>Feature sequence001 1402 308 gene locus_tag LOCUS_00010 gene nadA 1402 308 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_00010 3527 1749 gene locus_tag LOCUS_00020 gene aspS 3527 1749 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554661.1 protein_id gnl|my_center|LOCUS_00020 4031 3612 gene locus_tag LOCUS_00030 4031 3612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4084 4911 gene locus_tag LOCUS_00040 4084 4911 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_00040 4999 6975 gene locus_tag LOCUS_00050 4999 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 7071 9044 gene locus_tag LOCUS_00060 7071 9044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 9237 9977 gene locus_tag LOCUS_00070 9237 9977 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550362.1 protein_id gnl|my_center|LOCUS_00070 12697 10076 gene locus_tag LOCUS_00080 gene clpB 12697 10076 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_00080 13245 12844 gene locus_tag LOCUS_00090 13245 12844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 14184 13450 gene locus_tag LOCUS_00100 14184 13450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 14613 14200 gene locus_tag LOCUS_00110 14613 14200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 15575 14817 gene locus_tag LOCUS_00120 gene yfiH 15575 14817 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815687.1 protein_id gnl|my_center|LOCUS_00120 16527 15562 gene locus_tag LOCUS_00130 gene rluD 16527 15562 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_00130 16670 17476 gene locus_tag LOCUS_00140 16670 17476 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687645.1 protein_id gnl|my_center|LOCUS_00140 19223 17598 gene locus_tag LOCUS_00150 19223 17598 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_00150 19324 19554 gene locus_tag LOCUS_00160 19324 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 19564 21201 gene locus_tag LOCUS_00170 gene pilS 19564 21201 CDS product two-component system sensor histidine kinase PilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094692.1 protein_id gnl|my_center|LOCUS_00170 21247 22572 gene locus_tag LOCUS_00180 21247 22572 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266589.1 protein_id gnl|my_center|LOCUS_00180 23431 22577 gene locus_tag LOCUS_00190 23431 22577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 23769 24230 gene locus_tag LOCUS_00200 23769 24230 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020882.1 protein_id gnl|my_center|LOCUS_00200 24424 24816 gene locus_tag LOCUS_00210 24424 24816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 25196 26911 gene locus_tag LOCUS_00220 gene pilB 25196 26911 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070776.1 protein_id gnl|my_center|LOCUS_00220 26931 28148 gene locus_tag LOCUS_00230 26931 28148 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266635.1 protein_id gnl|my_center|LOCUS_00230 28248 29036 gene locus_tag LOCUS_00240 28248 29036 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_00240 29036 29620 gene locus_tag LOCUS_00250 gene coaE 29036 29620 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209319.1 protein_id gnl|my_center|LOCUS_00250 29701 30471 gene locus_tag LOCUS_00260 gene zapD 29701 30471 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957406.1 protein_id gnl|my_center|LOCUS_00260 31921 30515 gene locus_tag LOCUS_00270 31921 30515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32599 32288 gene locus_tag LOCUS_00280 32599 32288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 33679 32735 gene locus_tag LOCUS_00290 33679 32735 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_00290 34896 33691 gene locus_tag LOCUS_00300 gene argJ 34896 33691 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110156.1 protein_id gnl|my_center|LOCUS_00300 37620 34900 gene locus_tag LOCUS_00310 gene secA 37620 34900 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 protein_id gnl|my_center|LOCUS_00310 38782 37826 gene locus_tag LOCUS_00320 38782 37826 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073893.1 protein_id gnl|my_center|LOCUS_00320 38824 39243 gene locus_tag LOCUS_00330 38824 39243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 40232 39318 gene locus_tag LOCUS_00340 gene lpxC 40232 39318 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_00340 41632 40496 gene locus_tag LOCUS_00350 gene ftsZ 41632 40496 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 protein_id gnl|my_center|LOCUS_00350 42997 41762 gene locus_tag LOCUS_00360 gene ftsA 42997 41762 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_00360 43858 43001 gene locus_tag LOCUS_00370 43858 43001 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094118.1 protein_id gnl|my_center|LOCUS_00370 44774 43845 gene locus_tag LOCUS_00380 44774 43845 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_00380 45703 44771 gene locus_tag LOCUS_00390 gene murB 45703 44771 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_00390 47156 45705 gene locus_tag LOCUS_00400 gene murC 47156 45705 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_00400 48211 47129 gene locus_tag LOCUS_00410 gene murG 48211 47129 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194182.1 protein_id gnl|my_center|LOCUS_00410 49461 48208 gene locus_tag LOCUS_00420 gene ftsW 49461 48208 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216490.1 protein_id gnl|my_center|LOCUS_00420 50813 49458 gene locus_tag LOCUS_00430 gene murD 50813 49458 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268846.1 protein_id gnl|my_center|LOCUS_00430 51899 50817 gene locus_tag LOCUS_00440 gene mraY 51899 50817 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_00440 53254 51899 gene locus_tag LOCUS_00450 53254 51899 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957393.1 protein_id gnl|my_center|LOCUS_00450 54798 53251 gene locus_tag LOCUS_00460 54798 53251 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769454.1 protein_id gnl|my_center|LOCUS_00460 56537 54795 gene locus_tag LOCUS_00470 gene ftsI 56537 54795 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_00470 56812 56534 gene locus_tag LOCUS_00480 gene ftsL 56812 56534 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035956.1 protein_id gnl|my_center|LOCUS_00480 57744 56809 gene locus_tag LOCUS_00490 gene rsmH 57744 56809 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368254.1 protein_id gnl|my_center|LOCUS_00490 58222 57767 gene locus_tag LOCUS_00500 gene mraZ 58222 57767 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_00500 58535 60751 gene locus_tag LOCUS_00510 58535 60751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 61711 61229 gene locus_tag LOCUS_00520 61711 61229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 61775 62701 gene locus_tag LOCUS_00530 gene prmA 61775 62701 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_00530 62742 63563 gene locus_tag LOCUS_00540 62742 63563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 63968 63585 gene locus_tag LOCUS_00550 gene hslR 63968 63585 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005159667.1 protein_id gnl|my_center|LOCUS_00550 64979 63996 gene locus_tag LOCUS_00560 64979 63996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 66704 65055 gene locus_tag LOCUS_00570 gene pgi 66704 65055 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212085.1 protein_id gnl|my_center|LOCUS_00570 66843 69707 gene locus_tag LOCUS_00580 gene ppc 66843 69707 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_00580 70015 70773 gene locus_tag LOCUS_00590 70015 70773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 70815 72590 gene locus_tag LOCUS_00600 70815 72590 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_00600 74748 72613 gene locus_tag LOCUS_00610 gene slt 74748 72613 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_00610 75746 75168 gene locus_tag LOCUS_00620 75746 75168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 76254 75754 gene locus_tag LOCUS_00630 76254 75754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 77721 76531 gene locus_tag LOCUS_00640 77721 76531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 87317 77718 gene locus_tag LOCUS_00650 87317 77718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 89183 87417 gene locus_tag LOCUS_00660 gene tpsB1 89183 87417 CDS product two-partner secretion system transporter TpsB1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115686.1 protein_id gnl|my_center|LOCUS_00660 89353 89931 gene locus_tag LOCUS_00670 89353 89931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 89944 90909 gene locus_tag LOCUS_00680 gene cbf2 89944 90909 CDS product peptidylprolyl isomerase CBF2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000739470.1 protein_id gnl|my_center|LOCUS_00680 90983 91366 gene locus_tag LOCUS_00690 90983 91366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 93849 91831 gene locus_tag LOCUS_00700 gene rep 93849 91831 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773964.1 protein_id gnl|my_center|LOCUS_00700 94321 94926 gene locus_tag LOCUS_00710 gene ampD 94321 94926 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000936326.1 protein_id gnl|my_center|LOCUS_00710 94994 95833 gene locus_tag LOCUS_00720 94994 95833 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035739.1 protein_id gnl|my_center|LOCUS_00720 95830 96411 gene locus_tag LOCUS_00730 95830 96411 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_00730 96496 97131 gene locus_tag LOCUS_00740 96496 97131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 98032 97265 gene locus_tag LOCUS_00750 98032 97265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 98105 99073 gene locus_tag LOCUS_00760 98105 99073 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269130.1 protein_id gnl|my_center|LOCUS_00760 99070 99744 gene locus_tag LOCUS_00770 99070 99744 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927035.1 protein_id gnl|my_center|LOCUS_00770 100159 99755 gene locus_tag LOCUS_00780 100159 99755 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_00780 100300 100860 gene locus_tag LOCUS_00790 100300 100860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00790 100877 101275 gene locus_tag LOCUS_00800 100877 101275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00800 101291 102721 gene locus_tag LOCUS_00810 101291 102721 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392701.1 protein_id gnl|my_center|LOCUS_00810 103244 102726 gene locus_tag LOCUS_00820 103244 102726 CDS product zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483489.1 protein_id gnl|my_center|LOCUS_00820 103512 104336 gene locus_tag LOCUS_00830 103512 104336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 105677 104376 gene locus_tag LOCUS_00840 105677 104376 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_00840 108085 105674 gene locus_tag LOCUS_00850 gene ppsA 108085 105674 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023333.1 protein_id gnl|my_center|LOCUS_00850 109807 108641 gene locus_tag LOCUS_00860 gene nhaA 109807 108641 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704351.1 protein_id gnl|my_center|LOCUS_00860 109961 110854 gene locus_tag LOCUS_00870 109961 110854 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705198.1 protein_id gnl|my_center|LOCUS_00870 110920 111174 gene locus_tag LOCUS_00880 110920 111174 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388730.1 protein_id gnl|my_center|LOCUS_00880 111185 111451 gene locus_tag LOCUS_00890 111185 111451 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_00890 116628 111478 gene locus_tag LOCUS_00900 116628 111478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 125119 116621 gene locus_tag LOCUS_00910 125119 116621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 125766 125945 gene locus_tag LOCUS_00920 125766 125945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 126746 126964 gene locus_tag LOCUS_00930 126746 126964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 127226 128371 gene locus_tag LOCUS_00940 127226 128371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 128927 129283 gene locus_tag LOCUS_00950 128927 129283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 132588 131227 gene locus_tag LOCUS_00960 132588 131227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 133098 132598 gene locus_tag LOCUS_00970 133098 132598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 133589 133095 gene locus_tag LOCUS_00980 133589 133095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 134247 133582 gene locus_tag LOCUS_00990 134247 133582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 >Feature sequence002 736 4422 gene locus_tag LOCUS_01000 gene metH 736 4422 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095026.1 protein_id gnl|my_center|LOCUS_01000 4747 4430 gene locus_tag LOCUS_01010 4747 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 5048 4755 gene locus_tag LOCUS_01020 5048 4755 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085796.1 protein_id gnl|my_center|LOCUS_01020 5754 7652 gene locus_tag LOCUS_01030 5754 7652 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941581.1 protein_id gnl|my_center|LOCUS_01030 8841 7951 gene locus_tag LOCUS_01040 8841 7951 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091534.1 protein_id gnl|my_center|LOCUS_01040 8952 9332 gene locus_tag LOCUS_01050 8952 9332 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261698.1 protein_id gnl|my_center|LOCUS_01050 9407 10150 gene locus_tag LOCUS_01060 9407 10150 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114805.1 protein_id gnl|my_center|LOCUS_01060 10258 11088 gene locus_tag LOCUS_01070 10258 11088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 11743 11099 gene locus_tag LOCUS_01080 11743 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 11639 12028 gene locus_tag LOCUS_01090 11639 12028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 12433 12044 gene locus_tag LOCUS_01100 12433 12044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 13741 12524 gene locus_tag LOCUS_01110 gene fabB 13741 12524 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925736.1 protein_id gnl|my_center|LOCUS_01110 14292 13756 gene locus_tag LOCUS_01120 gene fabA 14292 13756 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316569.1 protein_id gnl|my_center|LOCUS_01120 14470 14778 gene locus_tag LOCUS_01130 14470 14778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 15285 14818 gene locus_tag LOCUS_01140 15285 14818 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233674.1 protein_id gnl|my_center|LOCUS_01140 16533 15421 gene locus_tag LOCUS_01150 gene rnd 16533 15421 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171280573.1 protein_id gnl|my_center|LOCUS_01150 16919 16533 gene locus_tag LOCUS_01160 gene gloA 16919 16533 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_01160 17439 16987 gene locus_tag LOCUS_01170 17439 16987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 17878 17441 gene locus_tag LOCUS_01180 17878 17441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 18581 17982 gene locus_tag LOCUS_01190 18581 17982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 18702 19325 gene locus_tag LOCUS_01200 18702 19325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 19843 19319 gene locus_tag LOCUS_01210 19843 19319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 20993 20112 gene locus_tag LOCUS_01220 20993 20112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 21913 20999 gene locus_tag LOCUS_01230 21913 20999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 22521 21988 gene locus_tag LOCUS_01240 22521 21988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 23003 22527 gene locus_tag LOCUS_01250 23003 22527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 23221 23093 gene locus_tag LOCUS_01260 23221 23093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 23220 24197 gene locus_tag LOCUS_01270 23220 24197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 24385 24191 gene locus_tag LOCUS_01280 24385 24191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 25746 24421 gene locus_tag LOCUS_01290 gene rimO 25746 24421 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704839.1 protein_id gnl|my_center|LOCUS_01290 25745 25930 gene locus_tag LOCUS_01300 25745 25930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 25939 26733 gene locus_tag LOCUS_01310 gene tcdA 25939 26733 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173260.1 protein_id gnl|my_center|LOCUS_01310 26730 28469 gene locus_tag LOCUS_01320 26730 28469 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_01320 29032 28478 gene locus_tag LOCUS_01330 29032 28478 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243674.1 protein_id gnl|my_center|LOCUS_01330 28949 29125 gene locus_tag LOCUS_01340 28949 29125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 29218 32421 gene locus_tag LOCUS_01350 29218 32421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 32811 32422 gene locus_tag LOCUS_01360 32811 32422 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 protein_id gnl|my_center|LOCUS_01360 33239 32811 gene locus_tag LOCUS_01370 33239 32811 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532284.1 protein_id gnl|my_center|LOCUS_01370 34285 33293 gene locus_tag LOCUS_01380 34285 33293 CDS product TIGR00341 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228684.1 protein_id gnl|my_center|LOCUS_01380 34985 34578 gene locus_tag LOCUS_01390 34985 34578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 36418 35141 gene locus_tag LOCUS_01400 36418 35141 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958298.1 protein_id gnl|my_center|LOCUS_01400 36777 36421 gene locus_tag LOCUS_01410 36777 36421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 39861 36970 gene locus_tag LOCUS_01420 39861 36970 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947500.1 protein_id gnl|my_center|LOCUS_01420 41323 40439 gene locus_tag LOCUS_01430 41323 40439 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_01430 42247 41603 gene locus_tag LOCUS_01440 42247 41603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 42443 42706 gene locus_tag LOCUS_01450 42443 42706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 42740 44221 gene locus_tag LOCUS_01460 42740 44221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 44223 44945 gene locus_tag LOCUS_01470 44223 44945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 44984 45586 gene locus_tag LOCUS_01480 44984 45586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 45735 47933 gene locus_tag LOCUS_01490 45735 47933 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_01490 47933 49570 gene locus_tag LOCUS_01500 gene pstA 47933 49570 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_01500 49634 50425 gene locus_tag LOCUS_01510 gene pstB 49634 50425 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_01510 50443 51159 gene locus_tag LOCUS_01520 gene phoU 50443 51159 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 protein_id gnl|my_center|LOCUS_01520 51156 51833 gene locus_tag LOCUS_01530 gene phoB 51156 51833 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071727.1 protein_id gnl|my_center|LOCUS_01530 51833 53101 gene locus_tag LOCUS_01540 gene phoR 51833 53101 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_01540 53261 54181 gene locus_tag LOCUS_01550 53261 54181 CDS product phosphate ABC transporter substrate-binding protein PstS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705170.1 protein_id gnl|my_center|LOCUS_01550 54945 54379 gene locus_tag LOCUS_01560 54945 54379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01560 55385 54912 gene locus_tag LOCUS_01570 55385 54912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01570 55846 56073 gene locus_tag LOCUS_01580 55846 56073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 56039 56833 gene locus_tag LOCUS_01590 56039 56833 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064634869.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01590 57318 56992 gene locus_tag LOCUS_01600 57318 56992 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060873.1 protein_id gnl|my_center|LOCUS_01600 59797 57347 gene locus_tag LOCUS_01610 59797 57347 CDS product copper-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244418.1 protein_id gnl|my_center|LOCUS_01610 60633 60037 gene locus_tag LOCUS_01620 60633 60037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 61907 60645 gene locus_tag LOCUS_01630 61907 60645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 62435 62025 gene locus_tag LOCUS_01640 62435 62025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 65868 62719 gene locus_tag LOCUS_01650 65868 62719 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_01650 67211 65868 gene locus_tag LOCUS_01660 67211 65868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 68488 67214 gene locus_tag LOCUS_01670 68488 67214 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482614.1 protein_id gnl|my_center|LOCUS_01670 69725 69057 gene locus_tag LOCUS_01680 69725 69057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 69828 70010 gene locus_tag LOCUS_01690 69828 70010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 71071 70067 gene locus_tag LOCUS_01700 71071 70067 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881170.1 protein_id gnl|my_center|LOCUS_01700 71891 71199 gene locus_tag LOCUS_01710 71891 71199 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330705.1 protein_id gnl|my_center|LOCUS_01710 73325 72063 gene locus_tag LOCUS_01720 73325 72063 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_01720 75110 73443 gene locus_tag LOCUS_01730 75110 73443 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113945.1 protein_id gnl|my_center|LOCUS_01730 77065 75188 gene locus_tag LOCUS_01740 77065 75188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 78066 77062 gene locus_tag LOCUS_01750 78066 77062 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_01750 78587 78063 gene locus_tag LOCUS_01760 78587 78063 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038328.1 protein_id gnl|my_center|LOCUS_01760 79537 78584 gene locus_tag LOCUS_01770 79537 78584 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_01770 80772 79804 gene locus_tag LOCUS_01780 80772 79804 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_01780 82800 80977 gene locus_tag LOCUS_01790 gene btuB 82800 80977 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112350.1 protein_id gnl|my_center|LOCUS_01790 82870 83067 gene locus_tag LOCUS_01800 82870 83067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 83084 83623 gene locus_tag LOCUS_01810 83084 83623 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036032.1 protein_id gnl|my_center|LOCUS_01810 83638 84534 gene locus_tag LOCUS_01820 83638 84534 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_01820 85407 84688 gene locus_tag LOCUS_01830 85407 84688 CDS product TIGR04219 family outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208017.1 protein_id gnl|my_center|LOCUS_01830 86972 85536 gene locus_tag LOCUS_01840 86972 85536 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940551.1 protein_id gnl|my_center|LOCUS_01840 88751 87099 gene locus_tag LOCUS_01850 88751 87099 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_01850 88951 89475 gene locus_tag LOCUS_01860 88951 89475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_01860 90267 89494 gene locus_tag LOCUS_01870 90267 89494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304632.1 protein_id gnl|my_center|LOCUS_01870 91193 90264 gene locus_tag LOCUS_01880 91193 90264 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_01880 91384 91956 gene locus_tag LOCUS_01890 91384 91956 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_01890 91970 92422 gene locus_tag LOCUS_01900 91970 92422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 92620 92426 gene locus_tag LOCUS_01910 92620 92426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 93158 92613 gene locus_tag LOCUS_01920 93158 92613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 93715 93155 gene locus_tag LOCUS_01930 93715 93155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 94427 93720 gene locus_tag LOCUS_01940 94427 93720 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943580.1 protein_id gnl|my_center|LOCUS_01940 95997 94408 gene locus_tag LOCUS_01950 95997 94408 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091675.1 protein_id gnl|my_center|LOCUS_01950 96501 96154 gene locus_tag LOCUS_01960 96501 96154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 96909 96532 gene locus_tag LOCUS_01970 96909 96532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 97387 96914 gene locus_tag LOCUS_01980 97387 96914 CDS product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 protein_id gnl|my_center|LOCUS_01980 98166 97384 gene locus_tag LOCUS_01990 98166 97384 CDS product DUF2063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072093.1 protein_id gnl|my_center|LOCUS_01990 99041 98178 gene locus_tag LOCUS_02000 99041 98178 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072092.1 protein_id gnl|my_center|LOCUS_02000 99506 99048 gene locus_tag LOCUS_02010 99506 99048 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005686601.1 protein_id gnl|my_center|LOCUS_02010 101262 99715 gene locus_tag LOCUS_02020 101262 99715 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_02020 101937 101467 gene locus_tag LOCUS_02030 101937 101467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 102520 102083 gene locus_tag LOCUS_02040 102520 102083 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020393.1 protein_id gnl|my_center|LOCUS_02040 103401 102766 gene locus_tag LOCUS_02050 gene nth 103401 102766 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001030339.1 protein_id gnl|my_center|LOCUS_02050 <104263 103575 gene locus_tag LOCUS_02060 <104263 103575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261584.1:electron transport complex subunit E >Feature sequence003 3015 277 gene locus_tag LOCUS_02070 3015 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 3985 3023 gene locus_tag LOCUS_02080 3985 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 4950 4159 gene locus_tag LOCUS_02090 4950 4159 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_02090 7226 4950 gene locus_tag LOCUS_02100 7226 4950 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_02100 8034 7372 gene locus_tag LOCUS_02110 8034 7372 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220465.1 protein_id gnl|my_center|LOCUS_02110 8043 9125 gene locus_tag LOCUS_02120 gene truD 8043 9125 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266986.1 protein_id gnl|my_center|LOCUS_02120 9183 10142 gene locus_tag LOCUS_02130 gene accA 9183 10142 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_02130 10120 11484 gene locus_tag LOCUS_02140 gene tilS 10120 11484 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113867.1 protein_id gnl|my_center|LOCUS_02140 12516 11851 gene locus_tag LOCUS_02150 12516 11851 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946684.1 protein_id gnl|my_center|LOCUS_02150 14111 12717 gene locus_tag LOCUS_02160 14111 12717 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769514.1 protein_id gnl|my_center|LOCUS_02160 14400 14313 gene locus_tag LOCUS_t00010 14400 14313 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 15485 15883 gene locus_tag LOCUS_02170 15485 15883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 15967 16917 gene locus_tag LOCUS_02180 gene arsS 15967 16917 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121078.1 protein_id gnl|my_center|LOCUS_02180 16951 17613 gene locus_tag LOCUS_02190 16951 17613 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118717.1 protein_id gnl|my_center|LOCUS_02190 17610 18230 gene locus_tag LOCUS_02200 17610 18230 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029005.1 protein_id gnl|my_center|LOCUS_02200 18242 19141 gene locus_tag LOCUS_02210 18242 19141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 19817 19158 gene locus_tag LOCUS_02220 19817 19158 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 protein_id gnl|my_center|LOCUS_02220 20527 19814 gene locus_tag LOCUS_02230 20527 19814 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_02230 21885 20572 gene locus_tag LOCUS_02240 21885 20572 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_02240 22027 22650 gene locus_tag LOCUS_02250 22027 22650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 22687 23988 gene locus_tag LOCUS_02260 22687 23988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817955.1 protein_id gnl|my_center|LOCUS_02260 24008 25042 gene locus_tag LOCUS_02270 24008 25042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 25398 25718 gene locus_tag LOCUS_02280 gene clpS 25398 25718 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 protein_id gnl|my_center|LOCUS_02280 25755 28001 gene locus_tag LOCUS_02290 gene clpA 25755 28001 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090432.1 protein_id gnl|my_center|LOCUS_02290 28546 28328 gene locus_tag LOCUS_02300 gene infA 28546 28328 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420180.1 protein_id gnl|my_center|LOCUS_02300 29573 28668 gene locus_tag LOCUS_02310 29573 28668 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213325.1 protein_id gnl|my_center|LOCUS_02310 29630 30808 gene locus_tag LOCUS_02320 29630 30808 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038595.1 protein_id gnl|my_center|LOCUS_02320 30813 31631 gene locus_tag LOCUS_02330 30813 31631 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483526.1 protein_id gnl|my_center|LOCUS_02330 31888 32604 gene locus_tag LOCUS_02340 gene cysE 31888 32604 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100615.1 protein_id gnl|my_center|LOCUS_02340 33643 32855 gene locus_tag LOCUS_02350 33643 32855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 33703 34881 gene locus_tag LOCUS_02360 33703 34881 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245819.1 protein_id gnl|my_center|LOCUS_02360 35104 36798 gene locus_tag LOCUS_02370 35104 36798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 36801 37196 gene locus_tag LOCUS_02380 36801 37196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 37209 39410 gene locus_tag LOCUS_02390 37209 39410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 39655 39407 gene locus_tag LOCUS_02400 39655 39407 CDS product TIGR02647 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344490.1 protein_id gnl|my_center|LOCUS_02400 39732 40274 gene locus_tag LOCUS_02410 39732 40274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 40290 41657 gene locus_tag LOCUS_02420 40290 41657 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113084.1 protein_id gnl|my_center|LOCUS_02420 41889 41668 gene locus_tag LOCUS_02430 41889 41668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140188.1 protein_id gnl|my_center|LOCUS_02430 41992 42597 gene locus_tag LOCUS_02440 41992 42597 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_02440 42899 42777 gene locus_tag LOCUS_02450 42899 42777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02450 43286 44893 gene locus_tag LOCUS_02460 43286 44893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 44945 46339 gene locus_tag LOCUS_02470 44945 46339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 46376 55930 gene locus_tag LOCUS_02480 46376 55930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 56068 56361 gene locus_tag LOCUS_02490 56068 56361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 56358 56672 gene locus_tag LOCUS_02500 56358 56672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 57136 57822 gene locus_tag LOCUS_02510 57136 57822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 58098 58754 gene locus_tag LOCUS_02520 58098 58754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 58917 59948 gene locus_tag LOCUS_02530 gene queA 58917 59948 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001198115.1 protein_id gnl|my_center|LOCUS_02530 60029 61132 gene locus_tag LOCUS_02540 gene tgt 60029 61132 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000768200.1 protein_id gnl|my_center|LOCUS_02540 61221 61568 gene locus_tag LOCUS_02550 gene yajC 61221 61568 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947718.1 protein_id gnl|my_center|LOCUS_02550 61627 63456 gene locus_tag LOCUS_02560 gene secD 61627 63456 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_02560 63488 64423 gene locus_tag LOCUS_02570 gene secF 63488 64423 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_02570 65114 64494 gene locus_tag LOCUS_02580 65114 64494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 66020 65115 gene locus_tag LOCUS_02590 gene cyoE 66020 65115 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 protein_id gnl|my_center|LOCUS_02590 67012 66023 gene locus_tag LOCUS_02600 67012 66023 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115033.1 protein_id gnl|my_center|LOCUS_02600 67625 67005 gene locus_tag LOCUS_02610 67625 67005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815732.1 protein_id gnl|my_center|LOCUS_02610 68426 67629 gene locus_tag LOCUS_02620 68426 67629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_02620 68400 68657 gene locus_tag LOCUS_02630 68400 68657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 69554 68679 gene locus_tag LOCUS_02640 69554 68679 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948580.1 protein_id gnl|my_center|LOCUS_02640 70172 69600 gene locus_tag LOCUS_02650 70172 69600 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482726.1 protein_id gnl|my_center|LOCUS_02650 71801 70203 gene locus_tag LOCUS_02660 gene ctaD 71801 70203 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074203.1 protein_id gnl|my_center|LOCUS_02660 73013 71880 gene locus_tag LOCUS_02670 gene coxB 73013 71880 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101203.1 protein_id gnl|my_center|LOCUS_02670 74367 73411 gene locus_tag LOCUS_02680 74367 73411 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551493.1 protein_id gnl|my_center|LOCUS_02680 74655 75770 gene locus_tag LOCUS_02690 74655 75770 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_02690 75777 76850 gene locus_tag LOCUS_02700 75777 76850 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192197.1 protein_id gnl|my_center|LOCUS_02700 76872 77282 gene locus_tag LOCUS_02710 76872 77282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 77477 78061 gene locus_tag LOCUS_02720 77477 78061 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 protein_id gnl|my_center|LOCUS_02720 79211 78123 gene locus_tag LOCUS_02730 79211 78123 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085825.1 protein_id gnl|my_center|LOCUS_02730 79997 79215 gene locus_tag LOCUS_02740 79997 79215 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444530.1 protein_id gnl|my_center|LOCUS_02740 80476 80126 gene locus_tag LOCUS_02750 80476 80126 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_02750 81530 80532 gene locus_tag LOCUS_02760 81530 80532 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772605.1 protein_id gnl|my_center|LOCUS_02760 82174 81554 gene locus_tag LOCUS_02770 gene tmk 82174 81554 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091125.1 protein_id gnl|my_center|LOCUS_02770 83229 82192 gene locus_tag LOCUS_02780 gene mltG 83229 82192 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036223.1 protein_id gnl|my_center|LOCUS_02780 84067 83213 gene locus_tag LOCUS_02790 gene pabC 84067 83213 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_02790 85445 84069 gene locus_tag LOCUS_02800 85445 84069 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_02800 <86648 85471 gene locus_tag LOCUS_02810 <86648 85471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193086.1:beta-ketoacyl-ACP synthase II >Feature sequence004 2407 2171 gene locus_tag LOCUS_02820 2407 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2951 2430 gene locus_tag LOCUS_02830 2951 2430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 4218 3241 gene locus_tag LOCUS_02840 4218 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 4617 4826 gene locus_tag LOCUS_02850 4617 4826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 4846 5445 gene locus_tag LOCUS_02860 4846 5445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 6288 6091 gene locus_tag LOCUS_02870 6288 6091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 6542 6285 gene locus_tag LOCUS_02880 6542 6285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 7966 6539 gene locus_tag LOCUS_02890 7966 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 8691 7978 gene locus_tag LOCUS_02900 8691 7978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 9433 8672 gene locus_tag LOCUS_02910 9433 8672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 10169 9423 gene locus_tag LOCUS_02920 10169 9423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 10737 10156 gene locus_tag LOCUS_02930 10737 10156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 11717 10782 gene locus_tag LOCUS_02940 11717 10782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 12501 11965 gene locus_tag LOCUS_02950 12501 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 12706 12491 gene locus_tag LOCUS_02960 12706 12491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 14667 12703 gene locus_tag LOCUS_02970 gene nrdJ 14667 12703 CDS product ribonucleoside-triphosphate reductase, adenosylcobalamin-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549289.1 protein_id gnl|my_center|LOCUS_02970 14972 16600 gene locus_tag LOCUS_02980 14972 16600 CDS product DUF4055 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931446.1 protein_id gnl|my_center|LOCUS_02980 16661 17431 gene locus_tag LOCUS_02990 16661 17431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 17535 18398 gene locus_tag LOCUS_03000 17535 18398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 18538 18993 gene locus_tag LOCUS_03010 18538 18993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 