag LOCUS_16630 9528 10331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 10997 10410 gene locus_tag LOCUS_16640 10997 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 12390 11077 gene locus_tag LOCUS_16650 12390 11077 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125187.1 protein_id gnl|my_center|LOCUS_16650 12499 12993 gene locus_tag LOCUS_16660 12499 12993 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125188.1 protein_id gnl|my_center|LOCUS_16660 14086 12914 gene locus_tag LOCUS_16670 14086 12914 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892385.1 protein_id gnl|my_center|LOCUS_16670 14700 14182 gene locus_tag LOCUS_16680 gene apcB 14700 14182 CDS product allophycocyanin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057869.1 protein_id gnl|my_center|LOCUS_16680 14908 16329 gene locus_tag LOCUS_16690 gene glnA 14908 16329 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125190.1 protein_id gnl|my_center|LOCUS_16690 17718 16333 gene locus_tag LOCUS_16700 gene glmM 17718 16333 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013191710.1 protein_id gnl|my_center|LOCUS_16700 17921 19744 gene locus_tag LOCUS_16710 17921 19744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 20138 19674 gene locus_tag LOCUS_16720 20138 19674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 20635 20192 gene locus_tag LOCUS_16730 20635 20192 CDS product NIL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057637.1 protein_id gnl|my_center|LOCUS_16730 20711 21250 gene locus_tag LOCUS_16740 20711 21250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 21639 21995 gene locus_tag LOCUS_16750 21639 21995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 23305 22835 gene locus_tag LOCUS_16760 23305 22835 CDS product DUF3531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125177.1 protein_id gnl|my_center|LOCUS_16760 23338 23964 gene locus_tag LOCUS_16770 23338 23964 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125178.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence36 840 1790 gene locus_tag LOCUS_16780 840 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 3768 4865 gene locus_tag LOCUS_16790 gene trpD 3768 4865 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124896.1 protein_id gnl|my_center|LOCUS_16790 4885 6051 gene locus_tag LOCUS_16800 gene carA 4885 6051 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124897.1 protein_id gnl|my_center|LOCUS_16800 6295 7620 gene locus_tag LOCUS_16810 6295 7620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 7681 7920 gene locus_tag LOCUS_16820 7681 7920 CDS product DUF1816 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124901.1 protein_id gnl|my_center|LOCUS_16820 7994 9475 gene locus_tag LOCUS_16830 gene gatA 7994 9475 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124902.1 protein_id gnl|my_center|LOCUS_16830 9526 9882 gene locus_tag LOCUS_16840 9526 9882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 9905 10342 gene locus_tag LOCUS_16850 9905 10342 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124399.1 protein_id gnl|my_center|LOCUS_16850 10352 12802 gene locus_tag LOCUS_16860 10352 12802 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124400.1 protein_id gnl|my_center|LOCUS_16860 13995 12796 gene locus_tag LOCUS_16870 13995 12796 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406250.1 protein_id gnl|my_center|LOCUS_16870 14048 16015 gene locus_tag LOCUS_16880 14048 16015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 16099 16425 gene locus_tag LOCUS_16890 16099 16425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 16547 17671 gene locus_tag LOCUS_16900 16547 17671 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866399.1 protein_id gnl|my_center|LOCUS_16900 18279 17701 gene locus_tag LOCUS_16910 18279 17701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 19401 18580 gene locus_tag LOCUS_16920 19401 18580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 20110 19406 gene locus_tag LOCUS_16930 20110 19406 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058294.1 protein_id gnl|my_center|LOCUS_16930 22569 20110 gene locus_tag LOCUS_16940 gene recG 22569 20110 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056582.1 protein_id gnl|my_center|LOCUS_16940 23477 22566 gene locus_tag LOCUS_16950 23477 22566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence37 1890 2204 gene locus_tag LOCUS_16960 1890 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 3631 2630 gene locus_tag LOCUS_16970 3631 2630 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039744.1 protein_id gnl|my_center|LOCUS_16970 5037 3664 gene locus_tag LOCUS_16980 5037 3664 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125907.1 protein_id gnl|my_center|LOCUS_16980 5240 7771 gene locus_tag LOCUS_16990 5240 7771 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125908.1 protein_id gnl|my_center|LOCUS_16990 8001 7768 gene locus_tag LOCUS_17000 8001 7768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 8325 8068 gene locus_tag LOCUS_17010 8325 8068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 9182 8706 gene locus_tag LOCUS_17020 9182 8706 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125280.1 protein_id gnl|my_center|LOCUS_17020 10085 9189 gene locus_tag LOCUS_17030 10085 9189 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125281.1 protein_id gnl|my_center|LOCUS_17030 11092 10187 gene locus_tag LOCUS_17040 gene folD 11092 10187 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125282.1 protein_id gnl|my_center|LOCUS_17040 11312 13291 gene locus_tag LOCUS_17050 11312 13291 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892411.1 protein_id gnl|my_center|LOCUS_17050 14157 13303 gene locus_tag LOCUS_17060 14157 13303 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057222.1 protein_id gnl|my_center|LOCUS_17060 15134 15451 gene locus_tag LOCUS_17070 15134 15451 CDS product DUF2499 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057277.1 protein_id gnl|my_center|LOCUS_17070 15451 15777 gene locus_tag LOCUS_17080 15451 15777 CDS product DUF3593 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144013.1 protein_id gnl|my_center|LOCUS_17080 15880 16140 gene locus_tag LOCUS_17090 gene psaK 15880 16140 CDS product photosystem I reaction center subunit PsaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921012.1 protein_id gnl|my_center|LOCUS_17090 18126 16210 gene locus_tag LOCUS_17100 gene dxs 18126 16210 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125080.1 protein_id gnl|my_center|LOCUS_17100 18268 18714 gene locus_tag LOCUS_17110 18268 18714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17110 18750 19760 gene locus_tag LOCUS_17120 18750 19760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17120 19814 19890 gene locus_tag LOCUS_t00320 19814 19890 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 21280 19898 gene locus_tag LOCUS_17130 21280 19898 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124556.1 protein_id gnl|my_center|LOCUS_17130 21367 21948 gene locus_tag LOCUS_17140 21367 21948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 21948 22667 gene locus_tag LOCUS_17150 21948 22667 CDS product DUF3386 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125333.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence38 316 801 gene locus_tag LOCUS_17160 316 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 860 1516 gene locus_tag LOCUS_17170 860 1516 CDS product ParB-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707381.1 protein_id gnl|my_center|LOCUS_17170 2368 1484 gene locus_tag LOCUS_17180 2368 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 3603 2374 gene locus_tag LOCUS_17190 3603 2374 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530038.1 protein_id gnl|my_center|LOCUS_17190 3943 3590 gene locus_tag LOCUS_17200 gene trxA 3943 3590 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191795.1 protein_id gnl|my_center|LOCUS_17200 4645 5475 gene locus_tag LOCUS_17210 4645 5475 CDS product IS5-like element ISVch5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019370.