>Feature sequence01 240 1043 gene locus_tag LOCUS_00010 gene cas6 240 1043 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_00010 1040 1543 gene locus_tag LOCUS_00020 1040 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1572 2855 gene locus_tag LOCUS_00030 1572 2855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2852 4018 gene locus_tag LOCUS_00040 2852 4018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4023 4805 gene locus_tag LOCUS_00050 4023 4805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4815 7538 gene locus_tag LOCUS_00060 4815 7538 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_00060 7610 8020 gene locus_tag LOCUS_00070 gene cas4 7610 8020 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016964.1 protein_id gnl|my_center|LOCUS_00070 8101 9201 gene locus_tag LOCUS_00080 gene cas1b 8101 9201 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545291.1 protein_id gnl|my_center|LOCUS_00080 9203 9469 gene locus_tag LOCUS_00090 gene cas2 9203 9469 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060963.1 protein_id gnl|my_center|LOCUS_00090 9696 13528 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttttaaatcgaacctatgagggattgaaat 13829 16333 gene locus_tag LOCUS_00100 13829 16333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 17021 17830 gene locus_tag LOCUS_00110 17021 17830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 17827 21003 gene locus_tag LOCUS_00120 17827 21003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 21792 21271 gene locus_tag LOCUS_00130 21792 21271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 22165 21749 gene locus_tag LOCUS_00140 22165 21749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 22595 25240 gene locus_tag LOCUS_00150 22595 25240 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766170.1 protein_id gnl|my_center|LOCUS_00150 26654 25245 gene locus_tag LOCUS_00160 26654 25245 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966661.1 protein_id gnl|my_center|LOCUS_00160 28950 27112 gene locus_tag LOCUS_00170 28950 27112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 30351 29152 gene locus_tag LOCUS_00180 30351 29152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 30394 30403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 30477 30791 gene locus_tag LOCUS_00190 30477 30791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 30845 31747 gene locus_tag LOCUS_00200 30845 31747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 32498 31770 gene locus_tag LOCUS_00210 32498 31770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 33503 32616 gene locus_tag LOCUS_00220 33503 32616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 35131 33503 gene locus_tag LOCUS_00230 gene bshC 35131 33503 CDS product bacillithiol biosynthesis cysteine-adding enzyme BshC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_231847126.1 protein_id gnl|my_center|LOCUS_00230 38410 35375 gene locus_tag LOCUS_00240 38410 35375 CDS product xanthan lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201996.1 protein_id gnl|my_center|LOCUS_00240 38474 38968 gene locus_tag LOCUS_00250 38474 38968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 40419 39172 gene locus_tag LOCUS_00260 40419 39172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_00260 40997 40431 gene locus_tag LOCUS_00270 40997 40431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 41629 41084 gene locus_tag LOCUS_00280 41629 41084 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932249.1 protein_id gnl|my_center|LOCUS_00280 42127 41666 gene locus_tag LOCUS_00290 gene smpB 42127 41666 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421925.1 protein_id gnl|my_center|LOCUS_00290 44065 42248 gene locus_tag LOCUS_00300 gene sppA 44065 42248 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_00300 44352 44810 gene locus_tag LOCUS_00310 44352 44810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 44807 46258 gene locus_tag LOCUS_00320 44807 46258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 47378 46503 gene locus_tag LOCUS_00330 47378 46503 CDS product DUF4835 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963945.1 protein_id gnl|my_center|LOCUS_00330 48937 47606 gene locus_tag LOCUS_00340 gene ftsZ 48937 47606 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003731982.1 protein_id gnl|my_center|LOCUS_00340 49528 48962 gene locus_tag LOCUS_00350 49528 48962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 50822 49518 gene locus_tag LOCUS_00360 gene ftsA 50822 49518 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_00360 51576 50794 gene locus_tag LOCUS_00370 51576 50794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 53150 51723 gene locus_tag LOCUS_00380 gene murC 53150 51723 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943693.1 protein_id gnl|my_center|LOCUS_00380 54213 53119 gene locus_tag LOCUS_00390 gene murG 54213 53119 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964156.1 protein_id gnl|my_center|LOCUS_00390 55427 54210 gene locus_tag LOCUS_00400 gene ftsW 55427 54210 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_00400 56776 55424 gene locus_tag LOCUS_00410 gene murD 56776 55424 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403334.1 protein_id gnl|my_center|LOCUS_00410 57888 56779 gene locus_tag LOCUS_00420 gene mraY 57888 56779 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403333.1 protein_id gnl|my_center|LOCUS_00420 59514 57982 gene locus_tag LOCUS_00430 gene murF 59514 57982 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927184.1 protein_id gnl|my_center|LOCUS_00430 61021 59555 gene locus_tag LOCUS_00440 61021 59555 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_00440 62903 61026 gene locus_tag LOCUS_00450 62903 61026 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_00450 63364 63035 gene locus_tag LOCUS_00460 63364 63035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 64345 63389 gene locus_tag LOCUS_00470 gene rsmH 64345 63389 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949033.1 protein_id gnl|my_center|LOCUS_00470 64796 64329 gene locus_tag LOCUS_00480 gene mraZ 64796 64329 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180984760.1 protein_id gnl|my_center|LOCUS_00480 66396 65158 gene locus_tag LOCUS_00490 66396 65158 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962856.1 protein_id gnl|my_center|LOCUS_00490 66508 66681 gene locus_tag LOCUS_00500 66508 66681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 66678 67454 gene locus_tag LOCUS_00510 66678 67454 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009896313.1 protein_id gnl|my_center|LOCUS_00510 68158 67559 gene locus_tag LOCUS_00520 68158 67559 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944038.1 protein_id gnl|my_center|LOCUS_00520 70261 68384 gene locus_tag LOCUS_00530 70261 68384 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393219.1 protein_id gnl|my_center|LOCUS_00530 71472 70261 gene locus_tag LOCUS_00540 71472 70261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 71956 71483 gene locus_tag LOCUS_00550 gene nuoE 71956 71483 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_00550 72337 71966 gene locus_tag LOCUS_00560 72337 71966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 74169 72664 gene locus_tag LOCUS_00570 74169 72664 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940686.1 protein_id gnl|my_center|LOCUS_00570 74681 74262 gene locus_tag LOCUS_00580 74681 74262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 76582 74678 gene locus_tag LOCUS_00590 76582 74678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 77425 77138 gene locus_tag LOCUS_00600 77425 77138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 78584 77400 gene locus_tag LOCUS_00610 78584 77400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 80346 78703 gene locus_tag LOCUS_00620 80346 78703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 81179 80391 gene locus_tag LOCUS_00630 81179 80391 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105573.1 protein_id gnl|my_center|LOCUS_00630 82873 81428 gene locus_tag LOCUS_00640 82873 81428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 83459 85687 gene locus_tag LOCUS_00650 83459 85687 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765859.1 protein_id gnl|my_center|LOCUS_00650 85716 85640 gene locus_tag LOCUS_t00010 85716 85640 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 86716 85949 gene locus_tag LOCUS_00660 86716 85949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 87039 86749 gene locus_tag LOCUS_00670 87039 86749 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_00670 87359 87973 gene locus_tag LOCUS_00680 87359 87973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 89818 87977 gene locus_tag LOCUS_00690 gene pepF 89818 87977 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003348.1 protein_id gnl|my_center|LOCUS_00690 90007 91998 gene locus_tag LOCUS_00700 gene secD 90007 91998 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839265.1 protein_id gnl|my_center|LOCUS_00700 92030 93172 gene locus_tag LOCUS_00710 92030 93172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 94250 93600 gene locus_tag LOCUS_00720 94250 93600 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461663.1 protein_id gnl|my_center|LOCUS_00720 97042 94502 gene locus_tag LOCUS_00730 97042 94502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 98711 97044 gene locus_tag LOCUS_00740 98711 97044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 99145 98714 gene locus_tag LOCUS_00750 99145 98714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 99506 99150 gene locus_tag LOCUS_00760 99506 99150 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003820087.1 protein_id gnl|my_center|LOCUS_00760 101933 99642 gene locus_tag LOCUS_00770 101933 99642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 103762 102173 gene locus_tag LOCUS_00780 103762 102173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 104361 103759 gene locus_tag LOCUS_00790 104361 103759 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583208.1 protein_id gnl|my_center|LOCUS_00790 104869 105045 gene locus_tag LOCUS_00800 104869 105045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 105580 105182 gene locus_tag LOCUS_00810 105580 105182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 111153 105688 gene locus_tag LOCUS_00820 111153 105688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 111577 111912 gene locus_tag LOCUS_00830 111577 111912 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_00830 112055 112321 gene locus_tag LOCUS_00840 112055 112321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 112324 113553 gene locus_tag LOCUS_00850 112324 113553 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_00850 117645 113701 gene locus_tag LOCUS_00860 117645 113701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 117821 121150 gene locus_tag LOCUS_00870 117821 121150 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_00870 122115 121219 gene locus_tag LOCUS_00880 122115 121219 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_00880 122691 122158 gene locus_tag LOCUS_00890 122691 122158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 123861 122950 gene locus_tag LOCUS_00900 123861 122950 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254417.1 protein_id gnl|my_center|LOCUS_00900 124812 124027 gene locus_tag LOCUS_00910 124812 124027 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941192.1 protein_id gnl|my_center|LOCUS_00910 125404 124790 gene locus_tag LOCUS_00920 125404 124790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 126041 125529 gene locus_tag LOCUS_00930 126041 125529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 126626 126327 gene locus_tag LOCUS_00940 126626 126327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 127343 126642 gene locus_tag LOCUS_00950 127343 126642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 127899 127588 gene locus_tag LOCUS_00960 127899 127588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 130112 127896 gene locus_tag LOCUS_00970 130112 127896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 130930 130205 gene locus_tag LOCUS_00980 130930 130205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 131623 130997 gene locus_tag LOCUS_00990 131623 130997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 131985 131620 gene locus_tag LOCUS_01000 131985 131620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 133185 131995 gene locus_tag LOCUS_01010 133185 131995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 133636 133229 gene locus_tag LOCUS_01020 133636 133229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 134512 135123 gene locus_tag LOCUS_01030 134512 135123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 136175 135333 gene locus_tag LOCUS_01040 136175 135333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 137913 136390 gene locus_tag LOCUS_01050 137913 136390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 138079 137906 gene locus_tag LOCUS_01060 138079 137906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 138414 138196 gene locus_tag LOCUS_01070 gene copZ 138414 138196 CDS product copper chaperone CopZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244260.1 protein_id gnl|my_center|LOCUS_01070 138494 140557 gene locus_tag LOCUS_01080 138494 140557 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_01080 141427 140996 gene locus_tag LOCUS_01090 141427 140996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 142779 141595 gene locus_tag LOCUS_01100 142779 141595 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788537.1 protein_id gnl|my_center|LOCUS_01100 143521 142844 gene locus_tag LOCUS_01110 143521 142844 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_01110 144341 143700 gene locus_tag LOCUS_01120 144341 143700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 146383 144674 gene locus_tag LOCUS_01130 146383 144674 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_01130 146876 146451 gene locus_tag LOCUS_01140 146876 146451 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143722.1 protein_id gnl|my_center|LOCUS_01140 147026 147439 gene locus_tag LOCUS_01150 147026 147439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 147596 149698 gene locus_tag LOCUS_01160 147596 149698 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404722.1 protein_id gnl|my_center|LOCUS_01160 150040 152241 gene locus_tag LOCUS_01170 150040 152241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 152277 153755 gene locus_tag LOCUS_01180 152277 153755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 153817 153892 gene locus_tag LOCUS_t00020 153817 153892 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 153915 154265 gene locus_tag LOCUS_01190 153915 154265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 155473 154409 gene locus_tag LOCUS_01200 155473 154409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 155730 156545 gene locus_tag LOCUS_01210 155730 156545 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035256676.1 protein_id gnl|my_center|LOCUS_01210 156904 156713 gene locus_tag LOCUS_01220 gene rpsU 156904 156713 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933577.1 protein_id gnl|my_center|LOCUS_01220 157238 156918 gene locus_tag LOCUS_01230 157238 156918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 159187 157373 gene locus_tag LOCUS_01240 159187 157373 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_01240 159956 159489 gene locus_tag LOCUS_01250 159956 159489 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_01250 160509 160162 gene locus_tag LOCUS_01260 160509 160162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 161084 160521 gene locus_tag LOCUS_01270 161084 160521 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932332.1 protein_id gnl|my_center|LOCUS_01270 162456 161338 gene locus_tag LOCUS_01280 162456 161338 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_01280 163406 162768 gene locus_tag LOCUS_01290 163406 162768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 163589 166861 gene locus_tag LOCUS_01300 163589 166861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 169027 166976 gene locus_tag LOCUS_01310 169027 166976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 171107 169038 gene locus_tag LOCUS_01320 gene pabB 171107 169038 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001217385.1 protein_id gnl|my_center|LOCUS_01320 171830 171318 gene locus_tag LOCUS_01330 171830 171318 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454093.1 protein_id gnl|my_center|LOCUS_01330 173041 171845 gene locus_tag LOCUS_01340 173041 171845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 173498 174805 gene locus_tag LOCUS_01350 173498 174805 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814920.1 protein_id gnl|my_center|LOCUS_01350 176323 175097 gene locus_tag LOCUS_01360 176323 175097 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_01360 176678 177082 gene locus_tag LOCUS_01370 176678 177082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 178902 177232 gene locus_tag LOCUS_01380 178902 177232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 179735 178899 gene locus_tag LOCUS_01390 179735 178899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 180676 179801 gene locus_tag LOCUS_01400 180676 179801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 181988 180744 gene locus_tag LOCUS_01410 gene coaBC 181988 180744 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107739.1 protein_id gnl|my_center|LOCUS_01410 182284 181991 gene locus_tag LOCUS_01420 182284 181991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 182721 182284 gene locus_tag LOCUS_01430 182721 182284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 183748 182864 gene locus_tag LOCUS_01440 183748 182864 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965023.1 protein_id gnl|my_center|LOCUS_01440 185812 183806 gene locus_tag LOCUS_01450 185812 183806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 186454 185900 gene locus_tag LOCUS_01460 gene frr 186454 185900 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_01460 187223 186501 gene locus_tag LOCUS_01470 gene pyrH 187223 186501 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933439.1 protein_id gnl|my_center|LOCUS_01470 188247 187390 gene locus_tag LOCUS_01480 gene tsf 188247 187390 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933440.1 protein_id gnl|my_center|LOCUS_01480 189032 188247 gene locus_tag LOCUS_01490 gene rpsB 189032 188247 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933441.1 protein_id gnl|my_center|LOCUS_01490 189528 189142 gene locus_tag LOCUS_01500 gene rpsI 189528 189142 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_01500 189979 189539 gene locus_tag LOCUS_01510 gene rplM 189979 189539 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459272.1 protein_id gnl|my_center|LOCUS_01510 191630 190680 gene locus_tag LOCUS_01520 191630 190680 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060800.1 protein_id gnl|my_center|LOCUS_01520 192024 193508 gene locus_tag LOCUS_01530 192024 193508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 198834 193480 gene locus_tag LOCUS_01540 198834 193480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 200122 199172 gene locus_tag LOCUS_01550 200122 199172 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_01550 201443 200109 gene locus_tag LOCUS_01560 201443 200109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 203467 201440 gene locus_tag LOCUS_01570 203467 201440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 204391 203645 gene locus_tag LOCUS_01580 204391 203645 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_01580 205182 204514 gene locus_tag LOCUS_01590 205182 204514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 205369 205468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 205826 205715 gene locus_tag LOCUS_r00010 205826 205715 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 206227 206826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 208902 206826 gene locus_tag LOCUS_r00020 208902 206826 rRNA product 23S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 note aligned only 64 percent of the 23S ribosomal RNA 209117 209044 gene locus_tag LOCUS_t00030 209117 209044 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 209247 209171 gene locus_tag LOCUS_t00040 209247 209171 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 209400 210336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 212422 211715 gene locus_tag LOCUS_01600 212422 211715 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932386.1 protein_id gnl|my_center|LOCUS_01600 214286 212517 gene locus_tag LOCUS_01610 214286 212517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 215402 214419 gene locus_tag LOCUS_01620 215402 214419 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010255239.1 protein_id gnl|my_center|LOCUS_01620 216378 215371 gene locus_tag LOCUS_01630 216378 215371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 216901 216464 gene locus_tag LOCUS_01640 216901 216464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 220129 216923 gene locus_tag LOCUS_01650 gene ileS 220129 216923 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932003.1 protein_id gnl|my_center|LOCUS_01650 221260 220148 gene locus_tag LOCUS_01660 221260 220148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 222081 221257 gene locus_tag LOCUS_01670 222081 221257 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_01670 222827 222084 gene locus_tag LOCUS_01680 222827 222084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 223509 222829 gene locus_tag LOCUS_01690 223509 222829 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943180.1 protein_id gnl|my_center|LOCUS_01690 223908 223669 gene locus_tag LOCUS_01700 223908 223669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 224635 224282 gene locus_tag LOCUS_01710 224635 224282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 224842 225828 gene locus_tag LOCUS_01720 gene pta 224842 225828 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943344.1 protein_id gnl|my_center|LOCUS_01720 226659 226162 gene locus_tag LOCUS_01730 226659 226162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 226985 232027 gene locus_tag LOCUS_01740 226985 232027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 232893 232168 gene locus_tag LOCUS_01750 232893 232168 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838137.1 protein_id gnl|my_center|LOCUS_01750 233983 232874 gene locus_tag LOCUS_01760 233983 232874 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838136.1 protein_id gnl|my_center|LOCUS_01760 234845 234066 gene locus_tag LOCUS_01770 234845 234066 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_01770 236388 234997 gene locus_tag LOCUS_01780 gene fumC 236388 234997 CDS product class II fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857390.1 protein_id gnl|my_center|LOCUS_01780 236508 238493 gene locus_tag LOCUS_01790 236508 238493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 238486 239865 gene locus_tag LOCUS_01800 238486 239865 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943546.1 protein_id gnl|my_center|LOCUS_01800 239892 240230 gene locus_tag LOCUS_01810 239892 240230 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_01810 240337 240708 gene locus_tag LOCUS_01820 240337 240708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 240762 243455 gene locus_tag LOCUS_01830 240762 243455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 244744 243713 gene locus_tag LOCUS_01840 244744 243713 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929295.1 protein_id gnl|my_center|LOCUS_01840 245736 245062 gene locus_tag LOCUS_01850 245736 245062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 246971 246450 gene locus_tag LOCUS_01860 246971 246450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 247261 250152 gene locus_tag LOCUS_01870 247261 250152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 250731 250312 gene locus_tag LOCUS_01880 250731 250312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 251846 250734 gene locus_tag LOCUS_01890 251846 250734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 252651 252576 gene locus_tag LOCUS_t00050 252651 252576 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 254238 252817 gene locus_tag LOCUS_01900 254238 252817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 256318 254249 gene locus_tag LOCUS_01910 256318 254249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 256855 256517 gene locus_tag LOCUS_01920 256855 256517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 258029 256857 gene locus_tag LOCUS_01930 258029 256857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 258195 259286 gene locus_tag LOCUS_01940 258195 259286 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974072.1 protein_id gnl|my_center|LOCUS_01940 259305 259646 gene locus_tag LOCUS_01950 259305 259646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 259649 261313 gene locus_tag LOCUS_01960 gene hutU 259649 261313 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416707.1 protein_id gnl|my_center|LOCUS_01960 261325 262515 gene locus_tag LOCUS_01970 261325 262515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 263444 262689 gene locus_tag LOCUS_01980 263444 262689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 264070 263723 gene locus_tag LOCUS_01990 gene rplS 264070 263723 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003220825.1 protein_id gnl|my_center|LOCUS_01990 264762 264067 gene locus_tag LOCUS_02000 gene trmD 264762 264067 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_02000 265227 264838 gene locus_tag LOCUS_02010 265227 264838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 265592 265359 gene locus_tag LOCUS_02020 265592 265359 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670215.1 protein_id gnl|my_center|LOCUS_02020 266384 265710 gene locus_tag LOCUS_02030 266384 265710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 267716 266409 gene locus_tag LOCUS_02040 gene ffh 267716 266409 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546620.1 protein_id gnl|my_center|LOCUS_02040 268588 267725 gene locus_tag LOCUS_02050 268588 267725 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933687.1 protein_id gnl|my_center|LOCUS_02050 270148 268604 gene locus_tag LOCUS_02060 gene atpA 270148 268604 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933688.1 protein_id gnl|my_center|LOCUS_02060 270723 270169 gene locus_tag LOCUS_02070 270723 270169 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017341.1 protein_id gnl|my_center|LOCUS_02070 271268 270726 gene locus_tag LOCUS_02080 271268 270726 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_02080 271512 271294 gene locus_tag LOCUS_02090 271512 271294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 272393 271548 gene locus_tag LOCUS_02100 272393 271548 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931715.1 protein_id gnl|my_center|LOCUS_02100 272784 272383 gene locus_tag LOCUS_02110 272784 272383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 273019 272768 gene locus_tag LOCUS_02120 273019 272768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 273668 273000 gene locus_tag LOCUS_02130 273668 273000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 273754 273853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 274287 273994 gene locus_tag LOCUS_02140 274287 273994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 275108 274467 gene locus_tag LOCUS_02150 275108 274467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 276282 275098 gene locus_tag LOCUS_02160 276282 275098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 277019 276291 gene locus_tag LOCUS_02170 277019 276291 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931905.1 protein_id gnl|my_center|LOCUS_02170 278555 277200 gene locus_tag LOCUS_02180 278555 277200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 279650 278631 gene locus_tag LOCUS_02190 279650 278631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 283305 279721 gene locus_tag LOCUS_02200 283305 279721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 286151 283323 gene locus_tag LOCUS_02210 286151 283323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 288115 286286 gene locus_tag LOCUS_02220 288115 286286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 288790 288470 gene locus_tag LOCUS_02230 288790 288470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 289658 288843 gene locus_tag LOCUS_02240 289658 288843 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_02240 293383 289892 gene locus_tag LOCUS_02250 gene dnaE 293383 289892 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403739.1 protein_id gnl|my_center|LOCUS_02250 294090 293632 gene locus_tag LOCUS_02260 gene dut 294090 293632 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528045.1 protein_id gnl|my_center|LOCUS_02260 295828 294347 gene locus_tag LOCUS_02270 295828 294347 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931965.1 protein_id gnl|my_center|LOCUS_02270 296400 295825 gene locus_tag LOCUS_02280 296400 295825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 297084 296677 gene locus_tag LOCUS_02290 297084 296677 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948808.1 protein_id gnl|my_center|LOCUS_02290 298036 297086 gene locus_tag LOCUS_02300 298036 297086 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931855.1 protein_id gnl|my_center|LOCUS_02300 300058 298037 gene locus_tag LOCUS_02310 300058 298037 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_02310 300824 300102 gene locus_tag LOCUS_02320 300824 300102 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_02320 302250 300847 gene locus_tag LOCUS_02330 302250 300847 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256942.1 protein_id gnl|my_center|LOCUS_02330 303361 302405 gene locus_tag LOCUS_02340 303361 302405 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259591.1 protein_id gnl|my_center|LOCUS_02340 304409 303486 gene locus_tag LOCUS_02350 304409 303486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 304600 305373 gene locus_tag LOCUS_02360 304600 305373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 305660 306637 gene locus_tag LOCUS_02370 305660 306637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 307259 306645 gene locus_tag LOCUS_02380 307259 306645 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_02380 309103 307826 gene locus_tag LOCUS_02390 309103 307826 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403893.1 protein_id gnl|my_center|LOCUS_02390 310400 309255 gene locus_tag LOCUS_02400 gene metK 310400 309255 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289731.1 protein_id gnl|my_center|LOCUS_02400 311404 310427 gene locus_tag LOCUS_02410 311404 310427 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932409.1 protein_id gnl|my_center|LOCUS_02410 311841 312791 gene locus_tag LOCUS_02420 311841 312791 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202434.1 protein_id gnl|my_center|LOCUS_02420 315223 313118 gene locus_tag LOCUS_02430 315223 313118 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203174.1 protein_id gnl|my_center|LOCUS_02430 315723 318608 gene locus_tag LOCUS_02440 gene gcvP 315723 318608 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_02440 318813 319232 gene locus_tag LOCUS_02450 318813 319232 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933012.1 protein_id gnl|my_center|LOCUS_02450 319408 320751 gene locus_tag LOCUS_02460 319408 320751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 320732 321160 gene locus_tag LOCUS_02470 320732 321160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 321142 321849 gene locus_tag LOCUS_02480 321142 321849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 322270 322518 gene locus_tag LOCUS_02490 322270 322518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 322674 323006 gene locus_tag LOCUS_02500 322674 323006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 323010 323285 gene locus_tag LOCUS_02510 323010 323285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 323347 324474 gene locus_tag LOCUS_02520 gene dprA 323347 324474 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546585.1 protein_id gnl|my_center|LOCUS_02520 324608 325336 gene locus_tag LOCUS_02530 324608 325336 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_02530 325538 325777 gene locus_tag LOCUS_02540 gene rpmB 325538 325777 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933275.1 protein_id gnl|my_center|LOCUS_02540 325904 326632 gene locus_tag LOCUS_02550 325904 326632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 326812 327249 gene locus_tag LOCUS_02560 326812 327249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 327504 329927 gene locus_tag LOCUS_02570 gene ccsA 327504 329927 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404869.1 protein_id gnl|my_center|LOCUS_02570 330752 329994 gene locus_tag LOCUS_02580 gene rnc 330752 329994 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838732.1 protein_id gnl|my_center|LOCUS_02580 332002 330755 gene locus_tag LOCUS_02590 gene fabF 332002 330755 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_02590 332322 332083 gene locus_tag LOCUS_02600 332322 332083 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_02600 333098 332352 gene locus_tag LOCUS_02610 gene fabG 333098 332352 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_02610 334069 333146 gene locus_tag LOCUS_02620 gene fabD 334069 333146 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933769.1 protein_id gnl|my_center|LOCUS_02620 335066 334062 gene locus_tag LOCUS_02630 335066 334062 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_02630 336103 335066 gene locus_tag LOCUS_02640 gene plsX 336103 335066 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545117.1 protein_id gnl|my_center|LOCUS_02640 336944 336438 gene locus_tag LOCUS_02650 336944 336438 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583304.1 protein_id gnl|my_center|LOCUS_02650 337575 338696 gene locus_tag LOCUS_02660 337575 338696 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_02660 338931 340451 gene locus_tag LOCUS_02670 338931 340451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 340448 341179 gene locus_tag LOCUS_02680 340448 341179 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058012.1 protein_id gnl|my_center|LOCUS_02680 341310 342461 gene locus_tag LOCUS_02690 gene pseC 341310 342461 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_02690 344070 342547 gene locus_tag LOCUS_02700 344070 342547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 344365 345543 gene locus_tag LOCUS_02710 344365 345543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 345593 347038 gene locus_tag LOCUS_02720 345593 347038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 347049 348518 gene locus_tag LOCUS_02730 347049 348518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 348525 349538 gene locus_tag LOCUS_02740 348525 349538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 349535 350536 gene locus_tag LOCUS_02750 349535 350536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268466.1 protein_id gnl|my_center|LOCUS_02750 352749 350632 gene locus_tag LOCUS_02760 352749 350632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 352971 353070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 353345 354316 gene locus_tag LOCUS_02770 353345 354316 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933029.1 protein_id gnl|my_center|LOCUS_02770 354346 354984 gene locus_tag LOCUS_02780 354346 354984 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962325.1 protein_id gnl|my_center|LOCUS_02780 354987 355658 gene locus_tag LOCUS_02790 gene pth 354987 355658 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932921.1 protein_id gnl|my_center|LOCUS_02790 355659 357881 gene locus_tag LOCUS_02800 355659 357881 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138432165.1 protein_id gnl|my_center|LOCUS_02800 358554 358653 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 358820 359293 gene locus_tag LOCUS_02810 gene ssb 358820 359293 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927163.1 protein_id gnl|my_center|LOCUS_02810 359299 359568 gene locus_tag LOCUS_02820 359299 359568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 359587 360039 gene locus_tag LOCUS_02830 gene rplI 359587 360039 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_02830 361504 360347 gene locus_tag LOCUS_02840 361504 360347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 362987 361836 gene locus_tag LOCUS_02850 362987 361836 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680236.1 protein_id gnl|my_center|LOCUS_02850 363247 364965 gene locus_tag LOCUS_02860 363247 364965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 364972 366222 gene locus_tag LOCUS_02870 gene clpX 364972 366222 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932095.1 protein_id gnl|my_center|LOCUS_02870 366456 367637 gene locus_tag LOCUS_02880 366456 367637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_02880 369116 367869 gene locus_tag LOCUS_02890 gene radA 369116 367869 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545683.1 protein_id gnl|my_center|LOCUS_02890 370059 369304 gene locus_tag LOCUS_02900 370059 369304 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405283.1 protein_id gnl|my_center|LOCUS_02900 371147 370374 gene locus_tag LOCUS_02910 371147 370374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 372854 371175 gene locus_tag LOCUS_02920 372854 371175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 374213 373275 gene locus_tag LOCUS_02930 374213 373275 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098074942.1 protein_id gnl|my_center|LOCUS_02930 374496 374633 gene locus_tag LOCUS_02940 374496 374633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 374707 375453 gene locus_tag LOCUS_02950 374707 375453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 376602 375460 gene locus_tag LOCUS_02960 gene pdxB 376602 375460 CDS product 4-phosphoerythronate dehydrogenase PdxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000699136.1 protein_id gnl|my_center|LOCUS_02960 376760 377104 gene locus_tag LOCUS_02970 376760 377104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 377101 377679 gene locus_tag LOCUS_02980 377101 377679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 377806 378756 gene locus_tag LOCUS_02990 gene gyaR 377806 378756 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_02990 379200 381281 gene locus_tag LOCUS_03000 379200 381281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 382754 381504 gene locus_tag LOCUS_03010 gene pepT 382754 381504 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_03010 382941 384152 gene locus_tag LOCUS_03020 382941 384152 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027385545.1 protein_id gnl|my_center|LOCUS_03020 384167 384841 gene locus_tag LOCUS_03030 384167 384841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 385172 387094 gene locus_tag LOCUS_03040 385172 387094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 387087 388028 gene locus_tag LOCUS_03050 gene cas7b 387087 388028 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_03050 388046 388807 gene locus_tag LOCUS_03060 gene cas5b 388046 388807 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_03060 388785 391208 gene locus_tag LOCUS_03070 388785 391208 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_03070 391205 391891 gene locus_tag LOCUS_03080 391205 391891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 391875 392921 gene locus_tag LOCUS_03090 gene cas1 391875 392921 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879371.1 protein_id gnl|my_center|LOCUS_03090 392918 393208 gene locus_tag LOCUS_03100 392918 393208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 393286 393861 gene locus_tag LOCUS_03110 gene cas4 393286 393861 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_03110 394064 396937 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcaaaagcatgatccatcaaaacaaggattgaaac 396956 397055 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 397073 398488 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcaaaagcatgatccatcaaaacaaggattgaaac 400818 399013 gene locus_tag LOCUS_03120 400818 399013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 401228 401064 gene locus_tag LOCUS_03130 401228 401064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 403617 401296 gene locus_tag LOCUS_03140 403617 401296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 403988 404662 gene locus_tag LOCUS_03150 gene metW 403988 404662 CDS product methionine biosynthesis protein MetW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529385.1 protein_id gnl|my_center|LOCUS_03150 404808 404977 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccgttgaagtaacctttttagtagggatgcgcttttag 404863 404873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 404999 405961 gene locus_tag LOCUS_03160 404999 405961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 406122 407237 gene locus_tag LOCUS_03170 406122 407237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 407237 407605 gene locus_tag LOCUS_03180 407237 407605 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461015.1 protein_id gnl|my_center|LOCUS_03180 407673 408755 gene locus_tag LOCUS_03190 407673 408755 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575178.1 protein_id gnl|my_center|LOCUS_03190 408755 409279 gene locus_tag LOCUS_03200 408755 409279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 410812 409439 gene locus_tag LOCUS_03210 410812 409439 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223056.1 protein_id gnl|my_center|LOCUS_03210 412179 410827 gene locus_tag LOCUS_03220 412179 410827 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223055.1 protein_id gnl|my_center|LOCUS_03220 415886 412530 gene