19102 19407 gene locus_tag LOCUS_03020 19102 19407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 19426 19983 gene locus_tag LOCUS_03030 19426 19983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 19983 20369 gene locus_tag LOCUS_03040 19983 20369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 20914 21339 gene locus_tag LOCUS_03050 20914 21339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 21366 23222 gene locus_tag LOCUS_03060 21366 23222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 23231 23431 gene locus_tag LOCUS_03070 23231 23431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 23403 23798 gene locus_tag LOCUS_03080 23403 23798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 23885 24115 gene locus_tag LOCUS_03090 23885 24115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 24119 27190 gene locus_tag LOCUS_03100 24119 27190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 27193 30594 gene locus_tag LOCUS_03110 27193 30594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 30795 31943 gene locus_tag LOCUS_03120 30795 31943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 31947 32804 gene locus_tag LOCUS_03130 31947 32804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 32806 36279 gene locus_tag LOCUS_03140 32806 36279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 36279 41582 gene locus_tag LOCUS_03150 36279 41582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 43231 41579 gene locus_tag LOCUS_03160 gene terL 43231 41579 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002399999.1 protein_id gnl|my_center|LOCUS_03160 46366 43574 gene locus_tag LOCUS_03170 46366 43574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 46977 46402 gene locus_tag LOCUS_03180 46977 46402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 47004 47414 gene locus_tag LOCUS_03190 47004 47414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 48929 47442 gene locus_tag LOCUS_03200 48929 47442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 49489 48926 gene locus_tag LOCUS_03210 49489 48926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 50178 49486 gene locus_tag LOCUS_03220 gene pyrF 50178 49486 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_03220 50693 50175 gene locus_tag LOCUS_03230 50693 50175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 51285 50674 gene locus_tag LOCUS_03240 51285 50674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 53697 51325 gene locus_tag LOCUS_03250 53697 51325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 54945 53983 gene locus_tag LOCUS_03260 54945 53983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 55659 54952 gene locus_tag LOCUS_03270 55659 54952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 56443 55727 gene locus_tag LOCUS_03280 56443 55727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 56775 56464 gene locus_tag LOCUS_03290 56775 56464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 57452 56772 gene locus_tag LOCUS_03300 57452 56772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 57862 57653 gene locus_tag LOCUS_03310 57862 57653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 58065 57859 gene locus_tag LOCUS_03320 58065 57859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 59693 58089 gene locus_tag LOCUS_03330 59693 58089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 60707 59706 gene locus_tag LOCUS_03340 60707 59706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 61762 60707 gene locus_tag LOCUS_03350 61762 60707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 62748 61762 gene locus_tag LOCUS_03360 62748 61762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 63537 62782 gene locus_tag LOCUS_03370 63537 62782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 64299 63541 gene locus_tag LOCUS_03380 64299 63541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 66226 64301 gene locus_tag LOCUS_03390 66226 64301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 66835 66230 gene locus_tag LOCUS_03400 66835 66230 CDS product DUF2460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337517.1 protein_id gnl|my_center|LOCUS_03400 67111 66842 gene locus_tag LOCUS_03410 67111 66842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 67512 67126 gene locus_tag LOCUS_03420 67512 67126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 67950 67534 gene locus_tag LOCUS_03430 67950 67534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 68486 67944 gene locus_tag LOCUS_03440 68486 67944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 69517 68486 gene locus_tag LOCUS_03450 69517 68486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 70313 69519 gene locus_tag LOCUS_03460 70313 69519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 70842 70327 gene locus_tag LOCUS_03470 70842 70327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 71630 70839 gene locus_tag LOCUS_03480 71630 70839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 71938 71630 gene locus_tag LOCUS_03490 71938 71630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 73167 71959 gene locus_tag LOCUS_03500 73167 71959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 73732 73298 gene locus_tag LOCUS_03510 73732 73298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 75087 73729 gene locus_tag LOCUS_03520 75087 73729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 75283 75074 gene locus_tag LOCUS_03530 75283 75074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 76617 75280 gene locus_tag LOCUS_03540 76617 75280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 77221 76691 gene locus_tag LOCUS_03550 77221 76691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 78371 77295 gene locus_tag LOCUS_03560 78371 77295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 78758 78540 gene locus_tag LOCUS_03570 78758 78540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 79027 78755 gene locus_tag LOCUS_03580 79027 78755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 79444 79046 gene locus_tag LOCUS_03590 79444 79046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03590 79803 79498 gene locus_tag LOCUS_03600 79803 79498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 80402 79845 gene locus_tag LOCUS_03610 80402 79845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03610 81075 80485 gene locus_tag LOCUS_03620 81075 80485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03620 81566 81156 gene locus_tag LOCUS_03630 81566 81156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 82258 81656 gene locus_tag LOCUS_03640 82258 81656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03640 82715 82347 gene locus_tag LOCUS_03650 82715 82347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03650 83616 82894 gene locus_tag LOCUS_03660 83616 82894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence005 503 48 gene locus_tag LOCUS_03670 503 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1097 597 gene locus_tag LOCUS_03680 1097 597 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879236.1 protein_id gnl|my_center|LOCUS_03680 1541 1104 gene locus_tag LOCUS_03690 1541 1104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 1735 1544 gene locus_tag LOCUS_03700 1735 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 1787 3037 gene locus_tag LOCUS_03710 gene cca 1787 3037 CDS product fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000708500.1 protein_id gnl|my_center|LOCUS_03710 3629 3225 gene locus_tag LOCUS_03720 3629 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 4487 3636 gene locus_tag LOCUS_03730 4487 3636 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119813.1 protein_id gnl|my_center|LOCUS_03730 5637 4465 gene locus_tag LOCUS_03740 5637 4465 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_03740 5705 6481 gene locus_tag LOCUS_03750 5705 6481 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_03750 6489 7109 gene locus_tag LOCUS_03760 6489 7109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 7496 7110 gene locus_tag LOCUS_03770 7496 7110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 8317 7493 gene locus_tag LOCUS_03780 8317 7493 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526186.1 protein_id gnl|my_center|LOCUS_03780 9248 8613 gene locus_tag LOCUS_03790 9248 8613 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_03790 9422 10318 gene locus_tag LOCUS_03800 9422 10318 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262935.1 protein_id gnl|my_center|LOCUS_03800 11735 10323 gene locus_tag LOCUS_03810 11735 10323 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938336.1 protein_id gnl|my_center|LOCUS_03810 12391 11732 gene locus_tag LOCUS_03820 12391 11732 CDS product TVP38/TMEM64 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444780.1 protein_id gnl|my_center|LOCUS_03820 13280 12405 gene locus_tag LOCUS_03830 13280 12405 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_03830 13326 14078 gene locus_tag LOCUS_03840 13326 14078 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_03840 14149 15279 gene locus_tag LOCUS_03850 14149 15279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 16276 15476 gene locus_tag LOCUS_03860 gene trpC 16276 15476 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522001.1 protein_id gnl|my_center|LOCUS_03860 17303 16278 gene locus_tag LOCUS_03870 gene trpD 17303 16278 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 protein_id gnl|my_center|LOCUS_03870 17974 17405 gene locus_tag LOCUS_03880 17974 17405 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_03880 18234 17998 gene locus_tag LOCUS_03890 18234 17998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 19676 18162 gene locus_tag LOCUS_03900 gene trpE 19676 18162 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_03900 20496 19822 gene locus_tag LOCUS_03910 20496 19822 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463955.1 protein_id gnl|my_center|LOCUS_03910 21279 20584 gene locus_tag LOCUS_03920 gene rpe 21279 20584 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 protein_id gnl|my_center|LOCUS_03920 21429 21890 gene locus_tag LOCUS_03930 21429 21890 CDS product DUF2269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619982.1 protein_id gnl|my_center|LOCUS_03930 22073 22381 gene locus_tag LOCUS_03940 22073 22381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 22396 23397 gene locus_tag LOCUS_03950 22396 23397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 24315 23410 gene locus_tag LOCUS_03960 24315 23410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 24987 24349 gene locus_tag LOCUS_03970 24987 24349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 25177 25863 gene locus_tag LOCUS_03980 25177 25863 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_03980 25896 26228 gene locus_tag LOCUS_03990 25896 26228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 26360 27061 gene locus_tag LOCUS_04000 26360 27061 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087270.1 protein_id gnl|my_center|LOCUS_04000 27541 27149 gene locus_tag LOCUS_04010 27541 27149 CDS product very short patch repair endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921451.1 protein_id gnl|my_center|LOCUS_04010 28700 27555 gene locus_tag LOCUS_04020 28700 27555 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921453.1 protein_id gnl|my_center|LOCUS_04020 29204 28794 gene locus_tag LOCUS_04030 29204 28794 CDS product DUF2141 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932889.1 protein_id gnl|my_center|LOCUS_04030 30070 29414 gene locus_tag LOCUS_04040 30070 29414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 30568 31392 gene locus_tag LOCUS_04050 30568 31392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 32042 31374 gene locus_tag LOCUS_04060 32042 31374 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_04060 32493 32035 gene locus_tag LOCUS_04070 32493 32035 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208527.1 protein_id gnl|my_center|LOCUS_04070 32580 33125 gene locus_tag LOCUS_04080 32580 33125 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_04080 33204 33791 gene locus_tag LOCUS_04090 33204 33791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 34339 33863 gene locus_tag LOCUS_04100 34339 33863 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460159.1 protein_id gnl|my_center|LOCUS_04100 34895 34422 gene locus_tag LOCUS_04110 34895 34422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 35055 35771 gene locus_tag LOCUS_04120 35055 35771 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073261.1 protein_id gnl|my_center|LOCUS_04120 35866 37182 gene locus_tag LOCUS_04130 gene gltA 35866 37182 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389475.1 protein_id gnl|my_center|LOCUS_04130 37427 37188 gene locus_tag LOCUS_04140 37427 37188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 37711 37424 gene locus_tag LOCUS_04150 37711 37424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 37710 39140 gene locus_tag LOCUS_04160 37710 39140 CDS product heme peroxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929330.1 protein_id gnl|my_center|LOCUS_04160 39568 39206 gene locus_tag LOCUS_04170 39568 39206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 40478 39876 gene locus_tag LOCUS_04180 40478 39876 CDS product glutathione S-transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920810.1 protein_id gnl|my_center|LOCUS_04180 40563 41000 gene locus_tag LOCUS_04190 40563 41000 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265884.1 protein_id gnl|my_center|LOCUS_04190 45057 41167 gene locus_tag LOCUS_04200 gene hrpA 45057 41167 CDS product ATP-dependent RNA helicase HrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104871.1 protein_id gnl|my_center|LOCUS_04200 45317 45132 gene locus_tag LOCUS_04210 45317 45132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 45592 46038 gene locus_tag LOCUS_04220 45592 46038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 46711 46250 gene locus_tag LOCUS_04230 46711 46250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 47457 46711 gene locus_tag LOCUS_04240 47457 46711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 47571 47831 gene locus_tag LOCUS_04250 47571 47831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 49853 47898 gene locus_tag LOCUS_04260 49853 47898 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_04260 49978 50889 gene locus_tag LOCUS_04270 49978 50889 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_04270 50886 51638 gene locus_tag LOCUS_04280 50886 51638 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102804.1 protein_id gnl|my_center|LOCUS_04280 51638 53032 gene locus_tag LOCUS_04290 51638 53032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 53034 53939 gene locus_tag LOCUS_04300 53034 53939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 54045 54464 gene locus_tag LOCUS_04310 54045 54464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 54484 55299 gene locus_tag LOCUS_04320 gene mutM 54484 55299 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039216.1 protein_id gnl|my_center|LOCUS_04320 55354 56829 gene locus_tag LOCUS_04330 55354 56829 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_04330 57629 56877 gene locus_tag LOCUS_04340 57629 56877 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_04340 58471 57656 gene locus_tag LOCUS_04350 58471 57656 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704177.1 protein_id gnl|my_center|LOCUS_04350 58595 59134 gene locus_tag LOCUS_04360 58595 59134 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198002.1 protein_id gnl|my_center|LOCUS_04360 59213 59584 gene locus_tag LOCUS_04370 59213 59584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 59905 60699 gene locus_tag LOCUS_04380 59905 60699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 63408 61399 gene locus_tag LOCUS_04390 63408 61399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 64340 63651 gene locus_tag LOCUS_04400 64340 63651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 66208 64406 gene locus_tag LOCUS_04410 66208 64406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 68602 66272 gene locus_tag LOCUS_04420 68602 66272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 69062 69877 gene locus_tag LOCUS_04430 69062 69877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 69874 71421 gene locus_tag LOCUS_04440 69874 71421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 73581 71548 gene locus_tag LOCUS_04450 73581 71548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 74009 73575 gene locus_tag LOCUS_04460 74009 73575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 75130 74006 gene locus_tag LOCUS_04470 75130 74006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 77134 75920 gene locus_tag LOCUS_04480 77134 75920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_04480 78706 77216 gene locus_tag LOCUS_04490 78706 77216 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330518.1 protein_id gnl|my_center|LOCUS_04490 <81679 78804 gene locus_tag LOCUS_04500 <81679 78804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120560.1:glutamate synthase large subunit >Feature sequence006 237 467 gene locus_tag LOCUS_04510 237 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 460 753 gene locus_tag LOCUS_04520 460 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 889 1368 gene locus_tag LOCUS_04530 889 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 1464 2243 gene locus_tag LOCUS_04540 1464 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 2714 3067 gene locus_tag LOCUS_04550 2714 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 3224 3496 gene locus_tag LOCUS_04560 3224 3496 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_04560 3500 3832 gene locus_tag LOCUS_04570 3500 3832 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_04570 4104 4925 gene locus_tag LOCUS_04580 4104 4925 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_04580 5257 5078 gene locus_tag LOCUS_04590 5257 5078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5341 5601 gene locus_tag LOCUS_04600 5341 5601 CDS product YdeI/OmpD-associated family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941406.1 protein_id gnl|my_center|LOCUS_04600 5664 5849 gene locus_tag LOCUS_04610 5664 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 6261 7262 gene locus_tag LOCUS_04620 6261 7262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 7880 7395 gene locus_tag LOCUS_04630 7880 7395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 8798 7923 gene locus_tag LOCUS_04640 gene sucD 8798 7923 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038208.1 protein_id gnl|my_center|LOCUS_04640 9955 8795 gene locus_tag LOCUS_04650 gene sucC 9955 8795 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_04650 10955 9993 gene locus_tag LOCUS_04660 10955 9993 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081163160.1 protein_id gnl|my_center|LOCUS_04660 11100 11594 gene locus_tag LOCUS_04670 11100 11594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 11734 12357 gene locus_tag LOCUS_04680 11734 12357 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706410.1 protein_id gnl|my_center|LOCUS_04680 12379 12825 gene locus_tag LOCUS_04690 12379 12825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 13144 12857 gene locus_tag LOCUS_04700 13144 12857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 13587 13156 gene locus_tag LOCUS_04710 13587 13156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 14107 13679 gene locus_tag LOCUS_04720 14107 13679 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405106.1 protein_id gnl|my_center|LOCUS_04720 14671 14162 gene locus_tag LOCUS_04730 14671 14162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 15436 14798 gene locus_tag LOCUS_04740 15436 14798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 17291 15597 gene locus_tag LOCUS_04750 17291 15597 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037028.1 protein_id gnl|my_center|LOCUS_04750 18601 17339 gene locus_tag LOCUS_04760 18601 17339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 19059 18598 gene locus_tag LOCUS_04770 19059 18598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 20107 19061 gene locus_tag LOCUS_04780 20107 19061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 20889 20098 gene locus_tag LOCUS_04790 20889 20098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 20873 21055 gene locus_tag LOCUS_04800 20873 21055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 21497 21255 gene locus_tag LOCUS_04810 21497 21255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 21765 21475 gene locus_tag LOCUS_04820 21765 21475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 22280 22011 gene locus_tag LOCUS_04830 22280 22011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 22233 23186 gene locus_tag LOCUS_04840 22233 23186 CDS product STAS-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728707.1 protein_id gnl|my_center|LOCUS_04840 23677 24003 gene locus_tag LOCUS_04850 23677 24003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 24103 25527 gene locus_tag LOCUS_04860 24103 25527 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537445.1 protein_id gnl|my_center|LOCUS_04860 25739 25873 gene locus_tag LOCUS_04870 25739 25873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 27151 25946 gene locus_tag LOCUS_04880 27151 25946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 28163 27402 gene locus_tag LOCUS_04890 28163 27402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 28251 28634 gene locus_tag LOCUS_04900 28251 28634 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814554.1 protein_id gnl|my_center|LOCUS_04900 28721 30040 gene locus_tag LOCUS_04910 28721 30040 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_04910 30056 32224 gene locus_tag LOCUS_04920 30056 32224 CDS product lipase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072838.1 protein_id gnl|my_center|LOCUS_04920 32729 32271 gene locus_tag LOCUS_04930 32729 32271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275420.1 protein_id gnl|my_center|LOCUS_04930 33584 32973 gene locus_tag LOCUS_04940 33584 32973 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 protein_id gnl|my_center|LOCUS_04940 34297 33581 gene locus_tag LOCUS_04950 gene rph 34297 33581 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_04950 34402 35268 gene locus_tag LOCUS_04960 34402 35268 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098315.1 protein_id gnl|my_center|LOCUS_04960 36149 35466 gene locus_tag LOCUS_04970 gene mip 36149 35466 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_04970 36360 37715 gene locus_tag LOCUS_04980 36360 37715 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457169.1 protein_id gnl|my_center|LOCUS_04980 38364 37933 gene locus_tag LOCUS_04990 gene moaE 38364 37933 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093025.1 protein_id gnl|my_center|LOCUS_04990 38594 38367 gene locus_tag LOCUS_05000 gene moaD 38594 38367 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406746.1 protein_id gnl|my_center|LOCUS_05000 38725 39399 gene locus_tag LOCUS_05010 38725 39399 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930094.1 protein_id gnl|my_center|LOCUS_05010 39573 40067 gene locus_tag LOCUS_05020 gene moaC 39573 40067 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_05020 40113 42299 gene locus_tag LOCUS_05030 40113 42299 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269293.1 protein_id gnl|my_center|LOCUS_05030 42299 43360 gene locus_tag LOCUS_05040 gene mutY 42299 43360 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482480.1 protein_id gnl|my_center|LOCUS_05040 43531 43606 gene locus_tag LOCUS_t00020 43531 43606 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 43970 45262 gene locus_tag LOCUS_05050 43970 45262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 46722 45310 gene locus_tag LOCUS_05060 46722 45310 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771063.1 protein_id gnl|my_center|LOCUS_05060 47795 46722 gene locus_tag LOCUS_05070 47795 46722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 49020 47761 gene locus_tag LOCUS_05080 49020 47761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 49418 48978 gene locus_tag LOCUS_05090 49418 48978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 50568 49588 gene locus_tag LOCUS_05100 gene galE 50568 49588 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876270.1 protein_id gnl|my_center|LOCUS_05100 51468 50587 gene locus_tag LOCUS_05110 51468 50587 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_05110 51619 51993 gene locus_tag LOCUS_05120 51619 51993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 52840 52004 gene locus_tag LOCUS_05130 gene cysQ 52840 52004 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_05130 52905 53585 gene locus_tag LOCUS_05140 gene yrfG 52905 53585 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769873.1 protein_id gnl|my_center|LOCUS_05140 54195 53767 gene locus_tag LOCUS_05150 54195 53767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 54994 54218 gene locus_tag LOCUS_05160 54994 54218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 55497 54991 gene locus_tag LOCUS_05170 55497 54991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 56714 55494 gene locus_tag LOCUS_05180 gene xcpY 56714 55494 CDS product GspL family type II secretion system protein XcpY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103522.1 protein_id gnl|my_center|LOCUS_05180 57691 56714 gene locus_tag LOCUS_05190 gene gspK 57691 56714 CDS product type II secretion system minor pseudopilin GspK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121457.1 protein_id gnl|my_center|LOCUS_05190 58317 57688 gene locus_tag LOCUS_05200 gene xcpW 58317 57688 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_05200 58675 58304 gene locus_tag LOCUS_05210 gene lspI 58675 58304 CDS product GspI family T2SS minor pseudopilin variant LspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947090.1 protein_id gnl|my_center|LOCUS_05210 59214 58675 gene locus_tag LOCUS_05220 gene gspH 59214 58675 CDS product type II secretion system minor pseudopilin GspH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262829.1 protein_id gnl|my_center|LOCUS_05220 59683 59252 gene locus_tag LOCUS_05230 gene gspG 59683 59252 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738789.1 protein_id gnl|my_center|LOCUS_05230 59783 60391 gene locus_tag LOCUS_05240 gene rrtA 59783 60391 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001055412.1 protein_id gnl|my_center|LOCUS_05240 62518 60398 gene locus_tag LOCUS_05250 gene recQ 62518 60398 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091724.1 protein_id gnl|my_center|LOCUS_05250 62687 63115 gene locus_tag LOCUS_05260 62687 63115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 63176 63820 gene locus_tag LOCUS_05270 63176 63820 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_05270 63807 64151 gene locus_tag LOCUS_05280 63807 64151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 64152 64568 gene locus_tag LOCUS_05290 64152 64568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 65365 64613 gene locus_tag LOCUS_05300 65365 64613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 66012 65362 gene locus_tag LOCUS_05310 66012 65362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 66153 67823 gene locus_tag LOCUS_05320 66153 67823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 67896 68561 gene locus_tag LOCUS_05330 67896 68561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 69478 68564 gene locus_tag LOCUS_05340 69478 68564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 69566 69925 gene locus_tag LOCUS_05350 69566 69925 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_05350 70055 71974 gene locus_tag LOCUS_05360 70055 71974 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074224.1 protein_id gnl|my_center|LOCUS_05360 72562 71978 gene locus_tag LOCUS_05370 72562 71978 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272442.1 protein_id gnl|my_center|LOCUS_05370 72608 73375 gene locus_tag LOCUS_05380 72608 73375 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011945636.1 protein_id gnl|my_center|LOCUS_05380 73415 74038 gene locus_tag LOCUS_05390 gene dut 73415 74038 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_05390 75066 74014 gene locus_tag LOCUS_05400 75066 74014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 75201 75392 gene locus_tag LOCUS_05410 75201 75392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 75460 75654 gene locus_tag LOCUS_05420 75460 75654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 76540 76385 gene locus_tag LOCUS_05430 gene rpmG 76540 76385 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094893.1 protein_id gnl|my_center|LOCUS_05430 76833 76552 gene locus_tag LOCUS_05440 gene rpmB 76833 76552 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096556.1 protein_id gnl|my_center|LOCUS_05440 77023 77382 gene locus_tag LOCUS_05450 gene folB 77023 77382 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_05450 77384 77875 gene locus_tag LOCUS_05460 gene folK 77384 77875 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_05460 79487 77904 gene locus_tag LOCUS_05470 79487 77904 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064121.1 protein_id gnl|my_center|LOCUS_05470 80143 79964 gene locus_tag LOCUS_05480 80143 79964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 80329 80574 gene locus_tag LOCUS_05490 80329 80574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 >Feature sequence007 114 965 gene locus_tag LOCUS_05500 114 965 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_05500 1448 978 gene locus_tag LOCUS_05510 1448 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 2587 1571 gene locus_tag LOCUS_05520 2587 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2663 3346 gene locus_tag LOCUS_05530 2663 3346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4552 3350 gene locus_tag LOCUS_05540 4552 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 5523 4600 gene locus_tag LOCUS_05550 5523 4600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 5688 7535 gene locus_tag LOCUS_05560 5688 7535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 8341 7856 gene locus_tag LOCUS_05570 8341 7856 CDS product DUF4442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962833.1 protein_id gnl|my_center|LOCUS_05570 8702 8331 gene locus_tag LOCUS_05580 8702 8331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 9445 8831 gene locus_tag LOCUS_05590 9445 8831 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_05590 9696 9445 gene locus_tag LOCUS_05600 9696 9445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 10191 9700 gene locus_tag LOCUS_05610 10191 9700 CDS product TIGR00645 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094773.1 protein_id gnl|my_center|LOCUS_05610 10925 10236 gene locus_tag LOCUS_05620 10925 10236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 10963 11991 gene locus_tag LOCUS_05630 10963 11991 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556653.1 protein_id gnl|my_center|LOCUS_05630 12075 12686 gene locus_tag LOCUS_05640 12075 12686 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000684133.1 protein_id gnl|my_center|LOCUS_05640 13238 13717 gene locus_tag LOCUS_05650 13238 13717 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_05650 14574 13810 gene locus_tag LOCUS_05660 14574 13810 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100327.1 protein_id gnl|my_center|LOCUS_05660 14726 15094 gene locus_tag LOCUS_05670 14726 15094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 15492 15109 gene locus_tag LOCUS_05680 15492 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 15584 16339 gene locus_tag LOCUS_05690 gene fpr 15584 16339 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796322.1 protein_id gnl|my_center|LOCUS_05690 16446 19121 gene locus_tag LOCUS_05700 16446 19121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 19114 19554 gene locus_tag LOCUS_05710 19114 19554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 19558 20286 gene locus_tag LOCUS_05720 19558 20286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 21558 20293 gene locus_tag LOCUS_05730 21558 20293 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073547.1 protein_id gnl|my_center|LOCUS_05730 22253 21576 gene locus_tag LOCUS_05740 22253 21576 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114053.1 protein_id gnl|my_center|LOCUS_05740 23090 22398 gene locus_tag LOCUS_05750 23090 22398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 23272 25155 gene locus_tag LOCUS_05760 23272 25155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 25170 25550 gene locus_tag LOCUS_05770 25170 25550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 25554 26234 gene locus_tag LOCUS_05780 25554 26234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 26395 27102 gene locus_tag LOCUS_05790 26395 27102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 27831 27163 gene locus_tag LOCUS_05800 27831 27163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 28168 27875 gene locus_tag LOCUS_05810 28168 27875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 28285 28527 gene locus_tag LOCUS_05820 28285 28527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 28543 29004 gene locus_tag LOCUS_05830 28543 29004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 29767 29159 gene locus_tag LOCUS_05840 29767 29159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 30348 30914 gene locus_tag LOCUS_05850 gene msrA 30348 30914 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_05850 31723 31118 gene locus_tag LOCUS_05860 31723 31118 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_05860 31789 33075 gene locus_tag LOCUS_05870 31789 33075 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175937.1 protein_id gnl|my_center|LOCUS_05870 33103 33897 gene locus_tag LOCUS_05880 33103 33897 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455384.1 protein_id gnl|my_center|LOCUS_05880 33978 34769 gene locus_tag LOCUS_05890 33978 34769 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_05890 34774 35067 gene locus_tag LOCUS_05900 34774 35067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 35073 36272 gene locus_tag LOCUS_05910 35073 36272 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926962.1 protein_id gnl|my_center|LOCUS_05910 36580 36290 gene locus_tag LOCUS_05920 36580 36290 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390589.1 protein_id gnl|my_center|LOCUS_05920 36879 36580 gene locus_tag LOCUS_05930 36879 36580 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019401.1 protein_id gnl|my_center|LOCUS_05930 37592 36903 gene locus_tag LOCUS_05940 37592 36903 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391312.1 protein_id gnl|my_center|LOCUS_05940 37606 38559 gene locus_tag LOCUS_05950 37606 38559 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582557.1 protein_id gnl|my_center|LOCUS_05950 38556 39206 gene locus_tag LOCUS_05960 38556 39206 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970812.1 protein_id gnl|my_center|LOCUS_05960 39216 39641 gene locus_tag LOCUS_05970 39216 39641 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103658.1 protein_id gnl|my_center|LOCUS_05970 40330 39668 gene locus_tag LOCUS_05980 40330 39668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040729.1 protein_id gnl|my_center|LOCUS_05980 41383 40355 gene locus_tag LOCUS_05990 41383 40355 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679870.1 protein_id gnl|my_center|LOCUS_05990 42567 41395 gene locus_tag LOCUS_06000 42567 41395 CDS product DUF839 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142441.1 protein_id gnl|my_center|LOCUS_06000 42641 43567 gene locus_tag LOCUS_06010 42641 43567 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_06010 43596 44132 gene locus_tag LOCUS_06020 43596 44132 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399826.1 protein_id gnl|my_center|LOCUS_06020 45190 44141 gene locus_tag LOCUS_06030 45190 44141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 45957 45319 gene locus_tag LOCUS_06040 45957 45319 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035431.1 protein_id gnl|my_center|LOCUS_06040 46299 46445 gene locus_tag LOCUS_06050 46299 46445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 47875 46466 gene locus_tag LOCUS_06060 47875 46466 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227779.1 protein_id gnl|my_center|LOCUS_06060 48177 47872 gene locus_tag LOCUS_06070 48177 47872 CDS product proton-translocating transhydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227778.1 protein_id gnl|my_center|LOCUS_06070 49307 48174 gene locus_tag LOCUS_06080 49307 48174 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_06080 49527 50531 gene locus_tag LOCUS_06090 gene hemH 49527 50531 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816874.1 protein_id gnl|my_center|LOCUS_06090 50562 51056 gene locus_tag LOCUS_06100 50562 51056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 51300 52262 gene locus_tag LOCUS_06110 gene cas1f 51300 52262 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_06110 52615 52247 gene locus_tag LOCUS_06120 52615 52247 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106996.1 protein_id gnl|my_center|LOCUS_06120 52848 52615 gene locus_tag LOCUS_06130 52848 52615 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_06130 53205 52930 gene locus_tag LOCUS_06140 53205 52930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 53152 56253 gene locus_tag LOCUS_06150 gene cas3f 53152 56253 CDS product type I-F CRISPR-associated helicase Cas3f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002221142.1 protein_id gnl|my_center|LOCUS_06150 56250 57752 gene locus_tag LOCUS_06160 gene csy1 56250 57752 CDS product type I-F CRISPR-associated protein Csy1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415806.1 protein_id gnl|my_center|LOCUS_06160 57749 58942 gene locus_tag LOCUS_06170 57749 58942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 58963 60030 gene locus_tag LOCUS_06180 gene csy3 58963 60030 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_06180 60027 60623 gene locus_tag LOCUS_06190 60027 60623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 60749 63417 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cttcactgccgcacaggcagcttagaaa 63941 63564 gene locus_tag LOCUS_06200 63941 63564 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948606.1 protein_id gnl|my_center|LOCUS_06200 64270 63875 gene locus_tag LOCUS_06210 64270 63875 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_06210 65225 64344 gene locus_tag LOCUS_06220 65225 64344 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_06220 66064 65843 gene locus_tag LOCUS_06230 66064 65843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 66133 68364 gene locus_tag LOCUS_06240 66133 68364 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095847.1 protein_id gnl|my_center|LOCUS_06240 68447 70207 gene locus_tag LOCUS_06250 gene argS 68447 70207 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_06250 70211 70828 gene locus_tag LOCUS_06260 70211 70828 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005621218.1 protein_id gnl|my_center|LOCUS_06260 71025 71417 gene locus_tag LOCUS_06270 71025 71417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 71583 72047 gene locus_tag LOCUS_06280 71583 72047 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_06280 72170 72355 gene locus_tag LOCUS_06290 72170 72355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 72352 72651 gene locus_tag LOCUS_06300 72352 72651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 72934 72710 gene locus_tag LOCUS_06310 72934 72710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 73940 72927 gene locus_tag LOCUS_06320 73940 72927 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_06320 75205 73937 gene locus_tag LOCUS_06330 75205 73937 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958086.1 protein_id gnl|my_center|LOCUS_06330 75286 75624 gene locus_tag LOCUS_06340 75286 75624 CDS product Rieske 2Fe-2S domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391321.1 protein_id gnl|my_center|LOCUS_06340 75626 76549 gene locus_tag LOCUS_06350 75626 76549 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074136.1 protein_id gnl|my_center|LOCUS_06350 76697 76930 gene locus_tag LOCUS_06360 76697 76930 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_06360 76971 77612 gene locus_tag LOCUS_06370 76971 77612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 78062 77616 gene locus_tag LOCUS_06380 gene sixA 78062 77616 CDS product phosphohistidine phosphatase SixA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947703.1 protein_id gnl|my_center|LOCUS_06380 78300 78091 gene locus_tag LOCUS_06390 78300 78091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 78624 78436 gene locus_tag LOCUS_06400 78624 78436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 78967 78755 gene locus_tag LOCUS_06410 78967 78755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 78997 79500 gene locus_tag LOCUS_06420 gene greB 78997 79500 CDS product transcription elongation factor GreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037693.