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17210 6846 5998 gene locus_tag LOCUS_17220 6846 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 6962 7240 gene locus_tag LOCUS_17230 6962 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 8590 7301 gene locus_tag LOCUS_17240 8590 7301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 8943 8587 gene locus_tag LOCUS_17250 8943 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 10499 9240 gene locus_tag LOCUS_17260 10499 9240 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124354.1 protein_id gnl|my_center|LOCUS_17260 11509 10517 gene locus_tag LOCUS_17270 11509 10517 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057016.1 protein_id gnl|my_center|LOCUS_17270 12424 11513 gene locus_tag LOCUS_17280 gene menA 12424 11513 CDS product 2-carboxy-1,4-naphthoquinone phytyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124356.1 protein_id gnl|my_center|LOCUS_17280 12585 13934 gene locus_tag LOCUS_17290 12585 13934 CDS product isochorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124357.1 protein_id gnl|my_center|LOCUS_17290 15143 13956 gene locus_tag LOCUS_17300 gene dnaN 15143 13956 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124156.1 protein_id gnl|my_center|LOCUS_17300 15579 16856 gene locus_tag LOCUS_17310 15579 16856 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390982.1 protein_id gnl|my_center|LOCUS_17310 17071 16835 gene locus_tag LOCUS_17320 17071 16835 CDS product DUF3148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530158.1 protein_id gnl|my_center|LOCUS_17320 17153 17719 gene locus_tag LOCUS_17330 17153 17719 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406022.1 protein_id gnl|my_center|LOCUS_17330 17724 18224 gene locus_tag LOCUS_17340 17724 18224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 18221 19864 gene locus_tag LOCUS_17350 18221 19864 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056847.1 protein_id gnl|my_center|LOCUS_17350 20860 20294 gene locus_tag LOCUS_17360 gene rpsD 20860 20294 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124564.1 protein_id gnl|my_center|LOCUS_17360 21018 21278 gene locus_tag LOCUS_17370 gene yidD 21018 21278 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001886301.1 protein_id gnl|my_center|LOCUS_17370 21275 21574 gene locus_tag LOCUS_17380 21275 21574 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124566.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence39 2344 1148 gene locus_tag LOCUS_17390 gene moeB 2344 1148 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058235.1 protein_id gnl|my_center|LOCUS_17390 2916 2341 gene locus_tag LOCUS_17400 2916 2341 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125872.1 protein_id gnl|my_center|LOCUS_17400 3030 3335 gene locus_tag LOCUS_17410 3030 3335 CDS product CAAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125871.1 protein_id gnl|my_center|LOCUS_17410 3816 6587 gene locus_tag LOCUS_17420 3816 6587 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124388.1 protein_id gnl|my_center|LOCUS_17420 6888 6619 gene locus_tag LOCUS_17430 6888 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 6946 7581 gene locus_tag LOCUS_17440 gene nusG 6946 7581 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124386.1 protein_id gnl|my_center|LOCUS_17440 7646 8071 gene locus_tag LOCUS_17450 gene rplK 7646 8071 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124385.1 protein_id gnl|my_center|LOCUS_17450 8164 8877 gene locus_tag LOCUS_17460 gene rplA 8164 8877 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124384.1 protein_id gnl|my_center|LOCUS_17460 9072 9692 gene locus_tag LOCUS_17470 gene rplJ 9072 9692 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124383.1 protein_id gnl|my_center|LOCUS_17470 9750 10139 gene locus_tag LOCUS_17480 gene rplL 9750 10139 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124382.1 protein_id gnl|my_center|LOCUS_17480 10337 11083 gene locus_tag LOCUS_17490 10337 11083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 11128 12300 gene locus_tag LOCUS_17500 11128 12300 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124380.1 protein_id gnl|my_center|LOCUS_17500 13433 13831 gene locus_tag LOCUS_17510 13433 13831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 13806 14690 gene locus_tag LOCUS_17520 13806 14690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 14693 15103 gene locus_tag LOCUS_17530 14693 15103 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921451.1 protein_id gnl|my_center|LOCUS_17530 15201 16247 gene locus_tag LOCUS_17540 15201 16247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 16251 16976 gene locus_tag LOCUS_17550 16251 16976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 16960 17685 gene locus_tag LOCUS_17560 16960 17685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 17736 17960 gene locus_tag LOCUS_17570 17736 17960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 18663 17932 gene locus_tag LOCUS_17580 18663 17932 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124326.1 protein_id gnl|my_center|LOCUS_17580 19648 18881 gene locus_tag LOCUS_17590 19648 18881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124377.1 protein_id gnl|my_center|LOCUS_17590 >Feature sequence40 293 1513 gene locus_tag LOCUS_17600 293 1513 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124503.1 protein_id gnl|my_center|LOCUS_17600 1729 3123 gene locus_tag LOCUS_17610 1729 3123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17610 3393 3683 gene locus_tag LOCUS_17620 3393 3683 CDS product DUF2470 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125332.1 protein_id gnl|my_center|LOCUS_17620 3734 4450 gene locus_tag LOCUS_17630 3734 4450 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388495.1 protein_id gnl|my_center|LOCUS_17630 4495 4569 gene locus_tag LOCUS_t00330 4495 4569 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4608 5468 gene locus_tag LOCUS_17640 4608 5468 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045599099.1 protein_id gnl|my_center|LOCUS_17640 7926 5545 gene locus_tag LOCUS_17650 7926 5545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 8195 8701 gene locus_tag LOCUS_17660 8195 8701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 10126 8618 gene locus_tag LOCUS_17670 10126 8618 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124371.1 protein_id gnl|my_center|LOCUS_17670 11457 10123 gene locus_tag LOCUS_17680 11457 10123 CDS product four-carbon acid sugar kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140919.1 protein_id gnl|my_center|LOCUS_17680 11532 12671 gene locus_tag LOCUS_17690 11532 12671 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057501.1 protein_id gnl|my_center|LOCUS_17690 13492 12632 gene locus_tag LOCUS_17700 13492 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 13558 14313 gene locus_tag LOCUS_17710 13558 14313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124639.1 protein_id gnl|my_center|LOCUS_17710 15462 14335 gene locus_tag LOCUS_17720 gene ald 15462 14335 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125750.1 protein_id gnl|my_center|LOCUS_17720 16483 15503 gene locus_tag LOCUS_17730 gene glyQ 16483 15503 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125419.1 protein_id gnl|my_center|LOCUS_17730 16541 16789 gene locus_tag LOCUS_17740 16541 16789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 16889 17596 gene locus_tag LOCUS_17750 gene tpiA 16889 17596 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125053.1 protein_id gnl|my_center|LOCUS_17750 17643 19190 gene locus_tag LOCUS_17760 17643 19190 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256229.