locus_tag LOCUS_03230 415886 412530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839243.1 protein_id gnl|my_center|LOCUS_03230 416515 415934 gene locus_tag LOCUS_03240 416515 415934 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_03240 416457 416627 gene locus_tag LOCUS_03250 416457 416627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 417647 417000 gene locus_tag LOCUS_03260 417647 417000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 419369 417900 gene locus_tag LOCUS_03270 gene rmuC 419369 417900 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072114.1 protein_id gnl|my_center|LOCUS_03270 420027 423632 gene locus_tag LOCUS_03280 420027 423632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 424097 424672 gene locus_tag LOCUS_03290 424097 424672 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707448.1 protein_id gnl|my_center|LOCUS_03290 425224 427776 gene locus_tag LOCUS_03300 425224 427776 CDS product PAS domain-containing hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258909.1 protein_id gnl|my_center|LOCUS_03300 427991 430465 gene locus_tag LOCUS_03310 gene leuS 427991 430465 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948005.1 protein_id gnl|my_center|LOCUS_03310 430467 431876 gene locus_tag LOCUS_03320 gene serS 430467 431876 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932293.1 protein_id gnl|my_center|LOCUS_03320 432697 433050 gene locus_tag LOCUS_03330 432697 433050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 433051 433395 gene locus_tag LOCUS_03340 433051 433395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 433569 433946 gene locus_tag LOCUS_03350 433569 433946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 433950 434378 gene locus_tag LOCUS_03360 433950 434378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 435005 435925 gene locus_tag LOCUS_03370 435005 435925 CDS product cobalamin-dependent protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258543.1 protein_id gnl|my_center|LOCUS_03370 438737 436263 gene locus_tag LOCUS_03380 gene priA 438737 436263 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989822.1 protein_id gnl|my_center|LOCUS_03380 439409 438855 gene locus_tag LOCUS_03390 439409 438855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 440705 439428 gene locus_tag LOCUS_03400 gene lysA 440705 439428 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_03400 442391 440889 gene locus_tag LOCUS_03410 442391 440889 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403984.1 protein_id gnl|my_center|LOCUS_03410 443467 442451 gene locus_tag LOCUS_03420 443467 442451 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_03420 443649 444098 gene locus_tag LOCUS_03430 443649 444098 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962680.1 protein_id gnl|my_center|LOCUS_03430 444230 446989 gene locus_tag LOCUS_03440 444230 446989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 447216 447626 gene locus_tag LOCUS_03450 gene mce 447216 447626 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561104.1 protein_id gnl|my_center|LOCUS_03450 447650 449203 gene locus_tag LOCUS_03460 447650 449203 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780626.1 protein_id gnl|my_center|LOCUS_03460 449219 449728 gene locus_tag LOCUS_03470 449219 449728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 449744 450181 gene locus_tag LOCUS_03480 449744 450181 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789540.1 protein_id gnl|my_center|LOCUS_03480 450183 451322 gene locus_tag LOCUS_03490 450183 451322 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789543.1 protein_id gnl|my_center|LOCUS_03490 451761 452879 gene locus_tag LOCUS_03500 451761 452879 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546683.1 protein_id gnl|my_center|LOCUS_03500 453128 453661 gene locus_tag LOCUS_03510 453128 453661 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_03510 453669 455660 gene locus_tag LOCUS_03520 453669 455660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 455669 457036 gene locus_tag LOCUS_03530 455669 457036 CDS product MmgE/PrpD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529380.1 protein_id gnl|my_center|LOCUS_03530 457287 458621 gene locus_tag LOCUS_03540 457287 458621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 458608 460164 gene locus_tag LOCUS_03550 gene citF 458608 460164 CDS product citrate lyase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870113.1 protein_id gnl|my_center|LOCUS_03550 463106 460359 gene locus_tag LOCUS_03560 463106 460359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 463852 463951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 464070 464318 gene locus_tag LOCUS_03570 464070 464318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 465718 464552 gene locus_tag LOCUS_03580 465718 464552 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461032.1 protein_id gnl|my_center|LOCUS_03580 466306 465719 gene locus_tag LOCUS_03590 466306 465719 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_03590 467277 466303 gene locus_tag LOCUS_03600 467277 466303 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582950.1 protein_id gnl|my_center|LOCUS_03600 470369 467664 gene locus_tag LOCUS_03610 470369 467664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 470782 471930 gene locus_tag LOCUS_03620 470782 471930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 471920 474355 gene locus_tag LOCUS_03630 471920 474355 CDS product SMC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082116.1 protein_id gnl|my_center|LOCUS_03630 475419 474448 gene locus_tag LOCUS_03640 475419 474448 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965021.1 protein_id gnl|my_center|LOCUS_03640 475542 476084 gene locus_tag LOCUS_03650 475542 476084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 476576 476725 gene locus_tag LOCUS_03660 476576 476725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 479964 476827 gene locus_tag LOCUS_03670 479964 476827 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404654.1 protein_id gnl|my_center|LOCUS_03670 480911 480522 gene locus_tag LOCUS_03680 480911 480522 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_03680 481981 481043 gene locus_tag LOCUS_03690 481981 481043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 483066 481987 gene locus_tag LOCUS_03700 483066 481987 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545786.1 protein_id gnl|my_center|LOCUS_03700 483287 483063 gene locus_tag LOCUS_03710 483287 483063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 483937 483284 gene locus_tag LOCUS_03720 483937 483284 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016590.1 protein_id gnl|my_center|LOCUS_03720 484457 483927 gene locus_tag LOCUS_03730 gene folK 484457 483927 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880048.1 protein_id gnl|my_center|LOCUS_03730 485044 484460 gene locus_tag LOCUS_03740 485044 484460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 485956 485219 gene locus_tag LOCUS_03750 gene pgeF 485956 485219 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839662.1 protein_id gnl|my_center|LOCUS_03750 486976 486038 gene locus_tag LOCUS_03760 486976 486038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 488634 486976 gene locus_tag LOCUS_03770 488634 486976 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404001.1 protein_id gnl|my_center|LOCUS_03770 489367 488642 gene locus_tag LOCUS_03780 489367 488642 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_03780 490296 489370 gene locus_tag LOCUS_03790 490296 489370 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_03790 491124 490348 gene locus_tag LOCUS_03800 491124 490348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 492648 491464 gene locus_tag LOCUS_03810 492648 491464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 495875 493722 gene locus_tag LOCUS_03820 495875 493722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 498710 496557 gene locus_tag LOCUS_03830 498710 496557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 499116 500156 gene locus_tag LOCUS_03840 499116 500156 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931705.1 protein_id gnl|my_center|LOCUS_03840 502509 500353 gene locus_tag LOCUS_03850 502509 500353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 503341 502751 gene locus_tag LOCUS_03860 gene fadR 503341 502751 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_03860 504540 503425 gene locus_tag LOCUS_03870 504540 503425 CDS product agmatine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933174.1 protein_id gnl|my_center|LOCUS_03870 505611 504721 gene locus_tag LOCUS_03880 505611 504721 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909400.1 protein_id gnl|my_center|LOCUS_03880 506682 505780 gene locus_tag LOCUS_03890 506682 505780 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_03890 508060 506747 gene locus_tag LOCUS_03900 508060 506747 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_03900 508364 510706 gene locus_tag LOCUS_03910 508364 510706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 510710 511525 gene locus_tag LOCUS_03920 510710 511525 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403324.1 protein_id gnl|my_center|LOCUS_03920 511592 514174 gene locus_tag LOCUS_03930 511592 514174 CDS product YfhO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963906.1 protein_id gnl|my_center|LOCUS_03930 514149 515495 gene locus_tag LOCUS_03940 514149 515495 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_03940 515468 516127 gene locus_tag LOCUS_03950 515468 516127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 516131 516769 gene locus_tag LOCUS_03960 516131 516769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125468.1 protein_id gnl|my_center|LOCUS_03960 516845 517756 gene locus_tag LOCUS_03970 516845 517756 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000050431.1 protein_id gnl|my_center|LOCUS_03970 517762 518739 gene locus_tag LOCUS_03980 517762 518739 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_03980 518793 520019 gene locus_tag LOCUS_03990 518793 520019 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_03990 520682 520143 gene locus_tag LOCUS_04000 520682 520143 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001167115.1 protein_id gnl|my_center|LOCUS_04000 521813 520839 gene locus_tag LOCUS_04010 gene iaaA 521813 520839 CDS product beta-aspartyl-peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704837.1 protein_id gnl|my_center|LOCUS_04010 522603 521806 gene locus_tag LOCUS_04020 522603 521806 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143916869.1 protein_id gnl|my_center|LOCUS_04020 523367 522600 gene locus_tag LOCUS_04030 523367 522600 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962496.1 protein_id gnl|my_center|LOCUS_04030 523928 523542 gene locus_tag LOCUS_04040 523928 523542 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844515.1 protein_id gnl|my_center|LOCUS_04040 524030 525691 gene locus_tag LOCUS_04050 524030 525691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 527442 525814 gene locus_tag LOCUS_04060 527442 525814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 529918 527540 gene locus_tag LOCUS_04070 529918 527540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 530295 531044 gene locus_tag LOCUS_04080 530295 531044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 532243 531125 gene locus_tag LOCUS_04090 532243 531125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 534001 532448 gene locus_tag LOCUS_04100 534001 532448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 535123 534386 gene locus_tag LOCUS_04110 535123 534386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 537545 535161 gene locus_tag LOCUS_04120 537545 535161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 539149 537932 gene locus_tag LOCUS_04130 539149 537932 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640195.1 protein_id gnl|my_center|LOCUS_04130 539596 539213 gene locus_tag LOCUS_04140 539596 539213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 539893 540732 gene locus_tag LOCUS_04150 539893 540732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 541188 540814 gene locus_tag LOCUS_04160 541188 540814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 542983 541457 gene locus_tag LOCUS_04170 542983 541457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 543512 543018 gene locus_tag LOCUS_04180 543512 543018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 544246 543518 gene locus_tag LOCUS_04190 544246 543518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 545250 544255 gene locus_tag LOCUS_04200 545250 544255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 548090 545265 gene locus_tag LOCUS_04210 548090 545265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 548544 548095 gene locus_tag LOCUS_04220 548544 548095 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_04220 549548 548808 gene locus_tag LOCUS_04230 gene rlmB 549548 548808 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174056.1 protein_id gnl|my_center|LOCUS_04230 550429 549545 gene locus_tag LOCUS_04240 gene lgt 550429 549545 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389930.1 protein_id gnl|my_center|LOCUS_04240 550951 550436 gene locus_tag LOCUS_04250 550951 550436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 551437 550964 gene locus_tag LOCUS_04260 551437 550964 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926822.1 protein_id gnl|my_center|LOCUS_04260 552695 551493 gene locus_tag LOCUS_04270 gene rocD 552695 551493 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037398015.1 protein_id gnl|my_center|LOCUS_04270 552867 553142 gene locus_tag LOCUS_04280 552867 553142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 553518 554072 gene locus_tag LOCUS_04290 gene sdbB 553518 554072 CDS product thiol-disulfide oxidoreductase-associated lipoprotein SdbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757386.1 protein_id gnl|my_center|LOCUS_04290 556189 554279 gene locus_tag LOCUS_04300 556189 554279 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_04300 557317 556379 gene locus_tag LOCUS_04310 557317 556379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 557861 557352 gene locus_tag LOCUS_04320 557861 557352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 558448 558041 gene locus_tag LOCUS_04330 558448 558041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 558622 561867 gene locus_tag LOCUS_04340 558622 561867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 562815 562282 gene locus_tag LOCUS_04350 562815 562282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 564021 562927 gene locus_tag LOCUS_04360 564021 562927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 567616 564827 gene locus_tag LOCUS_04370 567616 564827 CDS product bifunctional transaldolase/phosoglucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089497.1 protein_id gnl|my_center|LOCUS_04370 568619 567636 gene locus_tag LOCUS_04380 gene glk 568619 567636 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022001.1 protein_id gnl|my_center|LOCUS_04380 569889 568822 gene locus_tag LOCUS_04390 569889 568822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 571456 569957 gene locus_tag LOCUS_04400 gene zwf 571456 569957 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626064.1 protein_id gnl|my_center|LOCUS_04400 572360 571461 gene locus_tag LOCUS_04410 gene gnd 572360 571461 CDS product decarboxylating 6-phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256404.1 protein_id gnl|my_center|LOCUS_04410 573410 572385 gene locus_tag LOCUS_04420 573410 572385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 574050 573706 gene locus_tag LOCUS_04430 574050 573706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 575704 574793 gene locus_tag LOCUS_04440 575704 574793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 576904 576011 gene locus_tag LOCUS_04450 576904 576011 CDS product SUMF1/EgtB/PvdO family nonheme iron enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262010.1 protein_id gnl|my_center|LOCUS_04450 578969 577353 gene locus_tag LOCUS_04460 578969 577353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 580072 579125 gene locus_tag LOCUS_04470 gene miaA 580072 579125 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679096.1 protein_id gnl|my_center|LOCUS_04470 582545 580107 gene locus_tag LOCUS_04480 582545 580107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 582677 583294 gene locus_tag LOCUS_04490 582677 583294 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098063.1 protein_id gnl|my_center|LOCUS_04490 583320 583880 gene locus_tag LOCUS_04500 583320 583880 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965913.1 protein_id gnl|my_center|LOCUS_04500 583877 584110 gene locus_tag LOCUS_04510 583877 584110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 585376 584300 gene locus_tag LOCUS_04520 gene prfA 585376 584300 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_04520 586532 585741 gene locus_tag LOCUS_04530 586532 585741 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256896.1 protein_id gnl|my_center|LOCUS_04530 586646 588199 gene locus_tag LOCUS_04540 586646 588199 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_04540 589292 588444 gene locus_tag LOCUS_04550 589292 588444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 590378 589308 gene locus_tag LOCUS_04560 590378 589308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 591261 590350 gene locus_tag LOCUS_04570 591261 590350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 592507 591251 gene locus_tag LOCUS_04580 592507 591251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 592945 594423 gene locus_tag LOCUS_04590 592945 594423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 594440 594646 gene locus_tag LOCUS_04600 594440 594646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 595780 594578 gene locus_tag LOCUS_04610 gene lhgO 595780 594578 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142204.1 protein_id gnl|my_center|LOCUS_04610 596239 597165 gene locus_tag LOCUS_04620 596239 597165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 597180 598067 gene locus_tag LOCUS_04630 597180 598067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 598186 599088 gene locus_tag LOCUS_04640 598186 599088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 600125 599097 gene locus_tag LOCUS_04650 600125 599097 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_04650 600917 600381 gene locus_tag LOCUS_04660 600917 600381 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_04660 601508 600972 gene locus_tag LOCUS_04670 601508 600972 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089711913.1 protein_id gnl|my_center|LOCUS_04670 602274 601546 gene locus_tag LOCUS_04680 602274 601546 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789136.1 protein_id gnl|my_center|LOCUS_04680 602445 602615 gene locus_tag LOCUS_04690 602445 602615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 606314 602655 gene locus_tag LOCUS_04700 606314 602655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 607818 606631 gene locus_tag LOCUS_04710 607818 606631 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932884.1 protein_id gnl|my_center|LOCUS_04710 609660 607837 gene locus_tag LOCUS_04720 609660 607837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 610485 609874 gene locus_tag LOCUS_04730 gene gpmA 610485 609874 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_04730 610744 611364 gene locus_tag LOCUS_04740 610744 611364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 613473 611623 gene locus_tag LOCUS_04750 613473 611623 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943611.1 protein_id gnl|my_center|LOCUS_04750 613917 613522 gene locus_tag LOCUS_04760 613917 613522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 614731 614276 gene locus_tag LOCUS_04770 614731 614276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 616287 614746 gene locus_tag LOCUS_04780 616287 614746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 614817 614826 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 617033 617248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 618071 620077 gene locus_tag LOCUS_04790 618071 620077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 620507 620226 gene locus_tag LOCUS_04800 620507 620226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 621566 620781 gene locus_tag LOCUS_04810 621566 620781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 622472 621567 gene locus_tag LOCUS_04820 622472 621567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 623964 622453 gene locus_tag LOCUS_04830 623964 622453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 625569 624271 gene locus_tag LOCUS_04840 625569 624271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 627376 625571 gene locus_tag LOCUS_04850 627376 625571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 627625 627377 gene locus_tag LOCUS_04860 627625 627377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 627894 627547 gene locus_tag LOCUS_04870 627894 627547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 628544 627894 gene locus_tag LOCUS_04880 628544 627894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 629498 628554 gene locus_tag LOCUS_04890 629498 628554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 630120 629605 gene locus_tag LOCUS_04900 630120 629605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 630331 630110 gene locus_tag LOCUS_04910 630331 630110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 630936 630328 gene locus_tag LOCUS_04920 630936 630328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 631347 630979 gene locus_tag LOCUS_04930 631347 630979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 631799 631344 gene locus_tag LOCUS_04940 631799 631344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 632243 631800 gene locus_tag LOCUS_04950 632243 631800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 632738 632277 gene locus_tag LOCUS_04960 632738 632277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 633749 632832 gene locus_tag LOCUS_04970 633749 632832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 634638 633739 gene locus_tag LOCUS_04980 634638 633739 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938417.1 protein_id gnl|my_center|LOCUS_04980 634768 635082 gene locus_tag LOCUS_04990 634768 635082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 635072 635323 gene locus_tag LOCUS_05000 635072 635323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 635301 635732 gene locus_tag LOCUS_05010 635301 635732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 635826 637253 gene locus_tag LOCUS_05020 635826 637253 CDS product terminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889353.1 protein_id gnl|my_center|LOCUS_05020 637246 638646 gene locus_tag LOCUS_05030 637246 638646 CDS product DUF935 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000090679.1 protein_id gnl|my_center|LOCUS_05030 638633 639883 gene locus_tag LOCUS_05040 638633 639883 CDS product phage head morphogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005825914.1 protein_id gnl|my_center|LOCUS_05040 640010 640576 gene locus_tag LOCUS_05050 640010 640576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 640922 640635 gene locus_tag LOCUS_05060 640922 640635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 641548 640919 gene locus_tag LOCUS_05070 641548 640919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 641974 641708 gene locus_tag LOCUS_05080 641974 641708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 642707 641952 gene locus_tag LOCUS_05090 642707 641952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 643638 642715 gene locus_tag LOCUS_05100 643638 642715 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751204.1 protein_id gnl|my_center|LOCUS_05100 645628 643640 gene locus_tag LOCUS_05110 645628 643640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 646083 645628 gene locus_tag LOCUS_05120 646083 645628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 646333 646163 gene locus_tag LOCUS_05130 646333 646163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 646448 647083 gene locus_tag LOCUS_05140 646448 647083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 647454 647771 gene locus_tag LOCUS_05150 647454 647771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 648372 648109 gene locus_tag LOCUS_05160 648372 648109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 649053 648604 gene locus_tag LOCUS_05170 649053 648604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05170 649359 649195 gene locus_tag LOCUS_05180 649359 649195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05180 649375 650602 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 651679 650642 gene locus_tag LOCUS_05190 651679 650642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 652234 653875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 654832 653915 gene locus_tag LOCUS_05200 654832 653915 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_05200 655890 654889 gene locus_tag LOCUS_05210 655890 654889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 658100 656292 gene locus_tag LOCUS_05220 658100 656292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 660064 658139 gene locus_tag LOCUS_05230 660064 658139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 661175 660099 gene locus_tag LOCUS_05240 661175 660099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence02 159 2729 gene locus_tag LOCUS_05250 159 2729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 3113 3039 gene locus_tag LOCUS_t00060 3113 3039 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3605 4171 gene locus_tag LOCUS_05260 3605 4171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 4168 5310 gene locus_tag LOCUS_05270 4168 5310 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249477.1 protein_id gnl|my_center|LOCUS_05270 5498 6136 gene locus_tag LOCUS_05280 gene queE 5498 6136 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_05280 6143 6562 gene locus_tag LOCUS_05290 gene queD 6143 6562 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663812.1 protein_id gnl|my_center|LOCUS_05290 6563 7348 gene locus_tag LOCUS_05300 gene truA 6563 7348 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544911.1 protein_id gnl|my_center|LOCUS_05300 8478 7429 gene locus_tag LOCUS_05310 gene lpxD 8478 7429 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933028.1 protein_id gnl|my_center|LOCUS_05310 8987 8481 gene locus_tag LOCUS_05320 8987 8481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 9538 9014 gene locus_tag LOCUS_05330 9538 9014 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926824.1 protein_id gnl|my_center|LOCUS_05330 12076 9566 gene locus_tag LOCUS_05340 gene bamA 12076 9566 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931958.1 protein_id gnl|my_center|LOCUS_05340 12740 12084 gene locus_tag LOCUS_05350 12740 12084 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931959.1 protein_id gnl|my_center|LOCUS_05350 13486 13040 gene locus_tag LOCUS_05360 13486 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 13746 13498 gene locus_tag LOCUS_05370 13746 13498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 14399 13758 gene locus_tag LOCUS_05380 gene lexA 14399 13758 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940718.1 protein_id gnl|my_center|LOCUS_05380 14571 15347 gene locus_tag LOCUS_05390 gene surE 14571 15347 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404579.1 protein_id gnl|my_center|LOCUS_05390 15355 17496 gene locus_tag LOCUS_05400 15355 17496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963111.1 protein_id gnl|my_center|LOCUS_05400 17577 18296 gene locus_tag LOCUS_05410 17577 18296 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797461.1 protein_id gnl|my_center|LOCUS_05410 19892 18264 gene locus_tag LOCUS_05420 gene argS 19892 18264 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_05420 20320 19943 gene locus_tag LOCUS_05430 gene rsfS 20320 19943 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392104.1 protein_id gnl|my_center|LOCUS_05430 20804 20322 gene locus_tag LOCUS_05440 20804 20322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 21343 20819 gene locus_tag LOCUS_05450 21343 20819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 21718 21374 gene locus_tag LOCUS_05460 21718 21374 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404162.1 protein_id gnl|my_center|LOCUS_05460 22732 21806 gene locus_tag LOCUS_05470 gene porQ 22732 21806 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072714810.1 protein_id gnl|my_center|LOCUS_05470 22954 23979 gene locus_tag LOCUS_05480 22954 23979 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394438.1 protein_id gnl|my_center|LOCUS_05480 23976 26012 gene locus_tag LOCUS_05490 23976 26012 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948168.1 protein_id gnl|my_center|LOCUS_05490 26538 26101 gene locus_tag LOCUS_05500 gene ruvX 26538 26101 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_05500 28707 26542 gene locus_tag LOCUS_05510 28707 26542 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403822.1 protein_id gnl|my_center|LOCUS_05510 29800 28769 gene locus_tag LOCUS_05520 29800 28769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 31156 29804 gene locus_tag LOCUS_05530 31156 29804 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496570.1 protein_id gnl|my_center|LOCUS_05530 32466 31156 gene locus_tag LOCUS_05540 gene der 32466 31156 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_05540 33528 32482 gene locus_tag LOCUS_05550 33528 32482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 35076 33538 gene locus_tag LOCUS_05560 35076 33538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 36185 35238 gene locus_tag LOCUS_05570 36185 35238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 39266 36198 gene locus_tag LOCUS_05580 39266 36198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 42317 39276 gene locus_tag LOCUS_05590 42317 39276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 43633 42473 gene locus_tag LOCUS_05600 gene porV 43633 42473 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_05600 47894 43905 gene locus_tag LOCUS_05610 gene porU 47894 43905 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_05610 48921 48286 gene locus_tag LOCUS_05620 gene nth 48921 48286 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895383.1 protein_id gnl|my_center|LOCUS_05620 49208 49522 gene locus_tag LOCUS_05630 49208 49522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 49576 50478 gene locus_tag LOCUS_05640 49576 50478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 50597 51448 gene locus_tag LOCUS_05650 50597 51448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424517.1 protein_id gnl|my_center|LOCUS_05650 52632 51526 gene locus_tag LOCUS_05660 52632 51526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 53482 52625 gene locus_tag LOCUS_05670 gene yhdJ 53482 52625 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000642611.1 protein_id gnl|my_center|LOCUS_05670 54910 53624 gene locus_tag LOCUS_05680 gene hemL 54910 53624 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933753.1 protein_id gnl|my_center|LOCUS_05680 56064 55081 gene locus_tag LOCUS_05690 gene hemB 56064 55081 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881381.1 protein_id gnl|my_center|LOCUS_05690 56679 56161 gene locus_tag LOCUS_05700 56679 56161 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000222818.1 protein_id gnl|my_center|LOCUS_05700 58207 56927 gene locus_tag LOCUS_05710 58207 56927 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_05710 60221 58320 gene locus_tag LOCUS_05720 gene htpG 60221 58320 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939912.1 protein_id gnl|my_center|LOCUS_05720 60332 61519 gene locus_tag LOCUS_05730 60332 61519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 63205 61742 gene locus_tag LOCUS_05740 63205 61742 CDS product potassium/proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941860.1 protein_id gnl|my_center|LOCUS_05740 63329 64885 gene locus_tag LOCUS_05750 63329 64885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 65285 66169 gene locus_tag LOCUS_05760 65285 66169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 66620 67822 gene locus_tag LOCUS_05770 66620 67822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 68044 68961 gene locus_tag LOCUS_05780 68044 68961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 68983 70335 gene locus_tag LOCUS_05790 68983 70335 CDS product nucleoside transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036001.1 protein_id gnl|my_center|LOCUS_05790 70413 71240 gene locus_tag LOCUS_05800 70413 71240 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861146.1 protein_id gnl|my_center|LOCUS_05800 71985 71269 gene locus_tag LOCUS_05810 71985 71269 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721977.1 protein_id gnl|my_center|LOCUS_05810 72444 71992 gene locus_tag LOCUS_05820 72444 71992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582786.1 protein_id gnl|my_center|LOCUS_05820 72527 72925 gene locus_tag LOCUS_05830 72527 72925 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086198.1 protein_id gnl|my_center|LOCUS_05830 74948 73017 gene locus_tag LOCUS_05840 74948 73017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 75835 74960 gene locus_tag LOCUS_05850 75835 74960 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256005.1 protein_id gnl|my_center|LOCUS_05850 76823 75990 gene locus_tag LOCUS_05860 gene menB 76823 75990 CDS product 1,4-dihydroxy-2-naphthoyl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058289.1 protein_id gnl|my_center|LOCUS_05860 77749 76838 gene locus_tag LOCUS_05870 77749 76838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 78936 77938 gene locus_tag LOCUS_05880 78936 77938 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108349.1 protein_id gnl|my_center|LOCUS_05880 80351 78939 gene locus_tag LOCUS_05890 gene dacB 80351 78939 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201838.1 protein_id gnl|my_center|LOCUS_05890 80685 80341 gene locus_tag LOCUS_05900 80685 80341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 80797 81543 gene locus_tag LOCUS_05910 80797 81543 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692397.1 protein_id gnl|my_center|LOCUS_05910 81556 82524 gene locus_tag LOCUS_05920 81556 82524 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_05920 82521 83102 gene locus_tag LOCUS_05930 82521 83102 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_05930 84669 83188 gene locus_tag LOCUS_05940 84669 83188 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_05940 86228 84999 gene locus_tag LOCUS_05950 gene rodA 86228 84999 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926830.1 protein_id gnl|my_center|LOCUS_05950 88077 86233 gene locus_tag LOCUS_05960 gene mrdA 88077 86233 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932253.1 protein_id gnl|my_center|LOCUS_05960 88577 88074 gene locus_tag LOCUS_05970 88577 88074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 89326 88577 gene locus_tag LOCUS_05980 gene mreC 89326 88577 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048032.1 protein_id gnl|my_center|LOCUS_05980 90629 89604 gene locus_tag LOCUS_05990 90629 89604 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404386.1 protein_id gnl|my_center|LOCUS_05990 92336 90732 gene locus_tag LOCUS_06000 92336 90732 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931836.1 protein_id gnl|my_center|LOCUS_06000 92787 94070 gene locus_tag LOCUS_06010 92787 94070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 94930 94436 gene locus_tag LOCUS_06020 94930 94436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 95191 95736 gene locus_tag LOCUS_06030 95191 95736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 95849 98044 gene locus_tag LOCUS_06040 95849 98044 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787236.1 protein_id gnl|my_center|LOCUS_06040 98085 98522 gene locus_tag LOCUS_06050 98085 98522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 98804 98619 gene locus_tag LOCUS_06060 98804 98619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 98946 99293 gene locus_tag LOCUS_06070 98946 99293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 99295 100248 gene locus_tag LOCUS_06080 gene trxB 99295 100248 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003416869.1 protein_id gnl|my_center|LOCUS_06080 102453 100603 gene locus_tag LOCUS_06090 102453 100603 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963046.1 protein_id gnl|my_center|LOCUS_06090 103956 102646 gene locus_tag LOCUS_06100 gene menC 103956 102646 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990009.1 protein_id gnl|my_center|LOCUS_06100 105375 104335 gene locus_tag LOCUS_06110 105375 104335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 105929 108811 gene locus_tag LOCUS_06120 105929 108811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 111029 110954 gene locus_tag LOCUS_t00070 111029 110954 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 111206 111131 gene locus_tag LOCUS_t00080 111206 111131 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 114914 111276 gene locus_tag LOCUS_06130 114914 111276 CDS product multifunctional oxoglutarate decarboxylase/oxoglutarate dehydrogenase thiamine pyrophosphate-binding subunit/dihydrolipoyllysine-residue succinyltransferase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403927.1 protein_id gnl|my_center|LOCUS_06130 115045 115698 gene locus_tag LOCUS_06140 gene pdxH 115045 115698 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188935.1 protein_id gnl|my_center|LOCUS_06140 116750 115893 gene locus_tag LOCUS_06150 116750 115893 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015839.1 protein_id gnl|my_center|LOCUS_06150 116959 117582 gene locus_tag LOCUS_06160 116959 117582 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866995.1 protein_id gnl|my_center|LOCUS_06160 117569 118546 gene locus_tag LOCUS_06170 117569 118546 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943449.1 protein_id gnl|my_center|LOCUS_06170 118543 119481 gene locus_tag LOCUS_06180 118543 119481 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_06180 119483 120805 gene locus_tag LOCUS_06190 119483 120805 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_06190 120807 121547 gene locus_tag LOCUS_06200 120807 121547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 121549 122682 gene locus_tag LOCUS_06210 121549 122682 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393399.1 protein_id gnl|my_center|LOCUS_06210 122684 123814 gene locus_tag LOCUS_06220 122684 123814 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_06220 124982 123912 gene locus_tag LOCUS_06230 124982 123912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 127215 124984 gene locus_tag LOCUS_06240 127215 124984 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_06240 128730 127429 gene locus_tag LOCUS_06250 128730 127429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 129966 128785 gene locus_tag LOCUS_06260 129966 128785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 131075 130056 gene locus_tag LOCUS_06270 131075 130056 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765856.1 protein_id gnl|my_center|LOCUS_06270 133191 131098 gene locus_tag LOCUS_06280 133191 131098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 136231 133178 gene locus_tag LOCUS_06290 136231 133178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 138646 136427 gene locus_tag LOCUS_06300 138646 136427 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921395.1 protein_id gnl|my_center|LOCUS_06300 140197 139322 gene locus_tag LOCUS_06310 140197 139322 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838999.1 protein_id gnl|my_center|LOCUS_06310 141112 140330 gene locus_tag LOCUS_06320 141112 140330 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704187.1 protein_id gnl|my_center|LOCUS_06320 142143 141109 gene locus_tag LOCUS_06330 gene amrS 142143 141109 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_06330 143736 142252 gene locus_tag LOCUS_06340 gene pyk 143736 142252 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_06340 144064 144252 gene locus_tag LOCUS_06350 144064 144252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 144514 146367 gene locus_tag LOCUS_06360 144514 146367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 148883 146364 gene locus_tag LOCUS_06370 148883 146364 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792370.1 protein_id gnl|my_center|LOCUS_06370 149165 148929 gene locus_tag LOCUS_06380 149165 148929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 150642 149647 gene locus_tag LOCUS_06390 gene porQ 150642 149647 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_06390 153467 150663 gene locus_tag LOCUS_06400 153467 150663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 155943 153487 gene locus_tag LOCUS_06410 155943 153487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 156807 155956 gene locus_tag LOCUS_06420 156807 155956 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289254.1 protein_id gnl|my_center|LOCUS_06420 157981 156866 gene locus_tag LOCUS_06430 157981 156866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 158848 157997 gene locus_tag LOCUS_06440 158848 157997 CDS product cyanophycinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942561.1 protein_id gnl|my_center|LOCUS_06440 159951 158845 gene locus_tag LOCUS_06450 159951 158845 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861987.1 protein_id gnl|my_center|LOCUS_06450 160760 161893 gene locus_tag LOCUS_06460 160760 161893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 162044 162952 gene locus_tag LOCUS_06470 gene cysK 162044 162952 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645000.1 