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence008 2178 157 gene locus_tag LOCUS_06430 gene uvrB 2178 157 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957630.1 protein_id gnl|my_center|LOCUS_06430 2230 3414 gene locus_tag LOCUS_06440 2230 3414 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118408.1 protein_id gnl|my_center|LOCUS_06440 3581 3656 gene locus_tag LOCUS_t00030 3581 3656 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5280 3661 gene locus_tag LOCUS_06450 5280 3661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 7198 5504 gene locus_tag LOCUS_06460 7198 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 8103 7195 gene locus_tag LOCUS_06470 8103 7195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 9827 8100 gene locus_tag LOCUS_06480 gene hsbR 9827 8100 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_06480 10162 9824 gene locus_tag LOCUS_06490 gene hsbA 10162 9824 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_06490 10488 10318 gene locus_tag LOCUS_06500 10488 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 10993 10475 gene locus_tag LOCUS_06510 gene cheD 10993 10475 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704960.1 protein_id gnl|my_center|LOCUS_06510 12915 10996 gene locus_tag LOCUS_06520 12915 10996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 14019 12916 gene locus_tag LOCUS_06530 14019 12916 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941806.1 protein_id gnl|my_center|LOCUS_06530 14410 14057 gene locus_tag LOCUS_06540 14410 14057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 15375 14485 gene locus_tag LOCUS_06550 15375 14485 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941804.1 protein_id gnl|my_center|LOCUS_06550 15631 15966 gene locus_tag LOCUS_06560 gene hsbA 15631 15966 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_06560 18221 16011 gene locus_tag LOCUS_06570 18221 16011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 18757 20184 gene locus_tag LOCUS_06580 gene nhaD 18757 20184 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_06580 20296 22764 gene locus_tag LOCUS_06590 20296 22764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 23057 24139 gene locus_tag LOCUS_06600 23057 24139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 24837 24220 gene locus_tag LOCUS_06610 24837 24220 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105196.1 protein_id gnl|my_center|LOCUS_06610 25919 24834 gene locus_tag LOCUS_06620 25919 24834 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000340821.1 protein_id gnl|my_center|LOCUS_06620 26699 25932 gene locus_tag LOCUS_06630 gene pomA 26699 25932 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071707.1 protein_id gnl|my_center|LOCUS_06630 27217 27939 gene locus_tag LOCUS_06640 27217 27939 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089391.1 protein_id gnl|my_center|LOCUS_06640 28188 29162 gene locus_tag LOCUS_06650 28188 29162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 29163 31727 gene locus_tag LOCUS_06660 29163 31727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 32547 31777 gene locus_tag LOCUS_06670 32547 31777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 34983 32716 gene locus_tag LOCUS_06680 34983 32716 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704962.1 protein_id gnl|my_center|LOCUS_06680 38295 35041 gene locus_tag LOCUS_06690 38295 35041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 38904 38365 gene locus_tag LOCUS_06700 38904 38365 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941803.1 protein_id gnl|my_center|LOCUS_06700 41346 38995 gene locus_tag LOCUS_06710 41346 38995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 44151 41389 gene locus_tag LOCUS_06720 44151 41389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 46290 44182 gene locus_tag LOCUS_06730 46290 44182 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941945.1 protein_id gnl|my_center|LOCUS_06730 46604 46287 gene locus_tag LOCUS_06740 46604 46287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 46993 46631 gene locus_tag LOCUS_06750 46993 46631 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072313.1 protein_id gnl|my_center|LOCUS_06750 48250 47006 gene locus_tag LOCUS_06760 48250 47006 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770011.1 protein_id gnl|my_center|LOCUS_06760 48541 48254 gene locus_tag LOCUS_06770 48541 48254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 49393 48872 gene locus_tag LOCUS_06780 49393 48872 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000075896.1 protein_id gnl|my_center|LOCUS_06780 50016 49405 gene locus_tag LOCUS_06790 50016 49405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 50815 50018 gene locus_tag LOCUS_06800 50815 50018 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 protein_id gnl|my_center|LOCUS_06800 52932 50824 gene locus_tag LOCUS_06810 52932 50824 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073093.1 protein_id gnl|my_center|LOCUS_06810 53756 52971 gene locus_tag LOCUS_06820 53756 52971 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262351.1 protein_id gnl|my_center|LOCUS_06820 54151 53756 gene locus_tag LOCUS_06830 gene cheY 54151 53756 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010634617.1 protein_id gnl|my_center|LOCUS_06830 54948 54199 gene locus_tag LOCUS_06840 gene fliA 54948 54199 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_06840 55832 54945 gene locus_tag LOCUS_06850 gene fleN 55832 54945 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083064.1 protein_id gnl|my_center|LOCUS_06850 57102 55819 gene locus_tag LOCUS_06860 gene flhF 57102 55819 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705286.1 protein_id gnl|my_center|LOCUS_06860 59242 57137 gene locus_tag LOCUS_06870 gene flhA 59242 57137 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881783.1 protein_id gnl|my_center|LOCUS_06870 60427 59270 gene locus_tag LOCUS_06880 gene flhB 60427 59270 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_06880 61198 60431 gene locus_tag LOCUS_06890 gene fliR 61198 60431 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_06890 61472 61203 gene locus_tag LOCUS_06900 gene fliQ 61472 61203 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097797.1 protein_id gnl|my_center|LOCUS_06900 62237 61494 gene locus_tag LOCUS_06910 gene fliP 62237 61494 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 protein_id gnl|my_center|LOCUS_06910 62818 62234 gene locus_tag LOCUS_06920 62818 62234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 63270 62818 gene locus_tag LOCUS_06930 63270 62818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 64313 63312 gene locus_tag LOCUS_06940 gene fliM 64313 63312 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037085.1 protein_id gnl|my_center|LOCUS_06940 64877 64344 gene locus_tag LOCUS_06950 64877 64344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 65815 65081 gene locus_tag LOCUS_06960 65815 65081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 67199 65838 gene locus_tag LOCUS_06970 67199 65838 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037087.1 protein_id gnl|my_center|LOCUS_06970 67702 69147 gene locus_tag LOCUS_06980 67702 69147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 >Feature sequence009 72 1475 gene locus_tag LOCUS_06990 gene ntrC 72 1475 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_06990 2260 1538 gene locus_tag LOCUS_07000 2260 1538 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387878.1 protein_id gnl|my_center|LOCUS_07000 3030 2341 gene locus_tag LOCUS_07010 3030 2341 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387873.1 protein_id gnl|my_center|LOCUS_07010 3911 3150 gene locus_tag LOCUS_07020 3911 3150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 4691 3915 gene locus_tag LOCUS_07030 4691 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4798 6489 gene locus_tag LOCUS_07040 4798 6489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 7391 6639 gene locus_tag LOCUS_07050 7391 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387882.1 protein_id gnl|my_center|LOCUS_07050 8626 7391 gene locus_tag LOCUS_07060 8626 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 9019 8633 gene locus_tag LOCUS_07070 9019 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 9639 9016 gene locus_tag LOCUS_07080 9639 9016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 11209 9632 gene locus_tag LOCUS_07090 11209 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 12414 11206 gene locus_tag LOCUS_07100 12414 11206 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_07100 14129 12417 gene locus_tag LOCUS_07110 14129 12417 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387874.1 protein_id gnl|my_center|LOCUS_07110 15391 14126 gene locus_tag LOCUS_07120 15391 14126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 17004 15412 gene locus_tag LOCUS_07130 17004 15412 CDS product type II and III secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387870.1 protein_id gnl|my_center|LOCUS_07130 18453 17074 gene locus_tag LOCUS_07140 18453 17074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 19886 18453 gene locus_tag LOCUS_07150 gene zraR 19886 18453 CDS product sigma-54-dependent response regulator transcription factor ZraR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368806.1 protein_id gnl|my_center|LOCUS_07150 20000 20461 gene locus_tag LOCUS_07160 20000 20461 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105425.1 protein_id gnl|my_center|LOCUS_07160 21550 20543 gene locus_tag LOCUS_07170 gene gpsA 21550 20543 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076190.1 protein_id gnl|my_center|LOCUS_07170 22024 21554 gene locus_tag LOCUS_07180 gene secB 22024 21554 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948014.1 protein_id gnl|my_center|LOCUS_07180 22507 22073 gene locus_tag LOCUS_07190 22507 22073 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029413.1 protein_id gnl|my_center|LOCUS_07190 22880 22545 gene locus_tag LOCUS_07200 22880 22545 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265860.1 protein_id gnl|my_center|LOCUS_07200 23029 24195 gene locus_tag LOCUS_07210 23029 24195 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070463.1 protein_id gnl|my_center|LOCUS_07210 24318 25628 gene locus_tag LOCUS_07220 gene cptA 24318 25628 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_07220 25625 26440 gene locus_tag LOCUS_07230 25625 26440 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070461.1 protein_id gnl|my_center|LOCUS_07230 26403 26951 gene locus_tag LOCUS_07240 26403 26951 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127205.1 protein_id gnl|my_center|LOCUS_07240 27155 27490 gene locus_tag LOCUS_07250 27155 27490 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459007.1 protein_id gnl|my_center|LOCUS_07250 31031 27564 gene locus_tag LOCUS_07260 31031 27564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037251825.1 protein_id gnl|my_center|LOCUS_07260 31308 31469 gene locus_tag LOCUS_07270 31308 31469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 32859 31489 gene locus_tag LOCUS_07280 gene glmU 32859 31489 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369010.1 protein_id gnl|my_center|LOCUS_07280 33389 32970 gene locus_tag LOCUS_07290 33389 32970 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948665.1 protein_id gnl|my_center|LOCUS_07290 34790 33414 gene locus_tag LOCUS_07300 gene atpD 34790 33414 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649402.1 protein_id gnl|my_center|LOCUS_07300 35705 34842 gene locus_tag LOCUS_07310 gene atpG 35705 34842 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707909.1 protein_id gnl|my_center|LOCUS_07310 37281 35740 gene locus_tag LOCUS_07320 gene atpA 37281 35740 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_07320 37831 37295 gene locus_tag LOCUS_07330 37831 37295 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_07330 38317 37847 gene locus_tag LOCUS_07340 gene atpF 38317 37847 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 protein_id gnl|my_center|LOCUS_07340 38580 38341 gene locus_tag LOCUS_07350 gene atpE 38580 38341 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 protein_id gnl|my_center|LOCUS_07350 39505 38630 gene locus_tag LOCUS_07360 gene atpB 39505 38630 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 protein_id gnl|my_center|LOCUS_07360 39930 39520 gene locus_tag LOCUS_07370 39930 39520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 40928 40062 gene locus_tag LOCUS_07380 40928 40062 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_07380 41807 40986 gene locus_tag LOCUS_07390 gene soj 41807 40986 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_07390 42488 41868 gene locus_tag LOCUS_07400 gene rsmG 42488 41868 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367844.1 protein_id gnl|my_center|LOCUS_07400 43342 42650 gene locus_tag LOCUS_07410 gene mip 43342 42650 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_07410 43632 44468 gene locus_tag LOCUS_07420 43632 44468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 45307 44498 gene locus_tag LOCUS_07430 45307 44498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 46962 45310 gene locus_tag LOCUS_07440 46962 45310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 47420 47031 gene locus_tag LOCUS_07450 47420 47031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 50530 47411 gene locus_tag LOCUS_07460 50530 47411 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_07460 51886 50555 gene locus_tag LOCUS_07470 51886 50555 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941985.1 protein_id gnl|my_center|LOCUS_07470 54653 52104 gene locus_tag LOCUS_07480 54653 52104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 55261 54689 gene locus_tag LOCUS_07490 55261 54689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 56168 57685 gene locus_tag LOCUS_07500 gene lnt 56168 57685 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261462.1 protein_id gnl|my_center|LOCUS_07500 59572 57656 gene locus_tag LOCUS_07510 gene mnmG 59572 57656 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000499788.1 protein_id gnl|my_center|LOCUS_07510 59702 60025 gene locus_tag LOCUS_07520 59702 60025 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_07520 59985 60251 gene locus_tag LOCUS_07530 59985 60251 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041364541.1 protein_id gnl|my_center|LOCUS_07530 60316 60522 gene locus_tag LOCUS_07540 60316 60522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 61415 60693 gene locus_tag LOCUS_07550 61415 60693 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932829.1 protein_id gnl|my_center|LOCUS_07550 61561 61905 gene locus_tag LOCUS_07560 61561 61905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 62164 61937 gene locus_tag LOCUS_07570 62164 61937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 62405 62142 gene locus_tag LOCUS_07580 62405 62142 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087106.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence010 2 931 gene locus_tag LOCUS_07590 gene hemE 2 931 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765484.1 protein_id gnl|my_center|LOCUS_07590 3723 1246 gene locus_tag LOCUS_07600 3723 1246 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114576.1 protein_id gnl|my_center|LOCUS_07600 3901 4962 gene locus_tag LOCUS_07610 3901 4962 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_07610 4962 5525 gene locus_tag LOCUS_07620 gene pilN 4962 5525 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_07620 5525 6139 gene locus_tag LOCUS_07630 gene pilO 5525 6139 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_07630 6143 6670 gene locus_tag LOCUS_07640 gene pilP 6143 6670 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266376.1 protein_id gnl|my_center|LOCUS_07640 6752 8902 gene locus_tag LOCUS_07650 6752 8902 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_07650 8924 9895 gene locus_tag LOCUS_07660 8924 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 9946 10479 gene locus_tag LOCUS_07670 gene aroK 9946 10479 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648746.1 protein_id gnl|my_center|LOCUS_07670 10487 11569 gene locus_tag LOCUS_07680 gene aroB 10487 11569 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765495.1 protein_id gnl|my_center|LOCUS_07680 11573 12754 gene locus_tag LOCUS_07690 11573 12754 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 protein_id gnl|my_center|LOCUS_07690 12969 14708 gene locus_tag LOCUS_07700 gene dnaG 12969 14708 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704781.1 protein_id gnl|my_center|LOCUS_07700 14914 16092 gene locus_tag LOCUS_07710 gene metK 14914 16092 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_07710 16241 17674 gene locus_tag LOCUS_07720 gene ahcY 16241 17674 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931278.1 protein_id gnl|my_center|LOCUS_07720 17689 18537 gene locus_tag LOCUS_07730 gene metF 17689 18537 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765400.1 protein_id gnl|my_center|LOCUS_07730 18545 19279 gene locus_tag LOCUS_07740 18545 19279 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958567.1 protein_id gnl|my_center|LOCUS_07740 19767 19309 gene locus_tag LOCUS_07750 19767 19309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 25661 19767 gene locus_tag LOCUS_07760 25661 19767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 27774 25711 gene locus_tag LOCUS_07770 gene pilJ 27774 25711 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_07770 28356 27820 gene locus_tag LOCUS_07780 28356 27820 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_07780 28748 28383 gene locus_tag LOCUS_07790 gene pilH 28748 28383 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_07790 29211 28816 gene locus_tag LOCUS_07800 gene pilG 29211 28816 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_07800 29397 30365 gene locus_tag LOCUS_07810 gene gshB 29397 30365 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316740.1 protein_id gnl|my_center|LOCUS_07810 30476 31564 gene locus_tag LOCUS_07820 30476 31564 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_07820 31603 32511 gene locus_tag LOCUS_07830 31603 32511 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038050.1 protein_id gnl|my_center|LOCUS_07830 32522 33085 gene locus_tag LOCUS_07840 32522 33085 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054768.1 protein_id gnl|my_center|LOCUS_07840 33421 33837 gene locus_tag LOCUS_07850 gene ruvX 33421 33837 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356737.1 protein_id gnl|my_center|LOCUS_07850 33861 34358 gene locus_tag LOCUS_07860 gene pyrR 33861 34358 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_07860 34355 35371 gene locus_tag LOCUS_07870 34355 35371 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084569.1 protein_id gnl|my_center|LOCUS_07870 35368 36651 gene locus_tag LOCUS_07880 35368 36651 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_07880 36711 37037 gene locus_tag LOCUS_07890 36711 37037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 37671 37099 gene locus_tag LOCUS_07900 37671 37099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 38277 37720 gene locus_tag LOCUS_07910 38277 37720 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_07910 38652 38305 gene locus_tag LOCUS_07920 38652 38305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 38896 38612 gene locus_tag LOCUS_07930 38896 38612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 39177 41009 gene locus_tag LOCUS_07940 gene rpoD 39177 41009 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210359.1 protein_id gnl|my_center|LOCUS_07940 42033 41251 gene locus_tag LOCUS_07950 42033 41251 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187830.1 protein_id gnl|my_center|LOCUS_07950 42169 42245 gene locus_tag LOCUS_t00040 42169 42245 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 42291 42908 gene locus_tag LOCUS_07960 42291 42908 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530355.1 protein_id gnl|my_center|LOCUS_07960 43566 43084 gene locus_tag LOCUS_07970 43566 43084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 43991 46099 gene locus_tag LOCUS_07980 43991 46099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 46176 48353 gene locus_tag LOCUS_07990 46176 48353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 48883 48449 gene locus_tag LOCUS_08000 48883 48449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 49101 48880 gene locus_tag LOCUS_08010 49101 48880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 50776 49238 gene locus_tag LOCUS_08020 gene gpmI 50776 49238 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_08020 51809 50937 gene locus_tag LOCUS_08030 gene tatC 51809 50937 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704121.1 protein_id gnl|my_center|LOCUS_08030 52216 51809 gene locus_tag LOCUS_08040 gene tatB 52216 51809 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765539.1 protein_id gnl|my_center|LOCUS_08040 52519 52295 gene locus_tag LOCUS_08050 gene tatA 52519 52295 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260926.1 protein_id gnl|my_center|LOCUS_08050 52855 52541 gene locus_tag LOCUS_08060 52855 52541 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_08060 53252 52863 gene locus_tag LOCUS_08070 gene hisI 53252 52863 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_08070 54025 53252 gene locus_tag LOCUS_08080 gene hisF 54025 53252 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_08080 54780 54049 gene locus_tag LOCUS_08090 gene hisA 54780 54049 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_08090 55465 54818 gene locus_tag LOCUS_08100 gene hisH 55465 54818 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_08100 56084 55470 gene locus_tag LOCUS_08110 56084 55470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 56780 56331 gene locus_tag LOCUS_08120 gene dtd 56780 56331 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000560978.1 protein_id gnl|my_center|LOCUS_08120 58002 57175 gene locus_tag LOCUS_08130 gene ttcA 58002 57175 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082462.1 protein_id gnl|my_center|LOCUS_08130 58930 57995 gene locus_tag LOCUS_08140 gene lpxM 58930 57995 CDS product lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072152.1 protein_id gnl|my_center|LOCUS_08140 60383 58932 gene locus_tag LOCUS_08150 60383 58932 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465049.1 protein_id gnl|my_center|LOCUS_08150 62010 60634 gene locus_tag LOCUS_08160 gene trkA 62010 60634 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_08160 <63072 62068 gene locus_tag LOCUS_08170 <63072 62068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114643.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB >Feature sequence011 964 59 gene locus_tag LOCUS_08180 gene dapF 964 59 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000983200.1 protein_id gnl|my_center|LOCUS_08180 1636 977 gene locus_tag LOCUS_08190 1636 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1962 1780 gene locus_tag LOCUS_08200 1962 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 2709 2062 gene locus_tag LOCUS_08210 2709 2062 CDS product 2OG-Fe(II) oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118961.1 protein_id gnl|my_center|LOCUS_08210 3953 2706 gene locus_tag LOCUS_08220 gene lysA 3953 2706 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_08220 4160 4840 gene locus_tag LOCUS_08230 4160 4840 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814899.1 protein_id gnl|my_center|LOCUS_08230 4924 5277 gene locus_tag LOCUS_08240 4924 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 5314 5652 gene locus_tag LOCUS_08250 5314 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 7377 5998 gene locus_tag LOCUS_08260 gene argH 7377 5998 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_08260 7513 8586 gene locus_tag LOCUS_08270 gene algZ 7513 8586 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_08270 8593 9330 gene locus_tag LOCUS_08280 8593 9330 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 protein_id gnl|my_center|LOCUS_08280 9941 9393 gene locus_tag LOCUS_08290 9941 9393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 9963 10748 gene locus_tag LOCUS_08300 9963 10748 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114032.1 protein_id gnl|my_center|LOCUS_08300 10809 12077 gene locus_tag LOCUS_08310 10809 12077 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_08310 12626 12141 gene locus_tag LOCUS_08320 12626 12141 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036724.1 protein_id gnl|my_center|LOCUS_08320 13679 12633 gene locus_tag LOCUS_08330 13679 12633 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_08330 14170 16974 gene locus_tag LOCUS_08340 14170 16974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 16979 17875 gene locus_tag LOCUS_08350 16979 17875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 17932 18198 gene locus_tag LOCUS_08360 17932 18198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 18565 18254 gene locus_tag LOCUS_08370 18565 18254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 20162 18699 gene locus_tag LOCUS_08380 gene ubiD 20162 18699 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317344.1 protein_id gnl|my_center|LOCUS_08380 22641 20230 gene locus_tag LOCUS_08390 gene gyrB 22641 20230 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175131.1 protein_id gnl|my_center|LOCUS_08390 23764 22685 gene locus_tag LOCUS_08400 gene recF 23764 22685 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070426.1 protein_id gnl|my_center|LOCUS_08400 24889 23789 gene locus_tag LOCUS_08410 gene dnaN 24889 23789 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_08410 26532 25141 gene locus_tag LOCUS_08420 gene dnaA 26532 25141 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945763.1 protein_id gnl|my_center|LOCUS_08420 27049 27405 gene locus_tag LOCUS_08430 gene rnpA 27049 27405 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707927.1 protein_id gnl|my_center|LOCUS_08430 27390 27641 gene locus_tag LOCUS_08440 gene yidD 27390 27641 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551313.1 protein_id gnl|my_center|LOCUS_08440 27641 29281 gene locus_tag LOCUS_08450 gene yidC 27641 29281 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_08450 29301 30626 gene locus_tag LOCUS_08460 gene mnmE 29301 30626 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000019075.1 protein_id gnl|my_center|LOCUS_08460 31389 30634 gene locus_tag LOCUS_08470 31389 30634 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113815.1 protein_id gnl|my_center|LOCUS_08470 31524 32294 gene locus_tag LOCUS_08480 31524 32294 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965702.1 protein_id gnl|my_center|LOCUS_08480 32429 32839 gene locus_tag LOCUS_08490 32429 32839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 33483 34298 gene locus_tag LOCUS_08500 33483 34298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 34580 34389 gene locus_tag LOCUS_08510 34580 34389 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957320.1 protein_id gnl|my_center|LOCUS_08510 35775 34798 gene locus_tag LOCUS_08520 35775 34798 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_08520 36529 35798 gene locus_tag LOCUS_08530 36529 35798 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556370.1 protein_id gnl|my_center|LOCUS_08530 39456 36538 gene locus_tag LOCUS_08540 39456 36538 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_08540 39662 39925 gene locus_tag LOCUS_08550 39662 39925 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087106.1 protein_id gnl|my_center|LOCUS_08550 39906 40232 gene locus_tag LOCUS_08560 39906 40232 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802136.1 protein_id gnl|my_center|LOCUS_08560 40237 42180 gene locus_tag LOCUS_08570 gene mnmG 40237 42180 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369000.1 protein_id gnl|my_center|LOCUS_08570 43690 42182 gene locus_tag LOCUS_08580 gene lnt 43690 42182 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105186.1 protein_id gnl|my_center|LOCUS_08580 44769 45341 gene locus_tag LOCUS_08590 44769 45341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 45381 47930 gene locus_tag LOCUS_08600 45381 47930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 48181 49482 gene locus_tag LOCUS_08610 48181 49482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 49507 52620 gene locus_tag LOCUS_08620 49507 52620 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_08620 52617 53006 gene locus_tag LOCUS_08630 52617 53006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 53078 54730 gene locus_tag LOCUS_08640 53078 54730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 54733 55545 gene locus_tag LOCUS_08650 54733 55545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 56324 55575 gene locus_tag LOCUS_08660 56324 55575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 56725 57405 gene locus_tag LOCUS_08670 gene mip 56725 57405 CDS product macrophage infectivity potentiator Mip inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213317.1 protein_id gnl|my_center|LOCUS_08670 57464 58084 gene locus_tag LOCUS_08680 gene rsmG 57464 58084 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003367844.1 protein_id gnl|my_center|LOCUS_08680 58145 58963 gene locus_tag LOCUS_08690 gene soj 58145 58963 CDS product chromosome partitioning protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097243.1 protein_id gnl|my_center|LOCUS_08690 59022 59888 gene locus_tag LOCUS_08700 59022 59888 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_08700 60020 60430 gene locus_tag LOCUS_08710 60020 60430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 60443 61318 gene locus_tag LOCUS_08720 gene atpB 60443 61318 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377888.1 protein_id gnl|my_center|LOCUS_08720 61367 61606 gene locus_tag LOCUS_08730 gene atpE 61367 61606 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307205.