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence41 1528 293 gene locus_tag LOCUS_17770 gene recA 1528 293 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125865.1 protein_id gnl|my_center|LOCUS_17770 2296 1541 gene locus_tag LOCUS_17780 2296 1541 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125864.1 protein_id gnl|my_center|LOCUS_17780 4365 2332 gene locus_tag LOCUS_17790 4365 2332 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125961.1 protein_id gnl|my_center|LOCUS_17790 5313 4384 gene locus_tag LOCUS_17800 gene dapA 5313 4384 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125962.1 protein_id gnl|my_center|LOCUS_17800 6383 5310 gene locus_tag LOCUS_17810 6383 5310 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524132.1 protein_id gnl|my_center|LOCUS_17810 6661 6948 gene locus_tag LOCUS_17820 6661 6948 CDS product PipX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124545.1 protein_id gnl|my_center|LOCUS_17820 7024 7764 gene locus_tag LOCUS_17830 7024 7764 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140704.1 protein_id gnl|my_center|LOCUS_17830 7876 8472 gene locus_tag LOCUS_17840 7876 8472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 8505 9314 gene locus_tag LOCUS_17850 gene proC 8505 9314 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124548.1 protein_id gnl|my_center|LOCUS_17850 9973 9356 gene locus_tag LOCUS_17860 gene plsY 9973 9356 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125559.1 protein_id gnl|my_center|LOCUS_17860 10885 9977 gene locus_tag LOCUS_17870 10885 9977 CDS product DUF3086 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125558.1 protein_id gnl|my_center|LOCUS_17870 11294 10896 gene locus_tag LOCUS_17880 11294 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 12097 11342 gene locus_tag LOCUS_17890 12097 11342 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125556.1 protein_id gnl|my_center|LOCUS_17890 13496 12126 gene locus_tag LOCUS_17900 13496 12126 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125555.1 protein_id gnl|my_center|LOCUS_17900 13498 13570 gene locus_tag LOCUS_t00340 13498 13570 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 15636 13624 gene locus_tag LOCUS_17910 15636 13624 CDS product isoamylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052039698.1 protein_id gnl|my_center|LOCUS_17910 15756 16451 gene locus_tag LOCUS_17920 15756 16451 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125553.1 protein_id gnl|my_center|LOCUS_17920 16639 16935 gene locus_tag LOCUS_17930 16639 16935 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125552.1 protein_id gnl|my_center|LOCUS_17930 17210 16932 gene locus_tag LOCUS_17940 17210 16932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 17415 17903 gene locus_tag LOCUS_17950 17415 17903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 17938 18735 gene locus_tag LOCUS_17960 17938 18735 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244437.1 protein_id gnl|my_center|LOCUS_17960 19037 18807 gene locus_tag LOCUS_17970 19037 18807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence42 2 331 gene locus_tag LOCUS_17980 2 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 3523 713 gene locus_tag LOCUS_17990 gene gcvP 3523 713 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125978.1 protein_id gnl|my_center|LOCUS_17990 3782 3711 gene locus_tag LOCUS_t00350 3782 3711 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3867 3786 gene locus_tag LOCUS_t00360 3867 3786 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 3940 4689 gene locus_tag LOCUS_18000 gene cobI 3940 4689 CDS product precorrin-2 C(20)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124541.1 protein_id gnl|my_center|LOCUS_18000 4809 6056 gene locus_tag LOCUS_18010 4809 6056 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141544.1 protein_id gnl|my_center|LOCUS_18010 6247 6456 gene locus_tag LOCUS_18020 6247 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 8128 6761 gene locus_tag LOCUS_18030 8128 6761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 8355 8152 gene locus_tag LOCUS_18040 8355 8152 CDS product NAD(P)H dehydrogenase subunit NdhS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125912.1 protein_id gnl|my_center|LOCUS_18040 9157 8384 gene locus_tag LOCUS_18050 9157 8384 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124585.1 protein_id gnl|my_center|LOCUS_18050 10693 9161 gene locus_tag LOCUS_18060 10693 9161 CDS product NAD(P)H-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124586.1 protein_id gnl|my_center|LOCUS_18060 10932 13565 gene locus_tag LOCUS_18070 gene topA 10932 13565 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057718.1 protein_id gnl|my_center|LOCUS_18070 13562 14110 gene locus_tag LOCUS_18080 13562 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 14107 14784 gene locus_tag LOCUS_18090 14107 14784 CDS product DUF2232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036891708.1 protein_id gnl|my_center|LOCUS_18090 14781 16628 gene locus_tag LOCUS_18100 gene recQ 14781 16628 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529051.1 protein_id gnl|my_center|LOCUS_18100 16634 17122 gene locus_tag LOCUS_18110 16634 17122 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058266.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence43 173 1045 gene locus_tag LOCUS_18120 gene hslO 173 1045 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125179.1 protein_id gnl|my_center|LOCUS_18120 1706 1032 gene locus_tag LOCUS_18130 1706 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 2180 5719 gene locus_tag LOCUS_18140 gene mfd 2180 5719 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056796.1 protein_id gnl|my_center|LOCUS_18140 5819 6250 gene locus_tag LOCUS_18150 5819 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 6267 6340 gene locus_tag LOCUS_t00370 6267 6340 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8388 7663 gene locus_tag LOCUS_18160 gene pgl 8388 7663 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124996.1 protein_id gnl|my_center|LOCUS_18160 9794 8376 gene locus_tag LOCUS_18170 gene gndA 9794 8376 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124995.1 protein_id gnl|my_center|LOCUS_18170 11222 9879 gene locus_tag LOCUS_18180 11222 9879 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124994.1 protein_id gnl|my_center|LOCUS_18180 12545 11238 gene locus_tag LOCUS_18190 12545 11238 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124993.1 protein_id gnl|my_center|LOCUS_18190 13596 12577 gene locus_tag LOCUS_18200 gene glpX 13596 12577 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124992.1 protein_id gnl|my_center|LOCUS_18200 13736 14419 gene locus_tag LOCUS_18210 gene rpe 13736 14419 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058202.1 protein_id gnl|my_center|LOCUS_18210 14763 14446 gene locus_tag LOCUS_18220 14763 14446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 15677 14745 gene locus_tag LOCUS_18230 gene ccsB 15677 14745 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165438633.1 protein_id gnl|my_center|LOCUS_18230 >Feature sequence44 504 1046 gene locus_tag LOCUS_18240 gene moaC 504 1046 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975566.1 protein_id gnl|my_center|LOCUS_18240 2544 1837 gene locus_tag