protein_id gnl|my_center|LOCUS_06470 163183 163605 gene locus_tag LOCUS_06480 163183 163605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 163607 163846 gene locus_tag LOCUS_06490 163607 163846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 163849 165048 gene locus_tag LOCUS_06500 163849 165048 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202154.1 protein_id gnl|my_center|LOCUS_06500 166383 165229 gene locus_tag LOCUS_06510 166383 165229 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048110.1 protein_id gnl|my_center|LOCUS_06510 168586 166484 gene locus_tag LOCUS_06520 168586 166484 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073344531.1 protein_id gnl|my_center|LOCUS_06520 171627 169153 gene locus_tag LOCUS_06530 171627 169153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 171988 172941 gene locus_tag LOCUS_06540 171988 172941 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057545.1 protein_id gnl|my_center|LOCUS_06540 174684 173251 gene locus_tag LOCUS_06550 174684 173251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 178221 175105 gene locus_tag LOCUS_06560 178221 175105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 178990 178793 gene locus_tag LOCUS_06570 178990 178793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 180776 179757 gene locus_tag LOCUS_06580 180776 179757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 184130 181278 gene locus_tag LOCUS_06590 184130 181278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 184274 184283 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 185533 184340 gene locus_tag LOCUS_06600 185533 184340 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_06600 186471 185725 gene locus_tag LOCUS_06610 186471 185725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 189621 186664 gene locus_tag LOCUS_06620 189621 186664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 190232 190840 gene locus_tag LOCUS_06630 190232 190840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 191062 191135 gene locus_tag LOCUS_t00090 191062 191135 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 192203 191292 gene locus_tag LOCUS_06640 192203 191292 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259191.1 protein_id gnl|my_center|LOCUS_06640 192361 192200 gene locus_tag LOCUS_06650 192361 192200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 192715 194934 gene locus_tag LOCUS_06660 192715 194934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 195012 195644 gene locus_tag LOCUS_06670 195012 195644 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004184839.1 protein_id gnl|my_center|LOCUS_06670 195762 196124 gene locus_tag LOCUS_06680 195762 196124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 199293 196822 gene locus_tag LOCUS_06690 199293 196822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 199596 199673 gene locus_tag LOCUS_t00100 199596 199673 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 199698 200990 gene locus_tag LOCUS_06700 gene eno 199698 200990 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942923.1 protein_id gnl|my_center|LOCUS_06700 203969 201162 gene locus_tag LOCUS_06710 gene uvrA 203969 201162 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000045563.1 protein_id gnl|my_center|LOCUS_06710 204264 204896 gene locus_tag LOCUS_06720 204264 204896 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905752.1 protein_id gnl|my_center|LOCUS_06720 205541 204942 gene locus_tag LOCUS_06730 205541 204942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 205679 207163 gene locus_tag LOCUS_06740 205679 207163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 207670 207353 gene locus_tag LOCUS_06750 207670 207353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 208777 207818 gene locus_tag LOCUS_06760 208777 207818 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933874.1 protein_id gnl|my_center|LOCUS_06760 210210 209014 gene locus_tag LOCUS_06770 210210 209014 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933875.1 protein_id gnl|my_center|LOCUS_06770 211311 210319 gene locus_tag LOCUS_06780 gene gap 211311 210319 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933146.1 protein_id gnl|my_center|LOCUS_06780 211586 211389 gene locus_tag LOCUS_06790 211586 211389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 211526 212206 gene locus_tag LOCUS_06800 211526 212206 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584159.1 protein_id gnl|my_center|LOCUS_06800 212210 213031 gene locus_tag LOCUS_06810 212210 213031 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392599.1 protein_id gnl|my_center|LOCUS_06810 213248 213715 gene locus_tag LOCUS_06820 gene ribE 213248 213715 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_06820 213866 216073 gene locus_tag LOCUS_06830 213866 216073 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_06830 218911 216080 gene locus_tag LOCUS_06840 218911 216080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 219343 218921 gene locus_tag LOCUS_06850 219343 218921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 221185 219641 gene locus_tag LOCUS_06860 221185 219641 CDS product NapC/NirT family cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943871.1 protein_id gnl|my_center|LOCUS_06860 222637 221204 gene locus_tag LOCUS_06870 222637 221204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 223217 225829 gene locus_tag LOCUS_06880 223217 225829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 227040 226222 gene locus_tag LOCUS_06890 227040 226222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 228100 227042 gene locus_tag LOCUS_06900 228100 227042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 229739 228216 gene locus_tag LOCUS_06910 229739 228216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 230952 230128 gene locus_tag LOCUS_06920 230952 230128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 231746 231303 gene locus_tag LOCUS_06930 231746 231303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 232654 232001 gene locus_tag LOCUS_06940 232654 232001 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090624.1 protein_id gnl|my_center|LOCUS_06940 234069 232924 gene locus_tag LOCUS_06950 234069 232924 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_06950 234202 235530 gene locus_tag LOCUS_06960 234202 235530 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_06960 235531 236478 gene locus_tag LOCUS_06970 235531 236478 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_06970 236500 237060 gene locus_tag LOCUS_06980 gene def 236500 237060 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404043.1 protein_id gnl|my_center|LOCUS_06980 237125 237224 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 237291 238187 gene locus_tag LOCUS_06990 gene fmt 237291 238187 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_06990 238187 238609 gene locus_tag LOCUS_07000 238187 238609 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920363.1 protein_id gnl|my_center|LOCUS_07000 238612 238632 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 240447 238792 gene locus_tag LOCUS_07010 240447 238792 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_07010 241652 240489 gene locus_tag LOCUS_07020 241652 240489 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816051.1 protein_id gnl|my_center|LOCUS_07020 242701 241739 gene locus_tag LOCUS_07030 gene meaB 242701 241739 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_07030 243273 242701 gene locus_tag LOCUS_07040 gene nadD 243273 242701 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_07040 243974 243273 gene locus_tag LOCUS_07050 243974 243273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 244974 244060 gene locus_tag LOCUS_07060 244974 244060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 246252 245008 gene locus_tag LOCUS_07070 246252 245008 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839941.1 protein_id gnl|my_center|LOCUS_07070 247184 246249 gene locus_tag LOCUS_07080 247184 246249 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405383.1 protein_id gnl|my_center|LOCUS_07080 248122 248487 gene locus_tag LOCUS_07090 248122 248487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 248606 248532 gene locus_tag LOCUS_t00110 248606 248532 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 248990 250069 gene locus_tag LOCUS_07100 248990 250069 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784707.1 protein_id gnl|my_center|LOCUS_07100 250066 253143 gene locus_tag LOCUS_07110 250066 253143 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_119656495.1 protein_id gnl|my_center|LOCUS_07110 255898 253523 gene locus_tag LOCUS_07120 255898 253523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 256933 256283 gene locus_tag LOCUS_07130 256933 256283 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_07130 258149 256923 gene locus_tag LOCUS_07140 gene aroC 258149 256923 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879991.1 protein_id gnl|my_center|LOCUS_07140 259774 258290 gene locus_tag LOCUS_07150 259774 258290 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404792.1 protein_id gnl|my_center|LOCUS_07150 260708 259827 gene locus_tag LOCUS_07160 260708 259827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 261712 260708 gene locus_tag LOCUS_07170 gene mtnA 261712 260708 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925400.1 protein_id gnl|my_center|LOCUS_07170 262616 261702 gene locus_tag LOCUS_07180 262616 261702 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_07180 263279 262818 gene locus_tag LOCUS_07190 263279 262818 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771224.1 protein_id gnl|my_center|LOCUS_07190 266764 263297 gene locus_tag LOCUS_07200 266764 263297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840147.1 protein_id gnl|my_center|LOCUS_07200 267998 266778 gene locus_tag LOCUS_07210 gene waaC 267998 266778 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_07210 269478 267961 gene locus_tag LOCUS_07220 gene murJ 269478 267961 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582940.1 protein_id gnl|my_center|LOCUS_07220 270627 269503 gene locus_tag LOCUS_07230 270627 269503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 272132 270624 gene locus_tag LOCUS_07240 272132 270624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 274458 272236 gene locus_tag LOCUS_07250 gene wzc 274458 272236 CDS product tyrosine-protein kinase Wzc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097881.1 protein_id gnl|my_center|LOCUS_07250 275036 274467 gene locus_tag LOCUS_07260 275036 274467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 275960 275097 gene locus_tag LOCUS_07270 275960 275097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 276494 275967 gene locus_tag LOCUS_07280 276494 275967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 277362 276766 gene locus_tag LOCUS_07290 277362 276766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 278105 277347 gene locus_tag LOCUS_07300 278105 277347 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932718.1 protein_id gnl|my_center|LOCUS_07300 278695 278102 gene locus_tag LOCUS_07310 gene recR 278695 278102 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975321.1 protein_id gnl|my_center|LOCUS_07310 279107 278775 gene locus_tag LOCUS_07320 279107 278775 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_07320 279213 279827 gene locus_tag LOCUS_07330 279213 279827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 279828 280502 gene locus_tag LOCUS_07340 279828 280502 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838510.1 protein_id gnl|my_center|LOCUS_07340 280637 281359 gene locus_tag LOCUS_07350 gene pssA 280637 281359 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933008.1 protein_id gnl|my_center|LOCUS_07350 281430 281624 gene locus_tag LOCUS_07360 gene tatA 281430 281624 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_07360 281780 283279 gene locus_tag LOCUS_07370 gene gatA 281780 283279 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812377.1 protein_id gnl|my_center|LOCUS_07370 284485 283271 gene locus_tag LOCUS_07380 284485 283271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 284832 284497 gene locus_tag LOCUS_07390 284832 284497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 285986 284832 gene locus_tag LOCUS_07400 gene tgt 285986 284832 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_07400 287162 286251 gene locus_tag LOCUS_07410 gene porV 287162 286251 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_07410 288185 287175 gene locus_tag LOCUS_07420 288185 287175 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840096.1 protein_id gnl|my_center|LOCUS_07420 289779 288187 gene locus_tag LOCUS_07430 289779 288187 CDS product FlgD immunoglobulin-like domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838502.1 protein_id gnl|my_center|LOCUS_07430 290575 289781 gene locus_tag LOCUS_07440 290575 289781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 291699 290725 gene locus_tag LOCUS_07450 291699 290725 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933368.1 protein_id gnl|my_center|LOCUS_07450 292544 291714 gene locus_tag LOCUS_07460 292544 291714 CDS product DUF1207 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933461.1 protein_id gnl|my_center|LOCUS_07460 293700 292612 gene locus_tag LOCUS_07470 293700 292612 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_07470 294329 293688 gene locus_tag LOCUS_07480 294329 293688 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404602.1 protein_id gnl|my_center|LOCUS_07480 295366 294326 gene locus_tag LOCUS_07490 295366 294326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 296454 295462 gene locus_tag LOCUS_07500 296454 295462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 297286 296522 gene locus_tag LOCUS_07510 297286 296522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 298620 297295 gene locus_tag LOCUS_07520 298620 297295 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109228.1 protein_id gnl|my_center|LOCUS_07520 300083 298623 gene locus_tag LOCUS_07530 300083 298623 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767909.1 protein_id gnl|my_center|LOCUS_07530 300486 300091 gene locus_tag LOCUS_07540 300486 300091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 302437 300488 gene locus_tag LOCUS_07550 302437 300488 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986707.1 protein_id gnl|my_center|LOCUS_07550 304253 302802 gene locus_tag LOCUS_07560 304253 302802 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_07560 304928 304362 gene locus_tag LOCUS_07570 304928 304362 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454936.1 protein_id gnl|my_center|LOCUS_07570 307120 304928 gene locus_tag LOCUS_07580 307120 304928 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141815383.1 protein_id gnl|my_center|LOCUS_07580 308334 307249 gene locus_tag LOCUS_07590 308334 307249 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_07590 308763 308416 gene locus_tag LOCUS_07600 308763 308416 CDS product TM2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403069.1 protein_id gnl|my_center|LOCUS_07600 309345 310457 gene locus_tag LOCUS_07610 309345 310457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 311754 310516 gene locus_tag LOCUS_07620 311754 310516 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933019.1 protein_id gnl|my_center|LOCUS_07620 313042 311807 gene locus_tag LOCUS_07630 313042 311807 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405554.1 protein_id gnl|my_center|LOCUS_07630 313794 313039 gene locus_tag LOCUS_07640 313794 313039 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_07640 315199 313910 gene locus_tag LOCUS_07650 315199 313910 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_07650 316746 315415 gene locus_tag LOCUS_07660 316746 315415 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_07660 318328 316889 gene locus_tag LOCUS_07670 318328 316889 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963756.1 protein_id gnl|my_center|LOCUS_07670 320514 318340 gene locus_tag LOCUS_07680 320514 318340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 321751 320486 gene locus_tag LOCUS_07690 gene murA 321751 320486 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932242.1 protein_id gnl|my_center|LOCUS_07690 323667 321763 gene locus_tag LOCUS_07700 323667 321763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 324403 323678 gene locus_tag LOCUS_07710 324403 323678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 325713 324511 gene locus_tag LOCUS_07720 325713 324511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 328991 325995 gene locus_tag LOCUS_07730 328991 325995 CDS product basic secretory protein-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839758.1 protein_id gnl|my_center|LOCUS_07730 330813 329047 gene locus_tag LOCUS_07740 gene ptsP 330813 329047 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_07740 331076 330810 gene locus_tag LOCUS_07750 331076 330810 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_07750 332104 331085 gene locus_tag LOCUS_07760 332104 331085 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931948.1 protein_id gnl|my_center|LOCUS_07760 332193 332292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 333615 332572 gene locus_tag LOCUS_07770 gene fni 333615 332572 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259707.1 protein_id gnl|my_center|LOCUS_07770 335188 334346 gene locus_tag LOCUS_07780 335188 334346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 336003 335185 gene locus_tag LOCUS_07790 336003 335185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 337909 336329 gene locus_tag LOCUS_07800 337909 336329 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_07800 339013 337919 gene locus_tag LOCUS_07810 339013 337919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 340404 339178 gene locus_tag LOCUS_07820 340404 339178 CDS product IS256-like element ISSod18 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071025.1 protein_id gnl|my_center|LOCUS_07820 344311 340841 gene locus_tag LOCUS_07830 344311 340841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 347583 344308 gene locus_tag LOCUS_07840 347583 344308 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_204874017.1 protein_id gnl|my_center|LOCUS_07840 350290 348335 gene locus_tag LOCUS_07850 350290 348335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 351070 350438 gene locus_tag LOCUS_07860 351070 350438 CDS product PIG-L family deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403380.1 protein_id gnl|my_center|LOCUS_07860 351221 351499 gene locus_tag LOCUS_07870 351221 351499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 352499 351453 gene locus_tag LOCUS_07880 352499 351453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 353580 352540 gene locus_tag LOCUS_07890 353580 352540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 355645 354149 gene locus_tag LOCUS_07900 355645 354149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 356431 355658 gene locus_tag LOCUS_07910 356431 355658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 357236 356424 gene locus_tag LOCUS_07920 357236 356424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 359262 357253 gene locus_tag LOCUS_07930 359262 357253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 360306 359263 gene locus_tag LOCUS_07940 gene wecB 360306 359263 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_07940 361307 360303 gene locus_tag LOCUS_07950 361307 360303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 <362764 361485 gene locus_tag LOCUS_07960 <362764 361485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021092.1:phenylacetate--CoA ligase family protein >Feature sequence03 1665 892 gene locus_tag LOCUS_07970 1665 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226376454.1 protein_id gnl|my_center|LOCUS_07970 2500 1862 gene locus_tag LOCUS_07980 2500 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 3624 2497 gene locus_tag LOCUS_07990 gene pseC 3624 2497 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_07990 4614 3640 gene locus_tag LOCUS_08000 4614 3640 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392272.1 protein_id gnl|my_center|LOCUS_08000 5746 4607 gene locus_tag LOCUS_08010 gene cap8G 5746 4607 CDS product type 8 capsular polysaccharide synthesis protein Cap8G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413171.1 protein_id gnl|my_center|LOCUS_08010 6865 5750 gene locus_tag LOCUS_08020 6865 5750 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963418.1 protein_id gnl|my_center|LOCUS_08020 7905 6868 gene locus_tag LOCUS_08030 7905 6868 CDS product polysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000475901.1 protein_id gnl|my_center|LOCUS_08030 8848 7919 gene locus_tag LOCUS_08040 8848 7919 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_08040 9027 8845 gene locus_tag LOCUS_08050 9027 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 10328 9024 gene locus_tag LOCUS_08060 gene tviB 10328 9024 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_08060 11523 10351 gene locus_tag LOCUS_08070 11523 10351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 14241 12082 gene locus_tag LOCUS_08080 14241 12082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 16689 14626 gene locus_tag LOCUS_08090 16689 14626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 19820 16860 gene locus_tag LOCUS_08100 19820 16860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 20659 20273 gene locus_tag LOCUS_08110 20659 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 20851 20666 gene locus_tag LOCUS_08120 20851 20666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 21290 22453 gene locus_tag LOCUS_08130 21290 22453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 23225 22740 gene locus_tag LOCUS_08140 23225 22740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 23850 23293 gene locus_tag LOCUS_08150 23850 23293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 24438 23962 gene locus_tag LOCUS_08160 24438 23962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 25311 24838 gene locus_tag LOCUS_08170 25311 24838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 26049 25510 gene locus_tag LOCUS_08180 26049 25510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 26573 26100 gene locus_tag LOCUS_08190 26573 26100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 27374 26712 gene locus_tag LOCUS_08200 27374 26712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 27974 27468 gene locus_tag LOCUS_08210 27974 27468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 28178 28522 gene locus_tag LOCUS_08220 28178 28522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 28612 29409 gene locus_tag LOCUS_08230 28612 29409 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_08230 29751 30020 gene locus_tag LOCUS_08240 29751 30020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 31629 30319 gene locus_tag LOCUS_08250 31629 30319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 32494 31631 gene locus_tag LOCUS_08260 32494 31631 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939098.1 protein_id gnl|my_center|LOCUS_08260 33105 32491 gene locus_tag LOCUS_08270 33105 32491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 33417 33109 gene locus_tag LOCUS_08280 33417 33109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 34055 33426 gene locus_tag LOCUS_08290 34055 33426 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792207.1 protein_id gnl|my_center|LOCUS_08290 35704 34052 gene locus_tag LOCUS_08300 gene ctaD 35704 34052 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940894.1 protein_id gnl|my_center|LOCUS_08300 36485 35706 gene locus_tag LOCUS_08310 36485 35706 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258006.1 protein_id gnl|my_center|LOCUS_08310 37418 36501 gene locus_tag LOCUS_08320 37418 36501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 38623 37433 gene locus_tag LOCUS_08330 38623 37433 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453372.1 protein_id gnl|my_center|LOCUS_08330 39779 38613 gene locus_tag LOCUS_08340 39779 38613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 41149 39779 gene locus_tag LOCUS_08350 gene nrfD 41149 39779 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404833.1 protein_id gnl|my_center|LOCUS_08350 44236 41150 gene locus_tag LOCUS_08360 44236 41150 CDS product TAT-variant-translocated molybdopterin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372295.1 protein_id gnl|my_center|LOCUS_08360 44449 44237 gene locus_tag LOCUS_08370 44449 44237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 45029 44463 gene locus_tag LOCUS_08380 45029 44463 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_08380 46740 45373 gene locus_tag LOCUS_08390 46740 45373 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085032097.1 protein_id gnl|my_center|LOCUS_08390 48318 46867 gene locus_tag LOCUS_08400 48318 46867 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942268.1 protein_id gnl|my_center|LOCUS_08400 50371 48629 gene locus_tag LOCUS_08410 50371 48629 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933908.1 protein_id gnl|my_center|LOCUS_08410 50999 50376 gene locus_tag LOCUS_08420 gene tmk 50999 50376 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932982.1 protein_id gnl|my_center|LOCUS_08420 51909 51001 gene locus_tag LOCUS_08430 51909 51001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 52635 51946 gene locus_tag LOCUS_08440 52635 51946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 52928 52647 gene locus_tag LOCUS_08450 gene eutM 52928 52647 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358305.1 protein_id gnl|my_center|LOCUS_08450 54108 52999 gene locus_tag LOCUS_08460 54108 52999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 54703 54113 gene locus_tag LOCUS_08470 54703 54113 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767456.1 protein_id gnl|my_center|LOCUS_08470 54838 55428 gene locus_tag LOCUS_08480 54838 55428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 55581 56171 gene locus_tag LOCUS_08490 55581 56171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 57384 56257 gene locus_tag LOCUS_08500 57384 56257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 59539 57719 gene locus_tag LOCUS_08510 59539 57719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 62556 59821 gene locus_tag LOCUS_08520 62556 59821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 63084 63011 gene locus_tag LOCUS_t00120 63084 63011 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 64472 63285 gene locus_tag LOCUS_08530 64472 63285 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029501.1 protein_id gnl|my_center|LOCUS_08530 65883 64525 gene locus_tag LOCUS_08540 65883 64525 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_08540 67014 66082 gene locus_tag LOCUS_08550 gene argF 67014 66082 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_08550 67968 67018 gene locus_tag LOCUS_08560 gene arcC 67968 67018 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_08560 69284 67965 gene locus_tag LOCUS_08570 69284 67965 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_08570 71133 69301 gene locus_tag LOCUS_08580 gene glmS 71133 69301 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931824.1 protein_id gnl|my_center|LOCUS_08580 71923 71231 gene locus_tag LOCUS_08590 71923 71231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 77695 71942 gene locus_tag LOCUS_08600 77695 71942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 79465 77801 gene locus_tag LOCUS_08610 79465 77801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 80040 79465 gene locus_tag LOCUS_08620 80040 79465 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101302.1 protein_id gnl|my_center|LOCUS_08620 81065 80358 gene locus_tag LOCUS_08630 81065 80358 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000818985.1 protein_id gnl|my_center|LOCUS_08630 81637 81062 gene locus_tag LOCUS_08640 gene folE 81637 81062 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390685.1 protein_id gnl|my_center|LOCUS_08640 82056 81640 gene locus_tag LOCUS_08650 82056 81640 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405497.1 protein_id gnl|my_center|LOCUS_08650 82519 82061 gene locus_tag LOCUS_08660 gene bcp 82519 82061 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932346.1 protein_id gnl|my_center|LOCUS_08660 84213 83137 gene locus_tag LOCUS_08670 gene aroB 84213 83137 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358508.1 protein_id gnl|my_center|LOCUS_08670 84764 84204 gene locus_tag LOCUS_08680 84764 84204 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933072.1 protein_id gnl|my_center|LOCUS_08680 85475 84771 gene locus_tag LOCUS_08690 85475 84771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 87641 85569 gene locus_tag LOCUS_08700 87641 85569 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931897.1 protein_id gnl|my_center|LOCUS_08700 87849 88436 gene locus_tag LOCUS_08710 87849 88436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 89648 88587 gene locus_tag LOCUS_08720 89648 88587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 90412 89648 gene locus_tag LOCUS_08730 gene phnC 90412 89648 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_08730 91248 90409 gene locus_tag LOCUS_08740 91248 90409 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626171.1 protein_id gnl|my_center|LOCUS_08740 97064 91443 gene locus_tag LOCUS_08750 97064 91443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 99609 97165 gene locus_tag LOCUS_08760 99609 97165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 99886 100932 gene locus_tag LOCUS_08770 99886 100932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 100950 101627 gene locus_tag LOCUS_08780 100950 101627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 101783 104170 gene locus_tag LOCUS_08790 101783 104170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 104157 106394 gene locus_tag LOCUS_08800 104157 106394 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841931.1 protein_id gnl|my_center|LOCUS_08800 106366 107004 gene locus_tag LOCUS_08810 106366 107004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 107180 108682 gene locus_tag LOCUS_08820 107180 108682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 109736 108771 gene locus_tag LOCUS_08830 109736 108771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 109892 110989 gene locus_tag LOCUS_08840 109892 110989 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763530.1 protein_id gnl|my_center|LOCUS_08840 112161 111151 gene locus_tag LOCUS_08850 112161 111151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 113230 112178 gene locus_tag LOCUS_08860 113230 112178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 114002 113289 gene locus_tag LOCUS_08870 114002 113289 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784668.1 protein_id gnl|my_center|LOCUS_08870 116117 114081 gene locus_tag LOCUS_08880 116117 114081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 116350 116120 gene locus_tag LOCUS_08890 116350 116120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 116795 116331 gene locus_tag LOCUS_08900 116795 116331 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405408.1 protein_id gnl|my_center|LOCUS_08900 117065 118738 gene locus_tag LOCUS_08910 117065 118738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 119329 118928 gene locus_tag LOCUS_08920 119329 118928 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962927.1 protein_id gnl|my_center|LOCUS_08920 120616 119393 gene locus_tag LOCUS_08930 120616 119393 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795896.1 protein_id gnl|my_center|LOCUS_08930 121478 120621 gene locus_tag LOCUS_08940 121478 120621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 122525 121638 gene locus_tag LOCUS_08950 122525 121638 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861057.1 protein_id gnl|my_center|LOCUS_08950 124234 122579 gene locus_tag LOCUS_08960 124234 122579 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257715.1 protein_id gnl|my_center|LOCUS_08960 124696 125412 gene locus_tag LOCUS_08970 124696 125412 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_08970 125409 128444 gene locus_tag LOCUS_08980 125409 128444 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094146567.1 protein_id gnl|my_center|LOCUS_08980 128590 131205 gene locus_tag LOCUS_08990 128590 131205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 133256 131289 gene locus_tag LOCUS_09000 gene mutL 133256 131289 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404457.1 protein_id gnl|my_center|LOCUS_09000 133760 133275 gene locus_tag LOCUS_09010 133760 133275 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189313.1 protein_id gnl|my_center|LOCUS_09010 134811 133972 gene locus_tag LOCUS_09020 134811 133972 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212612.1 protein_id gnl|my_center|LOCUS_09020 136312 135086 gene locus_tag LOCUS_09030 136312 135086 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813072.1 protein_id gnl|my_center|LOCUS_09030 138235 136379 gene locus_tag LOCUS_09040 138235 136379 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_09040 139545 138232 gene locus_tag LOCUS_09050 gene aroA 139545 138232 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083129.1 protein_id gnl|my_center|LOCUS_09050 140564 139968 gene locus_tag LOCUS_09060 140564 139968 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939628.1 protein_id gnl|my_center|LOCUS_09060 140930 140727 gene locus_tag LOCUS_09070 140930 140727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 141795 140920 gene locus_tag LOCUS_09080 141795 140920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 142783 141899 gene locus_tag LOCUS_09090 gene folD 142783 141899 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_09090 143589 142780 gene locus_tag LOCUS_09100 143589 142780 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932049.1 protein_id gnl|my_center|LOCUS_09100 143816 146449 gene locus_tag LOCUS_09110 143816 146449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 146893 147144 gene locus_tag LOCUS_09120 146893 147144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 148170 147436 gene locus_tag LOCUS_09130 gene lptB 148170 147436 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_09130 149786 148305 gene locus_tag LOCUS_09140 149786 148305 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963882.1 protein_id gnl|my_center|LOCUS_09140 150409 149783 gene locus_tag LOCUS_09150 150409 149783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 151583 150525 gene locus_tag LOCUS_09160 151583 150525 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881003.1 protein_id gnl|my_center|LOCUS_09160 152439 151624 gene locus_tag LOCUS_09170 gene kdsA 152439 151624 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013382951.1 protein_id gnl|my_center|LOCUS_09170 153461 152436 gene locus_tag LOCUS_09180 gene ruvB 153461 152436 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_09180 154554 153463 gene locus_tag LOCUS_09190 154554 153463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 155015 154554 gene locus_tag LOCUS_09200 155015 154554 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419733.1 protein_id gnl|my_center|LOCUS_09200 155077 155835 gene locus_tag LOCUS_09210 gene mazG 155077 155835 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785408.1 protein_id gnl|my_center|LOCUS_09210 158724 156202 gene locus_tag LOCUS_09220 158724 156202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 160437 158932 gene locus_tag LOCUS_09230 160437 158932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 161689 160529 gene locus_tag LOCUS_09240 161689 160529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 163701 162604 gene locus_tag LOCUS_09250 163701 162604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 164967 164692 gene locus_tag LOCUS_09260 164967 164692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 167185 165209 gene locus_tag LOCUS_09270 gene tkt 167185 165209 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403054.1 protein_id gnl|my_center|LOCUS_09270 167490 168464 gene locus_tag LOCUS_09280 167490 168464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 171148 168554 gene locus_tag LOCUS_09290 gene mutS 171148 168554 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404353.1 protein_id gnl|my_center|LOCUS_09290 171434 173653 gene locus_tag LOCUS_09300 171434 173653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 173729 175792 gene locus_tag LOCUS_09310 173729 175792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 175798 176256 gene locus_tag LOCUS_09320 175798 176256 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106290.1 protein_id gnl|my_center|LOCUS_09320 176257 176442 gene locus_tag LOCUS_09330 176257 176442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 176439 177896 gene locus_tag LOCUS_09340 176439 177896 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_09340 177889 178566 gene locus_tag LOCUS_09350 177889 178566 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190643.1 protein_id gnl|my_center|LOCUS_09350 178584 181397 gene locus_tag LOCUS_09360 178584 181397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 181394 182428 gene locus_tag LOCUS_09370 181394 182428 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190908.1 protein_id gnl|my_center|LOCUS_09370 182412 183593 gene locus_tag LOCUS_09380 182412 183593 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056995.1 protein_id gnl|my_center|LOCUS_09380 183633 183884 gene locus_tag LOCUS_09390 183633 183884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 183886 185904 gene locus_tag LOCUS_09400 183886 185904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 186166 186005 gene locus_tag LOCUS_09410 186166 186005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 186679 188961 gene locus_tag LOCUS_09420 186679 188961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 189248 191866 gene locus_tag LOCUS_09430 gene clpB 189248 191866 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405536.1 protein_id gnl|my_center|LOCUS_09430 192421 195246 gene locus_tag LOCUS_09440 192421 195246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 199448 195345 gene locus_tag LOCUS_09450 199448 195345 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957290.1 protein_id gnl|my_center|LOCUS_09450 200771 199467 gene locus_tag LOCUS_09460 200771 199467 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082160.1 protein_id gnl|my_center|LOCUS_09460 200870 202357 gene locus_tag LOCUS_09470 gene mnmE 200870 202357 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379284.1 protein_id gnl|my_center|LOCUS_09470 203365 205545 gene locus_tag LOCUS_09480 203365 205545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 205568 206248 gene locus_tag LOCUS_09490 205568 206248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 206245 207183 gene locus_tag LOCUS_09500 gene murQ 206245 207183 CDS product N-acetylmuramic acid 6-phosphate etherase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837885.1 protein_id gnl|my_center|LOCUS_09500 207173 207940 gene locus_tag LOCUS_09510 207173 207940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 208031 211654 gene locus_tag LOCUS_09520 208031 211654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 211956 211729 gene locus_tag LOCUS_09530 211956 211729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 212113 212511 gene locus_tag LOCUS_09540 gene mscL 212113 212511 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_09540 214162 212795 gene locus_tag LOCUS_09550 gene hslU 214162 212795 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932863.1 protein_id gnl|my_center|LOCUS_09550 214716 214174 gene locus_tag LOCUS_09560 gene hslV 214716 214174 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_09560 217548 214813 gene locus_tag LOCUS_09570 217548 214813 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927267.1 protein_id gnl|my_center|LOCUS_09570 219439 217577 gene locus_tag LOCUS_09580 gene yidC 219439 217577 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931700.1 protein_id gnl|my_center|LOCUS_09580 219919 219512 gene locus_tag LOCUS_09590 gene rnpA 219919 219512 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242628.1 protein_id gnl|my_center|LOCUS_09590 220474 221898 gene locus_tag LOCUS_09600 gene dnaA 220474 221898 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931696.1 protein_id gnl|my_center|LOCUS_09600 222223 222843 gene locus_tag LOCUS_09610 222223 222843 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_09610 222856 223854 gene locus_tag LOCUS_09620 222856 223854 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766890.1 protein_id gnl|my_center|LOCUS_09620 226612 224201 gene locus_tag LOCUS_09630 226612 224201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 227563 226925 gene locus_tag LOCUS_09640 227563 226925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 228651 227806 gene locus_tag LOCUS_09650 gene htpX 228651 227806 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942212.1 protein_id gnl|my_center|LOCUS_09650 231088 229079 gene locus_tag LOCUS_09660 231088 229079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 232659 231160 gene locus_tag LOCUS_09670 232659 231160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 232940 232722 gene locus_tag LOCUS_09680 232940 232722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 234139 236046 gene locus_tag LOCUS_09690 gene acs 234139 236046 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_09690 236275 239547 gene locus_tag LOCUS_09700 236275 239547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 239841 239608 gene locus_tag LOCUS_09710 239841 239608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 239897 243484 gene locus_tag LOCUS_09720 gene nifJ 239897 243484 CDS product pyruvate:ferredoxin (flavodoxin) oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870177.1 protein_id gnl|my_center|LOCUS_09720 243525 244517 gene locus_tag LOCUS_09730 243525 244517 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_09730 244846 246849 gene locus_tag LOCUS_09740 244846 246849 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_09740 247425 249119 gene locus_tag LOCUS_09750 247425 249119 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545094.1 protein_id gnl|my_center|LOCUS_09750 249392 251230 gene locus_tag LOCUS_09760 249392 251230 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066403458.1 protein_id gnl|my_center|LOCUS_09760 251251 251895 gene locus_tag LOCUS_09770 251251 251895 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007478804.1 protein_id gnl|my_center|LOCUS_09770 252157 255483 gene locus_tag LOCUS_09780 252157 255483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 256022 255534 gene locus_tag LOCUS_09790 256022 255534 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_09790 257771 256392 gene locus_tag LOCUS_09800 gene mgtE 257771 256392 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933513.1 protein_id gnl|my_center|LOCUS_09800 258041 258113 gene locus_tag LOCUS_t00130 258041 258113 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 258493 258923 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 259867 259166 gene locus_tag LOCUS_09810 259867 259166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 261199 261627 gene locus_tag LOCUS_09820 261199 261627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 261672 262886 gene locus_tag LOCUS_09830 261672 262886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 262919 264232 gene locus_tag LOCUS_09840 262919 264232 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108103.1 protein_id gnl|my_center|LOCUS_09840 264328 267426 gene locus_tag LOCUS_09850 264328 267426 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944011.1 protein_id gnl|my_center|LOCUS_09850 267895 268980 gene locus_tag LOCUS_09860 267895 268980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 269235 270320 gene locus_tag LOCUS_09870 269235 270320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 270594 271154 gene locus_tag LOCUS_09880 270594 271154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 271312 271776 gene locus_tag LOCUS_09890 271312 271776 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001110309.1 protein_id gnl|my_center|LOCUS_09890 271866 272258 gene locus_tag LOCUS_09900 271866 272258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 272269 272898 gene locus_tag LOCUS_09910 gene upp 272269 272898 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360558.1 protein_id gnl|my_center|LOCUS_09910 274451 273225 gene locus_tag LOCUS_09920 gene megL 274451 273225 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_09920 276091 274724 gene locus_tag LOCUS_09930 276091 274724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 277594 276098 gene locus_tag LOCUS_09940 277594 276098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 277739 277509 gene locus_tag LOCUS_09950 277739 277509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 279573 279352 gene locus_tag LOCUS_09960 279573 279352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 279638 281530 gene locus_tag LOCUS_09970 279638 281530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 281477 281525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 281912 282268 gene locus_tag LOCUS_09980 281912 282268 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_09980 282270 282914 gene locus_tag LOCUS_09990 282270 282914 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028708.1 protein_id gnl|my_center|LOCUS_09990 283221 283320 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 284400 283399 gene locus_tag LOCUS_10000 284400 283399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 286704 285502 gene locus_tag LOCUS_10010 286704 285502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 288034 287597 gene locus_tag LOCUS_10020 288034 287597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 289658 288534 gene locus_tag LOCUS_10030 gene gmd 289658 288534 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941289.1 protein_id gnl|my_center|LOCUS_10030 290454 289789 gene locus_tag LOCUS_10040 290454 289789 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_10040 291172 290516 gene locus_tag LOCUS_10050 gene ccmA 291172 290516 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_10050 293127 291487 gene locus_tag LOCUS_10060 293127 291487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 293628 293167 gene locus_tag LOCUS_10070 293628 293167 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404589.1 protein_id gnl|my_center|LOCUS_10070 294601 293834 gene locus_tag LOCUS_10080 gene bamD 294601 293834 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926787.1 protein_id gnl|my_center|LOCUS_10080 294981 296156 gene locus_tag LOCUS_10090 294981 296156 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103065.1 protein_id gnl|my_center|LOCUS_10090 296512 297621 gene locus_tag LOCUS_10100 gene dnaN 296512 297621 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_10100 297618 298721 gene locus_tag LOCUS_10110 297618 298721 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402853.1 protein_id gnl|my_center|LOCUS_10110 299011 299301 gene locus_tag LOCUS_10120 299011 299301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 299406 301493 gene locus_tag LOCUS_10130 gene gyrB 299406 301493 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933913.1 protein_id gnl|my_center|LOCUS_10130 301691 304186 gene locus_tag LOCUS_10140 gene gyrA 301691 304186 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931835.