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence012 <1 1105 gene locus_tag LOCUS_08740 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015065015.1:DNA mismatch repair endonuclease MutL 414 341 gene locus_tag LOCUS_t00050 414 341 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1252 2211 gene locus_tag LOCUS_08750 gene miaA 1252 2211 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704863.1 protein_id gnl|my_center|LOCUS_08750 2293 2541 gene locus_tag LOCUS_08760 gene hfq 2293 2541 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_08760 2659 3939 gene locus_tag LOCUS_08770 gene hflX 2659 3939 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736856.1 protein_id gnl|my_center|LOCUS_08770 4237 5397 gene locus_tag LOCUS_08780 gene hflK 4237 5397 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266497.1 protein_id gnl|my_center|LOCUS_08780 5397 6260 gene locus_tag LOCUS_08790 gene hflC 5397 6260 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763025.1 protein_id gnl|my_center|LOCUS_08790 6306 6491 gene locus_tag LOCUS_08800 6306 6491 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_08800 6499 7689 gene locus_tag LOCUS_08810 6499 7689 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402926.1 protein_id gnl|my_center|LOCUS_08810 7740 9032 gene locus_tag LOCUS_08820 7740 9032 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000527932.1 protein_id gnl|my_center|LOCUS_08820 9120 11648 gene locus_tag LOCUS_08830 9120 11648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 11970 11623 gene locus_tag LOCUS_08840 11970 11623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 12039 13220 gene locus_tag LOCUS_08850 gene purT 12039 13220 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938024.1 protein_id gnl|my_center|LOCUS_08850 14071 14916 gene locus_tag LOCUS_08860 14071 14916 CDS product XrtA-associated ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390863.1 protein_id gnl|my_center|LOCUS_08860 15095 16516 gene locus_tag LOCUS_08870 15095 16516 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390850.1 protein_id gnl|my_center|LOCUS_08870 16772 17158 gene locus_tag LOCUS_08880 16772 17158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 17361 19454 gene locus_tag LOCUS_08890 gene prsK 17361 19454 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176643.1 protein_id gnl|my_center|LOCUS_08890 19463 20830 gene locus_tag LOCUS_08900 gene prsR 19463 20830 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_08900 20830 22347 gene locus_tag LOCUS_08910 20830 22347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 22454 24028 gene locus_tag LOCUS_08920 22454 24028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 24070 24960 gene locus_tag LOCUS_08930 24070 24960 CDS product XrtA-associated tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390867.1 protein_id gnl|my_center|LOCUS_08930 24971 25822 gene locus_tag LOCUS_08940 24971 25822 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942624.1 protein_id gnl|my_center|LOCUS_08940 25879 26997 gene locus_tag LOCUS_08950 25879 26997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 29593 26999 gene locus_tag LOCUS_08960 29593 26999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 30908 29886 gene locus_tag LOCUS_08970 30908 29886 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083903.1 protein_id gnl|my_center|LOCUS_08970 32345 30936 gene locus_tag LOCUS_08980 32345 30936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 33326 32349 gene locus_tag LOCUS_08990 33326 32349 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_08990 33415 34560 gene locus_tag LOCUS_09000 33415 34560 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926821.1 protein_id gnl|my_center|LOCUS_09000 35656 34565 gene locus_tag LOCUS_09010 35656 34565 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582952.1 protein_id gnl|my_center|LOCUS_09010 35818 36381 gene locus_tag LOCUS_09020 35818 36381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 36350 37633 gene locus_tag LOCUS_09030 36350 37633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 38457 37669 gene locus_tag LOCUS_09040 38457 37669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 39206 38709 gene locus_tag LOCUS_09050 39206 38709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 40096 40275 gene locus_tag LOCUS_09060 40096 40275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 42997 41942 gene locus_tag LOCUS_09070 42997 41942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 44130 42994 gene locus_tag LOCUS_09080 44130 42994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 45850 44216 gene locus_tag LOCUS_09090 45850 44216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 46797 45847 gene locus_tag LOCUS_09100 46797 45847 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932009.1 protein_id gnl|my_center|LOCUS_09100 47755 46781 gene locus_tag LOCUS_09110 47755 46781 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_09110 47917 49011 gene locus_tag LOCUS_09120 47917 49011 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042510611.1 protein_id gnl|my_center|LOCUS_09120 49025 50110 gene locus_tag LOCUS_09130 49025 50110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 50188 51888 gene locus_tag LOCUS_09140 50188 51888 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142835.1 protein_id gnl|my_center|LOCUS_09140 51885 52877 gene locus_tag LOCUS_09150 51885 52877 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932263.1 protein_id gnl|my_center|LOCUS_09150 53610 52882 gene locus_tag LOCUS_09160 53610 52882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 53779 54942 gene locus_tag LOCUS_09170 53779 54942 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021207.1 protein_id gnl|my_center|LOCUS_09170 54982 56910 gene locus_tag LOCUS_09180 gene asnB 54982 56910 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119978.1 protein_id gnl|my_center|LOCUS_09180 56910 58793 gene locus_tag LOCUS_09190 56910 58793 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965497.1 protein_id gnl|my_center|LOCUS_09190 58796 59026 gene locus_tag LOCUS_09200 58796 59026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 59046 59786 gene locus_tag LOCUS_09210 59046 59786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 59802 60728 gene locus_tag LOCUS_09220 59802 60728 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390629.1 protein_id gnl|my_center|LOCUS_09220 60764 61360 gene locus_tag LOCUS_09230 60764 61360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence013 183 1322 gene locus_tag LOCUS_09240 183 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 1325 1987 gene locus_tag LOCUS_09250 gene narL 1325 1987 CDS product two-component system response regulator NarL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705094.1 protein_id gnl|my_center|LOCUS_09250 2011 2508 gene locus_tag LOCUS_09260 2011 2508 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_09260 2868 2524 gene locus_tag LOCUS_09270 2868 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 2962 3441 gene locus_tag LOCUS_09280 2962 3441 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212871.1 protein_id gnl|my_center|LOCUS_09280 3511 4863 gene locus_tag LOCUS_09290 3511 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4850 6502 gene locus_tag LOCUS_09300 4850 6502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 6828 8093 gene locus_tag LOCUS_09310 6828 8093 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_09310 8170 8823 gene locus_tag LOCUS_09320 gene adk 8170 8823 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_09320 8903 10927 gene locus_tag LOCUS_09330 8903 10927 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038412.1 protein_id gnl|my_center|LOCUS_09330 12667 11033 gene locus_tag LOCUS_09340 12667 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 13525 12716 gene locus_tag LOCUS_09350 13525 12716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 14109 13537 gene locus_tag LOCUS_09360 14109 13537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 14562 14116 gene locus_tag LOCUS_09370 14562 14116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 15035 14565 gene locus_tag LOCUS_09380 15035 14565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 15476 15039 gene locus_tag LOCUS_09390 15476 15039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 16057 16194 gene locus_tag LOCUS_09400 16057 16194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 16534 17727 gene locus_tag LOCUS_09410 gene sat 16534 17727 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_09410 17830 18351 gene locus_tag LOCUS_09420 17830 18351 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267613.1 protein_id gnl|my_center|LOCUS_09420 19138 18395 gene locus_tag LOCUS_09430 19138 18395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 19686 19138 gene locus_tag LOCUS_09440 19686 19138 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_09440 19861 20397 gene locus_tag LOCUS_09450 19861 20397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 20507 20995 gene locus_tag LOCUS_09460 20507 20995 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930675.1 protein_id gnl|my_center|LOCUS_09460 21045 21491 gene locus_tag LOCUS_09470 21045 21491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_09470 21534 22892 gene locus_tag LOCUS_09480 21534 22892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 23744 22893 gene locus_tag LOCUS_09490 23744 22893 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266954.1 protein_id gnl|my_center|LOCUS_09490 25668 23827 gene locus_tag LOCUS_09500 25668 23827 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_09500 26289 25819 gene locus_tag LOCUS_09510 26289 25819 CDS product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_09510 27657 26428 gene locus_tag LOCUS_09520 27657 26428 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114306.1 protein_id gnl|my_center|LOCUS_09520 28172 27654 gene locus_tag LOCUS_09530 gene moaB 28172 27654 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482393.1 protein_id gnl|my_center|LOCUS_09530 28312 28947 gene locus_tag LOCUS_09540 gene napC 28312 28947 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 protein_id gnl|my_center|LOCUS_09540 29079 29717 gene locus_tag LOCUS_09550 29079 29717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 29740 32457 gene locus_tag LOCUS_09560 29740 32457 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461557.1 protein_id gnl|my_center|LOCUS_09560 32533 33117 gene locus_tag LOCUS_09570 32533 33117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 33114 34133 gene locus_tag LOCUS_09580 33114 34133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 34133 34741 gene locus_tag LOCUS_09590 34133 34741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09590 34766 35368 gene locus_tag LOCUS_09600 34766 35368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 35365 36897 gene locus_tag LOCUS_09610 35365 36897 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214612.1 protein_id gnl|my_center|LOCUS_09610 36910 37524 gene locus_tag LOCUS_09620 36910 37524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 37546 38559 gene locus_tag LOCUS_09630 gene moaA 37546 38559 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_09630 39031 38564 gene locus_tag LOCUS_09640 39031 38564 CDS product hemerythrin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930654.1 protein_id gnl|my_center|LOCUS_09640 39478 39125 gene locus_tag LOCUS_09650 39478 39125 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_09650 41375 39483 gene locus_tag LOCUS_09660 41375 39483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 43599 41395 gene locus_tag LOCUS_09670 43599 41395 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 protein_id gnl|my_center|LOCUS_09670 44037 43696 gene locus_tag LOCUS_09680 gene nirD 44037 43696 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061457.1 protein_id gnl|my_center|LOCUS_09680 46478 44046 gene locus_tag LOCUS_09690 gene nirB 46478 44046 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_09690 46793 48277 gene locus_tag LOCUS_09700 46793 48277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 48370 50082 gene locus_tag LOCUS_09710 48370 50082 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_09710 50066 50680 gene locus_tag LOCUS_09720 gene mobA 50066 50680 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074308.1 protein_id gnl|my_center|LOCUS_09720 52391 51195 gene locus_tag LOCUS_09730 52391 51195 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_09730 53163 52483 gene locus_tag LOCUS_09740 53163 52483 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704726.1 protein_id gnl|my_center|LOCUS_09740 54857 53427 gene locus_tag LOCUS_09750 gene cysG 54857 53427 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_09750 55170 54904 gene locus_tag LOCUS_09760 gene grxC 55170 54904 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929908.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence014 1507 38 gene locus_tag LOCUS_09770 gene glcD 1507 38 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_09770 2409 1510 gene locus_tag LOCUS_09780 2409 1510 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015065041.1 protein_id gnl|my_center|LOCUS_09780 2293 2517 gene locus_tag LOCUS_09790 2293 2517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 2652 3905 gene locus_tag LOCUS_09800 2652 3905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 3939 4565 gene locus_tag LOCUS_09810 3939 4565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 4643 5434 gene locus_tag LOCUS_09820 gene mazG 4643 5434 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038006.1 protein_id gnl|my_center|LOCUS_09820 6086 5454 gene locus_tag LOCUS_09830 6086 5454 CDS product DsbA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015217.1 protein_id gnl|my_center|LOCUS_09830 6133 6951 gene locus_tag LOCUS_09840 6133 6951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 7828 6971 gene locus_tag LOCUS_09850 7828 6971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 8855 8052 gene locus_tag LOCUS_09860 8855 8052 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_09860 9645 8863 gene locus_tag LOCUS_09870 9645 8863 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_09870 9730 10620 gene locus_tag LOCUS_09880 9730 10620 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245029.1 protein_id gnl|my_center|LOCUS_09880 11446 10610 gene locus_tag LOCUS_09890 11446 10610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 12973 11522 gene locus_tag LOCUS_09900 12973 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 13785 12970 gene locus_tag LOCUS_09910 13785 12970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 13990 15753 gene locus_tag LOCUS_09920 13990 15753 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_09920 15750 16271 gene locus_tag LOCUS_09930 15750 16271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 16418 17446 gene locus_tag LOCUS_09940 16418 17446 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_09940 17588 17962 gene locus_tag LOCUS_09950 gene trxA 17588 17962 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027416.1 protein_id gnl|my_center|LOCUS_09950 18254 18961 gene locus_tag LOCUS_09960 18254 18961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 19254 19895 gene locus_tag LOCUS_09970 19254 19895 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259574.1 protein_id gnl|my_center|LOCUS_09970 19898 20587 gene locus_tag LOCUS_09980 19898 20587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 20608 21876 gene locus_tag LOCUS_09990 20608 21876 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036840.1 protein_id gnl|my_center|LOCUS_09990 22142 22327 gene locus_tag LOCUS_10000 22142 22327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 22314 23324 gene locus_tag LOCUS_10010 22314 23324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 24665 23403 gene locus_tag LOCUS_10020 24665 23403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 24992 26794 gene locus_tag LOCUS_10030 gene mrdA 24992 26794 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_10030 26794 27924 gene locus_tag LOCUS_10040 gene mrdB 26794 27924 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_10040 27939 28919 gene locus_tag LOCUS_10050 gene mltB 27939 28919 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399773.1 protein_id gnl|my_center|LOCUS_10050 28919 29731 gene locus_tag LOCUS_10060 28919 29731 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261453.1 protein_id gnl|my_center|LOCUS_10060 29706 30866 gene locus_tag LOCUS_10070 29706 30866 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_10070 30869 31735 gene locus_tag LOCUS_10080 30869 31735 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947239.1 protein_id gnl|my_center|LOCUS_10080 31728 32030 gene locus_tag LOCUS_10090 31728 32030 CDS product YbeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002237935.1 protein_id gnl|my_center|LOCUS_10090 32035 32634 gene locus_tag LOCUS_10100 gene lipB 32035 32634 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313884.1 protein_id gnl|my_center|LOCUS_10100 32640 33611 gene locus_tag LOCUS_10110 gene lipA 32640 33611 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_10110 33608 33982 gene locus_tag LOCUS_10120 33608 33982 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087752.1 protein_id gnl|my_center|LOCUS_10120 34775 34224 gene locus_tag LOCUS_10130 34775 34224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 35041 34787 gene locus_tag LOCUS_10140 35041 34787 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976577.1 protein_id gnl|my_center|LOCUS_10140 35291 35031 gene locus_tag LOCUS_10150 gene yefM 35291 35031 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259253.1 protein_id gnl|my_center|LOCUS_10150 35689 35336 gene locus_tag LOCUS_10160 35689 35336 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_10160 35792 36004 gene locus_tag LOCUS_10170 35792 36004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 35994 36380 gene locus_tag LOCUS_10180 35994 36380 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921192.1 protein_id gnl|my_center|LOCUS_10180 37699 36461 gene locus_tag LOCUS_10190 gene dinB 37699 36461 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940720.1 protein_id gnl|my_center|LOCUS_10190 37908 37729 gene locus_tag LOCUS_10200 37908 37729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 38488 37886 gene locus_tag LOCUS_10210 gene lexA 38488 37886 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087594.1 protein_id gnl|my_center|LOCUS_10210 39001 38585 gene locus_tag LOCUS_10220 39001 38585 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958049.1 protein_id gnl|my_center|LOCUS_10220 39995 39060 gene locus_tag LOCUS_10230 gene znuA 39995 39060 CDS product zinc ABC transporter substrate-binding protein ZnuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707443.1 protein_id gnl|my_center|LOCUS_10230 39994 40509 gene locus_tag LOCUS_10240 gene zur 39994 40509 CDS product zinc uptake transcriptional repressor Zur inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096992.1 protein_id gnl|my_center|LOCUS_10240 40502 41278 gene locus_tag LOCUS_10250 gene znuC 40502 41278 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266293.1 protein_id gnl|my_center|LOCUS_10250 41271 42083 gene locus_tag LOCUS_10260 gene znuB 41271 42083 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971686.1 protein_id gnl|my_center|LOCUS_10260 43385 42090 gene locus_tag LOCUS_10270 43385 42090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 44136 43519 gene locus_tag LOCUS_10280 44136 43519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 44729 44157 gene locus_tag LOCUS_10290 44729 44157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 45312 44782 gene locus_tag LOCUS_10300 45312 44782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 46174 45338 gene locus_tag LOCUS_10310 46174 45338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 47156 46392 gene locus_tag LOCUS_10320 gene olsA 47156 46392 CDS product lyso-ornithine lipid O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112769.1 protein_id gnl|my_center|LOCUS_10320 47989 47156 gene locus_tag LOCUS_10330 gene nadC 47989 47156 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070778.1 protein_id gnl|my_center|LOCUS_10330 49356 47995 gene locus_tag LOCUS_10340 gene argA 49356 47995 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192168.1 protein_id gnl|my_center|LOCUS_10340 49443 51116 gene locus_tag LOCUS_10350 gene ilvD 49443 51116 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056900.1 protein_id gnl|my_center|LOCUS_10350 51248 51817 gene locus_tag LOCUS_10360 51248 51817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 51970 52542 gene locus_tag LOCUS_10370 51970 52542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 53734 52580 gene locus_tag LOCUS_10380 gene argE 53734 52580 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763453.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence015 255 1184 gene locus_tag LOCUS_10390 gene hemC 255 1184 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260939.1 protein_id gnl|my_center|LOCUS_10390 1478 1568 gene locus_tag LOCUS_t00060 1478 1568 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1757 1900 gene locus_tag LOCUS_10400 1757 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1961 2233 gene locus_tag LOCUS_10410 1961 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2382 2807 gene locus_tag LOCUS_10420 2382 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 3094 4557 gene locus_tag LOCUS_10430 3094 4557 CDS product DUF3375 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039229.1 protein_id gnl|my_center|LOCUS_10430 4541 5218 gene locus_tag LOCUS_10440 4541 5218 CDS product DUF4194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039228.1 protein_id gnl|my_center|LOCUS_10440 5215 8589 gene locus_tag LOCUS_10450 5215 8589 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039227.1 protein_id gnl|my_center|LOCUS_10450 8576 9769 gene locus_tag LOCUS_10460 8576 9769 CDS product DUF3322 and DUF2220 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727563.1 protein_id gnl|my_center|LOCUS_10460 9796 11070 gene locus_tag LOCUS_10470 gene bioA 9796 11070 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001303857.1 protein_id gnl|my_center|LOCUS_10470 11205 12575 gene locus_tag LOCUS_10480 gene mltF 11205 12575 CDS product membrane-bound lytic murein transglycosylase MltF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080546580.1 protein_id gnl|my_center|LOCUS_10480 13775 12927 gene locus_tag LOCUS_10490 13775 12927 CDS product protein-glutamate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420407.1 protein_id gnl|my_center|LOCUS_10490 14598 13882 gene locus_tag LOCUS_10500 gene recO 14598 13882 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772032.1 protein_id gnl|my_center|LOCUS_10500 15862 14966 gene locus_tag LOCUS_10510 gene era 15862 14966 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104911.1 protein_id gnl|my_center|LOCUS_10510 16556 15855 gene locus_tag LOCUS_10520 gene rnc 16556 15855 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001882136.1 protein_id gnl|my_center|LOCUS_10520 16959 16573 gene locus_tag LOCUS_10530 16959 16573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 17806 17006 gene locus_tag LOCUS_10540 gene lepB 17806 17006 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772035.1 protein_id gnl|my_center|LOCUS_10540 19634 17844 gene locus_tag LOCUS_10550 gene lepA 19634 17844 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 protein_id gnl|my_center|LOCUS_10550 19873 19631 gene locus_tag LOCUS_10560 19873 19631 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191739.1 protein_id gnl|my_center|LOCUS_10560 20472 20005 gene locus_tag LOCUS_10570 20472 20005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 21491 20475 gene locus_tag LOCUS_10580 21491 20475 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192760.1 protein_id gnl|my_center|LOCUS_10580 22119 21526 gene locus_tag LOCUS_10590 22119 21526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 22755 22147 gene locus_tag LOCUS_10600 gene rpoE 22755 22147 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_10600 22995 24635 gene locus_tag LOCUS_10610 gene nadB 22995 24635 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405338.1 protein_id gnl|my_center|LOCUS_10610 24636 25448 gene locus_tag LOCUS_10620 gene rhdA 24636 25448 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_10620 26435 25887 gene locus_tag LOCUS_10630 gene orn 26435 25887 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456987.1 protein_id gnl|my_center|LOCUS_10630 26540 27784 gene locus_tag LOCUS_10640 26540 27784 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039491.1 protein_id gnl|my_center|LOCUS_10640 27794 28078 gene locus_tag LOCUS_10650 27794 28078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 28080 28409 gene locus_tag LOCUS_10660 28080 28409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 28413 29372 gene locus_tag LOCUS_10670 gene rsgA 28413 29372 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039215125.1 protein_id gnl|my_center|LOCUS_10670 29861 29409 gene locus_tag LOCUS_10680 gene tadA 29861 29409 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370298.1 protein_id gnl|my_center|LOCUS_10680 30010 30429 gene locus_tag LOCUS_10690 30010 30429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 31502 30474 gene locus_tag LOCUS_10700 31502 30474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 32007 31489 gene locus_tag LOCUS_10710 32007 31489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 32374 32024 gene locus_tag LOCUS_10720 32374 32024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 34530 32644 gene locus_tag LOCUS_10730 gene aprA 34530 32644 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_10730 35012 34530 gene locus_tag LOCUS_10740 gene aprB 35012 34530 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_10740 35858 35037 gene locus_tag LOCUS_10750 35858 35037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 36327 36746 gene locus_tag LOCUS_10760 36327 36746 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_10760 36833 38116 gene locus_tag LOCUS_10770 gene egtB 36833 38116 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812990.1 protein_id gnl|my_center|LOCUS_10770 38113 39093 gene locus_tag LOCUS_10780 gene egtD 38113 39093 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967207.1 protein_id gnl|my_center|LOCUS_10780 39386 40657 gene locus_tag LOCUS_10790 39386 40657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926084.1 protein_id gnl|my_center|LOCUS_10790 41465 40860 gene locus_tag LOCUS_10800 41465 40860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 42027 41491 gene locus_tag LOCUS_10810 42027 41491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 46100 42228 gene locus_tag LOCUS_10820 46100 42228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 46439 47128 gene locus_tag LOCUS_10830 46439 47128 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_10830 47148 49040 gene locus_tag LOCUS_10840 47148 49040 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811551.1 protein_id gnl|my_center|LOCUS_10840 49122 52103 gene locus_tag LOCUS_10850 49122 52103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence016 <1 669 gene locus_tag LOCUS_10860 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003085971.1:aspartate kinase 847 1035 gene locus_tag LOCUS_10870 gene csrA 847 1035 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906485.1 protein_id gnl|my_center|LOCUS_10870 1194 1286 gene locus_tag LOCUS_t00070 1194 1286 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1714 1790 gene locus_tag LOCUS_t00080 1714 1790 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2589 4004 gene locus_tag LOCUS_10880 2589 4004 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035868.1 protein_id gnl|my_center|LOCUS_10880 4001 4918 gene locus_tag LOCUS_10890 4001 4918 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024341.1 protein_id gnl|my_center|LOCUS_10890 4927 6234 gene locus_tag LOCUS_10900 gene wbpA 4927 6234 CDS product UDP-N-acetyl-D-glucosamine 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113429.1 protein_id gnl|my_center|LOCUS_10900 6519 7823 gene locus_tag LOCUS_10910 6519 7823 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389965.1 protein_id gnl|my_center|LOCUS_10910 7977 8984 gene locus_tag LOCUS_10920 7977 8984 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_10920 9055 10143 gene locus_tag LOCUS_10930 gene gmd 9055 10143 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_10930 10300 11241 gene locus_tag LOCUS_10940 10300 11241 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_10940 11296 12069 gene locus_tag LOCUS_10950 11296 12069 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288211.1 protein_id gnl|my_center|LOCUS_10950 13246 13470 gene locus_tag LOCUS_10960 13246 13470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 13608 15845 gene locus_tag LOCUS_10970 13608 15845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 15858 16700 gene locus_tag LOCUS_10980 15858 16700 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254254.1 protein_id gnl|my_center|LOCUS_10980 16908 16738 gene locus_tag LOCUS_10990 16908 16738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 16994 18169 gene locus_tag LOCUS_11000 16994 18169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 18457 19494 gene locus_tag LOCUS_11010 18457 19494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 19525 20682 gene locus_tag LOCUS_11020 19525 20682 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027080.1 protein_id gnl|my_center|LOCUS_11020 20803 21243 gene locus_tag LOCUS_11030 20803 21243 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022159.1 protein_id gnl|my_center|LOCUS_11030 22551 21307 gene locus_tag LOCUS_11040 22551 21307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 23495 24361 gene locus_tag LOCUS_11050 23495 24361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 24381 26024 gene locus_tag LOCUS_11060 24381 26024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 26369 26791 gene locus_tag LOCUS_11070 26369 26791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 27052 28032 gene locus_tag LOCUS_11080 27052 28032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 28090 29823 gene locus_tag LOCUS_11090 28090 29823 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942628.1 protein_id gnl|my_center|LOCUS_11090 29839 30612 gene locus_tag LOCUS_11100 29839 30612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 30626 32341 gene locus_tag LOCUS_11110 30626 32341 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_11110 32432 34801 gene locus_tag LOCUS_11120 32432 34801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 34862 36904 gene locus_tag LOCUS_11130 gene prsK 34862 36904 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_11130 36963 38318 gene locus_tag LOCUS_11140 gene prsR 36963 38318 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_11140 38330 38965 gene locus_tag LOCUS_11150 38330 38965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 39251 39841 gene locus_tag LOCUS_11160 39251 39841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 40287 39850 gene locus_tag LOCUS_11170 40287 39850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 42292 40385 gene locus_tag LOCUS_11180 42292 40385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 43700 42339 gene locus_tag LOCUS_11190 43700 42339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 44526 45344 gene locus_tag LOCUS_11200 44526 45344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 45569 48184 gene locus_tag LOCUS_11210 45569 48184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 48212 50029 gene locus_tag LOCUS_11220 48212 50029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192726.1 protein_id gnl|my_center|LOCUS_11220 50710 50081 gene locus_tag LOCUS_11230 50710 50081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence017 484 2532 gene locus_tag LOCUS_11240 484 2532 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968448.1 protein_id gnl|my_center|LOCUS_11240 2732 3247 gene locus_tag LOCUS_11250 2732 3247 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_11250 3398 4369 gene locus_tag LOCUS_11260 3398 4369 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_11260 4386 5357 gene locus_tag LOCUS_11270 4386 5357 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_11270 5438 5962 gene locus_tag LOCUS_11280 5438 5962 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815172.1 protein_id gnl|my_center|LOCUS_11280 5967 6515 gene locus_tag LOCUS_11290 5967 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 6505 7023 gene locus_tag LOCUS_11300 6505 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 7020 7745 gene locus_tag LOCUS_11310 gene lptB 7020 7745 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073698.1 protein_id gnl|my_center|LOCUS_11310 7915 9330 gene locus_tag LOCUS_11320 7915 9330 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377556.1 protein_id gnl|my_center|LOCUS_11320 9363 9683 gene locus_tag LOCUS_11330 gene hpf 9363 9683 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_11330 9683 10153 gene locus_tag LOCUS_11340 gene ptsN 9683 10153 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_11340 10150 11091 gene locus_tag LOCUS_11350 gene hprK 10150 11091 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 protein_id gnl|my_center|LOCUS_11350 11119 11979 gene locus_tag LOCUS_11360 gene rapZ 11119 11979 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_11360 11985 12353 gene locus_tag LOCUS_11370 11985 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_11370 12346 12642 gene locus_tag LOCUS_11380 12346 12642 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_11380 12647 14377 gene locus_tag LOCUS_11390 gene ptsP 12647 14377 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_11390 16422 14692 gene locus_tag LOCUS_11400 16422 14692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 17278 16511 gene locus_tag LOCUS_11410 17278 16511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 19267 18017 gene locus_tag LOCUS_11420 19267 18017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 20698 19421 gene locus_tag LOCUS_11430 20698 19421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 21961 20711 gene locus_tag LOCUS_11440 21961 20711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 27481 22004 gene locus_tag LOCUS_11450 27481 22004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 28473 28745 gene locus_tag LOCUS_11460 28473 28745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 28841 29611 gene locus_tag LOCUS_11470 28841 29611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 29816 30433 gene locus_tag LOCUS_11480 29816 30433 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942047.1 protein_id gnl|my_center|LOCUS_11480 30405 32075 gene locus_tag LOCUS_11490 30405 32075 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942046.1 protein_id gnl|my_center|LOCUS_11490 32499 32095 gene locus_tag LOCUS_11500 32499 32095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 33715 32555 gene locus_tag LOCUS_11510 33715 32555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 34027 35385 gene locus_tag LOCUS_11520 gene mgtE 34027 35385 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840452.1 protein_id gnl|my_center|LOCUS_11520 37550 35556 gene locus_tag LOCUS_11530 37550 35556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 38851 37550 gene locus_tag LOCUS_11540 38851 37550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 39261 40088 gene locus_tag LOCUS_11550 39261 40088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 40106 41674 gene locus_tag LOCUS_11560 40106 41674 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_11560 41971 41813 gene locus_tag LOCUS_11570 41971 41813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 43186 45213 gene locus_tag LOCUS_11580 43186 45213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 46449 45241 gene locus_tag LOCUS_11590 46449 45241 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_11590 46738 49398 gene locus_tag LOCUS_11600 gene aceE 46738 49398 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence018 <1 1480 gene locus_tag LOCUS_11610 <1 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038837.1:DNA topoisomerase I 1493 2050 gene locus_tag LOCUS_11620 1493 2050 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461456.1 protein_id gnl|my_center|LOCUS_11620 2047 2967 gene locus_tag LOCUS_11630 gene hemF 2047 2967 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801336.1 protein_id gnl|my_center|LOCUS_11630 3731 3042 gene locus_tag LOCUS_11640 3731 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 5705 3786 gene locus_tag LOCUS_11650 5705 3786 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198677105.1 protein_id gnl|my_center|LOCUS_11650 6314 5718 gene locus_tag LOCUS_11660 6314 5718 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477566.1 protein_id gnl|my_center|LOCUS_11660 6437 7345 gene locus_tag LOCUS_11670 6437 7345 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072167.1 protein_id gnl|my_center|LOCUS_11670 7436 8680 gene locus_tag LOCUS_11680 7436 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 9522 8689 gene locus_tag LOCUS_11690 gene aroE 9522 8689 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111201.1 protein_id gnl|my_center|LOCUS_11690 10458 9529 gene locus_tag LOCUS_11700 gene hemB 10458 9529 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073891.1 protein_id gnl|my_center|LOCUS_11700 10640 11143 gene locus_tag LOCUS_11710 10640 11143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 11221 11502 gene locus_tag LOCUS_11720 11221 11502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091625.1 protein_id gnl|my_center|LOCUS_11720 11722 14334 gene locus_tag LOCUS_11730 11722 14334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 14883 14356 gene locus_tag LOCUS_11740 14883 14356 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401536.1 protein_id gnl|my_center|LOCUS_11740 14946 15896 gene locus_tag LOCUS_11750 gene ubiA 14946 15896 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104612.1 protein_id gnl|my_center|LOCUS_11750 16532 15897 gene locus_tag LOCUS_11760 16532 15897 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_11760 16840 16610 gene locus_tag LOCUS_11770 16840 16610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 16914 17885 gene locus_tag LOCUS_11780 gene bioB 16914 17885 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_11780 18021 19172 gene locus_tag LOCUS_11790 gene bioF 18021 19172 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269172.1 protein_id gnl|my_center|LOCUS_11790 19585 20814 gene locus_tag LOCUS_11800 19585 20814 CDS product spore maturation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929184.1 protein_id gnl|my_center|LOCUS_11800 22100 20820 gene locus_tag LOCUS_11810 22100 20820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 22894 22133 gene locus_tag LOCUS_11820 22894 22133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 23017 23298 gene locus_tag LOCUS_11830 23017 23298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 23380 24858 gene locus_tag LOCUS_11840 23380 24858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 25849 25097 gene locus_tag LOCUS_11850 25849 25097 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004114245.1 protein_id gnl|my_center|LOCUS_11850 26955 26083 gene locus_tag LOCUS_11860 gene sucD 26955 26083 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946282.1 protein_id gnl|my_center|LOCUS_11860 28118 26952 gene locus_tag LOCUS_11870 gene sucC 28118 26952 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444794.1 protein_id gnl|my_center|LOCUS_11870 29570 28128 gene locus_tag LOCUS_11880 gene lpdA 29570 28128 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_11880 30895 29600 gene locus_tag LOCUS_11890 gene odhB 30895 29600 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946280.1 protein_id gnl|my_center|LOCUS_11890 33726 30904 gene locus_tag LOCUS_11900 33726 30904 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087413.1 protein_id gnl|my_center|LOCUS_11900 33833 34288 gene locus_tag LOCUS_11910 33833 34288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 34625 34209 gene locus_tag LOCUS_11920 34625 34209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 35735 34725 gene locus_tag LOCUS_11930 35735 34725 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941474.1 protein_id gnl|my_center|LOCUS_11930 35874 36605 gene locus_tag LOCUS_11940 35874 36605 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403266.1 protein_id gnl|my_center|LOCUS_11940 36897 37211 gene locus_tag LOCUS_11950 36897 37211 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817039.1 protein_id gnl|my_center|LOCUS_11950 37233 38366 gene locus_tag LOCUS_11960 37233 38366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 38369 38659 gene locus_tag LOCUS_11970 38369 38659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 38670 39335 gene locus_tag LOCUS_11980 38670 39335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 39371 39589 gene locus_tag LOCUS_11990 39371 39589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 39698 40276 gene locus_tag LOCUS_12000 39698 40276 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_12000 40857 40447 gene locus_tag LOCUS_12010 40857 40447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 42997 41066 gene locus_tag LOCUS_12020 42997 41066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 45208 43115 gene locus_tag LOCUS_12030 gene recG 45208 43115 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 protein_id gnl|my_center|LOCUS_12030 45213 45485 gene locus_tag LOCUS_12040 45213 45485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 45784 45401 gene locus_tag LOCUS_12050 45784 45401 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070722.1 protein_id gnl|my_center|LOCUS_12050 48017 45828 gene locus_tag LOCUS_12060 gene spoT 48017 45828 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404001.1 protein_id gnl|my_center|LOCUS_12060 48277 48020 gene locus_tag LOCUS_12070 gene rpoZ 48277 48020 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096602.1 protein_id gnl|my_center|LOCUS_12070 48973 48353 gene locus_tag LOCUS_12080 gene gmk 48973 48353 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_12080 49260 49184 gene locus_tag LOCUS_t00090 49260 49184 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 203 739 gene locus_tag LOCUS_12090 gene infC 203 739 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026080374.1 protein_id gnl|my_center|LOCUS_12090 837 1034 gene locus_tag LOCUS_12100 gene rpmI 837 1034 