LOCUS_18250 2544 1837 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125773.1 protein_id gnl|my_center|LOCUS_18250 3722 2541 gene locus_tag LOCUS_18260 3722 2541 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125772.1 protein_id gnl|my_center|LOCUS_18260 3812 4690 gene locus_tag LOCUS_18270 gene rsmH 3812 4690 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124351.1 protein_id gnl|my_center|LOCUS_18270 6535 4775 gene locus_tag LOCUS_18280 6535 4775 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057660.1 protein_id gnl|my_center|LOCUS_18280 6606 8189 gene locus_tag LOCUS_18290 gene metG 6606 8189 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125122.1 protein_id gnl|my_center|LOCUS_18290 8179 9345 gene locus_tag LOCUS_18300 8179 9345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 11121 9394 gene locus_tag LOCUS_18310 11121 9394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 12260 11724 gene locus_tag LOCUS_18320 12260 11724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 13414 12257 gene locus_tag LOCUS_18330 13414 12257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 14681 13533 gene locus_tag LOCUS_18340 14681 13533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 15297 15641 gene locus_tag LOCUS_18350 15297 15641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18350 >Feature sequence45 593 802 gene locus_tag LOCUS_18360 593 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 1137 1370 gene locus_tag LOCUS_18370 1137 1370 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141485.1 protein_id gnl|my_center|LOCUS_18370 1610 3505 gene locus_tag LOCUS_18380 gene htpG 1610 3505 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125086.1 protein_id gnl|my_center|LOCUS_18380 4405 3569 gene locus_tag LOCUS_18390 4405 3569 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141322.1 protein_id gnl|my_center|LOCUS_18390 4781 4413 gene locus_tag LOCUS_18400 4781 4413 CDS product 2Fe-2S iron-sulfur cluster binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057493.1 protein_id gnl|my_center|LOCUS_18400 4859 4946 gene locus_tag LOCUS_t00380 4859 4946 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5216 5623 gene locus_tag LOCUS_18410 5216 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5804 6142 gene locus_tag LOCUS_18420 5804 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 7505 6333 gene locus_tag LOCUS_18430 7505 6333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 8683 7670 gene locus_tag LOCUS_18440 8683 7670 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124313.1 protein_id gnl|my_center|LOCUS_18440 9959 8721 gene locus_tag LOCUS_18450 gene plsX 9959 8721 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124312.1 protein_id gnl|my_center|LOCUS_18450 10946 10092 gene locus_tag LOCUS_18460 10946 10092 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524184.1 protein_id gnl|my_center|LOCUS_18460 11265 12527 gene locus_tag LOCUS_18470 gene radA 11265 12527 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142401.1 protein_id gnl|my_center|LOCUS_18470 14601 12709 gene locus_tag LOCUS_18480 14601 12709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 >Feature sequence46 400 537 gene locus_tag LOCUS_18490 400 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 2457 1348 gene locus_tag LOCUS_18500 gene aroB 2457 1348 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125161.1 protein_id gnl|my_center|LOCUS_18500 2657 2439 gene locus_tag LOCUS_18510 2657 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 2596 3369 gene locus_tag LOCUS_18520 2596 3369 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056604.1 protein_id gnl|my_center|LOCUS_18520 3370 4542 gene locus_tag LOCUS_18530 3370 4542 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125160.1 protein_id gnl|my_center|LOCUS_18530 5034 4750 gene locus_tag LOCUS_18540 5034 4750 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125069.1 protein_id gnl|my_center|LOCUS_18540 5460 5131 gene locus_tag LOCUS_18550 5460 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 5673 5837 gene locus_tag LOCUS_18560 5673 5837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 6203 5886 gene locus_tag LOCUS_18570 6203 5886 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125063.1 protein_id gnl|my_center|LOCUS_18570 6469 6230 gene locus_tag LOCUS_18580 6469 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 6902 8050 gene locus_tag LOCUS_18590 6902 8050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 8106 8180 gene locus_tag LOCUS_t00390 8106 8180 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8344 9852 gene locus_tag LOCUS_18600 8344 9852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 10937 9888 gene locus_tag LOCUS_18610 10937 9888 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143959.1 protein_id gnl|my_center|LOCUS_18610 11598 11026 gene locus_tag LOCUS_18620 gene cobU 11598 11026 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056947.1 protein_id gnl|my_center|LOCUS_18620 12760 11600 gene locus_tag LOCUS_18630 12760 11600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 13430 12774 gene locus_tag LOCUS_18640 13430 12774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 13934 13524 gene locus_tag LOCUS_18650 13934 13524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 >Feature sequence47 543 1850 gene locus_tag LOCUS_18660 543 1850 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125223.1 protein_id gnl|my_center|LOCUS_18660 1875 2285 gene locus_tag LOCUS_18670 1875 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 2282 2668 gene locus_tag LOCUS_18680 2282 2668 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125222.1 protein_id gnl|my_center|LOCUS_18680 2738 3529 gene locus_tag LOCUS_18690 2738 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 4682 3588 gene locus_tag LOCUS_18700 4682 3588 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125192.1 protein_id gnl|my_center|LOCUS_18700 6891 4816 gene locus_tag LOCUS_18710 6891 4816 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011129373.1 protein_id gnl|my_center|LOCUS_18710 7845 7072 gene locus_tag LOCUS_18720 gene rsmG 7845 7072 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125779.1 protein_id gnl|my_center|LOCUS_18720 8572 7850 gene locus_tag LOCUS_18730 8572 7850 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144380.1 protein_id gnl|my_center|LOCUS_18730 8599 9267 gene locus_tag LOCUS_18740 8599 9267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 10403 9681 gene locus_tag LOCUS_18750 10403 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18750 12876 10477 gene locus_tag LOCUS_18760 12876 10477 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124308.1 protein_id gnl|my_center|LOCUS_18760 12906 13451 gene locus_tag LOCUS_18770 12906 13451 CDS product photosystem I assembly protein Ycf3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057365.1 protein_id gnl|my_center|LOCUS_18770 13494 13967 gene locus_tag LOCUS_18780 13494 13967 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124353.1 protein_id gnl|my_center|LOCUS_18780 14246 13995 gene locus_tag LOCUS_18790 14246 13995 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008278.1 protein_id gnl|my_center|LOCUS_18790 14359 14540 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctcaacgaaggccggggccgaaaccccagcgacac >Feature sequence48 418 113 gene locus_tag LOCUS_18800 gene gatC 418 113 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124420.1 protein_id gnl|my_center|LOCUS_18800 1232 459 gene locus_tag LOCUS_18810 1232 459 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124419.1 protein_id gnl|my_center|LOCUS_18810 1323 1649 gene locus_tag LOCUS_18820 1323 