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence04 19 1106 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttagtggatttgccttgacttaaaaggattacgac 1452 2558 gene locus_tag LOCUS_10150 1452 2558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 3860 2598 gene locus_tag LOCUS_10160 3860 2598 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328867.1 protein_id gnl|my_center|LOCUS_10160 4217 5281 gene locus_tag LOCUS_10170 gene corA 4217 5281 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942048.1 protein_id gnl|my_center|LOCUS_10170 5477 7174 gene locus_tag LOCUS_10180 5477 7174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 7842 7351 gene locus_tag LOCUS_10190 7842 7351 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250949.1 protein_id gnl|my_center|LOCUS_10190 8125 9003 gene locus_tag LOCUS_10200 gene rfbA 8125 9003 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942725.1 protein_id gnl|my_center|LOCUS_10200 9026 9583 gene locus_tag LOCUS_10210 gene rfbC 9026 9583 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107717.1 protein_id gnl|my_center|LOCUS_10210 9591 12092 gene locus_tag LOCUS_10220 9591 12092 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942708.1 protein_id gnl|my_center|LOCUS_10220 12389 13819 gene locus_tag LOCUS_10230 12389 13819 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259553.1 protein_id gnl|my_center|LOCUS_10230 13936 15216 gene locus_tag LOCUS_10240 13936 15216 CDS product nitrate/sulfonate/bicarbonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259552.1 protein_id gnl|my_center|LOCUS_10240 15416 16204 gene locus_tag LOCUS_10250 15416 16204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946551.1 protein_id gnl|my_center|LOCUS_10250 16425 17579 gene locus_tag LOCUS_10260 16425 17579 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_10260 17576 18718 gene locus_tag LOCUS_10270 17576 18718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 18949 20406 gene locus_tag LOCUS_10280 18949 20406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 20998 20546 gene locus_tag LOCUS_10290 20998 20546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 21197 23884 gene locus_tag LOCUS_10300 21197 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 24666 24238 gene locus_tag LOCUS_10310 24666 24238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 25370 24681 gene locus_tag LOCUS_10320 25370 24681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 26239 25373 gene locus_tag LOCUS_10330 26239 25373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 26643 27233 gene locus_tag LOCUS_10340 26643 27233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 27920 27360 gene locus_tag LOCUS_10350 27920 27360 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797556.1 protein_id gnl|my_center|LOCUS_10350 30281 27933 gene locus_tag LOCUS_10360 30281 27933 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839861.1 protein_id gnl|my_center|LOCUS_10360 30484 31245 gene locus_tag LOCUS_10370 30484 31245 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085274.1 protein_id gnl|my_center|LOCUS_10370 33672 31483 gene locus_tag LOCUS_10380 33672 31483 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246556.1 protein_id gnl|my_center|LOCUS_10380 34039 34899 gene locus_tag LOCUS_10390 34039 34899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 35026 36288 gene locus_tag LOCUS_10400 35026 36288 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063044.1 protein_id gnl|my_center|LOCUS_10400 36360 37448 gene locus_tag LOCUS_10410 gene serC 36360 37448 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000442921.1 protein_id gnl|my_center|LOCUS_10410 37642 38109 gene locus_tag LOCUS_10420 37642 38109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 38253 40844 gene locus_tag LOCUS_10430 gene alaS 38253 40844 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931860.1 protein_id gnl|my_center|LOCUS_10430 41226 41032 gene locus_tag LOCUS_10440 41226 41032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 41741 43120 gene locus_tag LOCUS_10450 41741 43120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 43113 45002 gene locus_tag LOCUS_10460 43113 45002 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211204934.1 protein_id gnl|my_center|LOCUS_10460 45007 47928 gene locus_tag LOCUS_10470 45007 47928 CDS product type III restriction-modification system endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016374.1 protein_id gnl|my_center|LOCUS_10470 48010 48498 gene locus_tag LOCUS_10480 48010 48498 CDS product DUF2321 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440478.1 protein_id gnl|my_center|LOCUS_10480 48665 49609 gene locus_tag LOCUS_10490 48665 49609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 51072 50308 gene locus_tag LOCUS_10500 51072 50308 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372664.1 protein_id gnl|my_center|LOCUS_10500 52299 51226 gene locus_tag LOCUS_10510 52299 51226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 52463 53977 gene locus_tag LOCUS_10520 52463 53977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 55517 53925 gene locus_tag LOCUS_10530 55517 53925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 56591 55575 gene locus_tag LOCUS_10540 56591 55575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 57642 56632 gene locus_tag LOCUS_10550 57642 56632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 58345 57794 gene locus_tag LOCUS_10560 58345 57794 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_10560 59374 58382 gene locus_tag LOCUS_10570 59374 58382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 60851 59364 gene locus_tag LOCUS_10580 60851 59364 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_10580 61038 61496 gene locus_tag LOCUS_10590 61038 61496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 62879 61671 gene locus_tag LOCUS_10600 62879 61671 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022470187.1 protein_id gnl|my_center|LOCUS_10600 64453 63032 gene locus_tag LOCUS_10610 64453 63032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 65057 65989 gene locus_tag LOCUS_10620 65057 65989 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479611.1 protein_id gnl|my_center|LOCUS_10620 66259 67368 gene locus_tag LOCUS_10630 66259 67368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 67594 68109 gene locus_tag LOCUS_10640 67594 68109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 71084 68502 gene locus_tag LOCUS_10650 71084 68502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 72261 71767 gene locus_tag LOCUS_10660 72261 71767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 73550 72258 gene locus_tag LOCUS_10670 73550 72258 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940104.1 protein_id gnl|my_center|LOCUS_10670 73985 74983 gene locus_tag LOCUS_10680 73985 74983 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625950.1 protein_id gnl|my_center|LOCUS_10680 76172 75120 gene locus_tag LOCUS_10690 76172 75120 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_10690 77366 76455 gene locus_tag LOCUS_10700 77366 76455 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_10700 78409 78083 gene locus_tag LOCUS_10710 78409 78083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 79196 78474 gene locus_tag LOCUS_10720 79196 78474 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109158.1 protein_id gnl|my_center|LOCUS_10720 79385 80299 gene locus_tag LOCUS_10730 79385 80299 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684382.1 protein_id gnl|my_center|LOCUS_10730 81881 80403 gene locus_tag LOCUS_10740 81881 80403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 82798 83538 gene locus_tag LOCUS_10750 82798 83538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 83541 86342 gene locus_tag LOCUS_10760 83541 86342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 86465 87490 gene locus_tag LOCUS_10770 86465 87490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 87797 88441 gene locus_tag LOCUS_10780 87797 88441 CDS product type III restriction endonuclease subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389842.1 protein_id gnl|my_center|LOCUS_10780 88965 89972 gene locus_tag LOCUS_10790 88965 89972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 90029 92551 gene locus_tag LOCUS_10800 90029 92551 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033492290.1 protein_id gnl|my_center|LOCUS_10800 92993 94645 gene locus_tag LOCUS_10810 92993 94645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 94838 96106 gene locus_tag LOCUS_10820 94838 96106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 96106 98388 gene locus_tag LOCUS_10830 96106 98388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 98389 99633 gene locus_tag LOCUS_10840 98389 99633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 100011 99700 gene locus_tag LOCUS_10850 100011 99700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 100332 100177 gene locus_tag LOCUS_10860 100332 100177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 100585 101277 gene locus_tag LOCUS_10870 100585 101277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 103497 101428 gene locus_tag LOCUS_10880 gene glgX 103497 101428 CDS product glycogen debranching protein GlgX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706229.1 protein_id gnl|my_center|LOCUS_10880 106052 103596 gene locus_tag LOCUS_10890 106052 103596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 106041 106229 gene locus_tag LOCUS_10900 106041 106229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 107577 106714 gene locus_tag LOCUS_10910 107577 106714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803834.1 protein_id gnl|my_center|LOCUS_10910 107818 108303 gene locus_tag LOCUS_10920 107818 108303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 108422 109591 gene locus_tag LOCUS_10930 108422 109591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 110261 109836 gene locus_tag LOCUS_10940 110261 109836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 111851 110502 gene locus_tag LOCUS_10950 111851 110502 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_10950 112444 111848 gene locus_tag LOCUS_10960 112444 111848 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941233.1 protein_id gnl|my_center|LOCUS_10960 115760 112497 gene locus_tag LOCUS_10970 115760 112497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_10970 116443 117843 gene locus_tag LOCUS_10980 116443 117843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 118636 118073 gene locus_tag LOCUS_10990 118636 118073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 118895 121267 gene locus_tag LOCUS_11000 118895 121267 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_11000 121393 122655 gene locus_tag LOCUS_11010 gene hflX 121393 122655 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_11010 122878 124893 gene locus_tag LOCUS_11020 122878 124893 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942936.1 protein_id gnl|my_center|LOCUS_11020 124890 125846 gene locus_tag LOCUS_11030 124890 125846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 126226 126678 gene locus_tag LOCUS_11040 126226 126678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 126755 127153 gene locus_tag LOCUS_11050 126755 127153 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005419480.1 protein_id gnl|my_center|LOCUS_11050 129003 127252 gene locus_tag LOCUS_11060 129003 127252 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_11060 129126 130505 gene locus_tag LOCUS_11070 gene hemG 129126 130505 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930799.1 protein_id gnl|my_center|LOCUS_11070 130529 132019 gene locus_tag LOCUS_11080 130529 132019 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_11080 133421 132252 gene locus_tag LOCUS_11090 133421 132252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 133711 133541 gene locus_tag LOCUS_11100 133711 133541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 135718 134057 gene locus_tag LOCUS_11110 135718 134057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 135918 136790 gene locus_tag LOCUS_11120 gene dapF 135918 136790 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927135.1 protein_id gnl|my_center|LOCUS_11120 136803 137105 gene locus_tag LOCUS_11130 136803 137105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 137134 137724 gene locus_tag LOCUS_11140 137134 137724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 137771 139540 gene locus_tag LOCUS_11150 gene aspS 137771 139540 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393178.1 protein_id gnl|my_center|LOCUS_11150 141859 139955 gene locus_tag LOCUS_11160 gene pepF 141859 139955 CDS product oligoendopeptidase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967010.1 protein_id gnl|my_center|LOCUS_11160 142443 142691 gene locus_tag LOCUS_11170 142443 142691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 143145 144980 gene locus_tag LOCUS_11180 143145 144980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 144961 145530 gene locus_tag LOCUS_11190 144961 145530 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057311.1 protein_id gnl|my_center|LOCUS_11190 145636 146694 gene locus_tag LOCUS_11200 gene trpD 145636 146694 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_11200 146691 147692 gene locus_tag LOCUS_11210 146691 147692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 147830 148741 gene locus_tag LOCUS_11220 147830 148741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 148738 150339 gene locus_tag LOCUS_11230 148738 150339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 150739 151698 gene locus_tag LOCUS_11240 150739 151698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 154930 151886 gene locus_tag LOCUS_11250 154930 151886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 157228 155105 gene locus_tag LOCUS_11260 157228 155105 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142622.1 protein_id gnl|my_center|LOCUS_11260 158054 157530 gene locus_tag LOCUS_11270 158054 157530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 158589 158059 gene locus_tag LOCUS_11280 158589 158059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_11280 158844 159500 gene locus_tag LOCUS_11290 158844 159500 CDS product FHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761997.1 protein_id gnl|my_center|LOCUS_11290 159543 161186 gene locus_tag LOCUS_11300 159543 161186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 161200 162159 gene locus_tag LOCUS_11310 161200 162159 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_11310 162208 163437 gene locus_tag LOCUS_11320 162208 163437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 163444 164649 gene locus_tag LOCUS_11330 163444 164649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 164904 164707 gene locus_tag LOCUS_11340 164904 164707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 164935 166704 gene locus_tag LOCUS_11350 164935 166704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 169152 167485 gene locus_tag LOCUS_11360 169152 167485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 169554 170753 gene locus_tag LOCUS_11370 169554 170753 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250045.1 protein_id gnl|my_center|LOCUS_11370 170904 172157 gene locus_tag LOCUS_11380 170904 172157 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392573.1 protein_id gnl|my_center|LOCUS_11380 172170 173840 gene locus_tag LOCUS_11390 172170 173840 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403178.1 protein_id gnl|my_center|LOCUS_11390 173864 174919 gene locus_tag LOCUS_11400 gene nuoH 173864 174919 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552781.1 protein_id gnl|my_center|LOCUS_11400 174930 175424 gene locus_tag LOCUS_11410 174930 175424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 177884 175596 gene locus_tag LOCUS_11420 177884 175596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 178217 178723 gene locus_tag LOCUS_11430 178217 178723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 179296 178742 gene locus_tag LOCUS_11440 179296 178742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 182212 179309 gene locus_tag LOCUS_11450 182212 179309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 183118 183801 gene locus_tag LOCUS_11460 183118 183801 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963957.1 protein_id gnl|my_center|LOCUS_11460 183876 184604 gene locus_tag LOCUS_11470 183876 184604 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289836.1 protein_id gnl|my_center|LOCUS_11470 185436 184771 gene locus_tag LOCUS_11480 185436 184771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 187665 185575 gene locus_tag LOCUS_11490 187665 185575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 188384 187962 gene locus_tag LOCUS_11500 188384 187962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 189902 188793 gene locus_tag LOCUS_11510 189902 188793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 192127 189899 gene locus_tag LOCUS_11520 192127 189899 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839979.1 protein_id gnl|my_center|LOCUS_11520 194310 192391 gene locus_tag LOCUS_11530 194310 192391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 194524 195309 gene locus_tag LOCUS_11540 194524 195309 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037756.1 protein_id gnl|my_center|LOCUS_11540 195678 196229 gene locus_tag LOCUS_11550 195678 196229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 198800 196311 gene locus_tag LOCUS_11560 198800 196311 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356699.1 protein_id gnl|my_center|LOCUS_11560 199922 198909 gene locus_tag LOCUS_11570 199922 198909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 200075 200287 gene locus_tag LOCUS_11580 200075 200287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 200253 201707 gene locus_tag LOCUS_11590 200253 201707 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932252.1 protein_id gnl|my_center|LOCUS_11590 202816 201896 gene locus_tag LOCUS_11600 202816 201896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 203721 202813 gene locus_tag LOCUS_11610 203721 202813 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_11610 203757 204884 gene locus_tag LOCUS_11620 203757 204884 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081611101.1 protein_id gnl|my_center|LOCUS_11620 205921 205007 gene locus_tag LOCUS_11630 gene rfbD 205921 205007 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404591.1 protein_id gnl|my_center|LOCUS_11630 206954 205893 gene locus_tag LOCUS_11640 206954 205893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 207774 207873 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 208245 209393 gene locus_tag LOCUS_11650 208245 209393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 209405 211165 gene locus_tag LOCUS_11660 209405 211165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 211858 213453 gene locus_tag LOCUS_11670 211858 213453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 213492 217475 gene locus_tag LOCUS_11680 213492 217475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 217487 219187 gene locus_tag LOCUS_11690 217487 219187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 221935 219476 gene locus_tag LOCUS_11700 221935 219476 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_11700 222139 223338 gene locus_tag LOCUS_11710 222139 223338 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941822.1 protein_id gnl|my_center|LOCUS_11710 223351 224034 gene locus_tag LOCUS_11720 223351 224034 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941823.1 protein_id gnl|my_center|LOCUS_11720 224031 225191 gene locus_tag LOCUS_11730 224031 225191 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941824.1 protein_id gnl|my_center|LOCUS_11730 225267 226433 gene locus_tag LOCUS_11740 225267 226433 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941825.1 protein_id gnl|my_center|LOCUS_11740 226677 228218 gene locus_tag LOCUS_11750 226677 228218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 228256 229260 gene locus_tag LOCUS_11760 gene aroF 228256 229260 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256593.1 protein_id gnl|my_center|LOCUS_11760 229691 229329 gene locus_tag LOCUS_11770 229691 229329 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142285.1 protein_id gnl|my_center|LOCUS_11770 230868 229678 gene locus_tag LOCUS_11780 230868 229678 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_11780 233158 231161 gene locus_tag LOCUS_11790 233158 231161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 235115 233193 gene locus_tag LOCUS_11800 235115 233193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 235363 238032 gene locus_tag LOCUS_11810 gene aceE 235363 238032 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119356.1 protein_id gnl|my_center|LOCUS_11810 238049 239923 gene locus_tag LOCUS_11820 gene aceF 238049 239923 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035790.1 protein_id gnl|my_center|LOCUS_11820 239934 241346 gene locus_tag LOCUS_11830 gene lpdA 239934 241346 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118277.1 protein_id gnl|my_center|LOCUS_11830 241691 243634 gene locus_tag LOCUS_11840 241691 243634 CDS product alpha-ketoacid dehydrogenase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943646.1 protein_id gnl|my_center|LOCUS_11840 243868 246126 gene locus_tag LOCUS_11850 243868 246126 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863308.1 protein_id gnl|my_center|LOCUS_11850 246225 246395 gene locus_tag LOCUS_11860 246225 246395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 246399 248621 gene locus_tag LOCUS_11870 246399 248621 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839782.1 protein_id gnl|my_center|LOCUS_11870 248785 251562 gene locus_tag LOCUS_11880 248785 251562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 251577 255089 gene locus_tag LOCUS_11890 251577 255089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 255104 256111 gene locus_tag LOCUS_11900 gene porV 255104 256111 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_11900 256176 257624 gene locus_tag LOCUS_11910 256176 257624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 260275 258419 gene locus_tag LOCUS_11920 260275 258419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 260425 262218 gene locus_tag LOCUS_11930 260425 262218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 262777 262454 gene locus_tag LOCUS_11940 262777 262454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 263322 264878 gene locus_tag LOCUS_11950 263322 264878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 264880 265860 gene locus_tag LOCUS_11960 264880 265860 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_11960 265857 266417 gene locus_tag LOCUS_11970 265857 266417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 266414 267124 gene locus_tag LOCUS_11980 266414 267124 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_11980 267126 267698 gene locus_tag LOCUS_11990 gene rsxA 267126 267698 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419046.1 protein_id gnl|my_center|LOCUS_11990 267972 268679 gene locus_tag LOCUS_12000 267972 268679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 268756 269700 gene locus_tag LOCUS_12010 268756 269700 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081951.1 protein_id gnl|my_center|LOCUS_12010 269702 270505 gene locus_tag LOCUS_12020 269702 270505 CDS product RnfABCDGE type electron transport complex subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583458.1 protein_id gnl|my_center|LOCUS_12020 270699 271154 gene locus_tag LOCUS_12030 270699 271154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 271168 272031 gene locus_tag LOCUS_12040 271168 272031 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_12040 272051 273475 gene locus_tag LOCUS_12050 gene gltA 272051 273475 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926868.1 protein_id gnl|my_center|LOCUS_12050 273742 273578 gene locus_tag LOCUS_12060 273742 273578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 273907 275043 gene locus_tag LOCUS_12070 273907 275043 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_12070 275990 275220 gene locus_tag LOCUS_12080 275990 275220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 276481 276128 gene locus_tag LOCUS_12090 276481 276128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 276752 278578 gene locus_tag LOCUS_12100 276752 278578 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_12100 278575 279375 gene locus_tag LOCUS_12110 278575 279375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 279476 280840 gene locus_tag LOCUS_12120 279476 280840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 281411 281725 gene locus_tag LOCUS_12130 281411 281725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 281779 282681 gene locus_tag LOCUS_12140 281779 282681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 283407 284897 gene locus_tag LOCUS_12150 283407 284897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 285023 287356 gene locus_tag LOCUS_12160 285023 287356 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015613294.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence05 679 131 gene locus_tag LOCUS_12170 gene msrA 679 131 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_12170 1998 814 gene locus_tag LOCUS_12180 1998 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 4577 2025 gene locus_tag LOCUS_12190 4577 2025 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055229518.1 protein_id gnl|my_center|LOCUS_12190 4792 4983 gene locus_tag LOCUS_12200 4792 4983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 5072 5974 gene locus_tag LOCUS_12210 5072 5974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5988 7640 gene locus_tag LOCUS_12220 5988 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 11240 7923 gene locus_tag LOCUS_12230 11240 7923 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_12230 11853 11470 gene locus_tag LOCUS_12240 11853 11470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 12225 13778 gene locus_tag LOCUS_12250 12225 13778 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142469.1 protein_id gnl|my_center|LOCUS_12250 14020 14733 gene locus_tag LOCUS_12260 14020 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 14995 15068 gene locus_tag LOCUS_t00140 14995 15068 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16333 15188 gene locus_tag LOCUS_12270 16333 15188 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_12270 16688 16323 gene locus_tag LOCUS_12280 16688 16323 CDS product MmcQ/YjbR family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764003.1 protein_id gnl|my_center|LOCUS_12280 18145 16790 gene locus_tag LOCUS_12290 gene glmM 18145 16790 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109034.1 protein_id gnl|my_center|LOCUS_12290 18341 19060 gene locus_tag LOCUS_12300 18341 19060 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869727.1 protein_id gnl|my_center|LOCUS_12300 19230 19940 gene locus_tag LOCUS_12310 19230 19940 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_12310 19979 21853 gene locus_tag LOCUS_12320 19979 21853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 22523 23824 gene locus_tag LOCUS_12330 22523 23824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 24644 26701 gene locus_tag LOCUS_12340 24644 26701 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679967.1 protein_id gnl|my_center|LOCUS_12340 28294 26825 gene locus_tag LOCUS_12350 28294 26825 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_12350 28413 28601 gene locus_tag LOCUS_12360 28413 28601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 28690 29607 gene locus_tag LOCUS_12370 28690 29607 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403152.1 protein_id gnl|my_center|LOCUS_12370 29852 31135 gene locus_tag LOCUS_12380 29852 31135 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784237.1 protein_id gnl|my_center|LOCUS_12380 31139 34012 gene locus_tag LOCUS_12390 31139 34012 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403151.1 protein_id gnl|my_center|LOCUS_12390 34248 35078 gene locus_tag LOCUS_12400 34248 35078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 35280 36584 gene locus_tag LOCUS_12410 35280 36584 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933159.1 protein_id gnl|my_center|LOCUS_12410 36621 37529 gene locus_tag LOCUS_12420 gene era 36621 37529 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760765.1 protein_id gnl|my_center|LOCUS_12420 37669 38601 gene locus_tag LOCUS_12430 37669 38601 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468414.1 protein_id gnl|my_center|LOCUS_12430 38737 39012 gene locus_tag LOCUS_12440 38737 39012 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583748.1 protein_id gnl|my_center|LOCUS_12440 39009 39497 gene locus_tag LOCUS_12450 gene ispF 39009 39497 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933265.1 protein_id gnl|my_center|LOCUS_12450 39499 41214 gene locus_tag LOCUS_12460 gene lnt 39499 41214 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933164.1 protein_id gnl|my_center|LOCUS_12460 41268 41654 gene locus_tag LOCUS_12470 41268 41654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 41698 42573 gene locus_tag LOCUS_12480 41698 42573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 42570 44921 gene locus_tag LOCUS_12490 42570 44921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 46505 45159 gene locus_tag LOCUS_12500 gene cpsG 46505 45159 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001350528.1 protein_id gnl|my_center|LOCUS_12500 47096 46845 gene locus_tag LOCUS_12510 47096 46845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 47642 47651 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 48035 49567 gene locus_tag LOCUS_12520 48035 49567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 49550 49559 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 49585 49872 gene locus_tag LOCUS_12530 49585 49872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 50046 51080 gene locus_tag LOCUS_12540 50046 51080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 51573 53210 gene locus_tag LOCUS_12550 51573 53210 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_12550 53292 55379 gene locus_tag LOCUS_12560 53292 55379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 55363 57831 gene locus_tag LOCUS_12570 55363 57831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 57917 58681 gene locus_tag LOCUS_12580 57917 58681 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003397169.1 protein_id gnl|my_center|LOCUS_12580 59329 58772 gene locus_tag LOCUS_12590 gene ruvA 59329 58772 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_12590 60158 59619 gene locus_tag LOCUS_12600 gene ruvC 60158 59619 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933328.1 protein_id gnl|my_center|LOCUS_12600 62390 60306 gene locus_tag LOCUS_12610 62390 60306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 62448 62601 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ttaattttcaagcaacaaat 62616 64022 gene locus_tag LOCUS_12620 62616 64022 CDS product YfcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889640.1 protein_id gnl|my_center|LOCUS_12620 64224 64622 gene locus_tag LOCUS_12630 64224 64622 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357963.1 protein_id gnl|my_center|LOCUS_12630 64690 65073 gene locus_tag LOCUS_12640 64690 65073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 65260 65790 gene locus_tag LOCUS_12650 65260 65790 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405033.1 protein_id gnl|my_center|LOCUS_12650 65863 66405 gene locus_tag LOCUS_12660 65863 66405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 66440 68443 gene locus_tag LOCUS_12670 66440 68443 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933422.1 protein_id gnl|my_center|LOCUS_12670 68917 70131 gene locus_tag LOCUS_12680 68917 70131 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964458.1 protein_id gnl|my_center|LOCUS_12680 70276 71070 gene locus_tag LOCUS_12690 70276 71070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 71531 71986 gene locus_tag LOCUS_12700 71531 71986 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933079.1 protein_id gnl|my_center|LOCUS_12700 72170 73597 gene locus_tag LOCUS_12710 gene glnA 72170 73597 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_12710 77233 73889 gene locus_tag LOCUS_12720 77233 73889 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_12720 77318 77417 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 78223 77525 gene locus_tag LOCUS_12730 78223 77525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 79202 78366 gene locus_tag LOCUS_12740 79202 78366 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_030867471.1 protein_id gnl|my_center|LOCUS_12740 79972 79199 gene locus_tag LOCUS_12750 79972 79199 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128974497.1 protein_id gnl|my_center|LOCUS_12750 81159 80392 gene locus_tag LOCUS_12760 81159 80392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 81506 83557 gene locus_tag LOCUS_12770 gene metG 81506 83557 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767220.1 protein_id gnl|my_center|LOCUS_12770 83560 85314 gene locus_tag LOCUS_12780 83560 85314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 85299 86792 gene locus_tag LOCUS_12790 85299 86792 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_12790 86957 88957 gene locus_tag LOCUS_12800 86957 88957 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839216.1 protein_id gnl|my_center|LOCUS_12800 88981 90255 gene locus_tag LOCUS_12810 88981 90255 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933914.1 protein_id gnl|my_center|LOCUS_12810 90264 91241 gene locus_tag LOCUS_12820 90264 91241 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_12820 91321 93684 gene locus_tag LOCUS_12830 91321 93684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 93861 95324 gene locus_tag LOCUS_12840 gene gltX 93861 95324 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931991.1 protein_id gnl|my_center|LOCUS_12840 96372 95452 gene locus_tag LOCUS_12850 96372 95452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 97490 96438 gene locus_tag LOCUS_12860 97490 96438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 98228 97497 gene locus_tag LOCUS_12870 98228 97497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 98999 98241 gene locus_tag LOCUS_12880 98999 98241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 99800 99159 gene locus_tag LOCUS_12890 99800 99159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 100099 99863 gene locus_tag LOCUS_12900 100099 99863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 101199 100096 gene locus_tag LOCUS_12910 101199 100096 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933445.1 protein_id gnl|my_center|LOCUS_12910 103323 101209 gene locus_tag LOCUS_12920 gene ppk1 103323 101209 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_12920 105026 103515 gene locus_tag LOCUS_12930 105026 103515 CDS product DUF5009 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766054.1 protein_id gnl|my_center|LOCUS_12930 105726 105118 gene locus_tag LOCUS_12940 gene rnhB 105726 105118 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480979.1 protein_id gnl|my_center|LOCUS_12940 106500 105727 gene locus_tag LOCUS_12950 106500 105727 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_12950 106735 108009 gene locus_tag LOCUS_12960 106735 108009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 108238 108906 gene locus_tag LOCUS_12970 108238 108906 CDS product succinate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927180.1 protein_id gnl|my_center|LOCUS_12970 108906 110819 gene locus_tag LOCUS_12980 108906 110819 CDS product fumarate reductase/succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257750.1 protein_id gnl|my_center|LOCUS_12980 110835 111575 gene locus_tag LOCUS_12990 110835 111575 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364422.1 protein_id gnl|my_center|LOCUS_12990 111692 113065 gene locus_tag LOCUS_13000 111692 113065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 113068 114066 gene