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429729.1 protein_id gnl|my_center|LOCUS_12100 1050 1409 gene locus_tag LOCUS_12110 gene rplT 1050 1409 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138366.1 protein_id gnl|my_center|LOCUS_12110 1522 2538 gene locus_tag LOCUS_12120 gene pheS 1522 2538 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_12120 2674 5058 gene locus_tag LOCUS_12130 gene pheT 2674 5058 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114408.1 protein_id gnl|my_center|LOCUS_12130 5061 5363 gene locus_tag LOCUS_12140 gene ihfA 5061 5363 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_12140 5341 5697 gene locus_tag LOCUS_12150 5341 5697 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_12150 5773 5849 gene locus_tag LOCUS_t00100 5773 5849 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6343 6492 gene locus_tag LOCUS_12160 6343 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 6482 6889 gene locus_tag LOCUS_12170 6482 6889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 6979 9612 gene locus_tag LOCUS_12180 gene pepN 6979 9612 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267176.1 protein_id gnl|my_center|LOCUS_12180 9784 11517 gene locus_tag LOCUS_12190 9784 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 12762 11734 gene locus_tag LOCUS_12200 12762 11734 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837707.1 protein_id gnl|my_center|LOCUS_12200 12865 13557 gene locus_tag LOCUS_12210 12865 13557 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262216.1 protein_id gnl|my_center|LOCUS_12210 13679 14482 gene locus_tag LOCUS_12220 13679 14482 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687170.1 protein_id gnl|my_center|LOCUS_12220 14879 16522 gene locus_tag LOCUS_12230 14879 16522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 16535 18070 gene locus_tag LOCUS_12240 16535 18070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 19683 18451 gene locus_tag LOCUS_12250 19683 18451 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_12250 19919 19686 gene locus_tag LOCUS_12260 19919 19686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 20631 19990 gene locus_tag LOCUS_12270 20631 19990 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142016.1 protein_id gnl|my_center|LOCUS_12270 20707 21408 gene locus_tag LOCUS_12280 20707 21408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 21411 22103 gene locus_tag LOCUS_12290 21411 22103 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266245.1 protein_id gnl|my_center|LOCUS_12290 22175 23251 gene locus_tag LOCUS_12300 gene aroG 22175 23251 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109183.1 protein_id gnl|my_center|LOCUS_12300 24292 23261 gene locus_tag LOCUS_12310 24292 23261 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_12310 25096 24302 gene locus_tag LOCUS_12320 25096 24302 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098644.1 protein_id gnl|my_center|LOCUS_12320 26231 25083 gene locus_tag LOCUS_12330 gene ispG 26231 25083 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527159.1 protein_id gnl|my_center|LOCUS_12330 26450 27574 gene locus_tag LOCUS_12340 26450 27574 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072974.1 protein_id gnl|my_center|LOCUS_12340 27637 28947 gene locus_tag LOCUS_12350 27637 28947 CDS product M18 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114800.1 protein_id gnl|my_center|LOCUS_12350 29085 29558 gene locus_tag LOCUS_12360 29085 29558 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974302.1 protein_id gnl|my_center|LOCUS_12360 29772 31004 gene locus_tag LOCUS_12370 gene alaA 29772 31004 CDS product alanine transaminase AlaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365583.1 protein_id gnl|my_center|LOCUS_12370 31004 31693 gene locus_tag LOCUS_12380 31004 31693 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215609.1 protein_id gnl|my_center|LOCUS_12380 33219 32566 gene locus_tag LOCUS_12390 33219 32566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 33706 33308 gene locus_tag LOCUS_12400 33706 33308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 34676 34011 gene locus_tag LOCUS_12410 34676 34011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 35157 34762 gene locus_tag LOCUS_12420 35157 34762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 36277 35402 gene locus_tag LOCUS_12430 36277 35402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 36789 36424 gene locus_tag LOCUS_12440 36789 36424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 38392 36947 gene locus_tag LOCUS_12450 gene sbcB 38392 36947 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_12450 39769 38678 gene locus_tag LOCUS_12460 gene rlmM 39769 38678 CDS product 23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212119.1 protein_id gnl|my_center|LOCUS_12460 39835 40071 gene locus_tag LOCUS_12470 gene ibaG 39835 40071 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210126.1 protein_id gnl|my_center|LOCUS_12470 41279 40473 gene locus_tag LOCUS_12480 41279 40473 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947474.1 protein_id gnl|my_center|LOCUS_12480 41354 42115 gene locus_tag LOCUS_12490 gene trmJ 41354 42115 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771034.1 protein_id gnl|my_center|LOCUS_12490 42523 42119 gene locus_tag LOCUS_12500 42523 42119 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721784.1 protein_id gnl|my_center|LOCUS_12500 42581 43063 gene locus_tag LOCUS_12510 42581 43063 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038715.1 protein_id gnl|my_center|LOCUS_12510 43835 43053 gene locus_tag LOCUS_12520 43835 43053 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908213.1 protein_id gnl|my_center|LOCUS_12520 44148 44972 gene locus_tag LOCUS_12530 44148 44972 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035554.1 protein_id gnl|my_center|LOCUS_12530 45096 45794 gene locus_tag LOCUS_12540 45096 45794 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_12540 45791 46624 gene locus_tag LOCUS_12550 45791 46624 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_12550 46667 47017 gene locus_tag LOCUS_12560 46667 47017 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_12560 47014 47424 gene locus_tag LOCUS_12570 47014 47424 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_12570 48246 47443 gene locus_tag LOCUS_12580 gene folD 48246 47443 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705731.1 protein_id gnl|my_center|LOCUS_12580 48925 49001 gene locus_tag LOCUS_t00110 48925 49001 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence020 314 442 gene locus_tag LOCUS_12590 314 442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 646 1209 gene locus_tag LOCUS_12600 646 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2359 1670 gene locus_tag LOCUS_12610 2359 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 5774 2382 gene locus_tag LOCUS_12620 gene mfd 5774 2382 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024299434.1 protein_id gnl|my_center|LOCUS_12620 5914 6375 gene locus_tag LOCUS_12630 5914 6375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 6372 7373 gene locus_tag LOCUS_12640 6372 7373 CDS product PHB depolymerase family esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101591.1 protein_id gnl|my_center|LOCUS_12640 7531 8994 gene locus_tag LOCUS_12650 7531 8994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 10422 9094 gene locus_tag LOCUS_12660 gene rhlE 10422 9094 CDS product ATP-dependent RNA helicase RhlE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168103.1 protein_id gnl|my_center|LOCUS_12660 11975 10641 gene locus_tag LOCUS_12670 11975 10641 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_12670 13546 12239 gene locus_tag LOCUS_12680 13546 12239 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533388.1 protein_id gnl|my_center|LOCUS_12680 13865 13533 gene locus_tag LOCUS_12690 13865 13533 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389002.1 protein_id gnl|my_center|LOCUS_12690 14023 14823 gene locus_tag LOCUS_12700 14023 14823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 15774 14950 gene locus_tag LOCUS_12710 15774 14950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003392149.1 protein_id gnl|my_center|LOCUS_12710 16667 15981 gene locus_tag LOCUS_12720 16667 15981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 16823 18955 gene locus_tag LOCUS_12730 16823 18955 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073633.1 protein_id gnl|my_center|LOCUS_12730 18949 20421 gene locus_tag LOCUS_12740 18949 20421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 20428 21441 gene locus_tag LOCUS_12750 20428 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 21443 21967 gene locus_tag LOCUS_12760 21443 21967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 22024 22611 gene locus_tag LOCUS_12770 22024 22611 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931044.1 protein_id gnl|my_center|LOCUS_12770 22618 23037 gene locus_tag LOCUS_12780 gene arfB 22618 23037 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463517.1 protein_id gnl|my_center|LOCUS_12780 23223 23672 gene locus_tag LOCUS_12790 gene iscR 23223 23672 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222202.1 protein_id gnl|my_center|LOCUS_12790 23677 24825 gene locus_tag LOCUS_12800 gene nifS 23677 24825 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460327.1 protein_id gnl|my_center|LOCUS_12800 24837 26072 gene locus_tag LOCUS_12810 24837 26072 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_12810 26214 26597 gene locus_tag LOCUS_12820 gene iscU 26214 26597 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 protein_id gnl|my_center|LOCUS_12820 26649 26972 gene locus_tag LOCUS_12830 gene iscA 26649 26972 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000301571.1 protein_id gnl|my_center|LOCUS_12830 27012 27557 gene locus_tag LOCUS_12840 gene hscB 27012 27557 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 protein_id gnl|my_center|LOCUS_12840 27568 29460 gene locus_tag LOCUS_12850 gene hscA 27568 29460 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001196560.1 protein_id gnl|my_center|LOCUS_12850 29464 29802 gene locus_tag LOCUS_12860 gene fdx 29464 29802 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_12860 29811 30011 gene locus_tag LOCUS_12870 gene iscX 29811 30011 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_12870 30143 31276 gene locus_tag LOCUS_12880 gene rlmN 30143 31276 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219171.1 protein_id gnl|my_center|LOCUS_12880 31273 32052 gene locus_tag LOCUS_12890 gene pilW 31273 32052 CDS product type IV pilus biogenesis/stability protein PilW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172603.1 protein_id gnl|my_center|LOCUS_12890 32074 33069 gene locus_tag LOCUS_12900 gene rodZ 32074 33069 CDS product cytoskeleton protein RodZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482997.1 protein_id gnl|my_center|LOCUS_12900 33114 34391 gene locus_tag LOCUS_12910 gene hisS 33114 34391 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266910.1 protein_id gnl|my_center|LOCUS_12910 34427 35059 gene locus_tag LOCUS_12920 34427 35059 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_12920 35154 36311 gene locus_tag LOCUS_12930 gene bamB 35154 36311 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_12930 36317 37732 gene locus_tag LOCUS_12940 gene der 36317 37732 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249403.1 protein_id gnl|my_center|LOCUS_12940 37857 39122 gene locus_tag LOCUS_12950 37857 39122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 39135 40073 gene locus_tag LOCUS_12960 39135 40073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 40345 42555 gene locus_tag LOCUS_12970 gene mrcB 40345 42555 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_12970 42555 43013 gene locus_tag LOCUS_12980 42555 43013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 43013 44998 gene locus_tag LOCUS_12990 43013 44998 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_12990 44979 45662 gene locus_tag LOCUS_13000 gene tsaB 44979 45662 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266959.1 protein_id gnl|my_center|LOCUS_13000 46070 46921 gene locus_tag LOCUS_13010 gene prfB 46070 46921 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13010 47103 48626 gene locus_tag LOCUS_13020 gene lysS 47103 48626 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence021 <1 1616 gene locus_tag LOCUS_13030 <1 1616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037136.1:DNA translocase FtsK 2067 1912 gene locus_tag LOCUS_13040 2067 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261681.1 protein_id gnl|my_center|LOCUS_13040 2436 2077 gene locus_tag LOCUS_13050 2436 2077 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279154.1 protein_id gnl|my_center|LOCUS_13050 2725 2438 gene locus_tag LOCUS_13060 2725 2438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2852 3922 gene locus_tag LOCUS_13070 2852 3922 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140271.1 protein_id gnl|my_center|LOCUS_13070 3897 4403 gene locus_tag LOCUS_13080 3897 4403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4396 5859 gene locus_tag LOCUS_13090 4396 5859 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_13090 5856 7073 gene locus_tag LOCUS_13100 5856 7073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 7070 8026 gene locus_tag LOCUS_13110 7070 8026 CDS product Abi family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083539905.1 protein_id gnl|my_center|LOCUS_13110 8281 10662 gene locus_tag LOCUS_13120 8281 10662 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027389.1 protein_id gnl|my_center|LOCUS_13120 10686 11102 gene locus_tag LOCUS_13130 10686 11102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 11544 12071 gene locus_tag LOCUS_13140 11544 12071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 12159 12536 gene locus_tag LOCUS_13150 12159 12536 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090036.1 protein_id gnl|my_center|LOCUS_13150 12550 13197 gene locus_tag LOCUS_13160 gene lolA 12550 13197 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185701.1 protein_id gnl|my_center|LOCUS_13160 13200 14543 gene locus_tag LOCUS_13170 13200 14543 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104507.1 protein_id gnl|my_center|LOCUS_13170 16462 14606 gene locus_tag LOCUS_13180 16462 14606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 17615 16548 gene locus_tag LOCUS_13190 17615 16548 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_13190 17794 18108 gene locus_tag LOCUS_13200 17794 18108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 19791 18127 gene locus_tag LOCUS_13210 gene ettA 19791 18127 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110721.1 protein_id gnl|my_center|LOCUS_13210 19980 21260 gene locus_tag LOCUS_13220 gene glyA 19980 21260 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 protein_id gnl|my_center|LOCUS_13220 21267 21740 gene locus_tag LOCUS_13230 gene nrdR 21267 21740 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107181.1 protein_id gnl|my_center|LOCUS_13230 21774 22844 gene locus_tag LOCUS_13240 gene ribD 21774 22844 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035932.1 protein_id gnl|my_center|LOCUS_13240 22897 23505 gene locus_tag LOCUS_13250 22897 23505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 23508 24170 gene locus_tag LOCUS_13260 23508 24170 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_13260 24208 25323 gene locus_tag LOCUS_13270 gene ribBA 24208 25323 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073314.1 protein_id gnl|my_center|LOCUS_13270 25349 25819 gene locus_tag LOCUS_13280 gene ribE 25349 25819 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119264.1 protein_id gnl|my_center|LOCUS_13280 25825 26295 gene locus_tag LOCUS_13290 gene nusB 25825 26295 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035937.1 protein_id gnl|my_center|LOCUS_13290 26319 27275 gene locus_tag LOCUS_13300 gene thiL 26319 27275 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816909.1 protein_id gnl|my_center|LOCUS_13300 27482 27964 gene locus_tag LOCUS_13310 27482 27964 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_13310 28010 28657 gene locus_tag LOCUS_13320 28010 28657 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_13320 29259 28669 gene locus_tag LOCUS_13330 29259 28669 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367195.1 protein_id gnl|my_center|LOCUS_13330 29367 29873 gene locus_tag LOCUS_13340 gene yceD 29367 29873 CDS product 23S rRNA accumulation protein YceD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004709643.1 protein_id gnl|my_center|LOCUS_13340 29948 30133 gene locus_tag LOCUS_13350 gene rpmF 29948 30133 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091143.1 protein_id gnl|my_center|LOCUS_13350 30178 31200 gene locus_tag LOCUS_13360 gene plsX 30178 31200 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_13360 31197 32165 gene locus_tag LOCUS_13370 31197 32165 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_13370 32168 32539 gene locus_tag LOCUS_13380 32168 32539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 32672 33016 gene locus_tag LOCUS_13390 32672 33016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 33206 33415 gene locus_tag LOCUS_13400 33206 33415 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_13400 35196 33520 gene locus_tag LOCUS_13410 gene recN 35196 33520 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418848.1 protein_id gnl|my_center|LOCUS_13410 36104 35217 gene locus_tag LOCUS_13420 36104 35217 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 protein_id gnl|my_center|LOCUS_13420 38760 36130 gene locus_tag LOCUS_13430 gene mutS 38760 36130 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098485.1 protein_id gnl|my_center|LOCUS_13430 39078 39563 gene locus_tag LOCUS_13440 39078 39563 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016945236.1 protein_id gnl|my_center|LOCUS_13440 39563 40090 gene locus_tag LOCUS_13450 gene thpR 39563 40090 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807724.1 protein_id gnl|my_center|LOCUS_13450 40948 40574 gene locus_tag LOCUS_13460 40948 40574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 41148 42203 gene locus_tag LOCUS_13470 gene recA 41148 42203 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_13470 42232 42726 gene locus_tag LOCUS_13480 gene recX 42232 42726 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766020.1 protein_id gnl|my_center|LOCUS_13480 43092 45728 gene locus_tag LOCUS_13490 gene alaS 43092 45728 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000047160.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence022 906 121 gene locus_tag LOCUS_13500 906 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 1730 1233 gene locus_tag LOCUS_13510 1730 1233 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705365.1 protein_id gnl|my_center|LOCUS_13510 1984 1718 gene locus_tag LOCUS_13520 1984 1718 CDS product DUF1778 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965889.1 protein_id gnl|my_center|LOCUS_13520 2944 2150 gene locus_tag LOCUS_13530 2944 2150 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_13530 4178 2934 gene locus_tag LOCUS_13540 4178 2934 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_13540 4692 4315 gene locus_tag LOCUS_13550 4692 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 7882 4784 gene locus_tag LOCUS_13560 7882 4784 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057001.1 protein_id gnl|my_center|LOCUS_13560 8939 7884 gene locus_tag LOCUS_13570 8939 7884 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930031.1 protein_id gnl|my_center|LOCUS_13570 9262 11079 gene locus_tag LOCUS_13580 9262 11079 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_13580 11120 11734 gene locus_tag LOCUS_13590 gene can 11120 11734 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_13590 11780 12118 gene locus_tag LOCUS_13600 11780 12118 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_13600 12208 12492 gene locus_tag LOCUS_13610 12208 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 12648 12890 gene locus_tag LOCUS_13620 12648 12890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 12948 14495 gene locus_tag LOCUS_13630 12948 14495 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_13630 14492 15016 gene locus_tag LOCUS_13640 14492 15016 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_13640 15467 15003 gene locus_tag LOCUS_13650 15467 15003 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919737.1 protein_id gnl|my_center|LOCUS_13650 15547 17832 gene locus_tag LOCUS_13660 gene maeB 15547 17832 CDS product NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098212.1 protein_id gnl|my_center|LOCUS_13660 18088 17909 gene locus_tag LOCUS_13670 18088 17909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 18512 18312 gene locus_tag LOCUS_13680 18512 18312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 19674 18541 gene locus_tag LOCUS_13690 gene zapE 19674 18541 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094297.1 protein_id gnl|my_center|LOCUS_13690 19906 21567 gene locus_tag LOCUS_13700 19906 21567 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455581.1 protein_id gnl|my_center|LOCUS_13700 21567 22400 gene locus_tag LOCUS_13710 gene kdsA 21567 22400 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_13710 22518 23798 gene locus_tag LOCUS_13720 gene eno 22518 23798 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_13720 23838 24131 gene locus_tag LOCUS_13730 23838 24131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 24128 24859 gene locus_tag LOCUS_13740 gene ispD 24128 24859 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_13740 25074 24871 gene locus_tag LOCUS_13750 25074 24871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 24961 25371 gene locus_tag LOCUS_13760 gene ispF 24961 25371 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000619209.1 protein_id gnl|my_center|LOCUS_13760 25519 25923 gene locus_tag LOCUS_13770 25519 25923 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_13770 26077 26595 gene locus_tag LOCUS_13780 gene yqiA 26077 26595 CDS product esterase YqiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098741.1 protein_id gnl|my_center|LOCUS_13780 26867 27913 gene locus_tag LOCUS_13790 gene nagZ 26867 27913 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215854.1 protein_id gnl|my_center|LOCUS_13790 27906 28448 gene locus_tag LOCUS_13800 27906 28448 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_13800 28445 29191 gene locus_tag LOCUS_13810 28445 29191 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036479.1 protein_id gnl|my_center|LOCUS_13810 29563 31350 gene locus_tag LOCUS_13820 29563 31350 CDS product 30S ribosomal protein S12 methylthiotransferase accessory protein YcaO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211330.1 protein_id gnl|my_center|LOCUS_13820 31325 31936 gene locus_tag LOCUS_13830 31325 31936 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_13830 33718 31985 gene locus_tag LOCUS_13840 33718 31985 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_13840 34033 36189 gene locus_tag LOCUS_13850 34033 36189 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704810.1 protein_id gnl|my_center|LOCUS_13850 36200 36922 gene locus_tag LOCUS_13860 36200 36922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096987.1 protein_id gnl|my_center|LOCUS_13860 37052 38047 gene locus_tag LOCUS_13870 37052 38047 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098907.1 protein_id gnl|my_center|LOCUS_13870 38038 38997 gene locus_tag LOCUS_13880 38038 38997 CDS product U32 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193564.1 protein_id gnl|my_center|LOCUS_13880 39494 38994 gene locus_tag LOCUS_13890 39494 38994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 40050 39478 gene locus_tag LOCUS_13900 gene pdxT 40050 39478 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391559.1 protein_id gnl|my_center|LOCUS_13900 40954 40064 gene locus_tag LOCUS_13910 gene pdxS 40954 40064 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391558.1 protein_id gnl|my_center|LOCUS_13910 41104 41697 gene locus_tag LOCUS_13920 41104 41697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 >Feature sequence023 1027 218 gene locus_tag LOCUS_13930 1027 218 CDS product competence protein CoiA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183806888.1 protein_id gnl|my_center|LOCUS_13930 2533 1115 gene locus_tag LOCUS_13940 2533 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119352.1 protein_id gnl|my_center|LOCUS_13940 2645 3097 gene locus_tag LOCUS_13950 2645 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 3094 3288 gene locus_tag LOCUS_13960 3094 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5106 3466 gene locus_tag LOCUS_13970 gene groL 5106 3466 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_13970 5438 5148 gene locus_tag LOCUS_13980 gene groES 5438 5148 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_13980 6163 5666 gene locus_tag LOCUS_13990 gene fxsA 6163 5666 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000483998.1 protein_id gnl|my_center|LOCUS_13990 6321 8222 gene locus_tag LOCUS_14000 gene dsbD 6321 8222 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862442.1 protein_id gnl|my_center|LOCUS_14000 8266 8814 gene locus_tag LOCUS_14010 8266 8814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 8977 9420 gene locus_tag LOCUS_14020 gene aroQ 8977 9420 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555369.1 protein_id gnl|my_center|LOCUS_14020 9427 9894 gene locus_tag LOCUS_14030 gene accB 9427 9894 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354622.1 protein_id gnl|my_center|LOCUS_14030 9901 11241 gene locus_tag LOCUS_14040 gene accC 9901 11241 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884620.1 protein_id gnl|my_center|LOCUS_14040 11612 11340 gene locus_tag LOCUS_14050 11612 11340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 12493 11612 gene locus_tag LOCUS_14060 12493 11612 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583996.1 protein_id gnl|my_center|LOCUS_14060 13349 12486 gene locus_tag LOCUS_14070 gene rsmI 13349 12486 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005075551.1 protein_id gnl|my_center|LOCUS_14070 13436 15364 gene locus_tag LOCUS_14080 13436 15364 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_14080 15309 15707 gene locus_tag LOCUS_14090 15309 15707 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948678.1 protein_id gnl|my_center|LOCUS_14090 15719 16297 gene locus_tag LOCUS_14100 15719 16297 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707591.1 protein_id gnl|my_center|LOCUS_14100 16702 16304 gene locus_tag LOCUS_14110 gene sspB 16702 16304 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420947.1 protein_id gnl|my_center|LOCUS_14110 17367 16768 gene locus_tag LOCUS_14120 17367 16768 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003406040.1 protein_id gnl|my_center|LOCUS_14120 18164 17409 gene locus_tag LOCUS_14130 18164 17409 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707595.1 protein_id gnl|my_center|LOCUS_14130 19375 18164 gene locus_tag LOCUS_14140 19375 18164 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070939.1 protein_id gnl|my_center|LOCUS_14140 19971 19375 gene locus_tag LOCUS_14150 gene petA 19971 19375 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_14150 20201 21325 gene locus_tag LOCUS_14160 gene algW 20201 21325 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340656.1 protein_id gnl|my_center|LOCUS_14160 21423 21677 gene locus_tag LOCUS_14170 21423 21677 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259386.1 protein_id gnl|my_center|LOCUS_14170 21674 22006 gene locus_tag LOCUS_14180 21674 22006 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_14180 22092 22532 gene locus_tag LOCUS_14190 22092 22532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 23753 22671 gene locus_tag LOCUS_14200 gene hisC 23753 22671 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_14200 23909 24346 gene locus_tag LOCUS_14210 23909 24346 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_14210 33762 24427 gene locus_tag LOCUS_14220 33762 24427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 35296 33995 gene locus_tag LOCUS_14230 gene hisD 35296 33995 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268859.1 protein_id gnl|my_center|LOCUS_14230 35931 35302 gene locus_tag LOCUS_14240 gene hisG 35931 35302 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098837.1 protein_id gnl|my_center|LOCUS_14240 36378 36016 gene locus_tag LOCUS_14250 36378 36016 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_14250 37697 36438 gene locus_tag LOCUS_14260 gene murA 37697 36438 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_14260 38036 37713 gene locus_tag LOCUS_14270 38036 37713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 38687 38043 gene locus_tag LOCUS_14280 38687 38043 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_14280 39182 38715 gene locus_tag LOCUS_14290 gene mlaD 39182 38715 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_14290 39716 39336 gene locus_tag LOCUS_14300 39716 39336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence024 <1 957 gene locus_tag LOCUS_14310 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003377556.1:RNA polymerase factor sigma-54 378 387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 990 1310 gene locus_tag LOCUS_14320 gene hpf 990 1310 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_14320 1310 1780 gene locus_tag LOCUS_14330 gene ptsN 1310 1780 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005467453.1 protein_id gnl|my_center|LOCUS_14330 1777 2718 gene locus_tag LOCUS_14340 gene hprK 1777 2718 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929965.1 protein_id gnl|my_center|LOCUS_14340 2746 3606 gene locus_tag LOCUS_14350 gene rapZ 2746 3606 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094361.1 protein_id gnl|my_center|LOCUS_14350 3612 3980 gene locus_tag LOCUS_14360 3612 3980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_14360 3973 4263 gene locus_tag LOCUS_14370 3973 4263 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946224.1 protein_id gnl|my_center|LOCUS_14370 4268 5998 gene locus_tag LOCUS_14380 gene ptsP 4268 5998 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522912.1 protein_id gnl|my_center|LOCUS_14380 7769 6039 gene locus_tag LOCUS_14390 7769 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 8625 7858 gene locus_tag LOCUS_14400 8625 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 10594 9341 gene locus_tag LOCUS_14410 10594 9341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 12021 10744 gene locus_tag LOCUS_14420 12021 10744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 13278 12034 gene locus_tag LOCUS_14430 13278 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 18804 13327 gene locus_tag LOCUS_14440 18804 13327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 18928 19107 gene locus_tag LOCUS_14450 18928 19107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 20117 19296 gene locus_tag LOCUS_14460 20117 19296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 20401 21765 gene locus_tag LOCUS_14470 gene gdhA 20401 21765 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_14470 21787 22620 gene locus_tag LOCUS_14480 21787 22620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 22755 23273 gene locus_tag LOCUS_14490 22755 23273 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942047.1 protein_id gnl|my_center|LOCUS_14490 23245 24915 gene locus_tag LOCUS_14500 23245 24915 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942046.1 protein_id gnl|my_center|LOCUS_14500 25336 24935 gene locus_tag LOCUS_14510 25336 24935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 26550 25399 gene locus_tag LOCUS_14520 26550 25399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 26731 28089 gene locus_tag LOCUS_14530 gene mgtE 26731 28089 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840452.1 protein_id gnl|my_center|LOCUS_14530 28441 28091 gene locus_tag LOCUS_14540 28441 28091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 30456 28486 gene locus_tag LOCUS_14550 30456 28486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 31772 30471 gene locus_tag LOCUS_14560 31772 30471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 31974 32801 gene locus_tag LOCUS_14570 31974 32801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 32819 34387 gene locus_tag LOCUS_14580 32819 34387 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_14580 34400 35857 gene locus_tag LOCUS_14590 34400 35857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 35895 37922 gene locus_tag LOCUS_14600 35895 37922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 39156 37948 gene locus_tag LOCUS_14610 39156 37948 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence025 293 1231 gene locus_tag LOCUS_14620 293 1231 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390154.1 protein_id gnl|my_center|LOCUS_14620 1642 1256 gene locus_tag LOCUS_14630 1642 1256 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528522.1 protein_id gnl|my_center|LOCUS_14630 1767 2966 gene locus_tag LOCUS_14640 gene dapC 1767 2966 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092403.1 protein_id gnl|my_center|LOCUS_14640 3120 3944 gene locus_tag LOCUS_14650 gene dapD 3120 3944 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001186643.1 protein_id gnl|my_center|LOCUS_14650 3992 4372 gene locus_tag LOCUS_14660 3992 4372 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968490.1 protein_id gnl|my_center|LOCUS_14660 5066 4422 gene locus_tag LOCUS_14670 5066 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 6078 5188 gene locus_tag LOCUS_14680 6078 5188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 7142 6087 gene locus_tag LOCUS_14690 7142 6087 CDS product di-heme enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211849.1 protein_id gnl|my_center|LOCUS_14690 8315 7398 gene locus_tag LOCUS_14700 8315 7398 CDS product metallo-mystery pair system four-Cys motif protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383153.1 protein_id gnl|my_center|LOCUS_14700 8423 8680 gene locus_tag LOCUS_14710 8423 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 8934 10091 gene locus_tag LOCUS_14720 8934 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 11225 10113 gene locus_tag LOCUS_14730 11225 10113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 12608 11355 gene locus_tag LOCUS_14740 12608 11355 CDS product VWA-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809081.1 protein_id gnl|my_center|LOCUS_14740 13817 12777 gene locus_tag LOCUS_14750 13817 12777 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887814.1 protein_id gnl|my_center|LOCUS_14750 14356 13910 gene locus_tag LOCUS_14760 14356 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 14605 14799 gene locus_tag LOCUS_14770 14605 14799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 15442 14873 gene locus_tag LOCUS_14780 15442 14873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 15592 16635 gene locus_tag LOCUS_14790 15592 16635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 16637 17245 gene locus_tag LOCUS_14800 16637 17245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 17399 17830 gene locus_tag LOCUS_14810 17399 17830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 18612 17863 gene locus_tag LOCUS_14820 18612 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 19612 18704 gene locus_tag LOCUS_14830 19612 18704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 20879 19659 gene locus_tag LOCUS_14840 20879 19659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 21293 20919 gene locus_tag LOCUS_14850 21293 20919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 21658 21299 gene locus_tag LOCUS_14860 21658 21299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 21709 22383 gene locus_tag LOCUS_14870 21709 22383 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150092553.1 protein_id gnl|my_center|LOCUS_14870 22663 22460 gene locus_tag LOCUS_14880 22663 22460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 23106 22786 gene locus_tag LOCUS_14890 23106 22786 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_14890 23964 23260 gene locus_tag LOCUS_14900 gene cas6 23964 23260 CDS product type I-MYXAN CRISPR-associated protein Cas6/Cmx6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026911.1 protein_id gnl|my_center|LOCUS_14900 24160 23969 gene locus_tag LOCUS_14910 24160 23969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 25078 24194 gene locus_tag LOCUS_14920 25078 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 25544 26806 gene locus_tag LOCUS_14930 gene dsrA 25544 26806 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_14930 26896 27969 gene locus_tag LOCUS_14940 gene dsrB 26896 27969 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_14940 27985 28377 gene locus_tag LOCUS_14950 gene tusD 27985 28377 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_14950 28388 28789 gene locus_tag LOCUS_14960 gene tusC 28388 28789 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932537.1 protein_id gnl|my_center|LOCUS_14960 28799 29101 gene locus_tag LOCUS_14970 gene tusB 28799 29101 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_14970 29137 29469 gene locus_tag LOCUS_14980 29137 29469 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_14980 29578 30339 gene locus_tag LOCUS_14990 gene dsrM 29578 30339 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393108.1 protein_id gnl|my_center|LOCUS_14990 30377 31915 gene locus_tag LOCUS_15000 30377 31915 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_15000 31984 33951 gene locus_tag LOCUS_15010 31984 33951 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_15010 34037 34462 gene locus_tag LOCUS_15020 34037 34462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 