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143670.1 protein_id gnl|my_center|LOCUS_18820 1853 1716 gene locus_tag LOCUS_18830 1853 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 1906 2568 gene locus_tag LOCUS_18840 1906 2568 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866396.1 protein_id gnl|my_center|LOCUS_18840 2631 3587 gene locus_tag LOCUS_18850 2631 3587 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124417.1 protein_id gnl|my_center|LOCUS_18850 6563 5181 gene locus_tag LOCUS_18860 6563 5181 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125603.1 protein_id gnl|my_center|LOCUS_18860 6614 7777 gene locus_tag LOCUS_18870 6614 7777 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124280.1 protein_id gnl|my_center|LOCUS_18870 7807 8190 gene locus_tag LOCUS_18880 7807 8190 CDS product DUF4346 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124278.1 protein_id gnl|my_center|LOCUS_18880 9329 8400 gene locus_tag LOCUS_18890 9329 8400 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125613.1 protein_id gnl|my_center|LOCUS_18890 9522 10283 gene locus_tag LOCUS_18900 gene msrA 9522 10283 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124892.1 protein_id gnl|my_center|LOCUS_18900 10425 10643 gene locus_tag LOCUS_18910 10425 10643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 11549 10962 gene locus_tag LOCUS_18920 11549 10962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 12541 11549 gene locus_tag LOCUS_18930 12541 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 11736 11745 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12622 12840 gene locus_tag LOCUS_18940 12622 12840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18940 13226 13435 gene locus_tag LOCUS_18950 13226 13435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18950 >Feature sequence49 1054 1539 gene locus_tag LOCUS_18960 1054 1539 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125105.1 protein_id gnl|my_center|LOCUS_18960 1529 3493 gene locus_tag LOCUS_18970 gene uvrC 1529 3493 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057590.1 protein_id gnl|my_center|LOCUS_18970 5234 4317 gene locus_tag LOCUS_18980 5234 4317 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124421.1 protein_id gnl|my_center|LOCUS_18980 5532 7262 gene locus_tag LOCUS_18990 5532 7262 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124397.1 protein_id gnl|my_center|LOCUS_18990 7830 7384 gene locus_tag LOCUS_19000 7830 7384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 7943 7861 gene locus_tag LOCUS_t00400 7943 7861 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8058 9665 gene locus_tag LOCUS_19010 8058 9665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 10079 11176 gene locus_tag LOCUS_19020 10079 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 11226 12383 gene locus_tag LOCUS_19030 11226 12383 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056757.1 protein_id gnl|my_center|LOCUS_19030 12579 13259 gene locus_tag LOCUS_19040 12579 13259 CDS product DUF1995 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142786.1 protein_id gnl|my_center|LOCUS_19040 >Feature sequence50 677 3376 gene locus_tag LOCUS_19050 677 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 4950 6758 gene locus_tag LOCUS_19060 gene lepA 4950 6758 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124574.1 protein_id gnl|my_center|LOCUS_19060 7952 6840 gene locus_tag LOCUS_19070 7952 6840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19070 8309 9157 gene locus_tag LOCUS_19080 8309 9157 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_19080 9231 11009 gene locus_tag LOCUS_19090 9231 11009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 12100 11033 gene locus_tag LOCUS_19100 12100 11033 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125033.1 protein_id gnl|my_center|LOCUS_19100 12185 12412 gene locus_tag LOCUS_19110 12185 12412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 12864 13046 gene locus_tag LOCUS_19120 12864 13046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19120 >Feature sequence51 145 1611 gene locus_tag LOCUS_19130 145 1611 CDS product anthranilate synthase component I family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126005.1 protein_id gnl|my_center|LOCUS_19130 1608 2444 gene locus_tag LOCUS_19140 1608 2444 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126006.1 protein_id gnl|my_center|LOCUS_19140 4486 2552 gene locus_tag LOCUS_19150 gene dnaK 4486 2552 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126020.1 protein_id gnl|my_center|LOCUS_19150 4608 5510 gene locus_tag LOCUS_19160 4608 5510 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056438.1 protein_id gnl|my_center|LOCUS_19160 5538 6029 gene locus_tag LOCUS_19170 5538 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126022.1 protein_id gnl|my_center|LOCUS_19170 6094 6510 gene locus_tag LOCUS_19180 6094 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7700 6501 gene locus_tag LOCUS_19190 7700 6501 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126024.1 protein_id gnl|my_center|LOCUS_19190 7932 7705 gene locus_tag LOCUS_19200 7932 7705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 7993 8262 gene locus_tag LOCUS_19210 7993 8262 CDS product DUF3134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126026.1 protein_id gnl|my_center|LOCUS_19210 8316 9425 gene locus_tag LOCUS_19220 gene mraY 8316 9425 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126027.1 protein_id gnl|my_center|LOCUS_19220 9441 9692 gene locus_tag LOCUS_19230 9441 9692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 10107 10325 gene locus_tag LOCUS_19240 10107 10325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19240 11933 10338 gene locus_tag LOCUS_19250 gene guaA 11933 10338 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058250.1 protein_id gnl|my_center|LOCUS_19250 12835 12164 gene locus_tag LOCUS_19260 12835 12164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 >Feature sequence52 97 1632 gene locus_tag LOCUS_19270 gene purH 97 1632 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124453.1 protein_id gnl|my_center|LOCUS_19270 1705 2166 gene locus_tag LOCUS_19280 1705 2166 CDS product DUF4079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057333.1 protein_id gnl|my_center|LOCUS_19280 3401 2172 gene locus_tag LOCUS_19290 3401 2172 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056884.1 protein_id gnl|my_center|LOCUS_19290 5043 3577 gene locus_tag LOCUS_19300 5043 3577 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124450.1 protein_id gnl|my_center|LOCUS_19300 5986 5207 gene locus_tag LOCUS_19310 gene sfsA 5986 5207 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124449.1 protein_id gnl|my_center|LOCUS_19310 6036 7706 gene locus_tag LOCUS_19320 gene murJ 6036 7706 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124448.1 protein_id gnl|my_center|LOCUS_19320 7993 7733 gene locus_tag LOCUS_19330 7993 7733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 8303 8046 gene locus_tag LOCUS_19340 8303 8046 CDS product 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124446.1 protein_id gnl|my_center|LOCUS_19340 8445 8520 gene locus_tag LOCUS_t00410 8445 8520 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8646 9905 gene locus_tag LOCUS_19350 8646 9905 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124445.1 protein_id gnl|my_center|LOCUS_19350 9963 11159 gene locus_tag LOCUS_19360 9963 11159 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057962.1 protein_id gnl|my_center|LOCUS_19360 11149 12444 gene locus_tag LOCUS_19370 11149 12444 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073594983.