locus_tag LOCUS_13010 gene obgE 113068 114066 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933866.1 protein_id gnl|my_center|LOCUS_13010 114085 114933 gene locus_tag LOCUS_13020 114085 114933 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942084.1 protein_id gnl|my_center|LOCUS_13020 115133 117166 gene locus_tag LOCUS_13030 115133 117166 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074150.1 protein_id gnl|my_center|LOCUS_13030 117695 117189 gene locus_tag LOCUS_13040 117695 117189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 118385 117846 gene locus_tag LOCUS_13050 118385 117846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 119449 118385 gene locus_tag LOCUS_13060 119449 118385 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_13060 120565 119606 gene locus_tag LOCUS_13070 gene murI 120565 119606 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425992.1 protein_id gnl|my_center|LOCUS_13070 123159 120595 gene locus_tag LOCUS_13080 gene glnD 123159 120595 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942465.1 protein_id gnl|my_center|LOCUS_13080 123531 123166 gene locus_tag LOCUS_13090 123531 123166 CDS product NADPH-dependent 7-cyano-7-deazaguanine reductase QueF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324336.1 protein_id gnl|my_center|LOCUS_13090 124012 125652 gene locus_tag LOCUS_13100 124012 125652 CDS product acetaldehyde dehydrogenase (acetylating) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721578.1 protein_id gnl|my_center|LOCUS_13100 125768 126760 gene locus_tag LOCUS_13110 125768 126760 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_13110 126816 127502 gene locus_tag LOCUS_13120 126816 127502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 127514 128257 gene locus_tag LOCUS_13130 gene bshB1 127514 128257 CDS product bacillithiol biosynthesis deacetylase BshB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403695.1 protein_id gnl|my_center|LOCUS_13130 128956 128465 gene locus_tag LOCUS_13140 128956 128465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 131031 129202 gene locus_tag LOCUS_13150 131031 129202 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_13150 132033 131104 gene locus_tag LOCUS_13160 132033 131104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 134246 132048 gene locus_tag LOCUS_13170 134246 132048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 134952 134575 gene locus_tag LOCUS_13180 134952 134575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 135894 136916 gene locus_tag LOCUS_13190 135894 136916 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404173.1 protein_id gnl|my_center|LOCUS_13190 136919 137380 gene locus_tag LOCUS_13200 136919 137380 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121782.1 protein_id gnl|my_center|LOCUS_13200 137377 138063 gene locus_tag LOCUS_13210 137377 138063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 138148 139200 gene locus_tag LOCUS_13220 138148 139200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 139312 139557 gene locus_tag LOCUS_13230 139312 139557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 139723 140730 gene locus_tag LOCUS_13240 139723 140730 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932671.1 protein_id gnl|my_center|LOCUS_13240 140740 143475 gene locus_tag LOCUS_13250 140740 143475 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962910.1 protein_id gnl|my_center|LOCUS_13250 144023 143526 gene locus_tag LOCUS_13260 144023 143526 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943822.1 protein_id gnl|my_center|LOCUS_13260 144124 144049 gene locus_tag LOCUS_t00150 144124 144049 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 144362 146137 gene locus_tag LOCUS_13270 144362 146137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 148051 146456 gene locus_tag LOCUS_13280 148051 146456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 149182 148067 gene locus_tag LOCUS_13290 149182 148067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 153462 149380 gene locus_tag LOCUS_13300 153462 149380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 157372 153593 gene locus_tag LOCUS_13310 157372 153593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 157785 157342 gene locus_tag LOCUS_13320 157785 157342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 158631 157819 gene locus_tag LOCUS_13330 158631 157819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 158915 161959 gene locus_tag LOCUS_13340 158915 161959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 162818 163456 gene locus_tag LOCUS_13350 162818 163456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 163441 165945 gene locus_tag LOCUS_13360 163441 165945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 166150 166953 gene locus_tag LOCUS_13370 166150 166953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 166966 168531 gene locus_tag LOCUS_13380 166966 168531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 168975 170564 gene locus_tag LOCUS_13390 168975 170564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 170752 171303 gene locus_tag LOCUS_13400 170752 171303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 171335 171973 gene locus_tag LOCUS_13410 171335 171973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 171992 173095 gene locus_tag LOCUS_13420 171992 173095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 173125 174675 gene locus_tag LOCUS_13430 173125 174675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 174688 176091 gene locus_tag LOCUS_13440 174688 176091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 176152 177645 gene locus_tag LOCUS_13450 176152 177645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 177635 179044 gene locus_tag LOCUS_13460 177635 179044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 180327 179383 gene locus_tag LOCUS_13470 180327 179383 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000636970.1 protein_id gnl|my_center|LOCUS_13470 181760 180405 gene locus_tag LOCUS_13480 181760 180405 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941790.1 protein_id gnl|my_center|LOCUS_13480 183188 181779 gene locus_tag LOCUS_13490 183188 181779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_13490 183349 184836 gene locus_tag LOCUS_13500 183349 184836 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405055.1 protein_id gnl|my_center|LOCUS_13500 184973 186103 gene locus_tag LOCUS_13510 184973 186103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 186899 186342 gene locus_tag LOCUS_13520 gene rsmD 186899 186342 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706551.1 protein_id gnl|my_center|LOCUS_13520 187761 186889 gene locus_tag LOCUS_13530 187761 186889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 188320 187763 gene locus_tag LOCUS_13540 188320 187763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 188893 188321 gene locus_tag LOCUS_13550 188893 188321 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933581.1 protein_id gnl|my_center|LOCUS_13550 190057 188900 gene locus_tag LOCUS_13560 gene dnaJ 190057 188900 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405069.1 protein_id gnl|my_center|LOCUS_13560 190798 190076 gene locus_tag LOCUS_13570 gene grpE 190798 190076 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816478.1 protein_id gnl|my_center|LOCUS_13570 191942 190872 gene locus_tag LOCUS_13580 gene hrcA 191942 190872 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933152.1 protein_id gnl|my_center|LOCUS_13580 192169 192678 gene locus_tag LOCUS_13590 192169 192678 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_13590 192687 192989 gene locus_tag LOCUS_13600 gene nuoK 192687 192989 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_13600 193016 194956 gene locus_tag LOCUS_13610 gene nuoL 193016 194956 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_13610 194956 196458 gene locus_tag LOCUS_13620 194956 196458 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_13620 196824 197978 gene locus_tag LOCUS_13630 196824 197978 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986831.1 protein_id gnl|my_center|LOCUS_13630 197981 198343 gene locus_tag LOCUS_13640 197981 198343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 198346 199773 gene locus_tag LOCUS_13650 198346 199773 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_13650 199859 201460 gene locus_tag LOCUS_13660 199859 201460 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048317.1 protein_id gnl|my_center|LOCUS_13660 201460 201879 gene locus_tag LOCUS_13670 201460 201879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 201932 202681 gene locus_tag LOCUS_13680 201932 202681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 202932 203993 gene locus_tag LOCUS_13690 202932 203993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 204081 204572 gene locus_tag LOCUS_13700 gene nusB 204081 204572 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402806.1 protein_id gnl|my_center|LOCUS_13700 204565 205782 gene locus_tag LOCUS_13710 204565 205782 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986777.1 protein_id gnl|my_center|LOCUS_13710 206953 205883 gene locus_tag LOCUS_13720 gene paaK 206953 205883 CDS product phenylacetate-CoA oxygenase/reductase subunit PaaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965787.1 protein_id gnl|my_center|LOCUS_13720 207608 207015 gene locus_tag LOCUS_13730 207608 207015 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964444.1 protein_id gnl|my_center|LOCUS_13730 207766 209106 gene locus_tag LOCUS_13740 207766 209106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 208970 209069 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 209582 210724 gene locus_tag LOCUS_13750 209582 210724 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964032.1 protein_id gnl|my_center|LOCUS_13750 210852 211421 gene locus_tag LOCUS_13760 210852 211421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 211447 212397 gene locus_tag LOCUS_13770 211447 212397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 212394 213230 gene locus_tag LOCUS_13780 212394 213230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 213227 213646 gene locus_tag LOCUS_13790 213227 213646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 213659 215020 gene locus_tag LOCUS_13800 213659 215020 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218495.1 protein_id gnl|my_center|LOCUS_13800 215521 216861 gene locus_tag LOCUS_13810 gene miaB 215521 216861 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552700.1 protein_id gnl|my_center|LOCUS_13810 216967 217440 gene locus_tag LOCUS_13820 216967 217440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 217465 218244 gene locus_tag LOCUS_13830 217465 218244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 218267 219385 gene locus_tag LOCUS_13840 218267 219385 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933163.1 protein_id gnl|my_center|LOCUS_13840 219650 220201 gene locus_tag LOCUS_13850 219650 220201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 220291 221268 gene locus_tag LOCUS_13860 220291 221268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 221268 222374 gene locus_tag LOCUS_13870 221268 222374 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868996.1 protein_id gnl|my_center|LOCUS_13870 222352 223170 gene locus_tag LOCUS_13880 222352 223170 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_13880 223318 223668 gene locus_tag LOCUS_13890 223318 223668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 223706 224524 gene locus_tag LOCUS_13900 223706 224524 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869681.1 protein_id gnl|my_center|LOCUS_13900 224601 225893 gene locus_tag LOCUS_13910 gene rimO 224601 225893 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_13910 225895 227169 gene locus_tag LOCUS_13920 225895 227169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 227179 228141 gene locus_tag LOCUS_13930 gene pfkB 227179 228141 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391561.1 protein_id gnl|my_center|LOCUS_13930 228128 230026 gene locus_tag LOCUS_13940 228128 230026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 230081 232471 gene locus_tag LOCUS_13950 230081 232471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 232888 232454 gene locus_tag LOCUS_13960 232888 232454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 234487 233054 gene locus_tag LOCUS_13970 234487 233054 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704152.1 protein_id gnl|my_center|LOCUS_13970 235763 234639 gene locus_tag LOCUS_13980 gene bshA 235763 234639 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404813.1 protein_id gnl|my_center|LOCUS_13980 238145 236082 gene locus_tag LOCUS_13990 238145 236082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 238180 238335 gene locus_tag LOCUS_14000 238180 238335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 239529 238408 gene locus_tag LOCUS_14010 239529 238408 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927236.1 protein_id gnl|my_center|LOCUS_14010 241032 239842 gene locus_tag LOCUS_14020 241032 239842 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927123.1 protein_id gnl|my_center|LOCUS_14020 241226 242215 gene locus_tag LOCUS_14030 241226 242215 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_14030 242634 242224 gene locus_tag LOCUS_14040 242634 242224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 242706 245063 gene locus_tag LOCUS_14050 242706 245063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 246043 245291 gene locus_tag LOCUS_14060 246043 245291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 247259 246174 gene locus_tag LOCUS_14070 gene lptG 247259 246174 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948329.1 protein_id gnl|my_center|LOCUS_14070 248517 247243 gene locus_tag LOCUS_14080 248517 247243 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_14080 248831 250198 gene locus_tag LOCUS_14090 248831 250198 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108128.1 protein_id gnl|my_center|LOCUS_14090 250214 251098 gene locus_tag LOCUS_14100 250214 251098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 251234 252601 gene locus_tag LOCUS_14110 251234 252601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 252891 253439 gene locus_tag LOCUS_14120 252891 253439 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259300.1 protein_id gnl|my_center|LOCUS_14120 253549 253899 gene locus_tag LOCUS_tm00010 253549 253899 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 257145 254524 gene locus_tag LOCUS_14130 257145 254524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 257637 258824 gene locus_tag LOCUS_14140 257637 258824 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271909.1 protein_id gnl|my_center|LOCUS_14140 258881 260014 gene locus_tag LOCUS_14150 258881 260014 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838638.1 protein_id gnl|my_center|LOCUS_14150 261243 260035 gene locus_tag LOCUS_14160 261243 260035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 262669 261245 gene locus_tag LOCUS_14170 262669 261245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 263261 262671 gene locus_tag LOCUS_14180 263261 262671 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764719.1 protein_id gnl|my_center|LOCUS_14180 263693 264571 gene locus_tag LOCUS_14190 263693 264571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 264689 265453 gene locus_tag LOCUS_14200 264689 265453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 266346 265444 gene locus_tag LOCUS_14210 266346 265444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 266714 266400 gene locus_tag LOCUS_14220 266714 266400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 266788 266797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 266887 267066 gene locus_tag LOCUS_14230 266887 267066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 267075 267317 gene locus_tag LOCUS_14240 267075 267317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 267308 269044 gene locus_tag LOCUS_14250 267308 269044 CDS product DUF2326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121559.1 protein_id gnl|my_center|LOCUS_14250 269375 271987 gene locus_tag LOCUS_14260 gene valS 269375 271987 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398606.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence06 484 397 gene locus_tag LOCUS_t00160 484 397 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1129 2148 gene locus_tag LOCUS_14270 1129 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 2699 2355 gene locus_tag LOCUS_14280 2699 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 2922 3854 gene locus_tag LOCUS_14290 2922 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 4440 5222 gene locus_tag LOCUS_14300 4440 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 5918 5661 gene locus_tag LOCUS_14310 gene rpsT 5918 5661 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258282.1 protein_id gnl|my_center|LOCUS_14310 6420 8903 gene locus_tag LOCUS_14320 6420 8903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 8908 12501 gene locus_tag LOCUS_14330 gene smc 8908 12501 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403652.1 protein_id gnl|my_center|LOCUS_14330 12514 14445 gene locus_tag LOCUS_14340 12514 14445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 14474 15283 gene locus_tag LOCUS_14350 14474 15283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 15293 15919 gene locus_tag LOCUS_14360 15293 15919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 15895 17274 gene locus_tag LOCUS_14370 gene lpxB 15895 17274 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931972.1 protein_id gnl|my_center|LOCUS_14370 17264 17932 gene locus_tag LOCUS_14380 17264 17932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 18033 19067 gene locus_tag LOCUS_14390 gene lpxK 18033 19067 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881075.1 protein_id gnl|my_center|LOCUS_14390 19089 21860 gene locus_tag LOCUS_14400 gene ppdK 19089 21860 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933346.1 protein_id gnl|my_center|LOCUS_14400 21976 23010 gene locus_tag LOCUS_14410 gene queA 21976 23010 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962415.1 protein_id gnl|my_center|LOCUS_14410 23007 23708 gene locus_tag LOCUS_14420 gene ispD 23007 23708 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011860629.1 protein_id gnl|my_center|LOCUS_14420 26979 23779 gene locus_tag LOCUS_14430 26979 23779 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108531.1 protein_id gnl|my_center|LOCUS_14430 27416 28078 gene locus_tag LOCUS_14440 gene plsY 27416 28078 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931787.1 protein_id gnl|my_center|LOCUS_14440 28086 29090 gene locus_tag LOCUS_14450 28086 29090 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_14450 29522 30457 gene locus_tag LOCUS_14460 29522 30457 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_14460 30464 31669 gene locus_tag LOCUS_14470 30464 31669 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986808.1 protein_id gnl|my_center|LOCUS_14470 31780 31864 gene locus_tag LOCUS_t00170 31780 31864 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 31881 31953 gene locus_tag LOCUS_t00180 31881 31953 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 32018 32091 gene locus_tag LOCUS_t00190 32018 32091 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 32286 32359 gene locus_tag LOCUS_t00200 32286 32359 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 32386 32568 gene locus_tag LOCUS_14480 32386 32568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 32576 33109 gene locus_tag LOCUS_14490 gene nusG 32576 33109 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782159.1 protein_id gnl|my_center|LOCUS_14490 33142 33567 gene locus_tag LOCUS_14500 gene rplK 33142 33567 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931845.1 protein_id gnl|my_center|LOCUS_14500 33580 34272 gene locus_tag LOCUS_14510 gene rplA 33580 34272 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931846.1 protein_id gnl|my_center|LOCUS_14510 34341 34862 gene locus_tag LOCUS_14520 gene rplJ 34341 34862 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931847.1 protein_id gnl|my_center|LOCUS_14520 34899 35282 gene locus_tag LOCUS_14530 gene rplL 34899 35282 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393946.1 protein_id gnl|my_center|LOCUS_14530 35420 39196 gene locus_tag LOCUS_14540 gene rpoB 35420 39196 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051010823.1 protein_id gnl|my_center|LOCUS_14540 39238 43485 gene locus_tag LOCUS_14550 gene rpoC 39238 43485 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404501.1 protein_id gnl|my_center|LOCUS_14550 43702 44082 gene locus_tag LOCUS_14560 gene rpsL 43702 44082 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_14560 44093 44560 gene locus_tag LOCUS_14570 gene rpsG 44093 44560 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421180.1 protein_id gnl|my_center|LOCUS_14570 44582 46681 gene locus_tag LOCUS_14580 gene fusA 44582 46681 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_14580 46722 47927 gene locus_tag LOCUS_14590 gene tuf 46722 47927 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762026.1 protein_id gnl|my_center|LOCUS_14590 48003 48311 gene locus_tag LOCUS_14600 gene rpsJ 48003 48311 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403794.1 protein_id gnl|my_center|LOCUS_14600 48331 48954 gene locus_tag LOCUS_14610 gene rplC 48331 48954 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762034.1 protein_id gnl|my_center|LOCUS_14610 48967 49611 gene locus_tag LOCUS_14620 gene rplD 48967 49611 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762035.1 protein_id gnl|my_center|LOCUS_14620 49612 49902 gene locus_tag LOCUS_14630 gene rplW 49612 49902 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_14630 49924 50748 gene locus_tag LOCUS_14640 gene rplB 49924 50748 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933839.1 protein_id gnl|my_center|LOCUS_14640 50761 51048 gene locus_tag LOCUS_14650 gene rpsS 50761 51048 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933838.1 protein_id gnl|my_center|LOCUS_14650 51057 51425 gene locus_tag LOCUS_14660 gene rplV 51057 51425 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933837.1 protein_id gnl|my_center|LOCUS_14660 51427 52068 gene locus_tag LOCUS_14670 gene rpsC 51427 52068 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403801.1 protein_id gnl|my_center|LOCUS_14670 52135 52503 gene locus_tag LOCUS_14680 gene rplP 52135 52503 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_14680 52516 52722 gene locus_tag LOCUS_14690 gene rpmC 52516 52722 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_14690 52743 52997 gene locus_tag LOCUS_14700 gene rpsQ 52743 52997 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966403.1 protein_id gnl|my_center|LOCUS_14700 53019 53387 gene locus_tag LOCUS_14710 gene rplN 53019 53387 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_14710 53396 53728 gene locus_tag LOCUS_14720 gene rplX 53396 53728 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_14720 53751 54383 gene locus_tag LOCUS_14730 gene rplE 53751 54383 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986816.1 protein_id gnl|my_center|LOCUS_14730 54408 54677 gene locus_tag LOCUS_14740 gene rpsN 54408 54677 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933829.1 protein_id gnl|my_center|LOCUS_14740 54695 55090 gene locus_tag LOCUS_14750 gene rpsH 54695 55090 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459105.1 protein_id gnl|my_center|LOCUS_14750 55114 55656 gene locus_tag LOCUS_14760 gene rplF 55114 55656 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357306.1 protein_id gnl|my_center|LOCUS_14760 55675 56034 gene locus_tag LOCUS_14770 gene rplR 55675 56034 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943470.1 protein_id gnl|my_center|LOCUS_14770 56046 56117 gene locus_tag LOCUS_t00210 56046 56117 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 56149 56655 gene locus_tag LOCUS_14780 gene rpsE 56149 56655 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933825.1 protein_id gnl|my_center|LOCUS_14780 56671 56853 gene locus_tag LOCUS_14790 gene rpmD 56671 56853 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085234.1 protein_id gnl|my_center|LOCUS_14790 56859 57317 gene locus_tag LOCUS_14800 gene rplO 56859 57317 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_14800 57328 58665 gene locus_tag LOCUS_14810 gene secY 57328 58665 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_14810 58670 59428 gene locus_tag LOCUS_14820 gene map 58670 59428 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_14820 59429 59647 gene locus_tag LOCUS_14830 gene infA 59429 59647 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156508.1 protein_id gnl|my_center|LOCUS_14830 59798 60181 gene locus_tag LOCUS_14840 gene rpsM 59798 60181 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_14840 60204 60590 gene locus_tag LOCUS_14850 gene rpsK 60204 60590 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933817.1 protein_id gnl|my_center|LOCUS_14850 60613 61263 gene locus_tag LOCUS_14860 gene rpsD 60613 61263 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_14860 61269 62285 gene locus_tag LOCUS_14870 61269 62285 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061621.1 protein_id gnl|my_center|LOCUS_14870 62307 62768 gene locus_tag LOCUS_14880 gene rplQ 62307 62768 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933814.1 protein_id gnl|my_center|LOCUS_14880 62829 63413 gene locus_tag LOCUS_14890 gene yihA 62829 63413 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933808.1 protein_id gnl|my_center|LOCUS_14890 63484 65379 gene locus_tag LOCUS_14900 63484 65379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 65592 66626 gene locus_tag LOCUS_14910 65592 66626 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_14910 66729 67001 gene locus_tag LOCUS_14920 66729 67001 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815339.1 protein_id gnl|my_center|LOCUS_14920 67007 67276 gene locus_tag LOCUS_14930 67007 67276 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815267.1 protein_id gnl|my_center|LOCUS_14930 67311 68177 gene locus_tag LOCUS_14940 67311 68177 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_14940 68167 69039 gene locus_tag LOCUS_14950 68167 69039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 71188 69263 gene locus_tag LOCUS_14960 71188 69263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 71461 73209 gene locus_tag LOCUS_14970 71461 73209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 74152 73421 gene locus_tag LOCUS_14980 74152 73421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 74622 78203 gene locus_tag LOCUS_14990 74622 78203 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000783498.1 protein_id gnl|my_center|LOCUS_14990 78524 79819 gene locus_tag LOCUS_15000 78524 79819 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047968.1 protein_id gnl|my_center|LOCUS_15000 79913 80365 gene locus_tag LOCUS_15010 79913 80365 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_15010 80382 81623 gene locus_tag LOCUS_15020 80382 81623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 81644 84514 gene locus_tag LOCUS_15030 gene infB 81644 84514 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783920.1 protein_id gnl|my_center|LOCUS_15030 84647 85012 gene locus_tag LOCUS_15040 gene rbfA 84647 85012 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829509.1 protein_id gnl|my_center|LOCUS_15040 84981 85715 gene locus_tag LOCUS_15050 84981 85715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 85699 86631 gene locus_tag LOCUS_15060 85699 86631 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942133.1 protein_id gnl|my_center|LOCUS_15060 86764 87027 gene locus_tag LOCUS_15070 gene rpsO 86764 87027 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003388351.1 protein_id gnl|my_center|LOCUS_15070 87036 89144 gene locus_tag LOCUS_15080 gene pnp 87036 89144 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_15080 89358 90920 gene locus_tag LOCUS_15090 89358 90920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 90984 92066 gene locus_tag LOCUS_15100 gene gcvT 90984 92066 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_15100 92077 92823 gene locus_tag LOCUS_15110 92077 92823 CDS product 2-phosphosulfolactate phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773678.1 protein_id gnl|my_center|LOCUS_15110 92838 95222 gene locus_tag LOCUS_15120 92838 95222 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927087.1 protein_id gnl|my_center|LOCUS_15120 95250 95843 gene locus_tag LOCUS_15130 95250 95843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 95830 96900 gene locus_tag LOCUS_15140 95830 96900 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404317.1 protein_id gnl|my_center|LOCUS_15140 96884 97531 gene locus_tag LOCUS_15150 96884 97531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 97683 98531 gene locus_tag LOCUS_15160 97683 98531 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932021.1 protein_id gnl|my_center|LOCUS_15160 98542 99138 gene locus_tag LOCUS_15170 98542 99138 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003566814.1 protein_id gnl|my_center|LOCUS_15170 99125 99604 gene locus_tag LOCUS_15180 99125 99604 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641564.1 protein_id gnl|my_center|LOCUS_15180 99621 100619 gene locus_tag LOCUS_15190 gene holA 99621 100619 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460882.1 protein_id gnl|my_center|LOCUS_15190 100693 101280 gene locus_tag LOCUS_15200 100693 101280 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062898.1 protein_id gnl|my_center|LOCUS_15200 101287 102012 gene locus_tag LOCUS_15210 101287 102012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 102141 103217 gene locus_tag LOCUS_15220 102141 103217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 103377 104390 gene locus_tag LOCUS_15230 103377 104390 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038869.1 protein_id gnl|my_center|LOCUS_15230 104387 104899 gene locus_tag LOCUS_15240 104387 104899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 105105 105725 gene locus_tag LOCUS_15250 105105 105725 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940274.1 protein_id gnl|my_center|LOCUS_15250 106002 108053 gene locus_tag LOCUS_15260 gene uvrB 106002 108053 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403914.1 protein_id gnl|my_center|LOCUS_15260 108072 110699 gene locus_tag LOCUS_15270 gene thrA 108072 110699 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784545.1 protein_id gnl|my_center|LOCUS_15270 110897 112171 gene locus_tag LOCUS_15280 110897 112171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 112488 113972 gene locus_tag LOCUS_15290 gene thrC 112488 113972 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202074.1 protein_id gnl|my_center|LOCUS_15290 115326 114151 gene locus_tag LOCUS_15300 115326 114151 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_15300 115688 116518 gene locus_tag LOCUS_15310 115688 116518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 116515 118980 gene locus_tag LOCUS_15320 116515 118980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 119572 119162 gene locus_tag LOCUS_15330 119572 119162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 120024 119593 gene locus_tag LOCUS_15340 120024 119593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 120352 122535 gene locus_tag LOCUS_15350 120352 122535 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013008044.1 protein_id gnl|my_center|LOCUS_15350 122767 124668 gene locus_tag LOCUS_15360 122767 124668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 125554 124739 gene locus_tag LOCUS_15370 gene cas6 125554 124739 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082360.1 protein_id gnl|my_center|LOCUS_15370 127331 125667 gene locus_tag LOCUS_15380 127331 125667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 128013 127333 gene locus_tag LOCUS_15390 128013 127333 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_15390 128540 128313 gene locus_tag LOCUS_15400 128540 128313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 128732 129451 gene locus_tag LOCUS_15410 128732 129451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 129459 130382 gene locus_tag LOCUS_15420 129459 130382 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783522.1 protein_id gnl|my_center|LOCUS_15420 130667 132439 gene locus_tag LOCUS_15430 130667 132439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 133852 132542 gene locus_tag LOCUS_15440 133852 132542 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_15440 134654 134133 gene locus_tag LOCUS_15450 134654 134133 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_15450 134826 134981 gene locus_tag LOCUS_15460 134826 134981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 135187 135945 gene locus_tag LOCUS_15470 gene tpiA 135187 135945 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927032.1 protein_id gnl|my_center|LOCUS_15470 136639 136199 gene locus_tag LOCUS_15480 136639 136199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 137001 136654 gene locus_tag LOCUS_15490 137001 136654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 137260 137688 gene locus_tag LOCUS_15500 137260 137688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 137776 138330 gene locus_tag LOCUS_15510 137776 138330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 138599 139543 gene locus_tag LOCUS_15520 138599 139543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 140322 139681 gene locus_tag LOCUS_15530 140322 139681 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759973.1 protein_id gnl|my_center|LOCUS_15530 140413 140486 gene locus_tag LOCUS_t00220 140413 140486 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 140717 141289 gene locus_tag LOCUS_15540 140717 141289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 141599 142405 gene locus_tag LOCUS_15550 141599 142405 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258699.1 protein_id gnl|my_center|LOCUS_15550 142544 143263 gene locus_tag LOCUS_15560 gene rsmI 142544 143263 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166903.1 protein_id gnl|my_center|LOCUS_15560 143290 144405 gene locus_tag LOCUS_15570 143290 144405 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258698.1 protein_id gnl|my_center|LOCUS_15570 144664 145959 gene locus_tag LOCUS_15580 144664 145959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 148172 146031 gene locus_tag LOCUS_15590 148172 146031 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_15590 148942 148172 gene locus_tag LOCUS_15600 148942 148172 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107255.1 protein_id gnl|my_center|LOCUS_15600 149012 149470 gene locus_tag LOCUS_15610 149012 149470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 149746 150999 gene locus_tag LOCUS_15620 gene fabF 149746 150999 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405457.1 protein_id gnl|my_center|LOCUS_15620 151016 152428 gene locus_tag LOCUS_15630 151016 152428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 152636 154192 gene locus_tag LOCUS_15640 gene malQ 152636 154192 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259705.1 protein_id gnl|my_center|LOCUS_15640 155559 154390 gene locus_tag LOCUS_15650 155559 154390 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_15650 157566 155623 gene locus_tag LOCUS_15660 157566 155623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 158181 157699 gene locus_tag LOCUS_15670 158181 157699 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706473.1 protein_id gnl|my_center|LOCUS_15670 158633 158484 gene locus_tag LOCUS_15680 158633 158484 CDS product toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001085171.1 protein_id gnl|my_center|LOCUS_15680 159600 158719 gene locus_tag LOCUS_15690 159600 158719 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973939.1 protein_id gnl|my_center|LOCUS_15690 163621 159989 gene locus_tag LOCUS_15700 163621 159989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 164050 166014 gene locus_tag LOCUS_15710 164050 166014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 166262 168661 gene locus_tag LOCUS_15720 166262 168661 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259686.1 protein_id gnl|my_center|LOCUS_15720 168663 170591 gene locus_tag LOCUS_15730 168663 170591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 170588 171892 gene locus_tag LOCUS_15740 170588 171892 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037351.1 protein_id gnl|my_center|LOCUS_15740 171927 172796 gene locus_tag LOCUS_15750 171927 172796 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_15750 172870 173682 gene locus_tag LOCUS_15760 172870 173682 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037349.1 protein_id gnl|my_center|LOCUS_15760 173898 174932 gene locus_tag LOCUS_15770 173898 174932 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393520.1 protein_id gnl|my_center|LOCUS_15770 174984 176864 gene locus_tag LOCUS_15780 174984 176864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 176989 179688 gene locus_tag LOCUS_15790 176989 179688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 179691 182909 gene locus_tag LOCUS_15800 179691 182909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 182920 183936 gene locus_tag LOCUS_15810 182920 183936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 184344 185765 gene locus_tag LOCUS_15820 184344 185765 CDS product glucoamylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037352.1 protein_id gnl|my_center|LOCUS_15820 185762 185896 gene locus_tag LOCUS_15830 185762 185896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 185898 188060 gene locus_tag LOCUS_15840 185898 188060 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229242.1 protein_id gnl|my_center|LOCUS_15840 188315 188773 gene locus_tag LOCUS_15850 188315 188773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 188770 190239 gene locus_tag LOCUS_15860 188770 190239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 190633 191016 gene locus_tag LOCUS_15870 190633 191016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 192043 191327 gene locus_tag LOCUS_15880 192043 191327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 193067 192093 gene locus_tag LOCUS_15890 193067 192093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 194185 193073 gene locus_tag LOCUS_15900 194185 193073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 195119 194187 gene locus_tag LOCUS_15910 195119 194187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 197832 195175 gene locus_tag LOCUS_15920 197832 195175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 198556 197846 gene locus_tag LOCUS_15930 198556 197846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 199813 198560 gene locus_tag LOCUS_15940 199813 198560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 202384 200285 gene locus_tag LOCUS_15950 202384 200285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 203119 202394 gene locus_tag LOCUS_15960 gene lepB 203119 202394 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_15960 205343 203550 gene locus_tag LOCUS_15970 gene lepA 205343 203550 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933118.1 protein_id gnl|my_center|LOCUS_15970 206001 205447 gene locus_tag LOCUS_15980 206001 205447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 207251 206166 gene locus_tag LOCUS_15990 207251 206166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 208352 207705 gene locus_tag LOCUS_16000 208352 207705 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545081.1 protein_id gnl|my_center|LOCUS_16000 208725 209747 gene locus_tag LOCUS_16010 208725 209747 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405541.1 protein_id gnl|my_center|LOCUS_16010 211733 209955 gene locus_tag LOCUS_16020 211733 209955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 213475 211742 gene locus_tag LOCUS_16030 213475 211742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 214317 214526 gene locus_tag LOCUS_16040 214317 214526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 214638 216305 gene locus_tag LOCUS_16050 214638 216305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 216599 217261 gene locus_tag LOCUS_16060 216599 217261 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454888.1 protein_id gnl|my_center|LOCUS_16060 217652 218497 gene locus_tag LOCUS_16070 217652 218497 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_16070 220128 218671 gene locus_tag LOCUS_16080 220128 218671 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201994.1 protein_id gnl|my_center|LOCUS_16080 220489 221253 gene locus_tag LOCUS_16090 gene mntR 220489 221253 CDS product manganese-binding transcriptional regulator MntR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005057117.1 protein_id gnl|my_center|LOCUS_16090 221341 222357 gene locus_tag LOCUS_16100 221341 222357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 222354 223196 gene locus_tag LOCUS_16110 222354 223196 CDS product FeoB small GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392919.1 protein_id gnl|my_center|LOCUS_16110 223344 224744 gene locus_tag LOCUS_16120 223344 224744 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392918.1 protein_id gnl|my_center|LOCUS_16120 225215 225721 gene locus_tag LOCUS_16130 gene nrfH 225215 225721 CDS product cytochrome c nitrite reductase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107765.1 protein_id gnl|my_center|LOCUS_16130 225722 227206 gene locus_tag LOCUS_16140 gene nrfA 225722 227206 CDS product ammonia-forming cytochrome c nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107764.1 protein_id gnl|my_center|LOCUS_16140 227592 228911 gene locus_tag LOCUS_16150 227592 228911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 