34459 35238 gene locus_tag LOCUS_15030 gene hmeA 34459 35238 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_15030 35267 36469 gene locus_tag LOCUS_15040 gene hmeB 35267 36469 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_15040 36606 37997 gene locus_tag LOCUS_15050 gene cobB 36606 37997 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence026 157 1461 gene locus_tag LOCUS_15060 157 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1464 2165 gene locus_tag LOCUS_15070 1464 2165 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125417.1 protein_id gnl|my_center|LOCUS_15070 3424 2174 gene locus_tag LOCUS_15080 3424 2174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4547 3438 gene locus_tag LOCUS_15090 4547 3438 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942620.1 protein_id gnl|my_center|LOCUS_15090 4725 5861 gene locus_tag LOCUS_15100 4725 5861 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_15100 5866 7023 gene locus_tag LOCUS_15110 5866 7023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7086 7721 gene locus_tag LOCUS_15120 7086 7721 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_15120 7757 9058 gene locus_tag LOCUS_15130 7757 9058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 10491 9094 gene locus_tag LOCUS_15140 10491 9094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 10736 10488 gene locus_tag LOCUS_15150 10736 10488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 12052 10982 gene locus_tag LOCUS_15160 12052 10982 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037027.1 protein_id gnl|my_center|LOCUS_15160 12257 12496 gene locus_tag LOCUS_15170 gene acpP 12257 12496 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207280528.1 protein_id gnl|my_center|LOCUS_15170 12512 13750 gene locus_tag LOCUS_15180 12512 13750 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387806.1 protein_id gnl|my_center|LOCUS_15180 13759 14844 gene locus_tag LOCUS_15190 13759 14844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 15007 15969 gene locus_tag LOCUS_15200 15007 15969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 16059 16538 gene locus_tag LOCUS_15210 16059 16538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 18437 16539 gene locus_tag LOCUS_15220 18437 16539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 19164 18457 gene locus_tag LOCUS_15230 19164 18457 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965346.1 protein_id gnl|my_center|LOCUS_15230 19458 20327 gene locus_tag LOCUS_15240 19458 20327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 20397 20810 gene locus_tag LOCUS_15250 20397 20810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 21149 22201 gene locus_tag LOCUS_15260 21149 22201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 22327 23385 gene locus_tag LOCUS_15270 22327 23385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 23500 25716 gene locus_tag LOCUS_15280 23500 25716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 26005 29184 gene locus_tag LOCUS_15290 26005 29184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 29653 29567 gene locus_tag LOCUS_t00120 29653 29567 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 29771 32080 gene locus_tag LOCUS_15300 gene rnr 29771 32080 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_15300 32077 32847 gene locus_tag LOCUS_15310 gene rlmB 32077 32847 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704663.1 protein_id gnl|my_center|LOCUS_15310 32857 33879 gene locus_tag LOCUS_15320 32857 33879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 33860 35632 gene locus_tag LOCUS_15330 gene recJ 33860 35632 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence027 3 611 gene locus_tag LOCUS_15340 3 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 655 1455 gene locus_tag LOCUS_15350 655 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1478 2329 gene locus_tag LOCUS_15360 1478 2329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 2365 3390 gene locus_tag LOCUS_15370 2365 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 4168 3422 gene locus_tag LOCUS_15380 4168 3422 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261672.1 protein_id gnl|my_center|LOCUS_15380 4239 6206 gene locus_tag LOCUS_15390 gene mnmC 4239 6206 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_15390 9684 6154 gene locus_tag LOCUS_15400 9684 6154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 10695 9697 gene locus_tag LOCUS_15410 10695 9697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 10791 11567 gene locus_tag LOCUS_15420 10791 11567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 11841 11626 gene locus_tag LOCUS_15430 11841 11626 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003861693.1 protein_id gnl|my_center|LOCUS_15430 12557 11838 gene locus_tag LOCUS_15440 gene cysZ 12557 11838 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 protein_id gnl|my_center|LOCUS_15440 13891 12572 gene locus_tag LOCUS_15450 13891 12572 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393138.1 protein_id gnl|my_center|LOCUS_15450 14305 13916 gene locus_tag LOCUS_15460 gene queF 14305 13916 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_15460 14417 17977 gene locus_tag LOCUS_15470 gene smc 14417 17977 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_15470 18016 18750 gene locus_tag LOCUS_15480 18016 18750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 18764 20788 gene locus_tag LOCUS_15490 gene ligA 18764 20788 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878165.1 protein_id gnl|my_center|LOCUS_15490 22202 21207 gene locus_tag LOCUS_15500 22202 21207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 24774 22339 gene locus_tag LOCUS_15510 24774 22339 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444419.1 protein_id gnl|my_center|LOCUS_15510 24728 25477 gene locus_tag LOCUS_15520 gene pdxJ 24728 25477 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015370292.1 protein_id gnl|my_center|LOCUS_15520 28607 25878 gene locus_tag LOCUS_15530 gene gacS 28607 25878 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_15530 29500 28604 gene locus_tag LOCUS_15540 29500 28604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 31735 29525 gene locus_tag LOCUS_15550 31735 29525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 31865 32764 gene locus_tag LOCUS_15560 gene cysM 31865 32764 CDS product cysteine synthase CysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616363.1 protein_id gnl|my_center|LOCUS_15560 32770 34122 gene locus_tag LOCUS_15570 gene rlmD 32770 34122 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence028 3238 575 gene locus_tag LOCUS_15580 3238 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 4261 3299 gene locus_tag LOCUS_15590 4261 3299 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937401.1 protein_id gnl|my_center|LOCUS_15590 5361 4258 gene locus_tag LOCUS_15600 gene gmd 5361 4258 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_15600 7000 5381 gene locus_tag LOCUS_15610 7000 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 8545 7010 gene locus_tag LOCUS_15620 8545 7010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 9287 9120 gene locus_tag LOCUS_15630 9287 9120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 10620 11084 gene locus_tag LOCUS_15640 10620 11084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 11828 11100 gene locus_tag LOCUS_15650 11828 11100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 13943 12138 gene locus_tag LOCUS_15660 gene asnB 13943 12138 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957840.1 protein_id gnl|my_center|LOCUS_15660 14332 14027 gene locus_tag LOCUS_15670 14332 14027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 16139 14952 gene locus_tag LOCUS_15680 16139 14952 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974189.1 protein_id gnl|my_center|LOCUS_15680 16936 17499 gene locus_tag LOCUS_15690 16936 17499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 17625 18440 gene locus_tag LOCUS_15700 17625 18440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 19191 18433 gene locus_tag LOCUS_15710 19191 18433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 20027 21571 gene locus_tag LOCUS_15720 20027 21571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 21583 22596 gene locus_tag LOCUS_15730 21583 22596 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000678143.1 protein_id gnl|my_center|LOCUS_15730 22637 23512 gene locus_tag LOCUS_15740 22637 23512 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_15740 23837 23610 gene locus_tag LOCUS_15750 23837 23610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 24818 24171 gene locus_tag LOCUS_15760 24818 24171 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403388.1 protein_id gnl|my_center|LOCUS_15760 26972 25239 gene locus_tag LOCUS_15770 26972 25239 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_15770 28599 27139 gene locus_tag LOCUS_15780 28599 27139 CDS product phosphomannomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022277.1 protein_id gnl|my_center|LOCUS_15780 29002 28637 gene locus_tag LOCUS_15790 29002 28637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 30917 29004 gene locus_tag LOCUS_15800 30917 29004 CDS product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 protein_id gnl|my_center|LOCUS_15800 32407 31031 gene locus_tag LOCUS_15810 32407 31031 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253941.1 protein_id gnl|my_center|LOCUS_15810 32588 33550 gene locus_tag LOCUS_15820 32588 33550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence029 66 782 gene locus_tag LOCUS_15830 66 782 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103037.1 protein_id gnl|my_center|LOCUS_15830 787 1680 gene locus_tag LOCUS_15840 gene xerC 787 1680 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459099.1 protein_id gnl|my_center|LOCUS_15840 1985 2761 gene locus_tag LOCUS_15850 gene yaaA 1985 2761 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092094.1 protein_id gnl|my_center|LOCUS_15850 3048 2881 gene locus_tag LOCUS_15860 3048 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 3079 3705 gene locus_tag LOCUS_15870 3079 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 3884 6028 gene locus_tag LOCUS_15880 3884 6028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 6346 9030 gene locus_tag LOCUS_15890 6346 9030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 9280 10485 gene locus_tag LOCUS_15900 9280 10485 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077104.1 protein_id gnl|my_center|LOCUS_15900 10593 11126 gene locus_tag LOCUS_15910 gene hslV 10593 11126 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_15910 11133 12464 gene locus_tag LOCUS_15920 gene hslU 11133 12464 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208943.1 protein_id gnl|my_center|LOCUS_15920 12512 12871 gene locus_tag LOCUS_15930 12512 12871 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_15930 13051 13794 gene locus_tag LOCUS_15940 gene ubiE 13051 13794 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165601.1 protein_id gnl|my_center|LOCUS_15940 13812 14414 gene locus_tag LOCUS_15950 13812 14414 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015961899.1 protein_id gnl|my_center|LOCUS_15950 14416 16080 gene locus_tag LOCUS_15960 gene ubiB 14416 16080 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_15960 16125 18899 gene locus_tag LOCUS_15970 16125 18899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 18901 21120 gene locus_tag LOCUS_15980 gene uvrD 18901 21120 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383393.1 protein_id gnl|my_center|LOCUS_15980 21297 22370 gene locus_tag LOCUS_15990 gene dctP 21297 22370 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_15990 22901 22500 gene locus_tag LOCUS_16000 22901 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 25257 23227 gene locus_tag LOCUS_16010 25257 23227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 27744 25261 gene locus_tag LOCUS_16020 gene plsB 27744 25261 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266965.1 protein_id gnl|my_center|LOCUS_16020 28081 27758 gene locus_tag LOCUS_16030 28081 27758 CDS product DUF2288 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268691.1 protein_id gnl|my_center|LOCUS_16030 28827 28081 gene locus_tag LOCUS_16040 28827 28081 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_16040 29317 29087 gene locus_tag LOCUS_16050 29317 29087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 29895 29518 gene locus_tag LOCUS_16060 29895 29518 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684748.1 protein_id gnl|my_center|LOCUS_16060 30089 29895 gene locus_tag LOCUS_16070 30089 29895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 30969 30244 gene locus_tag LOCUS_16080 30969 30244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 31188 30988 gene locus_tag LOCUS_16090 31188 30988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 31084 31320 gene locus_tag LOCUS_16100 31084 31320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 31512 31733 gene locus_tag LOCUS_16110 31512 31733 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence030 1004 5074 gene locus_tag LOCUS_16120 1004 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 5268 5579 gene locus_tag LOCUS_16130 5268 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 5671 6030 gene locus_tag LOCUS_16140 5671 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 6444 6136 gene locus_tag LOCUS_16150 6444 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16150 6617 6438 gene locus_tag LOCUS_16160 6617 6438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 7909 6884 gene locus_tag LOCUS_16170 7909 6884 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087234.1 protein_id gnl|my_center|LOCUS_16170 8084 8416 gene locus_tag LOCUS_16180 8084 8416 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843587.1 protein_id gnl|my_center|LOCUS_16180 8403 8714 gene locus_tag LOCUS_16190 8403 8714 CDS product DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261951.1 protein_id gnl|my_center|LOCUS_16190 10050 8791 gene locus_tag LOCUS_16200 10050 8791 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613399.1 protein_id gnl|my_center|LOCUS_16200 10340 10047 gene locus_tag LOCUS_16210 10340 10047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 10617 10745 gene locus_tag LOCUS_16220 10617 10745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 11090 10785 gene locus_tag LOCUS_16230 11090 10785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 11705 11196 gene locus_tag LOCUS_16240 11705 11196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 12227 11979 gene locus_tag LOCUS_16250 12227 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 13225 12809 gene locus_tag LOCUS_16260 13225 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 13588 13403 gene locus_tag LOCUS_16270 gene csrA 13588 13403 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213314.1 protein_id gnl|my_center|LOCUS_16270 16564 13619 gene locus_tag LOCUS_16280 16564 13619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 17135 16617 gene locus_tag LOCUS_16290 17135 16617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 17899 17303 gene locus_tag LOCUS_16300 17899 17303 CDS product mobile mystery protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942040.1 protein_id gnl|my_center|LOCUS_16300 18362 17889 gene locus_tag LOCUS_16310 18362 17889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 19763 18816 gene locus_tag LOCUS_16320 19763 18816 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_16320 20007 19756 gene locus_tag LOCUS_16330 20007 19756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 21441 20485 gene locus_tag LOCUS_16340 21441 20485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 22346 21441 gene locus_tag LOCUS_16350 22346 21441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 22978 22343 gene locus_tag LOCUS_16360 22978 22343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 24108 22975 gene locus_tag LOCUS_16370 24108 22975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 24753 24109 gene locus_tag LOCUS_16380 24753 24109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 27124 24743 gene locus_tag LOCUS_16390 27124 24743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 27393 27121 gene locus_tag LOCUS_16400 27393 27121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 27695 27393 gene locus_tag LOCUS_16410 27695 27393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 28080 27724 gene locus_tag LOCUS_16420 28080 27724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 29678 28074 gene locus_tag LOCUS_16430 29678 28074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 30367 29696 gene locus_tag LOCUS_16440 30367 29696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 30659 30369 gene locus_tag LOCUS_16450 30659 30369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 31507 30656 gene locus_tag LOCUS_16460 31507 30656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 >Feature sequence031 1083 538 gene locus_tag LOCUS_16470 1083 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2026 1076 gene locus_tag LOCUS_16480 gene pseG 2026 1076 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867753.1 protein_id gnl|my_center|LOCUS_16480 2808 2185 gene locus_tag LOCUS_16490 2808 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 4007 2847 gene locus_tag LOCUS_16500 gene pseC 4007 2847 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867760.1 protein_id gnl|my_center|LOCUS_16500 5005 4004 gene locus_tag LOCUS_16510 gene pseB 5005 4004 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (inverting) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073154.1 protein_id gnl|my_center|LOCUS_16510 5284 6330 gene locus_tag LOCUS_16520 5284 6330 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036196.1 protein_id gnl|my_center|LOCUS_16520 6536 8350 gene locus_tag LOCUS_16530 gene typA 6536 8350 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074056.1 protein_id gnl|my_center|LOCUS_16530 8978 8508 gene locus_tag LOCUS_16540 8978 8508 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327119.1 protein_id gnl|my_center|LOCUS_16540 9386 9592 gene locus_tag LOCUS_16550 9386 9592 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005331438.1 protein_id gnl|my_center|LOCUS_16550 10088 9675 gene locus_tag LOCUS_16560 10088 9675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 11060 10116 gene locus_tag LOCUS_16570 gene mdh 11060 10116 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_16570 11975 11142 gene locus_tag LOCUS_16580 11975 11142 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266373.1 protein_id gnl|my_center|LOCUS_16580 12218 12006 gene locus_tag LOCUS_16590 gene rpmE 12218 12006 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003027123.1 protein_id gnl|my_center|LOCUS_16590 12413 12904 gene locus_tag LOCUS_16600 12413 12904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 14176 13040 gene locus_tag LOCUS_16610 gene hemW 14176 13040 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266423.1 protein_id gnl|my_center|LOCUS_16610 14376 14609 gene locus_tag LOCUS_16620 14376 14609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 15897 14638 gene locus_tag LOCUS_16630 15897 14638 CDS product AmpG family muropeptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198303.1 protein_id gnl|my_center|LOCUS_16630 16685 15909 gene locus_tag LOCUS_16640 16685 15909 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946385.1 protein_id gnl|my_center|LOCUS_16640 16787 17434 gene locus_tag LOCUS_16650 gene pyrE 16787 17434 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 protein_id gnl|my_center|LOCUS_16650 18180 17431 gene locus_tag LOCUS_16660 18180 17431 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124872.1 protein_id gnl|my_center|LOCUS_16660 18246 18935 gene locus_tag LOCUS_16670 18246 18935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 19824 18940 gene locus_tag LOCUS_16680 gene argB 19824 18940 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_16680 21642 20266 gene locus_tag LOCUS_16690 21642 20266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 23008 21749 gene locus_tag LOCUS_16700 gene coaBC 23008 21749 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_16700 23120 23791 gene locus_tag LOCUS_16710 gene radC 23120 23791 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_16710 24125 23802 gene locus_tag LOCUS_16720 24125 23802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 24221 24814 gene locus_tag LOCUS_16730 24221 24814 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_16730 24807 25607 gene locus_tag LOCUS_16740 gene fetB 24807 25607 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_16740 26220 25618 gene locus_tag LOCUS_16750 26220 25618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 29301 26251 gene locus_tag LOCUS_16760 29301 26251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 30425 29445 gene locus_tag LOCUS_16770 30425 29445 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence032 <1 2796 gene locus_tag LOCUS_16780 <1 2796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000838383.1:efflux RND transporter permease subunit 3288 3061 gene locus_tag LOCUS_16790 3288 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 4338 3373 gene locus_tag LOCUS_16800 4338 3373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 5068 4358 gene locus_tag LOCUS_16810 5068 4358 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412360.1 protein_id gnl|my_center|LOCUS_16810 5297 5731 gene locus_tag LOCUS_16820 gene trxC 5297 5731 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_16820 5782 6927 gene locus_tag LOCUS_16830 5782 6927 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_16830 7524 6991 gene locus_tag LOCUS_16840 7524 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 8375 7734 gene locus_tag LOCUS_16850 8375 7734 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106022.1 protein_id gnl|my_center|LOCUS_16850 8628 8389 gene locus_tag LOCUS_16860 8628 8389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 9295 8750 gene locus_tag LOCUS_16870 9295 8750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 9886 9527 gene locus_tag LOCUS_tm00010 9886 9527 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 9981 10193 gene locus_tag LOCUS_16880 9981 10193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 10240 13998 gene locus_tag LOCUS_16890 gene purL 10240 13998 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113821.1 protein_id gnl|my_center|LOCUS_16890 13986 14414 gene locus_tag LOCUS_16900 13986 14414 CDS product nucleotidyltransferase substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948605.1 protein_id gnl|my_center|LOCUS_16900 14404 14709 gene locus_tag LOCUS_16910 14404 14709 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_16910 15669 14758 gene locus_tag LOCUS_16920 15669 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 16844 15873 gene locus_tag LOCUS_16930 16844 15873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 17446 18039 gene locus_tag LOCUS_16940 17446 18039 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705502.1 protein_id gnl|my_center|LOCUS_16940 18650 18219 gene locus_tag LOCUS_16950 18650 18219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 18817 20334 gene locus_tag LOCUS_16960 18817 20334 CDS product YdiU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968967.1 protein_id gnl|my_center|LOCUS_16960 20368 21129 gene locus_tag LOCUS_16970 20368 21129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 21240 22190 gene locus_tag LOCUS_16980 gene msrP 21240 22190 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_16980 22232 22834 gene locus_tag LOCUS_16990 gene msrQ 22232 22834 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527905.1 protein_id gnl|my_center|LOCUS_16990 23534 22839 gene locus_tag LOCUS_17000 23534 22839 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103868.1 protein_id gnl|my_center|LOCUS_17000 25536 23629 gene locus_tag LOCUS_17010 gene soxB 25536 23629 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_17010 25728 26852 gene locus_tag LOCUS_17020 25728 26852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 27180 28427 gene locus_tag LOCUS_17030 27180 28427 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_17030 28420 29106 gene locus_tag LOCUS_17040 gene lolD 28420 29106 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947993.1 protein_id gnl|my_center|LOCUS_17040 29383 30429 gene locus_tag LOCUS_17050 gene hrcA 29383 30429 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_17050 >Feature sequence033 <1 569 gene locus_tag LOCUS_17060 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260903.1:glycine--tRNA ligase subunit beta 573 1310 gene locus_tag LOCUS_17070 573 1310 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064981.1 protein_id gnl|my_center|LOCUS_17070 1423 2793 gene locus_tag LOCUS_17080 gene nhaD 1423 2793 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_17080 2863 3402 gene locus_tag LOCUS_17090 2863 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 4177 3416 gene locus_tag LOCUS_17100 4177 3416 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_17100 5131 4247 gene locus_tag LOCUS_17110 5131 4247 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_17110 6291 5623 gene locus_tag LOCUS_17120 gene trmB 6291 5623 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_17120 7107 6295 gene locus_tag LOCUS_17130 7107 6295 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_17130 7350 7150 gene locus_tag LOCUS_17140 gene thiS 7350 7150 CDS product sulfur carrier protein ThiS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084514.1 protein_id gnl|my_center|LOCUS_17140 7665 8633 gene locus_tag LOCUS_17150 7665 8633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 8752 9849 gene locus_tag LOCUS_17160 gene thiO 8752 9849 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_17160 9857 9932 gene locus_tag LOCUS_t00130 9857 9932 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 10240 10428 gene locus_tag LOCUS_17170 10240 10428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 10491 12056 gene locus_tag LOCUS_17180 10491 12056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 13903 12155 gene locus_tag LOCUS_17190 13903 12155 CDS product replication endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090628599.1 protein_id gnl|my_center|LOCUS_17190 14100 13900 gene locus_tag LOCUS_17200 14100 13900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 14977 14207 gene locus_tag LOCUS_17210 14977 14207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 15999 14974 gene locus_tag LOCUS_17220 15999 14974 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_17220 16940 16392 gene locus_tag LOCUS_17230 gene ppa 16940 16392 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930982.1 protein_id gnl|my_center|LOCUS_17230 17249 17764 gene locus_tag LOCUS_17240 gene pilV 17249 17764 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946368.1 protein_id gnl|my_center|LOCUS_17240 17758 18810 gene locus_tag LOCUS_17250 17758 18810 CDS product PilW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073360.1 protein_id gnl|my_center|LOCUS_17250 18810 19307 gene locus_tag LOCUS_17260 18810 19307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 19318 21789 gene locus_tag LOCUS_17270 19318 21789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 22867 21923 gene locus_tag LOCUS_17280 gene ispH 22867 21923 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 protein_id gnl|my_center|LOCUS_17280 23332 22871 gene locus_tag LOCUS_17290 gene fkpB 23332 22871 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004660.1 protein_id gnl|my_center|LOCUS_17290 23789 23325 gene locus_tag LOCUS_17300 gene lspA 23789 23325 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769261.1 protein_id gnl|my_center|LOCUS_17300 26626 23792 gene locus_tag LOCUS_17310 gene ileS 26626 23792 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286823.1 protein_id gnl|my_center|LOCUS_17310 27637 26681 gene locus_tag LOCUS_17320 gene ribF 27637 26681 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_17320 <29025 27637 gene locus_tag LOCUS_17330 <29025 27637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073367.1:murein biosynthesis integral membrane protein MurJ >Feature sequence034 633 130 gene locus_tag LOCUS_17340 633 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1215 856 gene locus_tag LOCUS_17350 1215 856 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_17350 1297 2373 gene locus_tag LOCUS_17360 gene ald 1297 2373 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899477.1 protein_id gnl|my_center|LOCUS_17360 2588 3280 gene locus_tag LOCUS_17370 2588 3280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 3296 4183 gene locus_tag LOCUS_17380 3296 4183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 4603 5211 gene locus_tag LOCUS_17390 4603 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 5282 5869 gene locus_tag LOCUS_17400 5282 5869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 6280 5951 gene locus_tag LOCUS_17410 6280 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 6258 6440 gene locus_tag LOCUS_17420 6258 6440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 6464 7393 gene locus_tag LOCUS_17430 6464 7393 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405327.1 protein_id gnl|my_center|LOCUS_17430 7753 7427 gene locus_tag LOCUS_17440 7753 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 8267 7857 gene locus_tag LOCUS_17450 8267 7857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 8511 9155 gene locus_tag LOCUS_17460 8511 9155 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546790.1 protein_id gnl|my_center|LOCUS_17460 9396 9701 gene locus_tag LOCUS_17470 9396 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 10444 9767 gene locus_tag LOCUS_17480 10444 9767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 10540 11115 gene locus_tag LOCUS_17490 10540 11115 CDS product DUF4136 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073213.1 protein_id gnl|my_center|LOCUS_17490 11265 12218 gene locus_tag LOCUS_17500 11265 12218 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_17500 12222 12545 gene locus_tag LOCUS_17510 12222 12545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 12774 13502 gene locus_tag LOCUS_17520 12774 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 14642 13527 gene locus_tag LOCUS_17530 gene amrS 14642 13527 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_17530 14757 15539 gene locus_tag LOCUS_17540 gene amrB 14757 15539 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_17540 15545 16096 gene locus_tag LOCUS_17550 15545 16096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 17549 16104 gene locus_tag LOCUS_17560 17549 16104 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070440.1 protein_id gnl|my_center|LOCUS_17560 17673 18080 gene locus_tag LOCUS_17570 17673 18080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 18369 19160 gene locus_tag LOCUS_17580 18369 19160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 20557 19262 gene locus_tag LOCUS_17590 20557 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 20824 21117 gene locus_tag LOCUS_17600 20824 21117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 21121 21993 gene locus_tag LOCUS_17610 21121 21993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 22279 23256 gene locus_tag LOCUS_17620 22279 23256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 23428 23288 gene locus_tag LOCUS_17630 23428 23288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 25767 23425 gene locus_tag LOCUS_17640 25767 23425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 26573 25764 gene locus_tag LOCUS_17650 26573 25764 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837306.1 protein_id gnl|my_center|LOCUS_17650 28850 26958 gene locus_tag LOCUS_17660 gene thiC 28850 26958 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_17660 >Feature sequence035 200 874 gene locus_tag LOCUS_17670 200 874 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275303.1 protein_id gnl|my_center|LOCUS_17670 1028 1780 gene locus_tag LOCUS_17680 1028 1780 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086107.1 protein_id gnl|my_center|LOCUS_17680 1770 2294 gene locus_tag LOCUS_17690 gene ruvC 1770 2294 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418602.1 protein_id gnl|my_center|LOCUS_17690 2291 2896 gene locus_tag LOCUS_17700 gene ruvA 2291 2896 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245442.1 protein_id gnl|my_center|LOCUS_17700 2893 3933 gene locus_tag LOCUS_17710 gene ruvB 2893 3933 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707371.1 protein_id gnl|my_center|LOCUS_17710 4059 4472 gene locus_tag LOCUS_17720 gene ybgC 4059 4472 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378990.1 protein_id gnl|my_center|LOCUS_17720 4472 5227 gene locus_tag LOCUS_17730 gene tolQ 4472 5227 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483599.1 protein_id gnl|my_center|LOCUS_17730 5239 5661 gene locus_tag LOCUS_17740 gene tolR 5239 5661 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_17740 5681 6547 gene locus_tag LOCUS_17750 5681 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 6621 7901 gene locus_tag LOCUS_17760 gene tolB 6621 7901 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_17760 7944 8507 gene locus_tag LOCUS_17770 gene pal 7944 8507 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004859700.1 protein_id gnl|my_center|LOCUS_17770 8510 9328 gene locus_tag LOCUS_17780 gene ybgF 8510 9328 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072685.1 protein_id gnl|my_center|LOCUS_17780 9460 10110 gene locus_tag LOCUS_17790 gene queE 9460 10110 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120697.1 protein_id gnl|my_center|LOCUS_17790 10110 10796 gene locus_tag LOCUS_17800 gene queC 10110 10796 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803840.1 protein_id gnl|my_center|LOCUS_17800 10941 11016 gene locus_tag LOCUS_t00140 10941 11016 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 11994 11140 gene locus_tag LOCUS_17810 gene soxA 11994 11140 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 protein_id gnl|my_center|LOCUS_17810 12364 12050 gene locus_tag LOCUS_17820 gene soxZ 12364 12050 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_17820 12862 12392 gene locus_tag LOCUS_17830 gene soxY 12862 12392 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_17830 13254 12880 gene locus_tag LOCUS_17840 gene soxX 13254 12880 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 protein_id gnl|my_center|LOCUS_17840 14797 13463 gene locus_tag LOCUS_17850 14797 13463 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457720.1 protein_id gnl|my_center|LOCUS_17850 15058 16416 gene locus_tag LOCUS_17860 15058 16416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 16680 17609 gene locus_tag LOCUS_17870 16680 17609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 17872 19566 gene locus_tag LOCUS_17880 17872 19566 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522422.1 protein_id gnl|my_center|LOCUS_17880 19576 20064 gene locus_tag LOCUS_17890 gene ilvN 19576 20064 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095069.1 protein_id gnl|my_center|LOCUS_17890 20247 21263 gene locus_tag LOCUS_17900 gene ilvC 20247 21263 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_17900 21365 22156 gene locus_tag LOCUS_17910 gene pssA 21365 22156 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_17910 22415 23965 gene locus_tag LOCUS_17920 22415 23965 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_17920 23979 24725 gene locus_tag LOCUS_17930 23979 24725 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040248.1 protein_id gnl|my_center|LOCUS_17930 24730 25236 gene locus_tag LOCUS_17940 gene rimI 24730 25236 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_17940 25318 26904 gene locus_tag LOCUS_17950 25318 26904 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772589.1 protein_id gnl|my_center|LOCUS_17950 27482 27078 gene locus_tag LOCUS_17960 27482 27078 CDS product DUF4332 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946351.1 protein_id gnl|my_center|LOCUS_17960 27800 27525 gene locus_tag LOCUS_17970 27800 27525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013167310.1 protein_id gnl|my_center|LOCUS_17970 28304 27945 gene locus_tag LOCUS_17980 28304 27945 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 protein_id gnl|my_center|LOCUS_17980 >Feature sequence036 329 93 gene locus_tag LOCUS_17990 329 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1101 358 gene locus_tag LOCUS_18000 1101 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1788 1144 gene locus_tag LOCUS_18010 1788 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 4204 3122 gene locus_tag LOCUS_18020 4204 3122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 4430 5611 gene locus_tag LOCUS_18030 gene sopA 4430 5611 CDS product plasmid-partitioning protein SopA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000772446.1 protein_id gnl|my_center|LOCUS_18030 5631 6581 gene locus_tag LOCUS_18040 5631 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 6769 7335 gene locus_tag LOCUS_18050 6769 7335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18050 7296 7532 gene locus_tag LOCUS_18060 7296 7532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 9206 7647 gene locus_tag LOCUS_18070 9206 7647 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109635.1 protein_id gnl|my_center|LOCUS_18070 9546 10559 gene locus_tag LOCUS_18080 9546 10559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 10552 11394 gene locus_tag LOCUS_18090 10552 11394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18090 11643 15917 gene locus_tag LOCUS_18100 11643 15917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206868.1 protein_id gnl|my_center|LOCUS_18100 15943 17049 gene locus_tag LOCUS_18110 15943 17049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 