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence53 270 106 gene locus_tag LOCUS_19380 270 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 391 1212 gene locus_tag LOCUS_19390 gene sppA 391 1212 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125447.1 protein_id gnl|my_center|LOCUS_19390 1209 1592 gene locus_tag LOCUS_19400 gene aroH 1209 1592 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142699.1 protein_id gnl|my_center|LOCUS_19400 1832 2311 gene locus_tag LOCUS_19410 1832 2311 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125451.1 protein_id gnl|my_center|LOCUS_19410 2304 2798 gene locus_tag LOCUS_19420 2304 2798 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125452.1 protein_id gnl|my_center|LOCUS_19420 2869 4125 gene locus_tag LOCUS_19430 gene yidC 2869 4125 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125453.1 protein_id gnl|my_center|LOCUS_19430 4135 5643 gene locus_tag LOCUS_19440 4135 5643 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125454.1 protein_id gnl|my_center|LOCUS_19440 5882 6661 gene locus_tag LOCUS_19450 5882 6661 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125784.1 protein_id gnl|my_center|LOCUS_19450 6985 7197 gene locus_tag LOCUS_19460 6985 7197 CDS product DUF2997 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125783.1 protein_id gnl|my_center|LOCUS_19460 7213 7599 gene locus_tag LOCUS_19470 7213 7599 CDS product DUF1257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125782.1 protein_id gnl|my_center|LOCUS_19470 7592 8002 gene locus_tag LOCUS_19480 7592 8002 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125781.1 protein_id gnl|my_center|LOCUS_19480 9003 9191 gene locus_tag LOCUS_19490 9003 9191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 9362 9547 gene locus_tag LOCUS_19500 9362 9547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 10703 10359 gene locus_tag LOCUS_19510 10703 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 11330 10884 gene locus_tag LOCUS_19520 11330 10884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 11593 11399 gene locus_tag LOCUS_19530 11593 11399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 11671 11910 gene locus_tag LOCUS_19540 11671 11910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 >Feature sequence54 817 188 gene locus_tag LOCUS_19550 817 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 2000 831 gene locus_tag LOCUS_19560 2000 831 CDS product iron-containing alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125260.1 protein_id gnl|my_center|LOCUS_19560 4571 2022 gene locus_tag LOCUS_19570 4571 2022 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125259.1 protein_id gnl|my_center|LOCUS_19570 4713 6101 gene locus_tag LOCUS_19580 gene lysA 4713 6101 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125257.1 protein_id gnl|my_center|LOCUS_19580 6125 7009 gene locus_tag LOCUS_19590 gene cdaA 6125 7009 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125256.1 protein_id gnl|my_center|LOCUS_19590 7010 7798 gene locus_tag LOCUS_19600 gene uppS 7010 7798 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920928.1 protein_id gnl|my_center|LOCUS_19600 7857 8888 gene locus_tag LOCUS_19610 gene bioB 7857 8888 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125254.1 protein_id gnl|my_center|LOCUS_19610 10134 9067 gene locus_tag LOCUS_19620 10134 9067 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_19620 10787 10155 gene locus_tag LOCUS_19630 10787 10155 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_19630 >Feature sequence55 554 1324 gene locus_tag LOCUS_19640 554 1324 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254716.1 protein_id gnl|my_center|LOCUS_19640 1721 1422 gene locus_tag LOCUS_19650 1721 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 3367 2108 gene locus_tag LOCUS_19660 3367 2108 CDS product lycopene cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124942.1 protein_id gnl|my_center|LOCUS_19660 3687 3424 gene locus_tag LOCUS_19670 gene rpmB 3687 3424 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058293.1 protein_id gnl|my_center|LOCUS_19670 4132 3719 gene locus_tag LOCUS_19680 4132 3719 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124292.1 protein_id gnl|my_center|LOCUS_19680 4911 4183 gene locus_tag LOCUS_19690 4911 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 6853 5147 gene locus_tag LOCUS_19700 6853 5147 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124672.1 protein_id gnl|my_center|LOCUS_19700 7476 6994 gene locus_tag LOCUS_19710 7476 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 9016 7559 gene locus_tag LOCUS_19720 9016 7559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 9208 10233 gene locus_tag LOCUS_19730 9208 10233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 10302 11117 gene locus_tag LOCUS_19740 10302 11117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_19740 11492 11220 gene locus_tag LOCUS_19750 11492 11220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 >Feature sequence56 1273 317 gene locus_tag LOCUS_19760 1273 317 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125937.1 protein_id gnl|my_center|LOCUS_19760 1497 1910 gene locus_tag LOCUS_19770 1497 1910 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258478.1 protein_id gnl|my_center|LOCUS_19770 2113 2388 gene locus_tag LOCUS_19780 2113 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 2530 3942 gene locus_tag LOCUS_19790 gene murD 2530 3942 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055928.1 protein_id gnl|my_center|LOCUS_19790 4030 4428 gene locus_tag LOCUS_19800 gene psbU 4030 4428 CDS product photosystem II complex extrinsic protein PsbU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058241.1 protein_id gnl|my_center|LOCUS_19800 4478 6136 gene locus_tag LOCUS_19810 gene nadB 4478 6136 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058240.1 protein_id gnl|my_center|LOCUS_19810 6504 6190 gene locus_tag LOCUS_19820 6504 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 7755 6616 gene locus_tag LOCUS_19830 7755 6616 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124275.1 protein_id gnl|my_center|LOCUS_19830 8757 7936 gene locus_tag LOCUS_19840 8757 7936 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142640.1 protein_id gnl|my_center|LOCUS_19840 8884 10194 gene locus_tag LOCUS_19850 gene rimO 8884 10194 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057404.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence57 1196 171 gene locus_tag LOCUS_19860 gene trpS 1196 171 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125215.1 protein_id gnl|my_center|LOCUS_19860 1747 1196 gene locus_tag LOCUS_19870 1747 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19870 1925 2827 gene locus_tag LOCUS_19880 1925 2827 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921125.1 protein_id gnl|my_center|LOCUS_19880 2858 3673 gene locus_tag LOCUS_19890 2858 3673 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125211.1 protein_id gnl|my_center|LOCUS_19890 3673 4527 gene locus_tag LOCUS_19900 3673 4527 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058215.1 protein_id gnl|my_center|LOCUS_19900 4659 5738 gene locus_tag LOCUS_19910 gene psbA 4659 5738 CDS product photosystem II q(b) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057317.1 protein_id gnl|my_center|LOCUS_19910 6413 5826 gene locus_tag LOCUS_19920 6413 5826 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124647.1 protein_id gnl|my_center|LOCUS_19920 6853 6488 gene locus_tag LOCUS_19930 6853 6488 CDS product DUF760 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125208.1 protein_id gnl|my_center|LOCUS_19930 7439 6855 gene locus_tag LOCUS_19940 gene lepB 7439 6855 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125207.1 protein_id gnl|my_center|LOCUS_19940 7545 9413 gene locus_tag LOCUS_19950 gene menD 7545 9413 CDS product 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125206.1 protein_id gnl|my_center|LOCUS_19950 9352 10245 gene locus_tag LOCUS_19960 gene menB 9352 10245 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193328871.