230098 229037 gene locus_tag LOCUS_16160 gene mnmA 230098 229037 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657419.1 protein_id gnl|my_center|LOCUS_16160 230358 231308 gene locus_tag LOCUS_16170 gene metF 230358 231308 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_16170 231334 232332 gene locus_tag LOCUS_16180 231334 232332 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583009.1 protein_id gnl|my_center|LOCUS_16180 232319 233140 gene locus_tag LOCUS_16190 232319 233140 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_16190 233204 234379 gene locus_tag LOCUS_16200 233204 234379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 234379 234672 gene locus_tag LOCUS_16210 234379 234672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 234669 235970 gene locus_tag LOCUS_16220 234669 235970 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926922.1 protein_id gnl|my_center|LOCUS_16220 236134 236472 gene locus_tag LOCUS_16230 236134 236472 CDS product arsenate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003396628.1 protein_id gnl|my_center|LOCUS_16230 236745 238250 gene locus_tag LOCUS_16240 gene glmU 236745 238250 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966498.1 protein_id gnl|my_center|LOCUS_16240 238429 241782 gene locus_tag LOCUS_16250 238429 241782 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109099.1 protein_id gnl|my_center|LOCUS_16250 241833 242252 gene locus_tag LOCUS_16260 241833 242252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 242624 243370 gene locus_tag LOCUS_16270 242624 243370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 243499 245100 gene locus_tag LOCUS_16280 243499 245100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 245078 245761 gene locus_tag LOCUS_16290 245078 245761 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986854.1 protein_id gnl|my_center|LOCUS_16290 247114 245846 gene locus_tag LOCUS_16300 247114 245846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 247460 247200 gene locus_tag LOCUS_16310 247460 247200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 249539 247572 gene locus_tag LOCUS_16320 249539 247572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 249929 250741 gene locus_tag LOCUS_16330 249929 250741 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_16330 250798 251385 gene locus_tag LOCUS_16340 250798 251385 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964299.1 protein_id gnl|my_center|LOCUS_16340 251399 251989 gene locus_tag LOCUS_16350 251399 251989 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964298.1 protein_id gnl|my_center|LOCUS_16350 251999 252844 gene locus_tag LOCUS_16360 251999 252844 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792001.1 protein_id gnl|my_center|LOCUS_16360 253245 253319 gene locus_tag LOCUS_t00230 253245 253319 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 255904 253442 gene locus_tag LOCUS_16370 255904 253442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 256908 255910 gene locus_tag LOCUS_16380 256908 255910 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_045231753.1 protein_id gnl|my_center|LOCUS_16380 258292 257390 gene locus_tag LOCUS_16390 258292 257390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 258660 258346 gene locus_tag LOCUS_16400 258660 258346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 259501 259247 gene locus_tag LOCUS_16410 259501 259247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 261880 259508 gene locus_tag LOCUS_16420 261880 259508 CDS product AIPR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008002.1 protein_id gnl|my_center|LOCUS_16420 262855 261884 gene locus_tag LOCUS_16430 262855 261884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 265692 262852 gene locus_tag LOCUS_16440 265692 262852 CDS product Z1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383504.1 protein_id gnl|my_center|LOCUS_16440 267146 265689 gene locus_tag LOCUS_16450 267146 265689 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383503.1 protein_id gnl|my_center|LOCUS_16450 267536 267156 gene locus_tag LOCUS_16460 267536 267156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 268906 267659 gene locus_tag LOCUS_16470 268906 267659 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876134.1 protein_id gnl|my_center|LOCUS_16470 269305 268922 gene locus_tag LOCUS_16480 269305 268922 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280500.1 protein_id gnl|my_center|LOCUS_16480 270648 269890 gene locus_tag LOCUS_16490 270648 269890 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence07 114 3425 gene locus_tag LOCUS_16500 114 3425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 4022 3603 gene locus_tag LOCUS_16510 4022 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 5910 4090 gene locus_tag LOCUS_16520 5910 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 6950 5997 gene locus_tag LOCUS_16530 6950 5997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 8580 7183 gene locus_tag LOCUS_16540 8580 7183 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_16540 8821 9198 gene locus_tag LOCUS_16550 8821 9198 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_16550 9189 9710 gene locus_tag LOCUS_16560 9189 9710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 9700 10188 gene locus_tag LOCUS_16570 9700 10188 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396799.1 protein_id gnl|my_center|LOCUS_16570 10197 11450 gene locus_tag LOCUS_16580 gene nuoD 10197 11450 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403174.1 protein_id gnl|my_center|LOCUS_16580 11464 11937 gene locus_tag LOCUS_16590 11464 11937 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389434.1 protein_id gnl|my_center|LOCUS_16590 11947 13263 gene locus_tag LOCUS_16600 gene nuoF 11947 13263 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838122.1 protein_id gnl|my_center|LOCUS_16600 15093 13381 gene locus_tag LOCUS_16610 15093 13381 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940378.1 protein_id gnl|my_center|LOCUS_16610 15236 15667 gene locus_tag LOCUS_16620 15236 15667 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_16620 17058 15967 gene locus_tag LOCUS_16630 17058 15967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 17130 19031 gene locus_tag LOCUS_16640 17130 19031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 19028 21574 gene locus_tag LOCUS_16650 19028 21574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 21642 23120 gene locus_tag LOCUS_16660 21642 23120 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_16660 23122 24501 gene locus_tag LOCUS_16670 23122 24501 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073369.1 protein_id gnl|my_center|LOCUS_16670 24774 25244 gene locus_tag LOCUS_16680 gene greA 24774 25244 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933113.1 protein_id gnl|my_center|LOCUS_16680 25245 26564 gene locus_tag LOCUS_16690 25245 26564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 26545 27183 gene locus_tag LOCUS_16700 26545 27183 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932438.1 protein_id gnl|my_center|LOCUS_16700 27176 28108 gene locus_tag LOCUS_16710 27176 28108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 28179 28766 gene locus_tag LOCUS_16720 28179 28766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 28747 29298 gene locus_tag LOCUS_16730 gene hpt 28747 29298 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_16730 29314 31335 gene locus_tag LOCUS_16740 gene ftsH 29314 31335 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_16740 31319 31987 gene locus_tag LOCUS_16750 31319 31987 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404449.1 protein_id gnl|my_center|LOCUS_16750 32100 33179 gene locus_tag LOCUS_16760 32100 33179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 36244 33449 gene locus_tag LOCUS_16770 36244 33449 CDS product calcium-translocating P-type ATPase, SERCA-type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023974.1 protein_id gnl|my_center|LOCUS_16770 36378 36986 gene locus_tag LOCUS_16780 36378 36986 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833353.1 protein_id gnl|my_center|LOCUS_16780 36983 37426 gene locus_tag LOCUS_16790 36983 37426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 37952 38025 gene locus_tag LOCUS_t00240 37952 38025 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 38716 40611 gene locus_tag LOCUS_16800 38716 40611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 41678 40866 gene locus_tag LOCUS_16810 41678 40866 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531641.1 protein_id gnl|my_center|LOCUS_16810 42561 41680 gene locus_tag LOCUS_16820 42561 41680 CDS product N-acetylneuraminate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926938.1 protein_id gnl|my_center|LOCUS_16820 43179 42646 gene locus_tag LOCUS_16830 43179 42646 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932505.1 protein_id gnl|my_center|LOCUS_16830 44213 43308 gene locus_tag LOCUS_16840 44213 43308 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088717.1 protein_id gnl|my_center|LOCUS_16840 45648 44314 gene locus_tag LOCUS_16850 45648 44314 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222491.1 protein_id gnl|my_center|LOCUS_16850 46457 45645 gene locus_tag LOCUS_16860 46457 45645 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920693.1 protein_id gnl|my_center|LOCUS_16860 47623 46532 gene locus_tag LOCUS_16870 47623 46532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932826.1 protein_id gnl|my_center|LOCUS_16870 47797 48720 gene locus_tag LOCUS_16880 47797 48720 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392232.1 protein_id gnl|my_center|LOCUS_16880 51302 48816 gene locus_tag LOCUS_16890 51302 48816 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_16890 52382 51426 gene locus_tag LOCUS_16900 52382 51426 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404721.1 protein_id gnl|my_center|LOCUS_16900 52828 52379 gene locus_tag LOCUS_16910 gene dtd 52828 52379 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071581519.1 protein_id gnl|my_center|LOCUS_16910 53694 52831 gene locus_tag LOCUS_16920 gene prmC 53694 52831 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933153.1 protein_id gnl|my_center|LOCUS_16920 53802 54965 gene locus_tag LOCUS_16930 gene waaF 53802 54965 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_16930 54952 56409 gene locus_tag LOCUS_16940 54952 56409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 56530 57654 gene locus_tag LOCUS_16950 gene waaF 56530 57654 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706351.1 protein_id gnl|my_center|LOCUS_16950 57761 58597 gene locus_tag LOCUS_16960 gene ispE 57761 58597 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894070.1 protein_id gnl|my_center|LOCUS_16960 59613 58630 gene locus_tag LOCUS_16970 59613 58630 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_16970 60571 59648 gene locus_tag LOCUS_16980 60571 59648 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793101.1 protein_id gnl|my_center|LOCUS_16980 60971 62212 gene locus_tag LOCUS_16990 60971 62212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 62488 64095 gene locus_tag LOCUS_17000 62488 64095 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258461.1 protein_id gnl|my_center|LOCUS_17000 64998 64141 gene locus_tag LOCUS_17010 64998 64141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17010 65185 68145 gene locus_tag LOCUS_17020 65185 68145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 68129 70204 gene locus_tag LOCUS_17030 68129 70204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17030 70208 71146 gene locus_tag LOCUS_17040 70208 71146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 71157 71873 gene locus_tag LOCUS_17050 71157 71873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 71881 72576 gene locus_tag LOCUS_17060 71881 72576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 72771 73907 gene locus_tag LOCUS_17070 72771 73907 CDS product family 10 glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141800.1 protein_id gnl|my_center|LOCUS_17070 74114 73962 gene locus_tag LOCUS_17080 74114 73962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 74341 76152 gene locus_tag LOCUS_17090 74341 76152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 76840 76226 gene locus_tag LOCUS_17100 76840 76226 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920056.1 protein_id gnl|my_center|LOCUS_17100 76916 78037 gene locus_tag LOCUS_17110 76916 78037 CDS product lpg1661 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947388.1 protein_id gnl|my_center|LOCUS_17110 80116 78041 gene locus_tag LOCUS_17120 80116 78041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 81671 80172 gene locus_tag LOCUS_17130 81671 80172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 82371 81673 gene locus_tag LOCUS_17140 82371 81673 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405016.1 protein_id gnl|my_center|LOCUS_17140 83374 82373 gene locus_tag LOCUS_17150 83374 82373 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015777130.1 protein_id gnl|my_center|LOCUS_17150 85293 83374 gene locus_tag LOCUS_17160 gene dxs 85293 83374 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_17160 85543 85331 gene locus_tag LOCUS_17170 85543 85331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 86726 85536 gene locus_tag LOCUS_17180 gene xseA 86726 85536 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_17180 88242 87022 gene locus_tag LOCUS_17190 88242 87022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 88471 88761 gene locus_tag LOCUS_17200 88471 88761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 90251 90527 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cagtggttcaagaagcagc 90599 91156 gene locus_tag LOCUS_17210 90599 91156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 91153 92568 gene locus_tag LOCUS_17220 91153 92568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 92667 93560 gene locus_tag LOCUS_17230 gene rsgA 92667 93560 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764015.1 protein_id gnl|my_center|LOCUS_17230 93646 94041 gene locus_tag LOCUS_17240 93646 94041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 94044 95495 gene locus_tag LOCUS_17250 94044 95495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 95577 96155 gene locus_tag LOCUS_17260 95577 96155 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868834.1 protein_id gnl|my_center|LOCUS_17260 96217 97185 gene locus_tag LOCUS_17270 96217 97185 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259445.1 protein_id gnl|my_center|LOCUS_17270 97185 98438 gene locus_tag LOCUS_17280 gene icd 97185 98438 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229433.1 protein_id gnl|my_center|LOCUS_17280 98673 99011 gene locus_tag LOCUS_17290 98673 99011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 99039 99446 gene locus_tag LOCUS_17300 99039 99446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 99443 101533 gene locus_tag LOCUS_17310 gene fusA 99443 101533 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583197.1 protein_id gnl|my_center|LOCUS_17310 101802 102305 gene locus_tag LOCUS_17320 101802 102305 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_17320 103405 102308 gene locus_tag LOCUS_17330 103405 102308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 104520 104188 gene locus_tag LOCUS_17340 104520 104188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 104617 105111 gene locus_tag LOCUS_17350 gene coaD 104617 105111 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393371.1 protein_id gnl|my_center|LOCUS_17350 105129 106322 gene locus_tag LOCUS_17360 105129 106322 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796424.1 protein_id gnl|my_center|LOCUS_17360 107305 106418 gene locus_tag LOCUS_17370 gene aroE 107305 106418 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870596.1 protein_id gnl|my_center|LOCUS_17370 108738 107302 gene locus_tag LOCUS_17380 108738 107302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 110094 108910 gene locus_tag LOCUS_17390 gene sucC 110094 108910 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_17390 111716 110166 gene locus_tag LOCUS_17400 gene pruA 111716 110166 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000259550.1 protein_id gnl|my_center|LOCUS_17400 112605 112120 gene locus_tag LOCUS_17410 112605 112120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 113970 112822 gene locus_tag LOCUS_17420 113970 112822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 114878 113967 gene locus_tag LOCUS_17430 114878 113967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 116695 114875 gene locus_tag LOCUS_17440 gene uvrC 116695 114875 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933467.1 protein_id gnl|my_center|LOCUS_17440 118059 116821 gene locus_tag LOCUS_17450 gene glgC 118059 116821 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154339.1 protein_id gnl|my_center|LOCUS_17450 118243 119307 gene locus_tag LOCUS_17460 gene ychF 118243 119307 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_17460 119322 121172 gene locus_tag LOCUS_17470 gene typA 119322 121172 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941168.1 protein_id gnl|my_center|LOCUS_17470 121180 122829 gene locus_tag LOCUS_17480 121180 122829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 123056 125134 gene locus_tag LOCUS_17490 123056 125134 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881407.1 protein_id gnl|my_center|LOCUS_17490 125473 126717 gene locus_tag LOCUS_17500 125473 126717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 128140 127028 gene locus_tag LOCUS_17510 128140 127028 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942347.1 protein_id gnl|my_center|LOCUS_17510 128527 128177 gene locus_tag LOCUS_17520 128527 128177 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228813.1 protein_id gnl|my_center|LOCUS_17520 129064 128636 gene locus_tag LOCUS_17530 129064 128636 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_17530 130563 129190 gene locus_tag LOCUS_17540 130563 129190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 130589 130819 gene locus_tag LOCUS_17550 130589 130819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 130840 131472 gene locus_tag LOCUS_17560 gene lexA 130840 131472 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965137.1 protein_id gnl|my_center|LOCUS_17560 131662 132660 gene locus_tag LOCUS_17570 131662 132660 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880910.1 protein_id gnl|my_center|LOCUS_17570 132693 133844 gene locus_tag LOCUS_17580 gene dinB 132693 133844 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_087861794.1 protein_id gnl|my_center|LOCUS_17580 134118 135767 gene locus_tag LOCUS_17590 134118 135767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 135760 137583 gene locus_tag LOCUS_17600 135760 137583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 137825 139216 gene locus_tag LOCUS_17610 137825 139216 CDS product TatD family nuclease-associated radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545153.1 protein_id gnl|my_center|LOCUS_17610 139989 139279 gene locus_tag LOCUS_17620 139989 139279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 140212 140898 gene locus_tag LOCUS_17630 140212 140898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 141007 141693 gene locus_tag LOCUS_17640 141007 141693 CDS product inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872152.1 protein_id gnl|my_center|LOCUS_17640 143098 141734 gene locus_tag LOCUS_17650 143098 141734 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001981895.1 protein_id gnl|my_center|LOCUS_17650 144264 143095 gene locus_tag LOCUS_17660 144264 143095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 144464 145588 gene locus_tag LOCUS_17670 144464 145588 CDS product protein tlpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963548.1 protein_id gnl|my_center|LOCUS_17670 145588 146022 gene locus_tag LOCUS_17680 145588 146022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_17680 146012 146317 gene locus_tag LOCUS_17690 146012 146317 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871778.1 protein_id gnl|my_center|LOCUS_17690 146332 146676 gene locus_tag LOCUS_17700 146332 146676 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_17700 148913 146829 gene locus_tag LOCUS_17710 148913 146829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 149011 150639 gene locus_tag LOCUS_17720 149011 150639 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_17720 151178 150831 gene locus_tag LOCUS_17730 151178 150831 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056841.1 protein_id gnl|my_center|LOCUS_17730 152600 151245 gene locus_tag LOCUS_17740 152600 151245 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403955.1 protein_id gnl|my_center|LOCUS_17740 153344 152736 gene locus_tag LOCUS_17750 153344 152736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 153461 154780 gene locus_tag LOCUS_17760 gene megL 153461 154780 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_17760 154900 156021 gene locus_tag LOCUS_17770 154900 156021 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403664.1 protein_id gnl|my_center|LOCUS_17770 156031 157380 gene locus_tag LOCUS_17780 156031 157380 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_17780 157405 158109 gene locus_tag LOCUS_17790 157405 158109 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_17790 158325 165365 gene locus_tag LOCUS_17800 158325 165365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 166454 165399 gene locus_tag LOCUS_17810 166454 165399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 166563 167546 gene locus_tag LOCUS_17820 166563 167546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 168822 167701 gene locus_tag LOCUS_17830 gene meaB 168822 167701 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099360647.1 protein_id gnl|my_center|LOCUS_17830 171178 168995 gene locus_tag LOCUS_17840 gene scpA 171178 168995 CDS product methylmalonyl-CoA mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258367.1 protein_id gnl|my_center|LOCUS_17840 173322 171175 gene locus_tag LOCUS_17850 173322 171175 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258368.1 protein_id gnl|my_center|LOCUS_17850 173789 175714 gene locus_tag LOCUS_17860 173789 175714 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038548.1 protein_id gnl|my_center|LOCUS_17860 176416 175730 gene locus_tag LOCUS_17870 176416 175730 CDS product N-acetylmannosamine-6-phosphate 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430452.1 protein_id gnl|my_center|LOCUS_17870 178649 176481 gene locus_tag LOCUS_17880 178649 176481 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027257.1 protein_id gnl|my_center|LOCUS_17880 180214 178802 gene locus_tag LOCUS_17890 180214 178802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 180382 181401 gene locus_tag LOCUS_17900 gene murB 180382 181401 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_17900 181561 181376 gene locus_tag LOCUS_17910 181561 181376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 181533 182117 gene locus_tag LOCUS_17920 181533 182117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 182242 182613 gene locus_tag LOCUS_17930 182242 182613 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141564.1 protein_id gnl|my_center|LOCUS_17930 182615 183103 gene locus_tag LOCUS_17940 182615 183103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17940 184137 183298 gene locus_tag LOCUS_17950 184137 183298 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947363.1 protein_id gnl|my_center|LOCUS_17950 >Feature sequence08 173 1447 gene locus_tag LOCUS_17960 173 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17960 1477 2862 gene locus_tag LOCUS_17970 1477 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 3119 3667 gene locus_tag LOCUS_17980 3119 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 3695 4891 gene locus_tag LOCUS_17990 3695 4891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 4894 5079 gene locus_tag LOCUS_18000 4894 5079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 5099 5404 gene locus_tag LOCUS_18010 5099 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 5401 5712 gene locus_tag LOCUS_18020 5401 5712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 5720 6259 gene locus_tag LOCUS_18030 5720 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 6261 6473 gene locus_tag LOCUS_18040 6261 6473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6463 6966 gene locus_tag LOCUS_18050 6463 6966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 6966 7244 gene locus_tag LOCUS_18060 6966 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 7244 7615 gene locus_tag LOCUS_18070 7244 7615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 7620 8012 gene locus_tag LOCUS_18080 7620 8012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 8012 8353 gene locus_tag LOCUS_18090 8012 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 8559 9965 gene locus_tag LOCUS_18100 8559 9965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 9955 11484 gene locus_tag LOCUS_18110 9955 11484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 11500 11907 gene locus_tag LOCUS_18120 11500 11907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 12006 12686 gene locus_tag LOCUS_18130 12006 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 12769 13047 gene locus_tag LOCUS_18140 12769 13047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 13216 13141 gene locus_tag LOCUS_t00250 13216 13141 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 13345 13878 gene locus_tag LOCUS_18150 13345 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 14084 14171 gene locus_tag LOCUS_t00260 14084 14171 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14197 14271 gene locus_tag LOCUS_t00270 14197 14271 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 14413 14973 gene locus_tag LOCUS_18160 gene infC 14413 14973 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043553525.1 protein_id gnl|my_center|LOCUS_18160 14988 15179 gene locus_tag LOCUS_18170 gene rpmI 14988 15179 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103015481.1 protein_id gnl|my_center|LOCUS_18170 15195 15542 gene locus_tag LOCUS_18180 gene rplT 15195 15542 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_18180 15628 16638 gene locus_tag LOCUS_18190 gene pheS 15628 16638 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933784.1 protein_id gnl|my_center|LOCUS_18190 16650 19055 gene locus_tag LOCUS_18200 gene pheT 16650 19055 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405510.1 protein_id gnl|my_center|LOCUS_18200 19056 19379 gene locus_tag LOCUS_18210 19056 19379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 19401 19697 gene locus_tag LOCUS_18220 19401 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 19925 21559 gene locus_tag LOCUS_18230 gene rny 19925 21559 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392595.1 protein_id gnl|my_center|LOCUS_18230 21528 22190 gene locus_tag LOCUS_18240 gene coaE 21528 22190 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932880.1 protein_id gnl|my_center|LOCUS_18240 22260 23165 gene locus_tag LOCUS_18250 22260 23165 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_18250 23162 24217 gene locus_tag LOCUS_18260 gene tsaD 23162 24217 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546527.1 protein_id gnl|my_center|LOCUS_18260 24229 25554 gene locus_tag LOCUS_18270 24229 25554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 25524 27197 gene locus_tag LOCUS_18280 25524 27197 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964514.1 protein_id gnl|my_center|LOCUS_18280 28514 27282 gene locus_tag LOCUS_18290 28514 27282 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201992.1 protein_id gnl|my_center|LOCUS_18290 29772 28504 gene locus_tag LOCUS_18300 gene hutI 29772 28504 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016618.1 protein_id gnl|my_center|LOCUS_18300 30281 29775 gene locus_tag LOCUS_18310 30281 29775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 30409 31902 gene locus_tag LOCUS_18320 30409 31902 CDS product starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933668.1 protein_id gnl|my_center|LOCUS_18320 31902 32483 gene locus_tag LOCUS_18330 31902 32483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 32477 33664 gene locus_tag LOCUS_18340 32477 33664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 33671 34921 gene locus_tag LOCUS_18350 33671 34921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 34918 36156 gene locus_tag LOCUS_18360 34918 36156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 36173 37465 gene locus_tag LOCUS_18370 36173 37465 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933254.1 protein_id gnl|my_center|LOCUS_18370 37466 38236 gene locus_tag LOCUS_18380 gene tatC 37466 38236 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927002.1 protein_id gnl|my_center|LOCUS_18380 38215 39213 gene locus_tag LOCUS_18390 38215 39213 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932877.1 protein_id gnl|my_center|LOCUS_18390 39842 39378 gene locus_tag LOCUS_18400 39842 39378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 40607 39858 gene locus_tag LOCUS_18410 gene hisA 40607 39858 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932164.1 protein_id gnl|my_center|LOCUS_18410 40754 41587 gene locus_tag LOCUS_18420 40754 41587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18420 41589 42155 gene locus_tag LOCUS_18430 41589 42155 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966725.1 protein_id gnl|my_center|LOCUS_18430 42231 44228 gene locus_tag LOCUS_18440 42231 44228 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018338.1 protein_id gnl|my_center|LOCUS_18440 44246 44428 gene locus_tag LOCUS_18450 44246 44428 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_18450 44523 45737 gene locus_tag LOCUS_18460 44523 45737 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932672.1 protein_id gnl|my_center|LOCUS_18460 45715 46719 gene locus_tag LOCUS_18470 gene dusB 45715 46719 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927287.1 protein_id gnl|my_center|LOCUS_18470 46722 47450 gene locus_tag LOCUS_18480 46722 47450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 47447 49291 gene locus_tag LOCUS_18490 47447 49291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18490 49347 50093 gene locus_tag LOCUS_18500 49347 50093 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228020.1 protein_id gnl|my_center|LOCUS_18500 50104 50628 gene locus_tag LOCUS_18510 50104 50628 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357763.1 protein_id gnl|my_center|LOCUS_18510 52201 50858 gene locus_tag LOCUS_18520 gene lat 52201 50858 CDS product L-lysine 6-transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869888.1 protein_id gnl|my_center|LOCUS_18520 52526 54058 gene locus_tag LOCUS_18530 52526 54058 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964414.1 protein_id gnl|my_center|LOCUS_18530 55460 54321 gene locus_tag LOCUS_18540 55460 54321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18540 55714 56205 gene locus_tag LOCUS_18550 gene nuoE 55714 56205 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817340.1 protein_id gnl|my_center|LOCUS_18550 56202 58187 gene locus_tag LOCUS_18560 gene nuoF 56202 58187 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_18560 58201 59910 gene locus_tag LOCUS_18570 58201 59910 CDS product NADH-dependent [FeFe] hydrogenase, group A6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986411.1 protein_id gnl|my_center|LOCUS_18570 60072 62693 gene locus_tag LOCUS_18580 60072 62693 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_18580 62690 62899 gene locus_tag LOCUS_18590 62690 62899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 62899 65025 gene locus_tag LOCUS_18600 gene ccoN 62899 65025 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_18600 65033 65191 gene locus_tag LOCUS_18610 65033 65191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 65208 66131 gene locus_tag LOCUS_18620 65208 66131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18620 66405 67817 gene locus_tag LOCUS_18630 gene ccoG 66405 67817 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_18630 67817 68263 gene locus_tag LOCUS_18640 67817 68263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 68266 68982 gene locus_tag LOCUS_18650 68266 68982 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_18650 69265 70833 gene locus_tag LOCUS_18660 69265 70833 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_18660 70830 71264 gene locus_tag LOCUS_18670 gene tsaE 70830 71264 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434423.1 protein_id gnl|my_center|LOCUS_18670 71321 72001 gene locus_tag LOCUS_18680 71321 72001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 72003 72710 gene locus_tag LOCUS_18690 72003 72710 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943348.1 protein_id gnl|my_center|LOCUS_18690 72720 73574 gene locus_tag LOCUS_18700 gene accD 72720 73574 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_18700 73571 74422 gene locus_tag LOCUS_18710 gene panC 73571 74422 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_18710 75411 74596 gene locus_tag LOCUS_18720 gene nagB 75411 74596 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775719.1 protein_id gnl|my_center|LOCUS_18720 77210 75489 gene locus_tag LOCUS_18730 77210 75489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18730 79003 77276 gene locus_tag LOCUS_18740 79003 77276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 79169 80020 gene locus_tag LOCUS_18750 79169 80020 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932876.1 protein_id gnl|my_center|LOCUS_18750 80212 80877 gene locus_tag LOCUS_18760 gene rpe 80212 80877 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_18760 80880 82046 gene locus_tag LOCUS_18770 gene nagA 80880 82046 CDS product N-acetylglucosamine-6-phosphate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861065.1 protein_id gnl|my_center|LOCUS_18770 82088 82882 gene locus_tag LOCUS_18780 gene folP 82088 82882 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082506.1 protein_id gnl|my_center|LOCUS_18780 82875 83696 gene locus_tag LOCUS_18790 gene cdaA 82875 83696 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808428.1 protein_id gnl|my_center|LOCUS_18790 83770 84447 gene locus_tag LOCUS_18800 83770 84447 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_18800 84477 85244 gene locus_tag LOCUS_18810 84477 85244 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_18810 85244 86176 gene locus_tag LOCUS_18820 85244 86176 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403291.1 protein_id gnl|my_center|LOCUS_18820 86139 86702 gene locus_tag LOCUS_18830 86139 86702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 87808 86891 gene locus_tag LOCUS_18840 87808 86891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 87906 88178 gene locus_tag LOCUS_18850 87906 88178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 88175 88630 gene locus_tag LOCUS_18860 gene aroQ 88175 88630 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083137.1 protein_id gnl|my_center|LOCUS_18860 88608 89288 gene locus_tag LOCUS_18870 88608 89288 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870955.1 protein_id gnl|my_center|LOCUS_18870 89357 89791 gene locus_tag LOCUS_18880 89357 89791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18880 89795 89871 gene locus_tag LOCUS_t00280 89795 89871 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 90001 94227 gene locus_tag LOCUS_18890 90001 94227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 94227 94814 gene locus_tag LOCUS_18900 94227 94814 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881413.1 protein_id gnl|my_center|LOCUS_18900 94811 95752 gene locus_tag LOCUS_18910 gene ftsY 94811 95752 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931894.1 protein_id gnl|my_center|LOCUS_18910 95749 96666 gene locus_tag LOCUS_18920 95749 96666 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546833.1 protein_id gnl|my_center|LOCUS_18920 96866 99532 gene locus_tag LOCUS_18930 96866 99532 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_18930 101523 99952 gene locus_tag LOCUS_18940 101523 99952 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933059.1 protein_id gnl|my_center|LOCUS_18940 102631 101780 gene locus_tag LOCUS_18950 102631 101780 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_18950 103824 102649 gene locus_tag LOCUS_18960 103824 102649 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190136.1 protein_id gnl|my_center|LOCUS_18960 104978 103836 gene locus_tag LOCUS_18970 104978 103836 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933270.1 protein_id gnl|my_center|LOCUS_18970 105217 104996 gene locus_tag LOCUS_18980 105217 104996 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962743.1 protein_id gnl|my_center|LOCUS_18980 106098 105244 gene locus_tag LOCUS_18990 106098 105244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 107246 106248 gene locus_tag LOCUS_19000 gene hprK 107246 106248 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839617.1 protein_id gnl|my_center|LOCUS_19000 107567 107250 gene locus_tag LOCUS_19010 107567 107250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 108481 107585 gene locus_tag LOCUS_19020 108481 107585 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933299.1 protein_id gnl|my_center|LOCUS_19020 108938 108504 gene locus_tag LOCUS_19030 gene ybeY 108938 108504 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404820.1 protein_id gnl|my_center|LOCUS_19030 109507 108965 gene locus_tag LOCUS_19040 109507 108965 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964199.1 protein_id gnl|my_center|LOCUS_19040 110435 109695 gene locus_tag LOCUS_19050 110435 109695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 111466 110438 gene locus_tag LOCUS_19060 111466 110438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 112995 111487 gene locus_tag LOCUS_19070 gene lysS 112995 111487 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933055.1 protein_id gnl|my_center|LOCUS_19070 114510 113005 gene locus_tag LOCUS_19080 gene dacB 114510 113005 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_19080 115201 114482 gene locus_tag LOCUS_19090 115201 114482 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002909097.1 protein_id gnl|my_center|LOCUS_19090 115935 115300 gene locus_tag LOCUS_19100 gene scpB 115935 115300 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404243.1 protein_id gnl|my_center|LOCUS_19100 116805 116089 gene locus_tag LOCUS_19110 116805 116089 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931830.1 protein_id gnl|my_center|LOCUS_19110 117786 116806 gene locus_tag LOCUS_19120 gene trpS 117786 116806 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931707.1 protein_id gnl|my_center|LOCUS_19120 118757 118383 gene locus_tag LOCUS_19130 gene acpS 118757 118383 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873555.1 protein_id gnl|my_center|LOCUS_19130 120358 118754 gene locus_tag LOCUS_19140 gene ggt 120358 118754 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254471.1 protein_id gnl|my_center|LOCUS_19140 121382 120447 gene locus_tag LOCUS_19150 121382 120447 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_19150 122671 121442 gene locus_tag LOCUS_19160 122671 121442 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080781.1 protein_id gnl|my_center|LOCUS_19160 123262 122762 gene locus_tag LOCUS_19170 123262 122762 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_19170 124648 123365 gene locus_tag LOCUS_19180 124648 123365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 127047 124777 gene locus_tag LOCUS_19190 127047 124777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 127509 127075 gene locus_tag LOCUS_19200 127509 127075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 128845 127550 gene locus_tag LOCUS_19210 128845 127550 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404687.1 protein_id gnl|my_center|LOCUS_19210 130003 128864 gene locus_tag LOCUS_19220 130003 128864 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_19220 130636 130133 gene locus_tag LOCUS_19230 130636 130133 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763362.1 protein_id gnl|my_center|LOCUS_19230 132132 130633 gene locus_tag LOCUS_19240 gene accC 132132 130633 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_19240 134570 132141 gene locus_tag LOCUS_19250 134570 132141 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403423.1 protein_id gnl|my_center|LOCUS_19250 135070 134570 gene locus_tag LOCUS_19260 135070 134570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 135524 135075 gene locus_tag LOCUS_19270 135524 135075 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_19270 135955 135521 gene locus_tag LOCUS_19280 135955 135521 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_19280 136475 135948 gene locus_tag LOCUS_19290 136475 135948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 137104 136472 gene locus_tag LOCUS_19300 137104 136472 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_19300 137932 137240 gene locus_tag LOCUS_19310 gene fabG 137932 137240 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056775.1 protein_id gnl|my_center|LOCUS_19310 139270 137939 gene locus_tag LOCUS_19320 gene pfp 139270 137939 CDS product diphosphate--fructose-6-phosphate 1-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083005.1 protein_id gnl|my_center|LOCUS_19320 141099 139297 gene locus_tag LOCUS_19330 141099 139297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 143348 141165 gene locus_tag LOCUS_19340 gene pcrA 143348 141165 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002163769.1 protein_id gnl|my_center|LOCUS_19340 145497 143587 gene locus_tag LOCUS_19350 gene dnaK 145497 143587 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932327.1 