17291 17836 gene locus_tag LOCUS_18120 17291 17836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 17836 18297 gene locus_tag LOCUS_18130 17836 18297 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266690.1 protein_id gnl|my_center|LOCUS_18130 19642 22266 gene locus_tag LOCUS_18140 19642 22266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 23115 23816 gene locus_tag LOCUS_18150 23115 23816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 23813 26689 gene locus_tag LOCUS_18160 23813 26689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence037 77 1144 gene locus_tag LOCUS_18170 77 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 1141 1332 gene locus_tag LOCUS_18180 1141 1332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 1446 1520 gene locus_tag LOCUS_t00150 1446 1520 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2432 1536 gene locus_tag LOCUS_18190 gene rfbD 2432 1536 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121651858.1 protein_id gnl|my_center|LOCUS_18190 3498 2440 gene locus_tag LOCUS_18200 gene rfbB 3498 2440 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974014.1 protein_id gnl|my_center|LOCUS_18200 4128 7664 gene locus_tag LOCUS_18210 4128 7664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 8739 10421 gene locus_tag LOCUS_18220 8739 10421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18220 11196 12515 gene locus_tag LOCUS_18230 11196 12515 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919493.1 protein_id gnl|my_center|LOCUS_18230 12512 14062 gene locus_tag LOCUS_18240 gene guaA 12512 14062 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388108.1 protein_id gnl|my_center|LOCUS_18240 14689 14108 gene locus_tag LOCUS_18250 14689 14108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_18250 15059 14706 gene locus_tag LOCUS_18260 15059 14706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 15929 15507 gene locus_tag LOCUS_18270 15929 15507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18270 17004 16243 gene locus_tag LOCUS_18280 17004 16243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 17955 17212 gene locus_tag LOCUS_18290 17955 17212 CDS product sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383017.1 protein_id gnl|my_center|LOCUS_18290 20577 17968 gene locus_tag LOCUS_18300 20577 17968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 21497 20562 gene locus_tag LOCUS_18310 21497 20562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 22203 21973 gene locus_tag LOCUS_18320 22203 21973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 22498 22337 gene locus_tag LOCUS_18330 22498 22337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 22757 24085 gene locus_tag LOCUS_18340 22757 24085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 24096 24560 gene locus_tag LOCUS_18350 24096 24560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence038 1614 205 gene locus_tag LOCUS_18360 1614 205 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_18360 2135 1614 gene locus_tag LOCUS_18370 2135 1614 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227767.1 protein_id gnl|my_center|LOCUS_18370 3784 2264 gene locus_tag LOCUS_18380 3784 2264 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_18380 4111 3863 gene locus_tag LOCUS_18390 4111 3863 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_18390 4508 4323 gene locus_tag LOCUS_18400 4508 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 4432 5097 gene locus_tag LOCUS_18410 4432 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 5167 5505 gene locus_tag LOCUS_18420 gene glnK 5167 5505 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_18420 5536 6813 gene locus_tag LOCUS_18430 5536 6813 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_18430 7188 7526 gene locus_tag LOCUS_18440 gene glnK 7188 7526 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_18440 7564 8865 gene locus_tag LOCUS_18450 7564 8865 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003344468.1 protein_id gnl|my_center|LOCUS_18450 8957 9406 gene locus_tag LOCUS_18460 8957 9406 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093901.1 protein_id gnl|my_center|LOCUS_18460 11923 9455 gene locus_tag LOCUS_18470 11923 9455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 12160 13281 gene locus_tag LOCUS_18480 12160 13281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 13314 13736 gene locus_tag LOCUS_18490 13314 13736 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528650.1 protein_id gnl|my_center|LOCUS_18490 13741 14136 gene locus_tag LOCUS_18500 gene msrB 13741 14136 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_18500 15250 14396 gene locus_tag LOCUS_18510 15250 14396 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_18510 15591 15247 gene locus_tag LOCUS_18520 15591 15247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 15684 15902 gene locus_tag LOCUS_18530 15684 15902 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011336845.1 protein_id gnl|my_center|LOCUS_18530 16474 15965 gene locus_tag LOCUS_18540 16474 15965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524989.1 protein_id gnl|my_center|LOCUS_18540 16730 17293 gene locus_tag LOCUS_18550 16730 17293 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193229.1 protein_id gnl|my_center|LOCUS_18550 19377 17485 gene locus_tag LOCUS_18560 19377 17485 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141470.1 protein_id gnl|my_center|LOCUS_18560 19517 22519 gene locus_tag LOCUS_18570 19517 22519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 23781 22531 gene locus_tag LOCUS_18580 23781 22531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 24341 23778 gene locus_tag LOCUS_18590 24341 23778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 24647 25054 gene locus_tag LOCUS_18600 24647 25054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18600 25077 25445 gene locus_tag LOCUS_18610 25077 25445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence039 650 267 gene locus_tag LOCUS_18620 650 267 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_18620 1826 696 gene locus_tag LOCUS_18630 gene dapE 1826 696 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688278.1 protein_id gnl|my_center|LOCUS_18630 4529 1845 gene locus_tag LOCUS_18640 4529 1845 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_18640 5296 4529 gene locus_tag LOCUS_18650 gene map 5296 4529 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_18650 5648 6628 gene locus_tag LOCUS_18660 5648 6628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 6689 7570 gene locus_tag LOCUS_18670 gene tsf 6689 7570 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_18670 7641 8369 gene locus_tag LOCUS_18680 gene pyrH 7641 8369 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_18680 8369 8926 gene locus_tag LOCUS_18690 gene frr 8369 8926 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_18690 8965 9714 gene locus_tag LOCUS_18700 8965 9714 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480970.1 protein_id gnl|my_center|LOCUS_18700 9714 10529 gene locus_tag LOCUS_18710 gene cdsA 9714 10529 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092388.1 protein_id gnl|my_center|LOCUS_18710 10526 11710 gene locus_tag LOCUS_18720 gene ispC 10526 11710 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_18720 11718 13085 gene locus_tag LOCUS_18730 gene rseP 11718 13085 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406254.1 protein_id gnl|my_center|LOCUS_18730 13092 15419 gene locus_tag LOCUS_18740 gene bamA 13092 15419 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092382.1 protein_id gnl|my_center|LOCUS_18740 15433 15933 gene locus_tag LOCUS_18750 15433 15933 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946255.1 protein_id gnl|my_center|LOCUS_18750 15940 16977 gene locus_tag LOCUS_18760 gene lpxD 15940 16977 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771660.1 protein_id gnl|my_center|LOCUS_18760 16991 17443 gene locus_tag LOCUS_18770 gene fabZ 16991 17443 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_18770 17440 18210 gene locus_tag LOCUS_18780 gene lpxA 17440 18210 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092373.1 protein_id gnl|my_center|LOCUS_18780 18896 18573 gene locus_tag LOCUS_18790 18896 18573 CDS product YqfO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092679.1 protein_id gnl|my_center|LOCUS_18790 18978 19262 gene locus_tag LOCUS_18800 18978 19262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 19267 19935 gene locus_tag LOCUS_18810 19267 19935 CDS product thiopurine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070918.1 protein_id gnl|my_center|LOCUS_18810 19952 22921 gene locus_tag LOCUS_18820 19952 22921 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_18820 23183 23413 gene locus_tag LOCUS_18830 23183 23413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 23435 23773 gene locus_tag LOCUS_18840 23435 23773 CDS product SaoD/DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258649.1 protein_id gnl|my_center|LOCUS_18840 23821 24696 gene locus_tag LOCUS_18850 23821 24696 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257874.1 protein_id gnl|my_center|LOCUS_18850 >Feature sequence040 39 467 gene locus_tag LOCUS_18860 39 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 540 1352 gene locus_tag LOCUS_18870 540 1352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 1378 2010 gene locus_tag LOCUS_18880 gene parA 1378 2010 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022836937.1 protein_id gnl|my_center|LOCUS_18880 2033 3010 gene locus_tag LOCUS_18890 2033 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18890 3041 3631 gene locus_tag LOCUS_18900 3041 3631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18900 3632 4723 gene locus_tag LOCUS_18910 3632 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 4783 6300 gene locus_tag LOCUS_18920 4783 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 7144 6290 gene locus_tag LOCUS_18930 gene asd 7144 6290 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113924.1 protein_id gnl|my_center|LOCUS_18930 7576 7154 gene locus_tag LOCUS_18940 7576 7154 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192175.1 protein_id gnl|my_center|LOCUS_18940 7696 8607 gene locus_tag LOCUS_18950 gene prmB 7696 8607 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_18950 8648 9751 gene locus_tag LOCUS_18960 gene aroC 8648 9751 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087653.1 protein_id gnl|my_center|LOCUS_18960 10033 11184 gene locus_tag LOCUS_18970 10033 11184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103817.1 protein_id gnl|my_center|LOCUS_18970 12004 11189 gene locus_tag LOCUS_18980 12004 11189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 12976 12113 gene locus_tag LOCUS_18990 12976 12113 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103885.1 protein_id gnl|my_center|LOCUS_18990 13256 13789 gene locus_tag LOCUS_19000 13256 13789 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 protein_id gnl|my_center|LOCUS_19000 13794 15203 gene locus_tag LOCUS_19010 gene leuC 13794 15203 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033446523.1 protein_id gnl|my_center|LOCUS_19010 15360 15995 gene locus_tag LOCUS_19020 gene leuD 15360 15995 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010357988.1 protein_id gnl|my_center|LOCUS_19020 16257 16661 gene locus_tag LOCUS_19030 16257 16661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 17357 16968 gene locus_tag LOCUS_19040 17357 16968 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_19040 17548 17354 gene locus_tag LOCUS_19050 17548 17354 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 protein_id gnl|my_center|LOCUS_19050 17902 18570 gene locus_tag LOCUS_19060 17902 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 20240 18555 gene locus_tag LOCUS_19070 gene glnS 20240 18555 CDS product glutamine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001287115.1 protein_id gnl|my_center|LOCUS_19070 20678 20313 gene locus_tag LOCUS_19080 20678 20313 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265541.1 protein_id gnl|my_center|LOCUS_19080 20714 21565 gene locus_tag LOCUS_19090 gene birA 20714 21565 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167375482.1 protein_id gnl|my_center|LOCUS_19090 21549 22322 gene locus_tag LOCUS_19100 21549 22322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19100 22323 23129 gene locus_tag LOCUS_19110 22323 23129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 23236 23311 gene locus_tag LOCUS_t00160 23236 23311 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23388 23472 gene locus_tag LOCUS_t00170 23388 23472 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 23765 23838 gene locus_tag LOCUS_t00180 23765 23838 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 23983 24058 gene locus_tag LOCUS_t00190 23983 24058 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence041 1212 172 gene locus_tag LOCUS_19120 1212 172 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193428.1 protein_id gnl|my_center|LOCUS_19120 1431 1805 gene locus_tag LOCUS_19130 1431 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 1802 2149 gene locus_tag LOCUS_19140 gene sdhD 1802 2149 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958203.1 protein_id gnl|my_center|LOCUS_19140 2160 3920 gene locus_tag LOCUS_19150 gene sdhA 2160 3920 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813651.1 protein_id gnl|my_center|LOCUS_19150 4033 4728 gene locus_tag LOCUS_19160 4033 4728 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040190.1 protein_id gnl|my_center|LOCUS_19160 4740 4985 gene locus_tag LOCUS_19170 4740 4985 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768810.1 protein_id gnl|my_center|LOCUS_19170 5238 6701 gene locus_tag LOCUS_19180 5238 6701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19180 7375 6710 gene locus_tag LOCUS_19190 7375 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19190 7997 7413 gene locus_tag LOCUS_19200 7997 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 8067 8504 gene locus_tag LOCUS_19210 8067 8504 CDS product DUF1249 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212183.1 protein_id gnl|my_center|LOCUS_19210 8717 11263 gene locus_tag LOCUS_19220 gene gyrA 8717 11263 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_19220 11335 12414 gene locus_tag LOCUS_19230 gene serC 11335 12414 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_19230 12464 13627 gene locus_tag LOCUS_19240 12464 13627 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_19240 13632 14717 gene locus_tag LOCUS_19250 gene pheA 13632 14717 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091446.1 protein_id gnl|my_center|LOCUS_19250 14727 15863 gene locus_tag LOCUS_19260 gene hisC 14727 15863 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_19260 15867 16751 gene locus_tag LOCUS_19270 15867 16751 CDS product prephenate/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027162911.1 protein_id gnl|my_center|LOCUS_19270 16853 17068 gene locus_tag LOCUS_19280 16853 17068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 17149 18459 gene locus_tag LOCUS_19290 17149 18459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 18456 19142 gene locus_tag LOCUS_19300 gene cmk 18456 19142 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705689.1 protein_id gnl|my_center|LOCUS_19300 19286 20962 gene locus_tag LOCUS_19310 gene rpsA 19286 20962 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_19310 21035 21358 gene locus_tag LOCUS_19320 21035 21358 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_19320 21455 22651 gene locus_tag LOCUS_19330 gene lapB 21455 22651 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_19330 22641 23327 gene locus_tag LOCUS_19340 gene pyrF 22641 23327 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705694.1 protein_id gnl|my_center|LOCUS_19340 23389 23655 gene locus_tag LOCUS_19350 23389 23655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 24016 24708 gene locus_tag LOCUS_19360 24016 24708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19360 >Feature sequence042 <1 1224 gene locus_tag LOCUS_19370 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003087924.1:ATP-dependent Clp protease ATP-binding subunit ClpX 1338 3776 gene locus_tag LOCUS_19380 gene lon 1338 3776 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005493728.1 protein_id gnl|my_center|LOCUS_19380 4075 4347 gene locus_tag LOCUS_19390 4075 4347 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043860.1 protein_id gnl|my_center|LOCUS_19390 4362 4437 gene locus_tag LOCUS_t00200 4362 4437 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4442 4518 gene locus_tag LOCUS_t00210 4442 4518 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 4660 6534 gene locus_tag LOCUS_19400 gene ppiD 4660 6534 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_19400 6547 7836 gene locus_tag LOCUS_19410 6547 7836 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072045.1 protein_id gnl|my_center|LOCUS_19410 8682 7885 gene locus_tag LOCUS_19420 gene fabI 8682 7885 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_19420 8914 10623 gene locus_tag LOCUS_19430 8914 10623 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193219.1 protein_id gnl|my_center|LOCUS_19430 10626 11681 gene locus_tag LOCUS_19440 10626 11681 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 protein_id gnl|my_center|LOCUS_19440 11678 12724 gene locus_tag LOCUS_19450 11678 12724 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524778.1 protein_id gnl|my_center|LOCUS_19450 12728 14326 gene locus_tag LOCUS_19460 12728 14326 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_19460 14461 15879 gene locus_tag LOCUS_19470 14461 15879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19470 16048 16551 gene locus_tag LOCUS_19480 gene iscR 16048 16551 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707916.1 protein_id gnl|my_center|LOCUS_19480 16584 16970 gene locus_tag LOCUS_19490 gene iscU 16584 16970 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812460.1 protein_id gnl|my_center|LOCUS_19490 17134 19698 gene locus_tag LOCUS_19500 gene acnB 17134 19698 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 protein_id gnl|my_center|LOCUS_19500 19711 20085 gene locus_tag LOCUS_19510 gene crcB 19711 20085 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969203.1 protein_id gnl|my_center|LOCUS_19510 20082 20375 gene locus_tag LOCUS_19520 20082 20375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19520 20405 21769 gene locus_tag LOCUS_19530 gene serS 20405 21769 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_19530 21784 21957 gene locus_tag LOCUS_19540 21784 21957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19540 21994 23460 gene locus_tag LOCUS_19550 21994 23460 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_19550 23457 23954 gene locus_tag LOCUS_19560 gene tsaE 23457 23954 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981977.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence043 471 686 gene locus_tag LOCUS_19570 471 686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19570 690 1319 gene locus_tag LOCUS_19580 690 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19580 2254 1316 gene locus_tag LOCUS_19590 2254 1316 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259475.1 protein_id gnl|my_center|LOCUS_19590 3045 2611 gene locus_tag LOCUS_19600 3045 2611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 3559 3071 gene locus_tag LOCUS_19610 3559 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 4970 3564 gene locus_tag LOCUS_19620 gene fliI 4970 3564 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_19620 5620 4970 gene locus_tag LOCUS_19630 5620 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19630 6614 5604 gene locus_tag LOCUS_19640 gene fliG 6614 5604 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037091.1 protein_id gnl|my_center|LOCUS_19640 8250 6607 gene locus_tag LOCUS_19650 gene fliF 8250 6607 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268443.1 protein_id gnl|my_center|LOCUS_19650 8626 8291 gene locus_tag LOCUS_19660 gene fliE 8626 8291 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086454.1 protein_id gnl|my_center|LOCUS_19660 10131 8770 gene locus_tag LOCUS_19670 10131 8770 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073114.1 protein_id gnl|my_center|LOCUS_19670 11419 10136 gene locus_tag LOCUS_19680 gene fleS 11419 10136 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_19680 11646 12143 gene locus_tag LOCUS_19690 11646 12143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 12531 12223 gene locus_tag LOCUS_19700 12531 12223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 12998 12573 gene locus_tag LOCUS_19710 gene fliS 12998 12573 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_19710 14451 13090 gene locus_tag LOCUS_19720 gene fliD 14451 13090 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073119.1 protein_id gnl|my_center|LOCUS_19720 14903 14523 gene locus_tag LOCUS_19730 14903 14523 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268448.1 protein_id gnl|my_center|LOCUS_19730 15843 15007 gene locus_tag LOCUS_19740 gene flaB 15843 15007 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705589.1 protein_id gnl|my_center|LOCUS_19740 16970 16134 gene locus_tag LOCUS_19750 16970 16134 CDS product flagellin FliC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096009.1 protein_id gnl|my_center|LOCUS_19750 18840 17206 gene locus_tag LOCUS_19760 18840 17206 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141384.1 protein_id gnl|my_center|LOCUS_19760 19760 18858 gene locus_tag LOCUS_19770 gene flgL 19760 18858 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001212768.1 protein_id gnl|my_center|LOCUS_19770 21730 19766 gene locus_tag LOCUS_19780 gene flgK 21730 19766 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037108.1 protein_id gnl|my_center|LOCUS_19780 22155 21730 gene locus_tag LOCUS_19790 22155 21730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19790 23277 22156 gene locus_tag LOCUS_19800 23277 22156 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037110.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence044 883 596 gene locus_tag LOCUS_19810 883 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1088 876 gene locus_tag LOCUS_19820 1088 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 2033 1140 gene locus_tag LOCUS_19830 gene cas7c 2033 1140 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070169.1 protein_id gnl|my_center|LOCUS_19830 3793 2048 gene locus_tag LOCUS_19840 gene cas8c 3793 2048 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_19840 4479 3790 gene locus_tag LOCUS_19850 gene cas5c 4479 3790 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_19850 6735 4495 gene locus_tag LOCUS_19860 gene cas3 6735 4495 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_19860 7895 6903 gene locus_tag LOCUS_19870 7895 6903 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038601.1 protein_id gnl|my_center|LOCUS_19870 9471 8038 gene locus_tag LOCUS_19880 gene nuoN 9471 8038 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813916.1 protein_id gnl|my_center|LOCUS_19880 11023 9500 gene locus_tag LOCUS_19890 11023 9500 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_19890 13041 11053 gene locus_tag LOCUS_19900 gene nuoL 13041 11053 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_19900 13357 13052 gene locus_tag LOCUS_19910 gene nuoK 13357 13052 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_19910 13973 13359 gene locus_tag LOCUS_19920 13973 13359 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_19920 14493 13993 gene locus_tag LOCUS_19930 gene nuoI 14493 13993 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186558.1 protein_id gnl|my_center|LOCUS_19930 15580 14504 gene locus_tag LOCUS_19940 gene nuoH 15580 14504 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_19940 18078 15580 gene locus_tag LOCUS_19950 gene nuoG 18078 15580 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958230.1 protein_id gnl|my_center|LOCUS_19950 19506 18226 gene locus_tag LOCUS_19960 gene nuoF 19506 18226 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_19960 20012 19518 gene locus_tag LOCUS_19970 gene nuoE 20012 19518 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037655.1 protein_id gnl|my_center|LOCUS_19970 21271 20018 gene locus_tag LOCUS_19980 21271 20018 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_19980 22019 21264 gene locus_tag LOCUS_19990 22019 21264 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_19990 22516 22034 gene locus_tag LOCUS_20000 22516 22034 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence045 70 840 gene locus_tag LOCUS_20010 70 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 1913 900 gene locus_tag LOCUS_20020 1913 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 3562 1916 gene locus_tag LOCUS_20030 3562 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20030 4777 3575 gene locus_tag LOCUS_20040 4777 3575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093039140.1 protein_id gnl|my_center|LOCUS_20040 4793 5092 gene locus_tag LOCUS_20050 4793 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20050 6549 5104 gene locus_tag LOCUS_20060 6549 5104 CDS product toll/interleukin-1 receptor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941221.1 protein_id gnl|my_center|LOCUS_20060 7516 6560 gene locus_tag LOCUS_20070 7516 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 7800 7513 gene locus_tag LOCUS_20080 7800 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 9234 8029 gene locus_tag LOCUS_20090 9234 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 10886 9234 gene locus_tag LOCUS_20100 10886 9234 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948400.1 protein_id gnl|my_center|LOCUS_20100 13184 10905 gene locus_tag LOCUS_20110 13184 10905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20110 15924 13258 gene locus_tag LOCUS_20120 15924 13258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 16298 16014 gene locus_tag LOCUS_20130 16298 16014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 17966 16470 gene locus_tag LOCUS_20140 17966 16470 CDS product sigma 54-interacting transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940636.1 protein_id gnl|my_center|LOCUS_20140 18353 18277 gene locus_tag LOCUS_t00220 18353 18277 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 20290 18458 gene locus_tag LOCUS_20150 gene rpoD 20290 18458 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210359.1 protein_id gnl|my_center|LOCUS_20150 22151 20394 gene locus_tag LOCUS_20160 gene dnaG 22151 20394 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence046 824 1084 gene locus_tag LOCUS_20170 824 1084 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 protein_id gnl|my_center|LOCUS_20170 1088 1390 gene locus_tag LOCUS_20180 1088 1390 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074407.1 protein_id gnl|my_center|LOCUS_20180 3243 1675 gene locus_tag LOCUS_20190 gene guaA 3243 1675 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105901.1 protein_id gnl|my_center|LOCUS_20190 4816 3359 gene locus_tag LOCUS_20200 gene guaB 4816 3359 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812368.1 protein_id gnl|my_center|LOCUS_20200 5003 5317 gene locus_tag LOCUS_20210 5003 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 5430 6785 gene locus_tag LOCUS_20220 gene xseA 5430 6785 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000937912.1 protein_id gnl|my_center|LOCUS_20220 7001 7435 gene locus_tag LOCUS_20230 gene dksA 7001 7435 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095122.1 protein_id gnl|my_center|LOCUS_20230 7782 8759 gene locus_tag LOCUS_20240 gene gluQRS 7782 8759 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_20240 9189 8770 gene locus_tag LOCUS_20250 9189 8770 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406157.1 protein_id gnl|my_center|LOCUS_20250 9331 11307 gene locus_tag LOCUS_20260 gene acs 9331 11307 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926941.1 protein_id gnl|my_center|LOCUS_20260 11340 11939 gene locus_tag LOCUS_20270 11340 11939 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_20270 12883 12017 gene locus_tag LOCUS_20280 12883 12017 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921324.1 protein_id gnl|my_center|LOCUS_20280 13012 13878 gene locus_tag LOCUS_20290 13012 13878 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_20290 14125 13889 gene locus_tag LOCUS_20300 14125 13889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 14607 14125 gene locus_tag LOCUS_20310 14607 14125 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941405.1 protein_id gnl|my_center|LOCUS_20310 14872 14684 gene locus_tag LOCUS_20320 14872 14684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 15466 15014 gene locus_tag LOCUS_20330 15466 15014 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247110.1 protein_id gnl|my_center|LOCUS_20330 16866 15583 gene locus_tag LOCUS_20340 16866 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20340 17357 16860 gene locus_tag LOCUS_20350 17357 16860 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114245.1 protein_id gnl|my_center|LOCUS_20350 18375 17377 gene locus_tag LOCUS_20360 18375 17377 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770956.1 protein_id gnl|my_center|LOCUS_20360 19284 18451 gene locus_tag LOCUS_20370 19284 18451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 20095 19484 gene locus_tag LOCUS_20380 20095 19484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 <21994 20221 gene locus_tag LOCUS_20390 <21994 20221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037640.1:polyribonucleotide nucleotidyltransferase >Feature sequence047 38 1456 gene locus_tag LOCUS_20400 38 1456 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_20400 1556 1912 gene locus_tag LOCUS_20410 1556 1912 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_20410 2001 2318 gene locus_tag LOCUS_20420 2001 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20420 2380 3195 gene locus_tag LOCUS_20430 2380 3195 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_20430 3345 5696 gene locus_tag LOCUS_20440 3345 5696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 6337 5894 gene locus_tag LOCUS_20450 6337 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20450 8327 6663 gene locus_tag LOCUS_20460 8327 6663 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389659.1 protein_id gnl|my_center|LOCUS_20460 9849 8401 gene locus_tag LOCUS_20470 gene nhaD 9849 8401 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_20470 11862 9880 gene locus_tag LOCUS_20480 11862 9880 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_20480 12041 12937 gene locus_tag LOCUS_20490 12041 12937 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545844.1 protein_id gnl|my_center|LOCUS_20490 14345 12942 gene locus_tag LOCUS_20500 14345 12942 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067337.1 protein_id gnl|my_center|LOCUS_20500 16908 14635 gene locus_tag LOCUS_20510 16908 14635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 17609 18967 gene locus_tag LOCUS_20520 17609 18967 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404713.1 protein_id gnl|my_center|LOCUS_20520 18964 19311 gene locus_tag LOCUS_20530 18964 19311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 >Feature sequence048 178 2655 gene locus_tag LOCUS_20540 178 2655 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 protein_id gnl|my_center|LOCUS_20540 4035 2968 gene locus_tag LOCUS_20550 gene hemE 4035 2968 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765484.1 protein_id gnl|my_center|LOCUS_20550 4520 4065 gene locus_tag LOCUS_20560 4520 4065 CDS product CBU_1594 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772128.1 protein_id gnl|my_center|LOCUS_20560 4784 4530 gene locus_tag LOCUS_20570 gene rpsU 4784 4530 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001144069.1 protein_id gnl|my_center|LOCUS_20570 4886 5914 gene locus_tag LOCUS_20580 gene tsaD 4886 5914 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262666.1 protein_id gnl|my_center|LOCUS_20580 6332 5925 gene locus_tag LOCUS_20590 gene merR 6332 5925 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429838.1 protein_id gnl|my_center|LOCUS_20590 6763 6329 gene locus_tag LOCUS_20600 gene cueR 6763 6329 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528067.1 protein_id gnl|my_center|LOCUS_20600 7019 6750 gene locus_tag LOCUS_20610 7019 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20610 7503 7102 gene locus_tag LOCUS_20620 7503 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 7796 7500 gene locus_tag LOCUS_20630 7796 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 8619 7816 gene locus_tag LOCUS_20640 8619 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20640 9683 8748 gene locus_tag LOCUS_20650 9683 8748 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097980.1 protein_id gnl|my_center|LOCUS_20650 9993 9766 gene locus_tag LOCUS_20660 9993 9766 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_20660 10792 10151 gene locus_tag LOCUS_20670 10792 10151 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216918.1 protein_id gnl|my_center|LOCUS_20670 11002 10817 gene locus_tag LOCUS_20680 11002 10817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 11256 11588 gene locus_tag LOCUS_20690 11256 11588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 11663 12961 gene locus_tag LOCUS_20700 11663 12961 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_20700 12965 14137 gene locus_tag LOCUS_20710 12965 14137 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_20710 14149 17340 gene locus_tag LOCUS_20720 14149 17340 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_20720 17991 17341 gene locus_tag LOCUS_20730 gene crp 17991 17341 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070954.1 protein_id gnl|my_center|LOCUS_20730 18075 18491 gene locus_tag LOCUS_20740 18075 18491 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767887.1 protein_id gnl|my_center|LOCUS_20740 18488 20143 gene locus_tag LOCUS_20750 18488 20143 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037762.1 protein_id gnl|my_center|LOCUS_20750 20154 20561 gene locus_tag LOCUS_20760 20154 20561 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_20760 21265 20627 gene locus_tag LOCUS_20770 gene coq7 21265 20627 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011214319.1 protein_id gnl|my_center|LOCUS_20770 21342 21665 gene locus_tag LOCUS_20780 21342 21665 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence049 994 560 gene locus_tag LOCUS_20790 994 560 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_20790 1054 2082 gene locus_tag LOCUS_20800 gene dusB 1054 2082 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095402.1 protein_id gnl|my_center|LOCUS_20800 2079 2375 gene locus_tag LOCUS_20810 2079 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20810 2848 2420 gene locus_tag LOCUS_20820 2848 2420 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061418.1 protein_id gnl|my_center|LOCUS_20820 3037 4599 gene locus_tag LOCUS_20830 gene purH 3037 4599 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941271.1 protein_id gnl|my_center|LOCUS_20830 5556 4921 gene locus_tag LOCUS_20840 5556 4921 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_20840 6178 5639 gene locus_tag LOCUS_20850 6178 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 7584 6175 gene locus_tag LOCUS_20860 gene ccoG 7584 6175 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_20860 7924 7667 gene locus_tag LOCUS_20870 7924 7667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20870 8866 7955 gene locus_tag LOCUS_20880 gene ccoP 8866 7955 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930775.1 protein_id gnl|my_center|LOCUS_20880 9033 8872 gene locus_tag LOCUS_20890 9033 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 9641 9030 gene locus_tag LOCUS_20900 gene ccoO 9641 9030 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087303.1 protein_id gnl|my_center|LOCUS_20900 11075 9654 gene locus_tag LOCUS_20910 gene ccoN 11075 9654 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076726.1 protein_id gnl|my_center|LOCUS_20910 11829 11230 gene locus_tag LOCUS_20920 11829 11230 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082455.1 protein_id gnl|my_center|LOCUS_20920 12182 13570 gene locus_tag LOCUS_20930 gene hemN 12182 13570 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099379.1 protein_id gnl|my_center|LOCUS_20930 14476 13745 gene locus_tag LOCUS_20940 gene anr 14476 13745 CDS product transcriptional regulator Anr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087262.1 protein_id gnl|my_center|LOCUS_20940 14707 17046 gene locus_tag LOCUS_20950 14707 17046 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457369.1 protein_id gnl|my_center|LOCUS_20950 17046 17228 gene locus_tag LOCUS_20960 17046 17228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20960 17225 17770 gene locus_tag LOCUS_20970 17225 17770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 18553 17783 gene locus_tag LOCUS_20980 18553 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20980 18757 19887 gene locus_tag LOCUS_20990 18757 19887 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_20990 19988 20518 gene locus_tag LOCUS_21000 19988 20518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21000 20505 21284 gene locus_tag LOCUS_21010 20505 21284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence050 3128 2160 gene locus_tag LOCUS_21020 3128 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3765 3142 gene locus_tag LOCUS_21030 3765 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 3970 3770 gene locus_tag LOCUS_21040 3970 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4979 4047 gene locus_tag LOCUS_21050 4979 4047 CDS product P22 phage major capsid protein family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005110305.1 protein_id gnl|my_center|LOCUS_21050 