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence58 186 851 gene locus_tag LOCUS_19970 186 851 CDS product photosystem I assembly protein Ycf4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125405.1 protein_id gnl|my_center|LOCUS_19970 881 1573 gene locus_tag LOCUS_19980 881 1573 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055992.1 protein_id gnl|my_center|LOCUS_19980 1600 3039 gene locus_tag LOCUS_19990 1600 3039 CDS product YcjX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537795.1 protein_id gnl|my_center|LOCUS_19990 3491 4396 gene locus_tag LOCUS_20000 3491 4396 CDS product TIGR01620 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338325.1 protein_id gnl|my_center|LOCUS_20000 4853 4518 gene locus_tag LOCUS_20010 4853 4518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 6730 6029 gene locus_tag LOCUS_20020 6730 6029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 7205 6714 gene locus_tag LOCUS_20030 7205 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 7647 7240 gene locus_tag LOCUS_20040 7647 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 7934 7746 gene locus_tag LOCUS_20050 7934 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 8936 7956 gene locus_tag LOCUS_20060 8936 7956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 9396 9878 gene locus_tag LOCUS_20070 9396 9878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 >Feature sequence59 1134 820 gene locus_tag LOCUS_20080 1134 820 CDS product urease subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056185.1 protein_id gnl|my_center|LOCUS_20080 1473 1171 gene locus_tag LOCUS_20090 gene ureA 1473 1171 CDS product urease subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056825.1 protein_id gnl|my_center|LOCUS_20090 2294 1476 gene locus_tag LOCUS_20100 2294 1476 CDS product urease accessory protein UreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056386.1 protein_id gnl|my_center|LOCUS_20100 2870 3736 gene locus_tag LOCUS_20110 2870 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 5081 3825 gene locus_tag LOCUS_20120 5081 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 5599 5252 gene locus_tag LOCUS_20130 5599 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 6113 6361 gene locus_tag LOCUS_20140 6113 6361 CDS product Ycf34 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058288.1 protein_id gnl|my_center|LOCUS_20140 6391 7035 gene locus_tag LOCUS_20150 gene tsaB 6391 7035 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124317.1 protein_id gnl|my_center|LOCUS_20150 7032 7610 gene locus_tag LOCUS_20160 7032 7610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 8283 7564 gene locus_tag LOCUS_20170 8283 7564 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055897.1 protein_id gnl|my_center|LOCUS_20170 9179 8280 gene locus_tag LOCUS_20180 gene fabD 9179 8280 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124314.1 protein_id gnl|my_center|LOCUS_20180 >Feature sequence60 875 2026 gene locus_tag LOCUS_20190 gene mnmA 875 2026 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125516.1 protein_id gnl|my_center|LOCUS_20190 2049 2124 gene locus_tag LOCUS_t00420 2049 2124 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3814 2156 gene locus_tag LOCUS_20200 3814 2156 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124245.1 protein_id gnl|my_center|LOCUS_20200 4011 4271 gene locus_tag LOCUS_20210 4011 4271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5302 4289 gene locus_tag LOCUS_20220 gene fmt 5302 4289 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198406043.1 protein_id gnl|my_center|LOCUS_20220 6681 5314 gene locus_tag LOCUS_20230 6681 5314 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125148.1 protein_id gnl|my_center|LOCUS_20230 8173 6686 gene locus_tag LOCUS_20240 8173 6686 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036892364.1 protein_id gnl|my_center|LOCUS_20240 >Feature sequence61 1511 924 gene locus_tag LOCUS_20250 gene rimM 1511 924 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125913.1 protein_id gnl|my_center|LOCUS_20250 1648 1905 gene locus_tag LOCUS_20260 1648 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125228.1 protein_id gnl|my_center|LOCUS_20260 1930 3543 gene locus_tag LOCUS_20270 1930 3543 CDS product CocE/NonD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125229.1 protein_id gnl|my_center|LOCUS_20270 3760 3548 gene locus_tag LOCUS_20280 3760 3548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 3677 5899 gene locus_tag LOCUS_20290 gene glgB 3677 5899 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125230.1 protein_id gnl|my_center|LOCUS_20290 5963 7018 gene locus_tag LOCUS_20300 gene hemE 5963 7018 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125231.1 protein_id gnl|my_center|LOCUS_20300 7054 8058 gene locus_tag LOCUS_20310 7054 8058 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125232.1 protein_id gnl|my_center|LOCUS_20310 8111 8467 gene locus_tag LOCUS_20320 gene petE 8111 8467 CDS product plastocyanin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125233.1 protein_id gnl|my_center|LOCUS_20320 >Feature sequence62 265 86 gene locus_tag LOCUS_20330 265 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20330 2265 394 gene locus_tag LOCUS_20340 gene ftsH 2265 394 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125489.1 protein_id gnl|my_center|LOCUS_20340 3456 2290 gene locus_tag LOCUS_20350 gene ribD 3456 2290 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125490.1 protein_id gnl|my_center|LOCUS_20350 5927 3456 gene locus_tag LOCUS_20360 5927 3456 CDS product GH116 family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099797719.1 protein_id gnl|my_center|LOCUS_20360 6533 5946 gene locus_tag LOCUS_20370 6533 5946 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124515.1 protein_id gnl|my_center|LOCUS_20370 7402 6530 gene locus_tag LOCUS_20380 gene prmC 7402 6530 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124514.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence63 699 94 gene locus_tag LOCUS_20390 699 94 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124494.1 protein_id gnl|my_center|LOCUS_20390 1000 782 gene locus_tag LOCUS_20400 1000 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 1570 1076 gene locus_tag LOCUS_20410 1570 1076 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141189.1 protein_id gnl|my_center|LOCUS_20410 2339 1632 gene locus_tag LOCUS_20420 2339 1632 CDS product bleomycin hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141190.1 protein_id gnl|my_center|LOCUS_20420 2414 2644 gene locus_tag LOCUS_20430 2414 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2693 3319 gene locus_tag LOCUS_20440 2693 3319 CDS product allophycocyanin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141254.1 protein_id gnl|my_center|LOCUS_20440 4567 3341 gene locus_tag LOCUS_20450 4567 3341 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124376.1 protein_id gnl|my_center|LOCUS_20450 5751 6386 gene locus_tag LOCUS_20460 5751 6386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 6626 6465 gene locus_tag LOCUS_20470 6626 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 >Feature sequence64 1960 1187 gene locus_tag LOCUS_20480 1960 1187 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124505.1 protein_id