protein_id gnl|my_center|LOCUS_19350 145685 146461 gene locus_tag LOCUS_19360 145685 146461 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963909.1 protein_id gnl|my_center|LOCUS_19360 146458 147210 gene locus_tag LOCUS_19370 146458 147210 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886388.1 protein_id gnl|my_center|LOCUS_19370 148254 147385 gene locus_tag LOCUS_19380 148254 147385 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942615.1 protein_id gnl|my_center|LOCUS_19380 148504 148578 gene locus_tag LOCUS_t00290 148504 148578 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 149385 148960 gene locus_tag LOCUS_19390 149385 148960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence09 2623 116 gene locus_tag LOCUS_19400 2623 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 4225 3068 gene locus_tag LOCUS_19410 4225 3068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 5077 4514 gene locus_tag LOCUS_19420 5077 4514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 5149 5526 gene locus_tag LOCUS_19430 5149 5526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19430 5532 6722 gene locus_tag LOCUS_19440 5532 6722 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017139992.1 protein_id gnl|my_center|LOCUS_19440 10587 6874 gene locus_tag LOCUS_19450 gene metH 10587 6874 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933516.1 protein_id gnl|my_center|LOCUS_19450 10690 11664 gene locus_tag LOCUS_19460 gene rfaD 10690 11664 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937788.1 protein_id gnl|my_center|LOCUS_19460 12348 11920 gene locus_tag LOCUS_19470 12348 11920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 12552 16619 gene locus_tag LOCUS_19480 12552 16619 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029446868.1 protein_id gnl|my_center|LOCUS_19480 16923 19385 gene locus_tag LOCUS_19490 16923 19385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 19818 21812 gene locus_tag LOCUS_19500 19818 21812 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_19500 21829 22260 gene locus_tag LOCUS_19510 21829 22260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 22370 24091 gene locus_tag LOCUS_19520 gene recN 22370 24091 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403565.1 protein_id gnl|my_center|LOCUS_19520 24205 25566 gene locus_tag LOCUS_19530 24205 25566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 26005 26961 gene locus_tag LOCUS_19540 gene trxB 26005 26961 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932523.1 protein_id gnl|my_center|LOCUS_19540 27742 27398 gene locus_tag LOCUS_19550 27742 27398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 28221 28859 gene locus_tag LOCUS_19560 28221 28859 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767733.1 protein_id gnl|my_center|LOCUS_19560 28864 29376 gene locus_tag LOCUS_19570 28864 29376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 29644 29976 gene locus_tag LOCUS_19580 29644 29976 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962803.1 protein_id gnl|my_center|LOCUS_19580 32015 30192 gene locus_tag LOCUS_19590 32015 30192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19590 32078 32923 gene locus_tag LOCUS_19600 32078 32923 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_19600 33220 34239 gene locus_tag LOCUS_19610 gene queG 33220 34239 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_19610 34353 35405 gene locus_tag LOCUS_19620 34353 35405 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019081821.1 protein_id gnl|my_center|LOCUS_19620 35596 36150 gene locus_tag LOCUS_19630 35596 36150 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927009.1 protein_id gnl|my_center|LOCUS_19630 36945 36280 gene locus_tag LOCUS_19640 36945 36280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19640 39383 36867 gene locus_tag LOCUS_19650 39383 36867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 39796 39458 gene locus_tag LOCUS_19660 39796 39458 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007603495.1 protein_id gnl|my_center|LOCUS_19660 42893 39813 gene locus_tag LOCUS_19670 gene secA 42893 39813 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932908.1 protein_id gnl|my_center|LOCUS_19670 44853 43060 gene locus_tag LOCUS_19680 44853 43060 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_19680 47073 45385 gene locus_tag LOCUS_19690 47073 45385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 47441 47070 gene locus_tag LOCUS_19700 47441 47070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 51047 48093 gene locus_tag LOCUS_19710 51047 48093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 51824 51342 gene locus_tag LOCUS_19720 51824 51342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 53311 51935 gene locus_tag LOCUS_19730 53311 51935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 53787 56960 gene locus_tag LOCUS_19740 53787 56960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 56960 59074 gene locus_tag LOCUS_19750 56960 59074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 59327 60442 gene locus_tag LOCUS_19760 59327 60442 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_19760 60891 64007 gene locus_tag LOCUS_19770 60891 64007 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929325.1 protein_id gnl|my_center|LOCUS_19770 64237 66411 gene locus_tag LOCUS_19780 64237 66411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 67471 66497 gene locus_tag LOCUS_19790 gene glcK 67471 66497 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000391701.1 protein_id gnl|my_center|LOCUS_19790 67926 68843 gene locus_tag LOCUS_19800 gene rsmA 67926 68843 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183956993.1 protein_id gnl|my_center|LOCUS_19800 69044 69748 gene locus_tag LOCUS_19810 gene ubiE 69044 69748 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926864.1 protein_id gnl|my_center|LOCUS_19810 71706 69850 gene locus_tag LOCUS_19820 gene recJ 71706 69850 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963032.1 protein_id gnl|my_center|LOCUS_19820 73184 72444 gene locus_tag LOCUS_19830 73184 72444 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_19830 74314 73199 gene locus_tag LOCUS_19840 74314 73199 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_19840 76696 74714 gene locus_tag LOCUS_19850 76696 74714 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203674.1 protein_id gnl|my_center|LOCUS_19850 77174 79084 gene locus_tag LOCUS_19860 gene dnaG 77174 79084 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403730.1 protein_id gnl|my_center|LOCUS_19860 79677 81890 gene locus_tag LOCUS_19870 79677 81890 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_19870 81899 82966 gene locus_tag LOCUS_19880 81899 82966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 83240 83761 gene locus_tag LOCUS_19890 83240 83761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_19890 85164 84010 gene locus_tag LOCUS_19900 85164 84010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19900 85912 85157 gene locus_tag LOCUS_19910 85912 85157 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_19910 86679 85897 gene locus_tag LOCUS_19920 86679 85897 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921522.1 protein_id gnl|my_center|LOCUS_19920 86849 88486 gene locus_tag LOCUS_19930 86849 88486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 88500 89600 gene locus_tag LOCUS_19940 gene dctP 88500 89600 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_19940 89700 90020 gene locus_tag LOCUS_19950 89700 90020 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962681.1 protein_id gnl|my_center|LOCUS_19950 90208 90564 gene locus_tag LOCUS_19960 90208 90564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 90966 91412 gene locus_tag LOCUS_19970 90966 91412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19970 91506 93785 gene locus_tag LOCUS_19980 91506 93785 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529100.1 protein_id gnl|my_center|LOCUS_19980 94080 95360 gene locus_tag LOCUS_19990 94080 95360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 95357 97225 gene locus_tag LOCUS_20000 95357 97225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20000 97258 97407 gene locus_tag LOCUS_20010 97258 97407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 99014 97518 gene locus_tag LOCUS_20020 99014 97518 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088854992.1 protein_id gnl|my_center|LOCUS_20020 99348 99662 gene locus_tag LOCUS_20030 99348 99662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 99823 101283 gene locus_tag LOCUS_20040 gene gatB 99823 101283 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_20040 101356 102207 gene locus_tag LOCUS_20050 gene lepB 101356 102207 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933117.1 protein_id gnl|my_center|LOCUS_20050 102241 103506 gene locus_tag LOCUS_20060 102241 103506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 103503 104894 gene locus_tag LOCUS_20070 103503 104894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 105851 104802 gene locus_tag LOCUS_20080 105851 104802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 106649 105867 gene locus_tag LOCUS_20090 106649 105867 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_20090 107667 106804 gene locus_tag LOCUS_20100 107667 106804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 108167 107679 gene locus_tag LOCUS_20110 108167 107679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 108122 108337 gene locus_tag LOCUS_20120 108122 108337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 109229 108495 gene locus_tag LOCUS_20130 gene truA 109229 108495 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932658.1 protein_id gnl|my_center|LOCUS_20130 110816 109581 gene locus_tag LOCUS_20140 110816 109581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 111218 113746 gene locus_tag LOCUS_20150 gene lon 111218 113746 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392068.1 protein_id gnl|my_center|LOCUS_20150 113743 114543 gene locus_tag LOCUS_20160 113743 114543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20160 114568 116241 gene locus_tag LOCUS_20170 114568 116241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20170 116456 118294 gene locus_tag LOCUS_20180 116456 118294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 119177 120766 gene locus_tag LOCUS_20190 119177 120766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 120924 122960 gene locus_tag LOCUS_20200 120924 122960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 123788 126046 gene locus_tag LOCUS_20210 123788 126046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 126043 126264 gene locus_tag LOCUS_20220 126043 126264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 127386 126292 gene locus_tag LOCUS_20230 127386 126292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 127566 128183 gene locus_tag LOCUS_20240 127566 128183 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791331.1 protein_id gnl|my_center|LOCUS_20240 129433 128393 gene locus_tag LOCUS_20250 129433 128393 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088212.1 protein_id gnl|my_center|LOCUS_20250 130852 129809 gene locus_tag LOCUS_20260 130852 129809 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_20260 133002 131554 gene locus_tag LOCUS_20270 133002 131554 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891943.1 protein_id gnl|my_center|LOCUS_20270 133626 135704 gene locus_tag LOCUS_20280 133626 135704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20280 136189 135800 gene locus_tag LOCUS_20290 136189 135800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 136549 137577 gene locus_tag LOCUS_20300 136549 137577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582975.1 protein_id gnl|my_center|LOCUS_20300 138375 140990 gene locus_tag LOCUS_20310 138375 140990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 141171 142916 gene locus_tag LOCUS_20320 141171 142916 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_20320 143093 144880 gene locus_tag LOCUS_20330 143093 144880 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931951.1 protein_id gnl|my_center|LOCUS_20330 145041 146072 gene locus_tag LOCUS_20340 gene fbp 145041 146072 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 protein_id gnl|my_center|LOCUS_20340 146536 146255 gene locus_tag LOCUS_20350 146536 146255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20350 >Feature sequence10 1979 2218 gene locus_tag LOCUS_20360 1979 2218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 2425 3981 gene locus_tag LOCUS_20370 gene hisS 2425 3981 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339406.1 protein_id gnl|my_center|LOCUS_20370 4005 5591 gene locus_tag LOCUS_20380 gene hutH 4005 5591 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889407.1 protein_id gnl|my_center|LOCUS_20380 6833 5781 gene locus_tag LOCUS_20390 6833 5781 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014205909.1 protein_id gnl|my_center|LOCUS_20390 9594 6805 gene locus_tag LOCUS_20400 9594 6805 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_216713224.1 protein_id gnl|my_center|LOCUS_20400 9812 10012 gene locus_tag LOCUS_20410 9812 10012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 10380 9913 gene locus_tag LOCUS_20420 gene ybaK 10380 9913 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763164.1 protein_id gnl|my_center|LOCUS_20420 10800 11369 gene locus_tag LOCUS_20430 10800 11369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 11399 14308 gene locus_tag LOCUS_20440 11399 14308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 14483 15574 gene locus_tag LOCUS_20450 14483 15574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 17275 15767 gene locus_tag LOCUS_20460 17275 15767 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_20460 18740 17643 gene locus_tag LOCUS_20470 18740 17643 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_20470 19484 18873 gene locus_tag LOCUS_20480 gene clpP 19484 18873 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392065.1 protein_id gnl|my_center|LOCUS_20480 20989 19556 gene locus_tag LOCUS_20490 gene tig 20989 19556 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930702.1 protein_id gnl|my_center|LOCUS_20490 21096 21014 gene locus_tag LOCUS_t00300 21096 21014 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22507 21374 gene locus_tag LOCUS_20500 22507 21374 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401697.1 protein_id gnl|my_center|LOCUS_20500 23186 22497 gene locus_tag LOCUS_20510 23186 22497 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485336.1 protein_id gnl|my_center|LOCUS_20510 24981 23203 gene locus_tag LOCUS_20520 24981 23203 CDS product potassium transporter TrkG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084504.1 protein_id gnl|my_center|LOCUS_20520 26110 24965 gene locus_tag LOCUS_20530 26110 24965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 30654 26095 gene locus_tag LOCUS_20540 30654 26095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 31895 30651 gene locus_tag LOCUS_20550 31895 30651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 33583 31946 gene locus_tag LOCUS_20560 33583 31946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20560 33679 35826 gene locus_tag LOCUS_20570 33679 35826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 35826 36749 gene locus_tag LOCUS_20580 35826 36749 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021142.1 protein_id gnl|my_center|LOCUS_20580 36937 39270 gene locus_tag LOCUS_20590 gene topA 36937 39270 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_20590 39381 39454 gene locus_tag LOCUS_t00310 39381 39454 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 39504 39578 gene locus_tag LOCUS_t00320 39504 39578 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 40032 40553 gene locus_tag LOCUS_20600 40032 40553 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404680.1 protein_id gnl|my_center|LOCUS_20600 40715 41665 gene locus_tag LOCUS_20610 gene miaA 40715 41665 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986379.1 protein_id gnl|my_center|LOCUS_20610 41680 43047 gene locus_tag LOCUS_20620 41680 43047 CDS product DUF1446 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389228.1 protein_id gnl|my_center|LOCUS_20620 43049 43360 gene locus_tag LOCUS_20630 43049 43360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389227.1 protein_id gnl|my_center|LOCUS_20630 43614 44555 gene locus_tag LOCUS_20640 gene prfB 43614 44555 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942918.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20640 44567 44932 gene locus_tag LOCUS_20650 44567 44932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20650 46916 44937 gene locus_tag LOCUS_20660 46916 44937 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546388.1 protein_id gnl|my_center|LOCUS_20660 47299 48408 gene locus_tag LOCUS_20670 47299 48408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 48405 50606 gene locus_tag LOCUS_20680 48405 50606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 53708 50628 gene locus_tag LOCUS_20690 53708 50628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 55107 53740 gene locus_tag LOCUS_20700 gene sthA 55107 53740 CDS product Si-specific NAD(P)(+) transhydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001120816.1 protein_id gnl|my_center|LOCUS_20700 55319 57349 gene locus_tag LOCUS_20710 55319 57349 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071575.1 protein_id gnl|my_center|LOCUS_20710 60702 57346 gene locus_tag LOCUS_20720 60702 57346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 62864 61089 gene locus_tag LOCUS_20730 62864 61089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 63040 63729 gene locus_tag LOCUS_20740 gene queC 63040 63729 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389710.1 protein_id gnl|my_center|LOCUS_20740 63876 65270 gene locus_tag LOCUS_20750 63876 65270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 67238 65535 gene locus_tag LOCUS_20760 67238 65535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 67522 69216 gene locus_tag LOCUS_20770 67522 69216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20770 69209 69961 gene locus_tag LOCUS_20780 69209 69961 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933645.1 protein_id gnl|my_center|LOCUS_20780 69961 72195 gene locus_tag LOCUS_20790 69961 72195 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927193.1 protein_id gnl|my_center|LOCUS_20790 72350 72434 gene locus_tag LOCUS_t00330 72350 72434 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 72628 73008 gene locus_tag LOCUS_20800 72628 73008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20800 73218 74069 gene locus_tag LOCUS_20810 gene hpnC 73218 74069 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040123.1 protein_id gnl|my_center|LOCUS_20810 74060 74905 gene locus_tag LOCUS_20820 74060 74905 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933054.1 protein_id gnl|my_center|LOCUS_20820 74902 76542 gene locus_tag LOCUS_20830 74902 76542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 79363 76583 gene locus_tag LOCUS_20840 gene polA 79363 76583 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_20840 80793 79360 gene locus_tag LOCUS_20850 80793 79360 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142346.1 protein_id gnl|my_center|LOCUS_20850 80934 82463 gene locus_tag LOCUS_20860 80934 82463 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404499.1 protein_id gnl|my_center|LOCUS_20860 82465 84093 gene locus_tag LOCUS_20870 82465 84093 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_20870 84579 85691 gene locus_tag LOCUS_20880 gene hisC 84579 85691 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694274.1 protein_id gnl|my_center|LOCUS_20880 85703 86944 gene locus_tag LOCUS_20890 85703 86944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 89878 87464 gene locus_tag LOCUS_20900 89878 87464 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259686.1 protein_id gnl|my_center|LOCUS_20900 93026 90024 gene locus_tag LOCUS_20910 93026 90024 CDS product alpha-mannosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002369316.1 protein_id gnl|my_center|LOCUS_20910 94496 93135 gene locus_tag LOCUS_20920 94496 93135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20920 95934 94498 gene locus_tag LOCUS_20930 95934 94498 CDS product phosphoglucomutase/phosphomannomutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943934.1 protein_id gnl|my_center|LOCUS_20930 98587 96095 gene locus_tag LOCUS_20940 98587 96095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20940 98751 99815 gene locus_tag LOCUS_20950 98751 99815 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003898152.1 protein_id gnl|my_center|LOCUS_20950 100793 99975 gene locus_tag LOCUS_20960 100793 99975 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_20960 100945 102228 gene locus_tag LOCUS_20970 gene ugpC 100945 102228 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079960.1 protein_id gnl|my_center|LOCUS_20970 103079 102324 gene locus_tag LOCUS_20980 103079 102324 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932758.1 protein_id gnl|my_center|LOCUS_20980 103913 103167 gene locus_tag LOCUS_20990 103913 103167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20990 104772 104005 gene locus_tag LOCUS_21000 104772 104005 CDS product DUF3298 and DUF4163 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932758.1 protein_id gnl|my_center|LOCUS_21000 106801 104852 gene locus_tag LOCUS_21010 106801 104852 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403289.1 protein_id gnl|my_center|LOCUS_21010 107514 106840 gene locus_tag LOCUS_21020 107514 106840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 108515 107517 gene locus_tag LOCUS_21030 gene floA 108515 107517 CDS product flotillin-like protein FloA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583132.1 protein_id gnl|my_center|LOCUS_21030 108756 111254 gene locus_tag LOCUS_21040 108756 111254 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931885.1 protein_id gnl|my_center|LOCUS_21040 111495 111788 gene locus_tag LOCUS_21050 111495 111788 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980242.1 protein_id gnl|my_center|LOCUS_21050 111861 113138 gene locus_tag LOCUS_21060 111861 113138 CDS product IgA Peptidase M64 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797944.1 protein_id gnl|my_center|LOCUS_21060 113248 114612 gene locus_tag LOCUS_21070 113248 114612 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958071.1 protein_id gnl|my_center|LOCUS_21070 114723 115892 gene locus_tag LOCUS_21080 114723 115892 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_21080 115904 117013 gene locus_tag LOCUS_21090 115904 117013 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254072.1 protein_id gnl|my_center|LOCUS_21090 117046 118329 gene locus_tag LOCUS_21100 117046 118329 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_21100 118590 119876 gene locus_tag LOCUS_21110 gene gdhA 118590 119876 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867693.1 protein_id gnl|my_center|LOCUS_21110 119968 123150 gene locus_tag LOCUS_21120 119968 123150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 124564 123188 gene locus_tag LOCUS_21130 124564 123188 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839972.1 protein_id gnl|my_center|LOCUS_21130 125463 124561 gene locus_tag LOCUS_21140 125463 124561 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020663.1 protein_id gnl|my_center|LOCUS_21140 125651 126082 gene locus_tag LOCUS_21150 125651 126082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 126619 126422 gene locus_tag LOCUS_21160 126619 126422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 127224 128462 gene locus_tag LOCUS_21170 127224 128462 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005677642.1 protein_id gnl|my_center|LOCUS_21170 129054 129153 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 129888 129580 gene locus_tag LOCUS_21180 129888 129580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 130291 130010 gene locus_tag LOCUS_21190 130291 130010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 133034 131709 gene locus_tag LOCUS_21200 133034 131709 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010706495.1 protein_id gnl|my_center|LOCUS_21200 133486 133037 gene locus_tag LOCUS_21210 133486 133037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 133742 133500 gene locus_tag LOCUS_21220 133742 133500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 134068 133778 gene locus_tag LOCUS_21230 134068 133778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 135308 134001 gene locus_tag LOCUS_21240 135308 134001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 135525 135244 gene locus_tag LOCUS_21250 135525 135244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 135797 135648 gene locus_tag LOCUS_21260 135797 135648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 138267 135745 gene locus_tag LOCUS_21270 138267 135745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 138719 138339 gene locus_tag LOCUS_21280 138719 138339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 139581 138721 gene locus_tag LOCUS_21290 139581 138721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21290 >Feature sequence11 1708 1028 gene locus_tag LOCUS_21300 gene cmk 1708 1028 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_21300 2982 2071 gene locus_tag LOCUS_21310 2982 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21310 3187 3927 gene locus_tag LOCUS_21320 3187 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 5378 4017 gene locus_tag LOCUS_21330 5378 4017 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986993.1 protein_id gnl|my_center|LOCUS_21330 6330 5368 gene locus_tag LOCUS_21340 6330 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 6759 6442 gene locus_tag LOCUS_21350 6759 6442 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_21350 7393 8670 gene locus_tag LOCUS_21360 7393 8670 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_21360 8683 9918 gene locus_tag LOCUS_21370 8683 9918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088279.1 protein_id gnl|my_center|LOCUS_21370 11573 9978 gene locus_tag LOCUS_21380 11573 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 13120 11606 gene locus_tag LOCUS_21390 13120 11606 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898767.1 protein_id gnl|my_center|LOCUS_21390 13851 13126 gene locus_tag LOCUS_21400 13851 13126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 16339 13868 gene locus_tag LOCUS_21410 16339 13868 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_21410 18689 16524 gene locus_tag LOCUS_21420 18689 16524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 20308 18764 gene locus_tag LOCUS_21430 20308 18764 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_21430 20453 21301 gene locus_tag LOCUS_21440 20453 21301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 21862 22383 gene locus_tag LOCUS_21450 21862 22383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 23335 22661 gene locus_tag LOCUS_21460 23335 22661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 23754 23338 gene locus_tag LOCUS_21470 23754 23338 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404335.1 protein_id gnl|my_center|LOCUS_21470 24421 23762 gene locus_tag LOCUS_21480 24421 23762 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_21480 27864 24442 gene locus_tag LOCUS_21490 27864 24442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 29625 28036 gene locus_tag LOCUS_21500 29625 28036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 32603 29622 gene locus_tag LOCUS_21510 32603 29622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 34063 32600 gene locus_tag LOCUS_21520 34063 32600 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926895.1 protein_id gnl|my_center|LOCUS_21520 34695 34267 gene locus_tag LOCUS_21530 34695 34267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 36343 35000 gene locus_tag LOCUS_21540 36343 35000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 37884 36703 gene locus_tag LOCUS_21550 37884 36703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023522.1 protein_id gnl|my_center|LOCUS_21550 38149 37859 gene locus_tag LOCUS_21560 38149 37859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21560 39246 38149 gene locus_tag LOCUS_21570 39246 38149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21570 40457 39717 gene locus_tag LOCUS_21580 40457 39717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21580 40929 40720 gene locus_tag LOCUS_21590 40929 40720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21590 41138 40923 gene locus_tag LOCUS_21600 41138 40923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 41501 41416 gene locus_tag LOCUS_t00340 41501 41416 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 42408 41923 gene locus_tag LOCUS_21610 42408 41923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21610 43214 42417 gene locus_tag LOCUS_21620 43214 42417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 43749 43174 gene locus_tag LOCUS_21630 43749 43174 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962784.1 protein_id gnl|my_center|LOCUS_21630 44094 44615 gene locus_tag LOCUS_21640 44094 44615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 47715 44761 gene locus_tag LOCUS_21650 47715 44761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 50102 48075 gene locus_tag LOCUS_21660 50102 48075 CDS product glycoside hydrolase family 97 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202310.1 protein_id gnl|my_center|LOCUS_21660 50620 50213 gene locus_tag LOCUS_21670 50620 50213 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255952.1 protein_id gnl|my_center|LOCUS_21670 51001 50639 gene locus_tag LOCUS_21680 51001 50639 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937702.1 protein_id gnl|my_center|LOCUS_21680 51990 51226 gene locus_tag LOCUS_21690 gene kdsB 51990 51226 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942541.1 protein_id gnl|my_center|LOCUS_21690 52014 52113 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 52532 52236 gene locus_tag LOCUS_21700 gene gatC 52532 52236 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393506.1 protein_id gnl|my_center|LOCUS_21700 53091 52516 gene locus_tag LOCUS_21710 53091 52516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21710 54275 53511 gene locus_tag LOCUS_21720 54275 53511 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962306.1 protein_id gnl|my_center|LOCUS_21720 56059 54272 gene locus_tag LOCUS_21730 56059 54272 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765731.1 protein_id gnl|my_center|LOCUS_21730 56853 56056 gene locus_tag LOCUS_21740 56853 56056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 58094 56856 gene locus_tag LOCUS_21750 58094 56856 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_21750 59085 58096 gene locus_tag LOCUS_21760 59085 58096 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107514.1 protein_id gnl|my_center|LOCUS_21760 60307 59078 gene locus_tag LOCUS_21770 60307 59078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 61128 60313 gene locus_tag LOCUS_21780 61128 60313 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793731.1 protein_id gnl|my_center|LOCUS_21780 62182 61199 gene locus_tag LOCUS_21790 62182 61199 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_21790 63063 62509 gene locus_tag LOCUS_21800 63063 62509 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810294.1 protein_id gnl|my_center|LOCUS_21800 64395 63076 gene locus_tag LOCUS_21810 64395 63076 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810293.1 protein_id gnl|my_center|LOCUS_21810 66229 64565 gene locus_tag LOCUS_21820 66229 64565 CDS product succinic semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029859.1 protein_id gnl|my_center|LOCUS_21820 67050 66226 gene locus_tag LOCUS_21830 67050 66226 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892195.1 protein_id gnl|my_center|LOCUS_21830 67271 69250 gene locus_tag LOCUS_21840 67271 69250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21840 69584 70090 gene locus_tag LOCUS_21850 69584 70090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 70110 72104 gene locus_tag LOCUS_21860 gene nosZ 70110 72104 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838072.1 protein_id gnl|my_center|LOCUS_21860 72156 72743 gene locus_tag LOCUS_21870 72156 72743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_21870 72740 73180 gene locus_tag LOCUS_21880 72740 73180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 73182 74420 gene locus_tag LOCUS_21890 73182 74420 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403089.1 protein_id gnl|my_center|LOCUS_21890 74417 75139 gene locus_tag LOCUS_21900 74417 75139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 75127 75918 gene locus_tag LOCUS_21910 75127 75918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 75925 76413 gene locus_tag LOCUS_21920 75925 76413 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_21920 76464 77003 gene locus_tag LOCUS_21930 76464 77003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 77103 78296 gene locus_tag LOCUS_21940 77103 78296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_21940 78283 78591 gene locus_tag LOCUS_21950 78283 78591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 78630 78947 gene locus_tag LOCUS_21960 78630 78947 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061058.1 protein_id gnl|my_center|LOCUS_21960 79205 79342 gene locus_tag LOCUS_21970 79205 79342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 79834 79325 gene locus_tag LOCUS_21980 79834 79325 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_21980 80474 79944 gene locus_tag LOCUS_21990 80474 79944 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164923583.1 protein_id gnl|my_center|LOCUS_21990 80855 80535 gene locus_tag LOCUS_22000 80855 80535 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108936.1 protein_id gnl|my_center|LOCUS_22000 81314 80859 gene locus_tag LOCUS_22010 81314 80859 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_22010 82564 81314 gene locus_tag LOCUS_22020 82564 81314 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_22020 83888 82557 gene locus_tag LOCUS_22030 gene sufD 83888 82557 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964480.1 protein_id gnl|my_center|LOCUS_22030 84664 83900 gene locus_tag LOCUS_22040 gene sufC 84664 83900 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165620.1 protein_id gnl|my_center|LOCUS_22040 86135 84687 gene locus_tag LOCUS_22050 gene sufB 86135 84687 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141370.1 protein_id gnl|my_center|LOCUS_22050 86817 86365 gene locus_tag LOCUS_22060 86817 86365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 88623 87046 gene locus_tag LOCUS_22070 88623 87046 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926815.1 protein_id gnl|my_center|LOCUS_22070 88574 88810 gene locus_tag LOCUS_22080 88574 88810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 89926 88919 gene locus_tag LOCUS_22090 89926 88919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 91092 90175 gene locus_tag LOCUS_22100 gene xerD 91092 90175 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_22100 93229 91070 gene locus_tag LOCUS_22110 93229 91070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 94067 93237 gene locus_tag LOCUS_22120 94067 93237 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391801.1 protein_id gnl|my_center|LOCUS_22120 95847 94111 gene locus_tag LOCUS_22130 95847 94111 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932655.1 protein_id gnl|my_center|LOCUS_22130 97306 95834 gene locus_tag LOCUS_22140 97306 95834 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013060927.1 protein_id gnl|my_center|LOCUS_22140 97718 97368 gene locus_tag LOCUS_22150 97718 97368 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257824.1 protein_id gnl|my_center|LOCUS_22150 99848 97761 gene locus_tag LOCUS_22160 gene ligA 99848 97761 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233916.1 protein_id gnl|my_center|LOCUS_22160 100800 99754 gene locus_tag LOCUS_22170 100800 99754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 102174 100813 gene locus_tag LOCUS_22180 gene rsmB 102174 100813 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_22180 103462 102191 gene locus_tag LOCUS_22190 103462 102191 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404674.1 protein_id gnl|my_center|LOCUS_22190 104106 103855 gene locus_tag LOCUS_22200 104106 103855 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975406.1 protein_id gnl|my_center|LOCUS_22200 105448 104354 gene locus_tag LOCUS_22210 105448 104354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 109148 105936 gene locus_tag LOCUS_22220 109148 105936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 111275 109167 gene locus_tag LOCUS_22230 gene rnr 111275 109167 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838893.1 protein_id gnl|my_center|LOCUS_22230 116047 111275 gene locus_tag LOCUS_22240 116047 111275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 116564 116076 gene locus_tag LOCUS_22250 gene rfaE2 116564 116076 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_22250 117624 116629 gene locus_tag LOCUS_22260 gene rfaE1 117624 116629 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_22260 118869 117772 gene locus_tag LOCUS_22270 118869 117772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 119689 118874 gene locus_tag LOCUS_22280 gene panB 119689 118874 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933009.1 protein_id gnl|my_center|LOCUS_22280 120458 119700 gene locus_tag LOCUS_22290 120458 119700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 121232 120459 gene locus_tag LOCUS_22300 gene lpxA 121232 120459 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_22300 122592 121234 gene locus_tag LOCUS_22310 122592 121234 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_22310 123649 122948 gene locus_tag LOCUS_22320 gene rsmI 123649 122948 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_22320 123918 123649 gene locus_tag LOCUS_22330 123918 123649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 124021 126108 gene locus_tag LOCUS_22340 124021 126108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 128151 126178 gene locus_tag LOCUS_22350 gene acs 128151 126178 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228545.1 protein_id gnl|my_center|LOCUS_22350 128941 128339 gene locus_tag LOCUS_22360 128941 128339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 129541 130293 gene locus_tag LOCUS_22370 129541 130293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 131876 130536 gene locus_tag LOCUS_22380 131876 130536 CDS product SpoIID/LytB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201993.1 protein_id gnl|my_center|LOCUS_22380 132006 132917 gene locus_tag LOCUS_22390 gene rocF 132006 132917 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_22390 133179 133715 gene locus_tag LOCUS_22400 133179 133715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 135768 133813 gene locus_tag LOCUS_22410 135768 133813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 136328 135765 gene locus_tag LOCUS_22420 136328 135765 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036526.