gnl|my_center|LOCUS_20480 3217 1991 gene locus_tag LOCUS_20490 3217 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20490 3704 3240 gene locus_tag LOCUS_20500 gene nrdR 3704 3240 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057698.1 protein_id gnl|my_center|LOCUS_20500 4073 3891 gene locus_tag LOCUS_20510 4073 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 5565 4003 gene locus_tag LOCUS_20520 gene psbB 5565 4003 CDS product photosystem II chlorophyll-binding protein CP47 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057370.1 protein_id gnl|my_center|LOCUS_20520 5779 6237 gene locus_tag LOCUS_20530 5779 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 6941 6591 gene locus_tag LOCUS_20540 6941 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 7438 6938 gene locus_tag LOCUS_20550 gene sodN 7438 6938 CDS product superoxide dismutase, Ni inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973716.1 protein_id gnl|my_center|LOCUS_20550 >Feature sequence65 <1 5135 gene locus_tag LOCUS_20560 <1 5135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257272.1:Calx-beta domain-containing protein 5229 6062 gene locus_tag LOCUS_20570 5229 6062 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124250.1 protein_id gnl|my_center|LOCUS_20570 6062 6844 gene locus_tag LOCUS_20580 6062 6844 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124249.1 protein_id gnl|my_center|LOCUS_20580 7252 6854 gene locus_tag LOCUS_20590 gene bcp 7252 6854 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124248.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence66 376 113 gene locus_tag LOCUS_20600 376 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 541 723 gene locus_tag LOCUS_20610 541 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 2133 730 gene locus_tag LOCUS_20620 2133 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 2357 3535 gene locus_tag LOCUS_20630 gene hemH 2357 3535 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124679.1 protein_id gnl|my_center|LOCUS_20630 3744 5516 gene locus_tag LOCUS_20640 gene ilvB 3744 5516 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124680.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence67 484 1167 gene locus_tag LOCUS_20650 484 1167 CDS product cofactor assembly of complex C subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144297.1 protein_id gnl|my_center|LOCUS_20650 2363 1176 gene locus_tag LOCUS_20660 2363 1176 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390215.1 protein_id gnl|my_center|LOCUS_20660 2981 2697 gene locus_tag LOCUS_20670 2981 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 4778 3084 gene locus_tag LOCUS_20680 4778 3084 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124960.1 protein_id gnl|my_center|LOCUS_20680 5159 4884 gene locus_tag LOCUS_20690 5159 4884 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056827.1 protein_id gnl|my_center|LOCUS_20690 >Feature sequence68 <1 1343 gene locus_tag LOCUS_20700 <1 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011124567.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 1726 1382 gene locus_tag LOCUS_20710 1726 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 2969 1761 gene locus_tag LOCUS_20720 2969 1761 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124568.1 protein_id gnl|my_center|LOCUS_20720 4071 3247 gene locus_tag LOCUS_20730 4071 3247 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124289.1 protein_id gnl|my_center|LOCUS_20730 4642 4061 gene locus_tag LOCUS_20740 gene purE 4642 4061 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258176.1 protein_id gnl|my_center|LOCUS_20740 >Feature sequence69 132 1310 gene locus_tag LOCUS_20750 132 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124347.1 protein_id gnl|my_center|LOCUS_20750 3554 1332 gene locus_tag LOCUS_20760 gene ppk1 3554 1332 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126011.1 protein_id gnl|my_center|LOCUS_20760 4898 3621 gene locus_tag LOCUS_20770 4898 3621 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126010.1 protein_id gnl|my_center|LOCUS_20770 >Feature sequence70 <1 735 gene locus_tag LOCUS_20780 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125806.1:TIGR03960 family B12-binding radical SAM protein 950 3007 gene locus_tag LOCUS_20790 950 3007 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056445.1 protein_id gnl|my_center|LOCUS_20790 2970 3686 gene locus_tag LOCUS_20800 2970 3686 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125808.1 protein_id gnl|my_center|LOCUS_20800 4544 4356 gene locus_tag LOCUS_20810 4544 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 >Feature sequence71 3957 3034 gene locus_tag LOCUS_20820 gene lipA 3957 3034 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125251.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence72 2029 3264 gene locus_tag LOCUS_20830 2029 3264 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057937.1 protein_id gnl|my_center|LOCUS_20830 >Feature sequence73 <1 3767 gene locus_tag LOCUS_20840 <1 3767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016361986.1:Calx-beta domain-containing protein >Feature sequence74 2863 1409 gene locus_tag LOCUS_20850 gene argH 2863 1409 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056221.1 protein_id gnl|my_center|LOCUS_20850 3334 3603 gene locus_tag LOCUS_20860 3334 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence75 550 104 gene locus_tag LOCUS_20870 550 104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 >Feature sequence76 >Feature sequence77 2742 2669 gene locus_tag LOCUS_t00430 2742 2669 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2826 2750 gene locus_tag LOCUS_t00440 2826 2750 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence78 >Feature sequence79 <1 568 gene locus_tag LOCUS_20880 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125914.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase 549 1574 gene locus_tag LOCUS_20890 549 1574 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940611.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence80 3 785 gene locus_tag LOCUS_20900 3 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20900 887 1837 gene locus_tag LOCUS_20910 887 1837 CDS product RpoD/SigA family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125514.1 protein_id gnl|my_center|LOCUS_20910 1945 2901 gene locus_tag LOCUS_20920 1945 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 >Feature sequence81 340 95 gene locus_tag LOCUS_20930 340 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20930 759 487 gene locus_tag LOCUS_20940 759 487 CDS product DUF3288 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124895.1 protein_id gnl|my_center|LOCUS_20940 887 2665 gene locus_tag LOCUS_20950 887 2665 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124894.1 protein_id gnl|my_center|LOCUS_20950 >Feature sequence82 782 1219 gene locus_tag LOCUS_20960 782 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 1434 1637 gene locus_tag LOCUS_20970 1434 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2596 1754 gene locus_tag LOCUS_20980 2596 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 >Feature sequence83 <2583 1 gene locus_tag LOCUS_20990 <2583 1 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268673.1:glycosyl hydrolase family 28-related protein >Feature sequence84 2004 2420 gene locus_tag LOCUS_21000 2004 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 >Feature sequence85 407 1609 gene locus_tag LOCUS_21010 407 1609 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530160.1 protein_id gnl|my_center|LOCUS_21010 1937 2230 gene locus_tag LOCUS_21020 1937 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020