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence12 608 258 gene locus_tag LOCUS_22430 608 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 1024 629 gene locus_tag LOCUS_22440 1024 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 1348 1202 gene locus_tag LOCUS_22450 1348 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 2293 3051 gene locus_tag LOCUS_22460 2293 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 5362 3449 gene locus_tag LOCUS_22470 5362 3449 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_22470 5579 7852 gene locus_tag LOCUS_22480 5579 7852 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_22480 8875 9618 gene locus_tag LOCUS_22490 8875 9618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 10007 11284 gene locus_tag LOCUS_22500 gene tyrS 10007 11284 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229300.1 protein_id gnl|my_center|LOCUS_22500 11382 11747 gene locus_tag LOCUS_22510 11382 11747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 12795 12004 gene locus_tag LOCUS_22520 gene hisN 12795 12004 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390913.1 protein_id gnl|my_center|LOCUS_22520 14790 12997 gene locus_tag LOCUS_22530 gene thrS 14790 12997 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000608336.1 protein_id gnl|my_center|LOCUS_22530 15105 16079 gene locus_tag LOCUS_22540 15105 16079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 16124 17038 gene locus_tag LOCUS_22550 16124 17038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 19279 17231 gene locus_tag LOCUS_22560 19279 17231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 21161 19389 gene locus_tag LOCUS_22570 21161 19389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 23321 21309 gene locus_tag LOCUS_22580 23321 21309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 25065 23479 gene locus_tag LOCUS_22590 25065 23479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 25209 26054 gene locus_tag LOCUS_22600 25209 26054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 26265 26633 gene locus_tag LOCUS_22610 26265 26633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 27157 26888 gene locus_tag LOCUS_22620 27157 26888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 27730 27170 gene locus_tag LOCUS_22630 27730 27170 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_22630 28547 27744 gene locus_tag LOCUS_22640 28547 27744 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_22640 29630 28560 gene locus_tag LOCUS_22650 29630 28560 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_22650 29870 29643 gene locus_tag LOCUS_22660 29870 29643 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005776432.1 protein_id gnl|my_center|LOCUS_22660 30537 32123 gene locus_tag LOCUS_22670 30537 32123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 32303 33502 gene locus_tag LOCUS_22680 32303 33502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22680 33468 33812 gene locus_tag LOCUS_22690 33468 33812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22690 35028 36530 gene locus_tag LOCUS_22700 35028 36530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 36835 37479 gene locus_tag LOCUS_22710 36835 37479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 38222 38839 gene locus_tag LOCUS_22720 38222 38839 CDS product DUF3862 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986761.1 protein_id gnl|my_center|LOCUS_22720 39231 39860 gene locus_tag LOCUS_22730 39231 39860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 41398 40211 gene locus_tag LOCUS_22740 41398 40211 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_22740 42448 41687 gene locus_tag LOCUS_22750 42448 41687 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942545.1 protein_id gnl|my_center|LOCUS_22750 42645 44441 gene locus_tag LOCUS_22760 42645 44441 CDS product phosphoenolpyruvate carboxykinase (GTP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973998.1 protein_id gnl|my_center|LOCUS_22760 44599 45324 gene locus_tag LOCUS_22770 44599 45324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 47202 45469 gene locus_tag LOCUS_22780 47202 45469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 47559 48437 gene locus_tag LOCUS_22790 47559 48437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 48789 49217 gene locus_tag LOCUS_22800 48789 49217 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813896.1 protein_id gnl|my_center|LOCUS_22800 49245 50606 gene locus_tag LOCUS_22810 49245 50606 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122520.1 protein_id gnl|my_center|LOCUS_22810 50609 51637 gene locus_tag LOCUS_22820 gene cydB 50609 51637 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122521.1 protein_id gnl|my_center|LOCUS_22820 52830 51880 gene locus_tag LOCUS_22830 52830 51880 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932928.1 protein_id gnl|my_center|LOCUS_22830 53633 52941 gene locus_tag LOCUS_22840 53633 52941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 53908 53648 gene locus_tag LOCUS_22850 53908 53648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 54697 54005 gene locus_tag LOCUS_22860 gene radC 54697 54005 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360029.1 protein_id gnl|my_center|LOCUS_22860 55821 54706 gene locus_tag LOCUS_22870 55821 54706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22870 56758 55841 gene locus_tag LOCUS_22880 56758 55841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22880 58290 56749 gene locus_tag LOCUS_22890 gene guaA 58290 56749 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880099.1 protein_id gnl|my_center|LOCUS_22890 58766 58383 gene locus_tag LOCUS_22900 gene gcvH 58766 58383 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290491.1 protein_id gnl|my_center|LOCUS_22900 60127 58781 gene locus_tag LOCUS_22910 gene accC 60127 58781 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931851.1 protein_id gnl|my_center|LOCUS_22910 60627 60142 gene locus_tag LOCUS_22920 gene accB 60627 60142 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_22920 61216 60653 gene locus_tag LOCUS_22930 gene efp 61216 60653 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258741.1 protein_id gnl|my_center|LOCUS_22930 62039 61722 gene locus_tag LOCUS_22940 62039 61722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 63184 62039 gene locus_tag LOCUS_22950 63184 62039 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909134.1 protein_id gnl|my_center|LOCUS_22950 64669 63743 gene locus_tag LOCUS_22960 64669 63743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 67001 64671 gene locus_tag LOCUS_22970 67001 64671 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_22970 67108 67671 gene locus_tag LOCUS_22980 67108 67671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 67675 69783 gene locus_tag LOCUS_22990 67675 69783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22990 69971 70345 gene locus_tag LOCUS_23000 69971 70345 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065974.1 protein_id gnl|my_center|LOCUS_23000 71415 70342 gene locus_tag LOCUS_23010 71415 70342 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545786.1 protein_id gnl|my_center|LOCUS_23010 74645 71637 gene locus_tag LOCUS_23020 74645 71637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 74903 74667 gene locus_tag LOCUS_23030 74903 74667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 75053 75607 gene locus_tag LOCUS_23040 75053 75607 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763683.1 protein_id gnl|my_center|LOCUS_23040 75607 77034 gene locus_tag LOCUS_23050 gene rpoN 75607 77034 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403901.1 protein_id gnl|my_center|LOCUS_23050 77158 77790 gene locus_tag LOCUS_23060 77158 77790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 78008 79567 gene locus_tag LOCUS_23070 78008 79567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 80423 79656 gene locus_tag LOCUS_23080 80423 79656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 81896 80568 gene locus_tag LOCUS_23090 gene yegQ 81896 80568 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172489.1 protein_id gnl|my_center|LOCUS_23090 82700 82047 gene locus_tag LOCUS_23100 82700 82047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23100 84514 82706 gene locus_tag LOCUS_23110 84514 82706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 86235 84514 gene locus_tag LOCUS_23120 86235 84514 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_23120 86474 86244 gene locus_tag LOCUS_23130 86474 86244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 87162 86767 gene locus_tag LOCUS_23140 87162 86767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23140 87357 87172 gene locus_tag LOCUS_23150 87357 87172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23150 88892 88179 gene locus_tag LOCUS_23160 88892 88179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 90440 89055 gene locus_tag LOCUS_23170 90440 89055 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383078.1 protein_id gnl|my_center|LOCUS_23170 91851 90502 gene locus_tag LOCUS_23180 91851 90502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 92032 92106 gene locus_tag LOCUS_t00350 92032 92106 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 93159 92452 gene locus_tag LOCUS_23190 93159 92452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23190 94173 93478 gene locus_tag LOCUS_23200 94173 93478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 94607 95056 gene locus_tag LOCUS_23210 94607 95056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 95053 96246 gene locus_tag LOCUS_23220 95053 96246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23220 96243 97649 gene locus_tag LOCUS_23230 96243 97649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23230 97646 98980 gene locus_tag LOCUS_23240 97646 98980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 99034 99462 gene locus_tag LOCUS_23250 99034 99462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 99575 100999 gene locus_tag LOCUS_23260 99575 100999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23260 101070 101354 gene locus_tag LOCUS_23270 101070 101354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 101359 103752 gene locus_tag LOCUS_23280 101359 103752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 104395 106857 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttagtggatttgccttgacttaaaaggattacgac 106951 107235 gene locus_tag LOCUS_23290 106951 107235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23290 108468 109733 gene locus_tag LOCUS_23300 108468 109733 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764755.1 protein_id gnl|my_center|LOCUS_23300 109742 111166 gene locus_tag LOCUS_23310 109742 111166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 111370 113778 gene locus_tag LOCUS_23320 gene cas10 111370 113778 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052261170.1 protein_id gnl|my_center|LOCUS_23320 113791 114195 gene locus_tag LOCUS_23330 gene csm2 113791 114195 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546625.1 protein_id gnl|my_center|LOCUS_23330 114207 114953 gene locus_tag LOCUS_23340 gene csm3 114207 114953 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876704.1 protein_id gnl|my_center|LOCUS_23340 114973 116046 gene locus_tag LOCUS_23350 114973 116046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23350 116043 117737 gene locus_tag LOCUS_23360 116043 117737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23360 117802 118758 gene locus_tag LOCUS_23370 gene cas6 117802 118758 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_23370 119853 120224 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttagtggatttgccttgacttaaaaggattacgac 120454 122349 gene locus_tag LOCUS_23380 120454 122349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23380 >Feature sequence13 429 893 gene locus_tag LOCUS_23390 429 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23390 2438 903 gene locus_tag LOCUS_23400 2438 903 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926839.1 protein_id gnl|my_center|LOCUS_23400 2515 2979 gene locus_tag LOCUS_23410 2515 2979 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436879.1 protein_id gnl|my_center|LOCUS_23410 3216 6074 gene locus_tag LOCUS_23420 3216 6074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 6530 7021 gene locus_tag LOCUS_23430 6530 7021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23430 7035 8177 gene locus_tag LOCUS_23440 7035 8177 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861463.1 protein_id gnl|my_center|LOCUS_23440 8191 9576 gene locus_tag LOCUS_23450 gene rseP 8191 9576 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931818.1 protein_id gnl|my_center|LOCUS_23450 10994 9813 gene locus_tag LOCUS_23460 10994 9813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 12124 11012 gene locus_tag LOCUS_23470 12124 11012 CDS product carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259418.1 protein_id gnl|my_center|LOCUS_23470 13087 12131 gene locus_tag LOCUS_23480 13087 12131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255955.1 protein_id gnl|my_center|LOCUS_23480 15558 13459 gene locus_tag LOCUS_23490 15558 13459 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404722.1 protein_id gnl|my_center|LOCUS_23490 17589 15622 gene locus_tag LOCUS_23500 17589 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23500 17778 17596 gene locus_tag LOCUS_23510 17778 17596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 19632 17803 gene locus_tag LOCUS_23520 19632 17803 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303185.1 protein_id gnl|my_center|LOCUS_23520 20231 19635 gene locus_tag LOCUS_23530 20231 19635 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933693.1 protein_id gnl|my_center|LOCUS_23530 20475 21617 gene locus_tag LOCUS_23540 20475 21617 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000793731.1 protein_id gnl|my_center|LOCUS_23540 23830 21764 gene locus_tag LOCUS_23550 23830 21764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23550 27363 24286 gene locus_tag LOCUS_23560 gene uvrA 27363 24286 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403227.1 protein_id gnl|my_center|LOCUS_23560 27847 28767 gene locus_tag LOCUS_23570 27847 28767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 28949 29287 gene locus_tag LOCUS_23580 28949 29287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 29912 29358 gene locus_tag LOCUS_23590 29912 29358 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876433.1 protein_id gnl|my_center|LOCUS_23590 32043 29986 gene locus_tag LOCUS_23600 32043 29986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 32093 32998 gene locus_tag LOCUS_23610 32093 32998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 33103 34692 gene locus_tag LOCUS_23620 gene rlmD 33103 34692 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986823.1 protein_id gnl|my_center|LOCUS_23620 36217 34712 gene locus_tag LOCUS_23630 36217 34712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 37450 36422 gene locus_tag LOCUS_23640 37450 36422 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_23640 37812 38399 gene locus_tag LOCUS_23650 37812 38399 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966608.1 protein_id gnl|my_center|LOCUS_23650 39818 38463 gene locus_tag LOCUS_23660 39818 38463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 40345 39818 gene locus_tag LOCUS_23670 40345 39818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23670 41067 40354 gene locus_tag LOCUS_23680 41067 40354 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_23680 42641 41064 gene locus_tag LOCUS_23690 42641 41064 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940402.1 protein_id gnl|my_center|LOCUS_23690 44342 43062 gene locus_tag LOCUS_23700 44342 43062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 45231 44509 gene locus_tag LOCUS_23710 45231 44509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 45399 46334 gene locus_tag LOCUS_23720 45399 46334 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583758.1 protein_id gnl|my_center|LOCUS_23720 48303 46471 gene locus_tag LOCUS_23730 48303 46471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 48552 50135 gene locus_tag LOCUS_23740 48552 50135 CDS product calcineurin-like phosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118830048.1 protein_id gnl|my_center|LOCUS_23740 50152 50877 gene locus_tag LOCUS_23750 50152 50877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 52366 50858 gene locus_tag LOCUS_23760 52366 50858 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022342.1 protein_id gnl|my_center|LOCUS_23760 52843 53883 gene locus_tag LOCUS_23770 gene asd 52843 53883 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256126.1 protein_id gnl|my_center|LOCUS_23770 55550 54027 gene locus_tag LOCUS_23780 55550 54027 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680223.1 protein_id gnl|my_center|LOCUS_23780 55828 56280 gene locus_tag LOCUS_23790 55828 56280 CDS product DNA starvation/stationary phase protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403108.1 protein_id gnl|my_center|LOCUS_23790 56646 58664 gene locus_tag LOCUS_23800 56646 58664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 58839 59840 gene locus_tag LOCUS_23810 58839 59840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 63538 60152 gene locus_tag LOCUS_23820 63538 60152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 64058 63858 gene locus_tag LOCUS_23830 64058 63858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 64031 65887 gene locus_tag LOCUS_23840 64031 65887 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975332.1 protein_id gnl|my_center|LOCUS_23840 66140 66568 gene locus_tag LOCUS_23850 66140 66568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 68714 67221 gene locus_tag LOCUS_23860 68714 67221 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_23860 69065 69904 gene locus_tag LOCUS_23870 69065 69904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23870 70167 71000 gene locus_tag LOCUS_23880 70167 71000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 71173 71436 gene locus_tag LOCUS_23890 71173 71436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 71531 71755 gene locus_tag LOCUS_23900 71531 71755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 72670 72068 gene locus_tag LOCUS_23910 gene aat 72670 72068 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338055.1 protein_id gnl|my_center|LOCUS_23910 73637 72798 gene locus_tag LOCUS_23920 73637 72798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 74691 73822 gene locus_tag LOCUS_23930 74691 73822 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055217507.1 protein_id gnl|my_center|LOCUS_23930 74847 75593 gene locus_tag LOCUS_23940 gene rpiA 74847 75593 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259045.1 protein_id gnl|my_center|LOCUS_23940 75998 78229 gene locus_tag LOCUS_23950 75998 78229 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118837966.1 protein_id gnl|my_center|LOCUS_23950 78226 79179 gene locus_tag LOCUS_23960 78226 79179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23960 79189 81138 gene locus_tag LOCUS_23970 79189 81138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 82164 81322 gene locus_tag LOCUS_23980 82164 81322 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_23980 82049 82255 gene locus_tag LOCUS_23990 82049 82255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 82601 82690 gene locus_tag LOCUS_t00360 82601 82690 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 82988 84373 gene locus_tag LOCUS_24000 82988 84373 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_24000 84374 84943 gene locus_tag LOCUS_24010 84374 84943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 85397 86611 gene locus_tag LOCUS_24020 85397 86611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 86698 87363 gene locus_tag LOCUS_24030 86698 87363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 87822 88625 gene locus_tag LOCUS_24040 gene proC 87822 88625 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962247.1 protein_id gnl|my_center|LOCUS_24040 91052 88839 gene locus_tag LOCUS_24050 91052 88839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 92398 91130 gene locus_tag LOCUS_24060 92398 91130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 93788 92496 gene locus_tag LOCUS_24070 93788 92496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 94663 94217 gene locus_tag LOCUS_24080 94663 94217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24080 95423 94635 gene locus_tag LOCUS_24090 95423 94635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 97226 95946 gene locus_tag LOCUS_24100 97226 95946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 98387 97374 gene locus_tag LOCUS_24110 gene rfbB 98387 97374 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877391.1 protein_id gnl|my_center|LOCUS_24110 99271 98504 gene locus_tag LOCUS_24120 99271 98504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 100712 99279 gene locus_tag LOCUS_24130 100712 99279 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788556.1 protein_id gnl|my_center|LOCUS_24130 100868 101704 gene locus_tag LOCUS_24140 100868 101704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 101714 101968 gene locus_tag LOCUS_24150 101714 101968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 101965 102999 gene locus_tag LOCUS_24160 101965 102999 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582961.1 protein_id gnl|my_center|LOCUS_24160 103183 104544 gene locus_tag LOCUS_24170 gene fslC 103183 104544 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_24170 104725 107133 gene locus_tag LOCUS_24180 104725 107133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 107188 107862 gene locus_tag LOCUS_24190 107188 107862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 107859 108773 gene locus_tag LOCUS_24200 107859 108773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 108826 109686 gene locus_tag LOCUS_24210 108826 109686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 109782 110645 gene locus_tag LOCUS_24220 109782 110645 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_24220 112070 110649 gene locus_tag LOCUS_24230 gene dnaB 112070 110649 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_24230 112246 112482 gene locus_tag LOCUS_24240 112246 112482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 112452 113669 gene locus_tag LOCUS_24250 112452 113669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24250 >Feature sequence14 370 846 gene locus_tag LOCUS_24260 370 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 883 2169 gene locus_tag LOCUS_24270 gene hemA 883 2169 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_24270 2250 3176 gene locus_tag LOCUS_24280 gene hemC 2250 3176 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943896.1 protein_id gnl|my_center|LOCUS_24280 3486 4340 gene locus_tag LOCUS_24290 3486 4340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 4620 5525 gene locus_tag LOCUS_24300 gene hemE 4620 5525 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933694.1 protein_id gnl|my_center|LOCUS_24300 5760 7142 gene locus_tag LOCUS_24310 gene hemN 5760 7142 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881391.1 protein_id gnl|my_center|LOCUS_24310 7245 8249 gene locus_tag LOCUS_24320 gene hemH 7245 8249 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_24320 8484 9968 gene locus_tag LOCUS_24330 gene hemG 8484 9968 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_24330 10252 10746 gene locus_tag LOCUS_24340 10252 10746 CDS product winged helix DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403129.1 protein_id gnl|my_center|LOCUS_24340 11190 11933 gene locus_tag LOCUS_24350 11190 11933 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_24350 12099 13142 gene locus_tag LOCUS_24360 12099 13142 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_24360 13161 14675 gene locus_tag LOCUS_24370 13161 14675 CDS product sodium/proline symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868031.1 protein_id gnl|my_center|LOCUS_24370 14878 16380 gene locus_tag LOCUS_24380 14878 16380 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965213.1 protein_id gnl|my_center|LOCUS_24380 16490 17425 gene locus_tag LOCUS_24390 16490 17425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 17505 19040 gene locus_tag LOCUS_24400 17505 19040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 19052 19993 gene locus_tag LOCUS_24410 19052 19993 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764971.1 protein_id gnl|my_center|LOCUS_24410 20077 20943 gene locus_tag LOCUS_24420 20077 20943 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730992.1 protein_id gnl|my_center|LOCUS_24420 21533 24796 gene locus_tag LOCUS_24430 21533 24796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 25020 25907 gene locus_tag LOCUS_24440 gene sucD 25020 25907 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_24440 26049 26480 gene locus_tag LOCUS_24450 26049 26480 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_24450 26480 27037 gene locus_tag LOCUS_24460 26480 27037 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141087.1 protein_id gnl|my_center|LOCUS_24460 27037 28275 gene locus_tag LOCUS_24470 27037 28275 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234976.1 protein_id gnl|my_center|LOCUS_24470 28280 29347 gene locus_tag LOCUS_24480 28280 29347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24480 30942 29611 gene locus_tag LOCUS_24490 30942 29611 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583133.1 protein_id gnl|my_center|LOCUS_24490 31076 32440 gene locus_tag LOCUS_24500 31076 32440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964011.1 protein_id gnl|my_center|LOCUS_24500 32452 34158 gene locus_tag LOCUS_24510 32452 34158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 34172 34402 gene locus_tag LOCUS_24520 34172 34402 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802828.1 protein_id gnl|my_center|LOCUS_24520 34421 35929 gene locus_tag LOCUS_24530 34421 35929 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804150.1 protein_id gnl|my_center|LOCUS_24530 35945 37120 gene locus_tag LOCUS_24540 35945 37120 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202994.1 protein_id gnl|my_center|LOCUS_24540 37126 38256 gene locus_tag LOCUS_24550 37126 38256 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107704.1 protein_id gnl|my_center|LOCUS_24550 38272 39600 gene locus_tag LOCUS_24560 38272 39600 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_24560 39650 41104 gene locus_tag LOCUS_24570 39650 41104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 41166 42833 gene locus_tag LOCUS_24580 41166 42833 CDS product glycoside hydrolase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193485975.1 protein_id gnl|my_center|LOCUS_24580 42998 44302 gene locus_tag LOCUS_24590 42998 44302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 44310 47222 gene locus_tag LOCUS_24600 44310 47222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 47247 48641 gene locus_tag LOCUS_24610 47247 48641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 48657 49139 gene locus_tag LOCUS_24620 48657 49139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 49193 51022 gene locus_tag LOCUS_24630 49193 51022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24630 51041 52342 gene locus_tag LOCUS_24640 51041 52342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 52350 55739 gene locus_tag LOCUS_24650 52350 55739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 55749 56489 gene locus_tag LOCUS_24660 55749 56489 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943147.1 protein_id gnl|my_center|LOCUS_24660 58431 56593 gene locus_tag LOCUS_24670 58431 56593 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142698.1 protein_id gnl|my_center|LOCUS_24670 58533 59537 gene locus_tag LOCUS_24680 58533 59537 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123109.1 protein_id gnl|my_center|LOCUS_24680 60781 59855 gene locus_tag LOCUS_24690 gene mdh 60781 59855 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933173.1 protein_id gnl|my_center|LOCUS_24690 61056 60796 gene locus_tag LOCUS_24700 gene rpmA 61056 60796 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_24700 61376 61068 gene locus_tag LOCUS_24710 61376 61068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 61868 64336 gene locus_tag LOCUS_24720 61868 64336 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880620.1 protein_id gnl|my_center|LOCUS_24720 64520 69400 gene locus_tag LOCUS_24730 64520 69400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 >Feature sequence15 1282 1815 gene locus_tag LOCUS_24740 gene tadA 1282 1815 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552523.1 protein_id gnl|my_center|LOCUS_24740 1881 2555 gene locus_tag LOCUS_24750 1881 2555 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_24750 3360 2695 gene locus_tag LOCUS_24760 gene ftsE 3360 2695 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544942.1 protein_id gnl|my_center|LOCUS_24760 4082 3357 gene locus_tag LOCUS_24770 4082 3357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 5022 4072 gene locus_tag LOCUS_24780 gene pdxA 5022 4072 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545509.1 protein_id gnl|my_center|LOCUS_24780 6282 5035 gene locus_tag LOCUS_24790 gene rho 6282 5035 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139456756.1 protein_id gnl|my_center|LOCUS_24790 7528 6305 gene locus_tag LOCUS_24800 7528 6305 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_24800 8508 7849 gene locus_tag LOCUS_24810 8508 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 9682 8615 gene locus_tag LOCUS_24820 9682 8615 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403343.1 protein_id gnl|my_center|LOCUS_24820 10590 9682 gene locus_tag LOCUS_24830 10590 9682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 11707 10577 gene locus_tag LOCUS_24840 gene alr 11707 10577 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963814.1 protein_id gnl|my_center|LOCUS_24840 11883 12341 gene locus_tag LOCUS_24850 11883 12341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 12341 12829 gene locus_tag LOCUS_24860 12341 12829 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932449.1 protein_id gnl|my_center|LOCUS_24860 12834 13364 gene locus_tag LOCUS_24870 12834 13364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 13372 14505 gene locus_tag LOCUS_24880 13372 14505 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926925.1 protein_id gnl|my_center|LOCUS_24880 14502 15560 gene locus_tag LOCUS_24890 gene nuoH 14502 15560 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932452.1 protein_id gnl|my_center|LOCUS_24890 15563 16468 gene locus_tag LOCUS_24900 15563 16468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24900 16472 16969 gene locus_tag LOCUS_24910 16472 16969 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546128.1 protein_id gnl|my_center|LOCUS_24910 16972 17283 gene locus_tag LOCUS_24920 gene nuoK 16972 17283 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_24920 17287 19341 gene locus_tag LOCUS_24930 gene nuoL 17287 19341 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927227.1 protein_id gnl|my_center|LOCUS_24930 19362 20945 gene locus_tag LOCUS_24940 19362 20945 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932457.1 protein_id gnl|my_center|LOCUS_24940 20963 22462 gene locus_tag LOCUS_24950 20963 22462 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932458.1 protein_id gnl|my_center|LOCUS_24950 22688 22996 gene locus_tag LOCUS_24960 22688 22996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 23210 23815 gene locus_tag LOCUS_24970 gene sodA 23210 23815 CDS product superoxide dismutase [Mn] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887922.1 protein_id gnl|my_center|LOCUS_24970 23973 24488 gene locus_tag LOCUS_24980 23973 24488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 25037 24630 gene locus_tag LOCUS_24990 gene atpC 25037 24630 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847211.1 protein_id gnl|my_center|LOCUS_24990 26434 25037 gene locus_tag LOCUS_25000 gene atpD 26434 25037 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933887.1 protein_id gnl|my_center|LOCUS_25000 27577 26573 gene locus_tag LOCUS_25010 27577 26573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 28634 27645 gene locus_tag LOCUS_25020 28634 27645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 31461 28636 gene locus_tag LOCUS_25030 31461 28636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 33017 31458 gene locus_tag LOCUS_25040 33017 31458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 35151 33058 gene locus_tag LOCUS_25050 35151 33058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 37240 35165 gene locus_tag LOCUS_25060 37240 35165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 38249 37323 gene locus_tag LOCUS_25070 gene lipA 38249 37323 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061389.1 protein_id gnl|my_center|LOCUS_25070 40268 38268 gene locus_tag LOCUS_25080 40268 38268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 42367 40283 gene locus_tag LOCUS_25090 42367 40283 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840085.1 protein_id gnl|my_center|LOCUS_25090 43058 42390 gene locus_tag LOCUS_25100 gene lipB 43058 42390 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_25100 44460 43060 gene locus_tag LOCUS_25110 gene lpdA 44460 43060 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_25110 45178 44534 gene locus_tag LOCUS_25120 45178 44534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25120 46355 45339 gene locus_tag LOCUS_25130 gene recA 46355 45339 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_25130 47023 46352 gene locus_tag LOCUS_25140 47023 46352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25140 48323 47067 gene locus_tag LOCUS_25150 48323 47067 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404055.1 protein_id gnl|my_center|LOCUS_25150 48810 48337 gene locus_tag LOCUS_25160 48810 48337 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932028.1 protein_id gnl|my_center|LOCUS_25160 49396 48797 gene locus_tag LOCUS_25170 gene pgsA 49396 48797 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932027.1 protein_id gnl|my_center|LOCUS_25170 49666 49739 gene locus_tag LOCUS_t00370 49666 49739 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 49781 49869 gene locus_tag LOCUS_t00380 49781 49869 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 50441 50142 gene locus_tag LOCUS_25180 50441 50142 CDS product multidrug efflux SMR transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169602550.1 protein_id gnl|my_center|LOCUS_25180 50686 52014 gene locus_tag LOCUS_25190 50686 52014 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764161.1 protein_id gnl|my_center|LOCUS_25190 52032 53081 gene locus_tag LOCUS_25200 52032 53081 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262874.1 protein_id gnl|my_center|LOCUS_25200 53098 56223 gene locus_tag LOCUS_25210 53098 56223 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_25210 56928 56407 gene locus_tag LOCUS_25220 56928 56407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 57936 57088 gene locus_tag LOCUS_25230 57936 57088 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_25230 58508 58026 gene locus_tag LOCUS_25240 58508 58026 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057647.1 protein_id gnl|my_center|LOCUS_25240 58916 60313 gene locus_tag LOCUS_25250 gene asnS 58916 60313 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462263.1 protein_id gnl|my_center|LOCUS_25250 60402 61544 gene locus_tag LOCUS_25260 60402 61544 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694337.1 protein_id gnl|my_center|LOCUS_25260 61588 62088 gene locus_tag LOCUS_25270 gene tpx 61588 62088 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963706.1 protein_id gnl|my_center|LOCUS_25270 >Feature sequence16 142 870 gene locus_tag LOCUS_25280 142 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_25280 1987 1082 gene locus_tag LOCUS_25290 1987 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 2074 2871 gene locus_tag LOCUS_25300 2074 2871 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_25300 3711 3082 gene locus_tag LOCUS_25310 3711 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 4447 3887 gene locus_tag LOCUS_25320 4447 3887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 5910 4576 gene locus_tag LOCUS_25330 5910 4576 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_25330 7490 5910 gene locus_tag LOCUS_25340 7490 5910 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941262.1 protein_id gnl|my_center|LOCUS_25340 7688 8950 gene locus_tag LOCUS_25350 7688 8950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 9177 10178 gene locus_tag LOCUS_25360 9177 10178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 10195 11061 gene locus_tag LOCUS_25370 10195 11061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 12021 11326 gene locus_tag LOCUS_25380 12021 11326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_25380 13313 12075 gene locus_tag LOCUS_25390 13313 12075 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402810.1 protein_id gnl|my_center|LOCUS_25390 14542 13313 gene locus_tag LOCUS_25400 14542 13313 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404265.1 protein_id gnl|my_center|LOCUS_25400 15884 14544 gene locus_tag LOCUS_25410 15884 14544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 16278 16353 gene locus_tag LOCUS_t00390 16278 16353 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 16369 16443 gene locus_tag LOCUS_t00400 16369 16443 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 16571 16643 gene locus_tag LOCUS_t00410 16571 16643 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 17617 16901 gene locus_tag LOCUS_25420 17617 16901 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962991.1 protein_id gnl|my_center|LOCUS_25420 18070 17867 gene locus_tag LOCUS_25430 18070 17867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 18152 20113 gene locus_tag LOCUS_25440 18152 20113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 20376 22214 gene locus_tag LOCUS_25450 20376 22214 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108988152.1 protein_id gnl|my_center|LOCUS_25450 22211 23245 gene locus_tag LOCUS_25460 22211 23245 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838141.1 protein_id gnl|my_center|LOCUS_25460 23716 24723 gene locus_tag LOCUS_25470 23716 24723 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403765.1 protein_id gnl|my_center|LOCUS_25470 24716 26188 gene locus_tag LOCUS_25480 24716 26188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 26185 27021 gene locus_tag LOCUS_25490 26185 27021 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189681.1 protein_id gnl|my_center|LOCUS_25490 27108 29576 gene locus_tag LOCUS_25500 27108 29576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25500 29769 31622 gene locus_tag LOCUS_25510 29769 31622 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392090.1 protein_id gnl|my_center|LOCUS_25510 31669 33618 gene locus_tag LOCUS_25520 31669 33618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25520 34018 34191 gene locus_tag LOCUS_25530 34018 34191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 34179 34409 gene locus_tag LOCUS_25540 34179 34409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 34755 37673 gene locus_tag LOCUS_25550 34755 37673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 37708 39093 gene locus_tag LOCUS_25560 37708 39093 CDS product amino acid carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932503.1 protein_id gnl|my_center|LOCUS_25560 39203 40354 gene locus_tag LOCUS_25570 39203 40354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25570 41237 40611 gene locus_tag LOCUS_25580 41237 40611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25580 43690 41543 gene locus_tag LOCUS_25590 43690 41543 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963765.1 protein_id gnl|my_center|LOCUS_25590 44820 43981 gene locus_tag LOCUS_25600 44820 43981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 46144 44828 gene locus_tag LOCUS_25610 gene mtaB 46144 44828 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963271.1 protein_id gnl|my_center|LOCUS_25610 48024 46201 gene locus_tag LOCUS_25620 gene rpsA 48024 46201 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931980.1 protein_id gnl|my_center|LOCUS_25620 >Feature sequence17 630 1517 gene locus_tag LOCUS_25630 630 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25630 1519 3156 gene locus_tag LOCUS_25640 1519 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 5632 3509 gene locus_tag LOCUS_25650 5632 3509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 5960 6253 gene locus_tag LOCUS_25660 gene groES 5960 6253 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932216.1 protein_id gnl|my_center|LOCUS_25660 6280 7911 gene locus_tag LOCUS_25670 gene groL 6280 7911 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932217.1 protein_id gnl|my_center|LOCUS_25670 8058 12191 gene locus_tag LOCUS_25680 8058 12191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25680 12954 12244 gene locus_tag LOCUS_25690 12954 12244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 14212 13286 gene locus_tag LOCUS_25700 14212 13286 CDS product DUF5668 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461600.1 protein_id gnl|my_center|LOCUS_25700 14675 14220 gene locus_tag LOCUS_25710 14675 14220 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461534.1 protein_id gnl|my_center|LOCUS_25710 16180 14915 gene locus_tag LOCUS_25720 16180 14915 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528421.1 protein_id gnl|my_center|LOCUS_25720 16594 16681 gene locus_tag LOCUS_t00420 16594 16681 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 17763 17449 gene locus_tag LOCUS_25730 17763 17449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 <18964 17784 gene locus_tag LOCUS_25740 <18964 17784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966227.1:FG-GAP-like repeat-containing protein 17848 17857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence18 2129 1824 gene locus_tag LOCUS_25750 2129 1824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25750 2427 2134 gene locus_tag LOCUS_25760 2427 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 3410 2505 gene locus_tag LOCUS_25770 3410 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 5593 4847 gene locus_tag LOCUS_25780 5593 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 6155 6928 gene locus_tag LOCUS_25790 6155 6928 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596591.1 protein_id gnl|my_center|LOCUS_25790 6928 8313 gene locus_tag LOCUS_25800 6928 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 8348 8833 gene locus_tag LOCUS_25810 8348 8833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 8830 9036 gene locus_tag LOCUS_25820 8830 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 9050 9679 gene locus_tag LOCUS_25830 9050 9679 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167392103.1 protein_id gnl|my_center|LOCUS_25830 10191 9874 gene locus_tag LOCUS_25840 10191 9874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 10462 10175 gene locus_tag LOCUS_25850 10462 10175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 12028 10586 gene locus_tag LOCUS_25860 12028 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 12598 12038 gene locus_tag LOCUS_25870 12598 12038 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002437759.1 protein_id gnl|my_center|LOCUS_25870 12673 13002 gene locus_tag LOCUS_25880 12673 13002 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012708963.1 protein_id gnl|my_center|LOCUS_25880 13323 13087 gene locus_tag LOCUS_25890 13323 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 >Feature sequence19 195 1442 gene locus_tag LOCUS_25900 195 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 1584 2027 gene locus_tag LOCUS_25910 1584 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 2252 3289 gene locus_tag LOCUS_25920 2252 3289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 >Feature sequence20 201 114 gene locus_tag LOCUS_t00430 201 114 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1160 2692 gene locus_tag LOCUS_25930 1160 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 >Feature sequence21 624 1646 gene locus_tag LOCUS_25940 624 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940