5883 4993 gene locus_tag LOCUS_21060 5883 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 6126 5917 gene locus_tag LOCUS_21070 6126 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 8188 6155 gene locus_tag LOCUS_21080 8188 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 10985 8199 gene locus_tag LOCUS_21090 10985 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 9096 9177 gene locus_tag LOCUS_t00230 9096 9177 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 11552 10992 gene locus_tag LOCUS_21100 11552 10992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 13021 11549 gene locus_tag LOCUS_21110 13021 11549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 13778 13026 gene locus_tag LOCUS_21120 13778 13026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 17524 13775 gene locus_tag LOCUS_21130 17524 13775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 18123 17524 gene locus_tag LOCUS_21140 18123 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 19298 18120 gene locus_tag LOCUS_21150 19298 18120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21150 19900 19370 gene locus_tag LOCUS_21160 19900 19370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21160 20081 19869 gene locus_tag LOCUS_21170 20081 19869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 20592 20074 gene locus_tag LOCUS_21180 20592 20074 CDS product N-acetylmuramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389986.1 protein_id gnl|my_center|LOCUS_21180 >Feature sequence051 261 701 gene locus_tag LOCUS_21190 261 701 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337321.1 protein_id gnl|my_center|LOCUS_21190 982 707 gene locus_tag LOCUS_21200 982 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029251.1 protein_id gnl|my_center|LOCUS_21200 1160 972 gene locus_tag LOCUS_21210 1160 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1861 1244 gene locus_tag LOCUS_21220 gene ubiX 1861 1244 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_21220 4180 2801 gene locus_tag LOCUS_21230 gene mpl 4180 2801 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_21230 4690 4184 gene locus_tag LOCUS_21240 4690 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21240 4740 5780 gene locus_tag LOCUS_21250 gene pyrC 4740 5780 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073490.1 protein_id gnl|my_center|LOCUS_21250 5773 6402 gene locus_tag LOCUS_21260 gene rnt 5773 6402 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_21260 6439 7428 gene locus_tag LOCUS_21270 6439 7428 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106524.1 protein_id gnl|my_center|LOCUS_21270 7821 7498 gene locus_tag LOCUS_21280 gene grxD 7821 7498 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_21280 9949 8174 gene locus_tag LOCUS_21290 9949 8174 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106635.1 protein_id gnl|my_center|LOCUS_21290 10291 10031 gene locus_tag LOCUS_21300 10291 10031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 10574 10293 gene locus_tag LOCUS_21310 10574 10293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21310 11083 11325 gene locus_tag LOCUS_21320 11083 11325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 11322 11723 gene locus_tag LOCUS_21330 11322 11723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 12059 11814 gene locus_tag LOCUS_21340 12059 11814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21340 14121 12154 gene locus_tag LOCUS_21350 14121 12154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 15288 14518 gene locus_tag LOCUS_21360 15288 14518 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070906.1 protein_id gnl|my_center|LOCUS_21360 16181 15285 gene locus_tag LOCUS_21370 16181 15285 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925611.1 protein_id gnl|my_center|LOCUS_21370 17364 16192 gene locus_tag LOCUS_21380 17364 16192 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070904.1 protein_id gnl|my_center|LOCUS_21380 19308 17746 gene locus_tag LOCUS_21390 19308 17746 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_21390 19466 20071 gene locus_tag LOCUS_21400 19466 20071 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919854.1 protein_id gnl|my_center|LOCUS_21400 >Feature sequence052 350 75 gene locus_tag LOCUS_21410 350 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 976 362 gene locus_tag LOCUS_21420 976 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 4137 973 gene locus_tag LOCUS_21430 4137 973 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_21430 6182 4134 gene locus_tag LOCUS_21440 6182 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 6734 6192 gene locus_tag LOCUS_21450 6734 6192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 6906 8348 gene locus_tag LOCUS_21460 6906 8348 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_21460 8358 9362 gene locus_tag LOCUS_21470 8358 9362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 11232 9370 gene locus_tag LOCUS_21480 11232 9370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 11765 11235 gene locus_tag LOCUS_21490 11765 11235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 12573 11959 gene locus_tag LOCUS_21500 12573 11959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 13726 13334 gene locus_tag LOCUS_21510 13726 13334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21510 14111 16195 gene locus_tag LOCUS_21520 gene fusA 14111 16195 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456593.1 protein_id gnl|my_center|LOCUS_21520 16982 16314 gene locus_tag LOCUS_21530 16982 16314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 17548 18309 gene locus_tag LOCUS_21540 17548 18309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21540 18918 18466 gene locus_tag LOCUS_21550 18918 18466 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702226.1 protein_id gnl|my_center|LOCUS_21550 19324 19076 gene locus_tag LOCUS_21560 19324 19076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_21560 >Feature sequence053 333 563 gene locus_tag LOCUS_21570 333 563 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379121.1 protein_id gnl|my_center|LOCUS_21570 589 1482 gene locus_tag LOCUS_21580 589 1482 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407877.1 protein_id gnl|my_center|LOCUS_21580 1507 3405 gene locus_tag LOCUS_21590 gene dxs 1507 3405 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 protein_id gnl|my_center|LOCUS_21590 3800 4186 gene locus_tag LOCUS_21600 gene queD 3800 4186 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_21600 4188 5015 gene locus_tag LOCUS_21610 gene folE2 4188 5015 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_21610 7073 5019 gene locus_tag LOCUS_21620 7073 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 7569 8003 gene locus_tag LOCUS_21630 7569 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21630 8019 9125 gene locus_tag LOCUS_21640 8019 9125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 10381 9269 gene locus_tag LOCUS_21650 10381 9269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 11255 10374 gene locus_tag LOCUS_21660 gene dapA 11255 10374 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379025.1 protein_id gnl|my_center|LOCUS_21660 11414 11794 gene locus_tag LOCUS_21670 11414 11794 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770186.1 protein_id gnl|my_center|LOCUS_21670 11920 12387 gene locus_tag LOCUS_21680 11920 12387 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104801.1 protein_id gnl|my_center|LOCUS_21680 12405 13349 gene locus_tag LOCUS_21690 12405 13349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 13380 13979 gene locus_tag LOCUS_21700 13380 13979 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065304.1 protein_id gnl|my_center|LOCUS_21700 14052 15338 gene locus_tag LOCUS_21710 gene purD 14052 15338 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456447.1 protein_id gnl|my_center|LOCUS_21710 17540 15663 gene locus_tag LOCUS_21720 17540 15663 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112817.1 protein_id gnl|my_center|LOCUS_21720 18293 17697 gene locus_tag LOCUS_21730 18293 17697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 >Feature sequence054 369 920 gene locus_tag LOCUS_21740 369 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 921 1598 gene locus_tag LOCUS_21750 921 1598 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_21750 1713 1910 gene locus_tag LOCUS_21760 1713 1910 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388999.1 protein_id gnl|my_center|LOCUS_21760 2042 2236 gene locus_tag LOCUS_21770 2042 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 3162 2440 gene locus_tag LOCUS_21780 3162 2440 CDS product DUF1223 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195184.1 protein_id gnl|my_center|LOCUS_21780 4705 3563 gene locus_tag LOCUS_21790 4705 3563 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257427.1 protein_id gnl|my_center|LOCUS_21790 5902 4724 gene locus_tag LOCUS_21800 5902 4724 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_21800 6398 5892 gene locus_tag LOCUS_21810 6398 5892 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_21810 6476 7003 gene locus_tag LOCUS_21820 6476 7003 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113919.1 protein_id gnl|my_center|LOCUS_21820 7689 7012 gene locus_tag LOCUS_21830 7689 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 9283 7781 gene locus_tag LOCUS_21840 gene purF 9283 7781 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_21840 9855 9283 gene locus_tag LOCUS_21850 gene cvpA 9855 9283 CDS product colicin V production protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420022.1 protein_id gnl|my_center|LOCUS_21850 10427 9936 gene locus_tag LOCUS_21860 10427 9936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 11878 10604 gene locus_tag LOCUS_21870 gene folC 11878 10604 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036164.1 protein_id gnl|my_center|LOCUS_21870 12904 12032 gene locus_tag LOCUS_21880 gene accD 12904 12032 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_21880 13769 12939 gene locus_tag LOCUS_21890 gene trpA 13769 12939 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_21890 14995 13766 gene locus_tag LOCUS_21900 gene trpB 14995 13766 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 protein_id gnl|my_center|LOCUS_21900 15614 14985 gene locus_tag LOCUS_21910 15614 14985 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_21910 16430 15624 gene locus_tag LOCUS_21920 gene truA 16430 15624 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072966.1 protein_id gnl|my_center|LOCUS_21920 19604 16671 gene locus_tag LOCUS_21930 19604 16671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence055 204 129 gene locus_tag LOCUS_t00240 204 129 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 678 340 gene locus_tag LOCUS_21940 678 340 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261019.1 protein_id gnl|my_center|LOCUS_21940 1770 736 gene locus_tag LOCUS_21950 1770 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 3308 2232 gene locus_tag LOCUS_21960 3308 2232 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937589.1 protein_id gnl|my_center|LOCUS_21960 4286 3423 gene locus_tag LOCUS_21970 4286 3423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 5641 4394 gene locus_tag LOCUS_21980 5641 4394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 6537 5764 gene locus_tag LOCUS_21990 6537 5764 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000702850.1 protein_id gnl|my_center|LOCUS_21990 7330 6497 gene locus_tag LOCUS_22000 7330 6497 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731237.1 protein_id gnl|my_center|LOCUS_22000 7484 7409 gene locus_tag LOCUS_t00250 7484 7409 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 8957 7539 gene locus_tag LOCUS_22010 gene gltX 8957 7539 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222185.1 protein_id gnl|my_center|LOCUS_22010 9052 10122 gene locus_tag LOCUS_22020 gene queG 9052 10122 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_22020 12074 10167 gene locus_tag LOCUS_22030 gene htpG 12074 10167 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038845.1 protein_id gnl|my_center|LOCUS_22030 13502 12312 gene locus_tag LOCUS_22040 13502 12312 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_22040 14260 13499 gene locus_tag LOCUS_22050 14260 13499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 14720 14253 gene locus_tag LOCUS_22060 14720 14253 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522636.1 protein_id gnl|my_center|LOCUS_22060 16691 14751 gene locus_tag LOCUS_22070 16691 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 17112 16768 gene locus_tag LOCUS_22080 gene rplS 17112 16768 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065250.1 protein_id gnl|my_center|LOCUS_22080 17923 17147 gene locus_tag LOCUS_22090 gene trmD 17923 17147 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704631.1 protein_id gnl|my_center|LOCUS_22090 >Feature sequence056 1442 825 gene locus_tag LOCUS_22100 1442 825 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103257.1 protein_id gnl|my_center|LOCUS_22100 2935 1439 gene locus_tag LOCUS_22110 2935 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 3089 4024 gene locus_tag LOCUS_22120 3089 4024 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104731.1 protein_id gnl|my_center|LOCUS_22120 4107 4541 gene locus_tag LOCUS_22130 4107 4541 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_22130 5218 4625 gene locus_tag LOCUS_22140 5218 4625 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_22140 6540 5215 gene locus_tag LOCUS_22150 6540 5215 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_22150 7038 6619 gene locus_tag LOCUS_22160 7038 6619 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_22160 8037 7225 gene locus_tag LOCUS_22170 8037 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 8139 9560 gene locus_tag LOCUS_22180 8139 9560 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815311.1 protein_id gnl|my_center|LOCUS_22180 10269 9619 gene locus_tag LOCUS_22190 10269 9619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 10728 10282 gene locus_tag LOCUS_22200 10728 10282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 12476 11202 gene locus_tag LOCUS_22210 12476 11202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 12559 13176 gene locus_tag LOCUS_22220 12559 13176 CDS product transglutaminase-like cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294588.1 protein_id gnl|my_center|LOCUS_22220 13176 15215 gene locus_tag LOCUS_22230 13176 15215 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938319.1 protein_id gnl|my_center|LOCUS_22230 15952 15209 gene locus_tag LOCUS_22240 15952 15209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 16814 16104 gene locus_tag LOCUS_22250 16814 16104 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 protein_id gnl|my_center|LOCUS_22250 17039 16854 gene locus_tag LOCUS_22260 17039 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 17342 17067 gene locus_tag LOCUS_22270 17342 17067 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_22270 17450 17809 gene locus_tag LOCUS_22280 17450 17809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22280 >Feature sequence057 1075 68 gene locus_tag LOCUS_22290 1075 68 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22290 1152 2534 gene locus_tag LOCUS_22300 1152 2534 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_22300 2537 3892 gene locus_tag LOCUS_22310 2537 3892 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948372.1 protein_id gnl|my_center|LOCUS_22310 3895 4458 gene locus_tag LOCUS_22320 gene rsmD 3895 4458 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763630.1 protein_id gnl|my_center|LOCUS_22320 4455 4958 gene locus_tag LOCUS_22330 gene coaD 4455 4958 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_22330 4975 5223 gene locus_tag LOCUS_22340 4975 5223 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763614.1 protein_id gnl|my_center|LOCUS_22340 5322 6932 gene locus_tag LOCUS_22350 gene ggt 5322 6932 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_22350 7209 6934 gene locus_tag LOCUS_22360 7209 6934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 9063 7276 gene locus_tag LOCUS_22370 9063 7276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 9143 9763 gene locus_tag LOCUS_22380 gene rluA 9143 9763 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073570.1 protein_id gnl|my_center|LOCUS_22380 10557 9835 gene locus_tag LOCUS_22390 10557 9835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 12323 10557 gene locus_tag LOCUS_22400 12323 10557 CDS product ExeA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071510.1 protein_id gnl|my_center|LOCUS_22400 12478 14490 gene locus_tag LOCUS_22410 12478 14490 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072396.1 protein_id gnl|my_center|LOCUS_22410 14487 16424 gene locus_tag LOCUS_22420 14487 16424 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_22420 16447 17403 gene locus_tag LOCUS_22430 gene dusA 16447 17403 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073658.1 protein_id gnl|my_center|LOCUS_22430 >Feature sequence058 722 87 gene locus_tag LOCUS_22440 gene rsxG 722 87 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_22440 1763 723 gene locus_tag LOCUS_22450 gene rsxD 1763 723 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072474.1 protein_id gnl|my_center|LOCUS_22450 3451 1763 gene locus_tag LOCUS_22460 3451 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 4053 3484 gene locus_tag LOCUS_22470 gene rsxB 4053 3484 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 protein_id gnl|my_center|LOCUS_22470 4650 4069 gene locus_tag LOCUS_22480 gene rsxA 4650 4069 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_22480 4846 5349 gene locus_tag LOCUS_22490 4846 5349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 7457 5391 gene locus_tag LOCUS_22500 gene metG 7457 5391 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816718.1 protein_id gnl|my_center|LOCUS_22500 7858 8973 gene locus_tag LOCUS_22510 7858 8973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 8966 9889 gene locus_tag LOCUS_22520 8966 9889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22520 10345 9872 gene locus_tag LOCUS_22530 10345 9872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22530 11324 12412 gene locus_tag LOCUS_22540 gene apbC 11324 12412 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_22540 12766 12479 gene locus_tag LOCUS_22550 12766 12479 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811141.1 protein_id gnl|my_center|LOCUS_22550 13240 13806 gene locus_tag LOCUS_22560 gene dcd 13240 13806 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003808382.1 protein_id gnl|my_center|LOCUS_22560 14116 14787 gene locus_tag LOCUS_22570 14116 14787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 15427 14771 gene locus_tag LOCUS_22580 15427 14771 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_22580 15595 16062 gene locus_tag LOCUS_22590 15595 16062 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814635.1 protein_id gnl|my_center|LOCUS_22590 16566 16144 gene locus_tag LOCUS_22600 16566 16144 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_22600 >Feature sequence059 152 811 gene locus_tag LOCUS_22610 152 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22610 1762 1055 gene locus_tag LOCUS_22620 gene trmH 1762 1055 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042026804.1 protein_id gnl|my_center|LOCUS_22620 2583 1783 gene locus_tag LOCUS_22630 2583 1783 CDS product TerC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008654400.1 protein_id gnl|my_center|LOCUS_22630 2773 3582 gene locus_tag LOCUS_22640 2773 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 3968 3768 gene locus_tag LOCUS_22650 3968 3768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 5164 4067 gene locus_tag LOCUS_22660 5164 4067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 5267 6109 gene locus_tag LOCUS_22670 5267 6109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22670 7478 6129 gene locus_tag LOCUS_22680 gene yegQ 7478 6129 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071476.1 protein_id gnl|my_center|LOCUS_22680 8493 7591 gene locus_tag LOCUS_22690 8493 7591 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_22690 8683 9810 gene locus_tag LOCUS_22700 8683 9810 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_22700 10097 11320 gene locus_tag LOCUS_22710 10097 11320 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_22710 11417 12901 gene locus_tag LOCUS_22720 11417 12901 CDS product DUF853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706587.1 protein_id gnl|my_center|LOCUS_22720 13254 13544 gene locus_tag LOCUS_22730 13254 13544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 13571 13906 gene locus_tag LOCUS_22740 13571 13906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 14150 14425 gene locus_tag LOCUS_22750 14150 14425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 14542 16116 gene locus_tag LOCUS_22760 gene gshA 14542 16116 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_22760 >Feature sequence060 1219 1401 gene locus_tag LOCUS_22770 1219 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1841 1584 gene locus_tag LOCUS_22780 1841 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 2225 2491 gene locus_tag LOCUS_22790 2225 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22790 3270 2503 gene locus_tag LOCUS_22800 3270 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 8365 3494 gene locus_tag LOCUS_22810 8365 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22810 11543 8895 gene locus_tag LOCUS_22820 11543 8895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 12346 13560 gene locus_tag LOCUS_22830 12346 13560 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404343.1 protein_id gnl|my_center|LOCUS_22830 14323 14562 gene locus_tag LOCUS_22840 14323 14562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22840 14555 15802 gene locus_tag LOCUS_22850 14555 15802 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533371.1 protein_id gnl|my_center|LOCUS_22850 >Feature sequence061 927 361 gene locus_tag LOCUS_22860 927 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 1231 1584 gene locus_tag LOCUS_22870 gene arsC 1231 1584 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000166449.1 protein_id gnl|my_center|LOCUS_22870 1584 2198 gene locus_tag LOCUS_22880 gene wrbA 1584 2198 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115189.1 protein_id gnl|my_center|LOCUS_22880 2210 2569 gene locus_tag LOCUS_22890 2210 2569 CDS product DUF2069 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705569.1 protein_id gnl|my_center|LOCUS_22890 3424 2729 gene locus_tag LOCUS_22900 gene hda 3424 2729 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958403.1 protein_id gnl|my_center|LOCUS_22900 4630 3431 gene locus_tag LOCUS_22910 4630 3431 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958404.1 protein_id gnl|my_center|LOCUS_22910 4769 5812 gene locus_tag LOCUS_22920 gene purM 4769 5812 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000016423.1 protein_id gnl|my_center|LOCUS_22920 5813 6475 gene locus_tag LOCUS_22930 gene purN 5813 6475 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_22930 6508 7188 gene locus_tag LOCUS_22940 6508 7188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 7181 7711 gene locus_tag LOCUS_22950 gene yjgA 7181 7711 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707625.1 protein_id gnl|my_center|LOCUS_22950 8693 7905 gene locus_tag LOCUS_22960 8693 7905 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_22960 9067 8714 gene locus_tag LOCUS_22970 9067 8714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 12665 9060 gene locus_tag LOCUS_22980 12665 9060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 14159 12714 gene locus_tag LOCUS_22990 gene rng 14159 12714 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_22990 14785 14156 gene locus_tag LOCUS_23000 14785 14156 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064139.1 protein_id gnl|my_center|LOCUS_23000 14951 15625 gene locus_tag LOCUS_23010 14951 15625 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185803.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence062 1185 994 gene locus_tag LOCUS_23020 1185 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23020 2846 3349 gene locus_tag LOCUS_23030 2846 3349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 5282 5055 gene locus_tag LOCUS_23040 5282 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23040 6362 5619 gene locus_tag LOCUS_23050 6362 5619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23050 9322 6380 gene locus_tag LOCUS_23060 9322 6380 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_23060 10386 9322 gene locus_tag LOCUS_23070 10386 9322 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143360.1 protein_id gnl|my_center|LOCUS_23070 11064 10405 gene locus_tag LOCUS_23080 11064 10405 CDS product DUF4433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143359.1 protein_id gnl|my_center|LOCUS_23080 12479 11067 gene locus_tag LOCUS_23090 12479 11067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23090 14805 12472 gene locus_tag LOCUS_23100 14805 12472 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114406.1 protein_id gnl|my_center|LOCUS_23100 15014 14802 gene locus_tag LOCUS_23110 15014 14802 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263390.1 protein_id gnl|my_center|LOCUS_23110 >Feature sequence063 1421 1882 gene locus_tag LOCUS_23120 1421 1882 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_23120 4310 1959 gene locus_tag LOCUS_23130 4310 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23130 4799 5770 gene locus_tag LOCUS_23140 gene rluC 4799 5770 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705035.1 protein_id gnl|my_center|LOCUS_23140 8187 5965 gene locus_tag LOCUS_23150 8187 5965 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481838.1 protein_id gnl|my_center|LOCUS_23150 9503 8247 gene locus_tag LOCUS_23160 9503 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23160 9683 9859 gene locus_tag LOCUS_23170 9683 9859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 10025 10228 gene locus_tag LOCUS_23180 10025 10228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23180 10789 10355 gene locus_tag LOCUS_23190 10789 10355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_23190 11016 11405 gene locus_tag LOCUS_23200 11016 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23200 11510 11752 gene locus_tag LOCUS_23210 11510 11752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23210 11756 12433 gene locus_tag LOCUS_23220 11756 12433 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_23220 12447 13763 gene locus_tag LOCUS_23230 12447 13763 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_23230 14255 15022 gene locus_tag LOCUS_23240 14255 15022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 >Feature sequence064 2273 1173 gene locus_tag LOCUS_23250 2273 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23250 3641 2637 gene locus_tag LOCUS_23260 gene epmA 3641 2637 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770152.1 protein_id gnl|my_center|LOCUS_23260 4217 3654 gene locus_tag LOCUS_23270 gene efp 4217 3654 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_23270 4324 5346 gene locus_tag LOCUS_23280 gene epmB 4324 5346 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958496.1 protein_id gnl|my_center|LOCUS_23280 5462 7273 gene locus_tag LOCUS_23290 5462 7273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105244.1 protein_id gnl|my_center|LOCUS_23290 7324 9417 gene locus_tag LOCUS_23300 gene fimX 7324 9417 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_23300 9430 9993 gene locus_tag LOCUS_23310 9430 9993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 10067 10273 gene locus_tag LOCUS_23320 10067 10273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23320 12576 10324 gene locus_tag LOCUS_23330 gene parC 12576 10324 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_23330 14672 12789 gene locus_tag LOCUS_23340 gene parE 14672 12789 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence065 2373 1903 gene locus_tag LOCUS_23350 gene rpsG 2373 1903 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306266.1 protein_id gnl|my_center|LOCUS_23350 2867 2379 gene locus_tag LOCUS_23360 gene rpsL 2867 2379 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004450478.1 protein_id gnl|my_center|LOCUS_23360 7264 2954 gene locus_tag LOCUS_23370 gene rpoC 7264 2954 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_23370 11460 7327 gene locus_tag LOCUS_23380 gene rpoB 11460 7327 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115576597.1 protein_id gnl|my_center|LOCUS_23380 12021 11641 gene locus_tag LOCUS_23390 gene rplL 12021 11641 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_23390 12609 12085 gene locus_tag LOCUS_23400 gene rplJ 12609 12085 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946071.1 protein_id gnl|my_center|LOCUS_23400 13572 12877 gene locus_tag LOCUS_23410 gene rplA 13572 12877 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262793.1 protein_id gnl|my_center|LOCUS_23410 14030 13575 gene locus_tag LOCUS_23420 gene rplK 14030 13575 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003690112.1 protein_id gnl|my_center|LOCUS_23420 14692 14159 gene locus_tag LOCUS_23430 gene nusG 14692 14159 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence066 427 194 gene locus_tag LOCUS_23440 427 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643598.1 protein_id gnl|my_center|LOCUS_23440 1667 567 gene locus_tag LOCUS_23450 1667 567 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113218.1 protein_id gnl|my_center|LOCUS_23450 2091 1870 gene locus_tag LOCUS_23460 2091 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 2411 2091 gene locus_tag LOCUS_23470 2411 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23470 3173 2520 gene locus_tag LOCUS_23480 3173 2520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23480 4523 3462 gene locus_tag LOCUS_23490 4523 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23490 6246 4627 gene locus_tag LOCUS_23500 6246 4627 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456743.1 protein_id gnl|my_center|LOCUS_23500 6428 6895 gene locus_tag LOCUS_23510 gene rnhA 6428 6895 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015471.1 protein_id gnl|my_center|LOCUS_23510 6936 7634 gene locus_tag LOCUS_23520 gene dnaQ 6936 7634 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957503.1 protein_id gnl|my_center|LOCUS_23520 8377 7904 gene locus_tag LOCUS_23530 gene smpB 8377 7904 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100496.1 protein_id gnl|my_center|LOCUS_23530 8530 9903 gene locus_tag LOCUS_23540 8530 9903 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024648070.1 protein_id gnl|my_center|LOCUS_23540 9913 10359 gene locus_tag LOCUS_23550 9913 10359 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210715.1 protein_id gnl|my_center|LOCUS_23550 10356 10673 gene locus_tag LOCUS_23560 10356 10673 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649214.1 protein_id gnl|my_center|LOCUS_23560 11098 10697 gene locus_tag LOCUS_23570 11098 10697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 11210 11617 gene locus_tag LOCUS_23580 gene fur 11210 11617 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_23580 11661 13832 gene locus_tag LOCUS_23590 gene relA 11661 13832 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704766.1 protein_id gnl|my_center|LOCUS_23590 >Feature sequence067 2254 1178 gene locus_tag LOCUS_23600 gene leuB 2254 1178 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091395.1 protein_id gnl|my_center|LOCUS_23600 3185 2379 gene locus_tag LOCUS_23610 3185 2379 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018647871.1 protein_id gnl|my_center|LOCUS_23610 3841 3290 gene locus_tag LOCUS_23620 3841 3290 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_23620 4218 4880 gene locus_tag LOCUS_23630 4218 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 6430 5225 gene locus_tag LOCUS_23640 gene tyrS 6430 5225 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479092.1 protein_id gnl|my_center|LOCUS_23640 6597 8114 gene locus_tag LOCUS_23650 6597 8114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23650 8119 9219 gene locus_tag LOCUS_23660 8119 9219 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_23660 9371 10078 gene locus_tag LOCUS_23670 9371 10078 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119447.1 protein_id gnl|my_center|LOCUS_23670 11237 10080 gene locus_tag LOCUS_23680 11237 10080 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_23680 11753 11376 gene locus_tag LOCUS_23690 gene erpA 11753 11376 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420796.1 protein_id gnl|my_center|LOCUS_23690 12290 11862 gene locus_tag LOCUS_23700 12290 11862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 13029 12271 gene locus_tag LOCUS_23710 13029 12271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 14089 13055 gene locus_tag LOCUS_23720 gene argC 14089 13055 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence068 3 194 gene locus_tag LOCUS_23730 gene ccmD 3 194 CDS product heme exporter protein CcmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070634.1 protein_id gnl|my_center|LOCUS_23730 203 646 gene locus_tag LOCUS_23740 gene ccmE 203 646 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387797.1 protein_id gnl|my_center|LOCUS_23740 646 2601 gene locus_tag LOCUS_23750 646 2601 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114291.1 protein_id gnl|my_center|LOCUS_23750 2604 3179 gene locus_tag LOCUS_23760 2604 3179 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171969.1 protein_id gnl|my_center|LOCUS_23760 3167 3655 gene locus_tag LOCUS_23770 gene ccmH 3167 3655 CDS product cytochrome c maturation protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114292.1 protein_id gnl|my_center|LOCUS_23770 3661 4947 gene locus_tag LOCUS_23780 gene ccmI 3661 4947 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083145.1 protein_id gnl|my_center|LOCUS_23780 4993 5607 gene locus_tag LOCUS_23790 gene dsbA 4993 5607 CDS product thiol:disulfide interchange protein DsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190112.1 protein_id gnl|my_center|LOCUS_23790 5756 6337 gene locus_tag LOCUS_23800 5756 6337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 6416 8014 gene locus_tag LOCUS_23810 6416 8014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 8073 8149 gene locus_tag LOCUS_t00260 8073 8149 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9330 8380 gene locus_tag LOCUS_23820 9330 8380 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007184747.1 protein_id gnl|my_center|LOCUS_23820 10270 9548 gene locus_tag LOCUS_23830 10270 9548 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_23830 10397 13129 gene locus_tag LOCUS_23840 gene polA 10397 13129 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_23840 >Feature sequence069 967 143 gene locus_tag LOCUS_23850 967 143 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002354922.1 protein_id gnl|my_center|LOCUS_23850 3665 978 gene locus_tag LOCUS_23860 3665 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 4827 3883 gene locus_tag LOCUS_23870 gene sppA 4827 3883 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_23870 5540 4848 gene locus_tag LOCUS_23880 5540 4848 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_23880 7940 5916 gene locus_tag LOCUS_23890 7940 5916 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947325.1 protein_id gnl|my_center|LOCUS_23890 9413 8112 gene locus_tag LOCUS_23900 9413 8112 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_23900 11931 9406 gene locus_tag LOCUS_23910 gene fadE 11931 9406 CDS product acyl-CoA dehydrogenase FadE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705468.1 protein_id gnl|my_center|LOCUS_23910 >Feature sequence070 45 1943 gene locus_tag LOCUS_23920 gene tkt 45 1943 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477253.1 protein_id gnl|my_center|LOCUS_23920 1990 2991 gene locus_tag LOCUS_23930 gene gap 1990 2991 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_23930 3250 4437 gene locus_tag LOCUS_23940 3250 4437 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704731.1 protein_id gnl|my_center|LOCUS_23940 4495 5919 gene locus_tag LOCUS_23950 gene pyk 4495 5919 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453949.1 protein_id gnl|my_center|LOCUS_23950 6038 7075 gene locus_tag LOCUS_23960 gene fba 6038 7075 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022162.1 protein_id gnl|my_center|LOCUS_23960 7364 7690 gene locus_tag LOCUS_23970 7364 7690 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525093.1 protein_id gnl|my_center|LOCUS_23970 8409 7708 gene locus_tag LOCUS_23980 gene bioD 8409 7708 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942228.1 protein_id gnl|my_center|LOCUS_23980 9333 8446 gene locus_tag LOCUS_23990 9333 8446 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189256.1 protein_id gnl|my_center|LOCUS_23990 9422 10129 gene locus_tag LOCUS_24000 9422 10129 CDS product glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207090.1 protein_id gnl|my_center|LOCUS_24000 >Feature sequence071 <1 2456 gene locus_tag LOCUS_24010 <1 2456 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703518.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase 2477 3418 gene locus_tag LOCUS_24020 gene ilvE 2477 3418 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_24020 3433 3645 gene locus_tag LOCUS_24030 3433 3645 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_24030 3645 4922 gene locus_tag LOCUS_24040 3645 4922 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088667.1 protein_id gnl|my_center|LOCUS_24040 4922 5710 gene locus_tag LOCUS_24050 4922 5710 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703807.1 protein_id gnl|my_center|LOCUS_24050 5707 6459 gene locus_tag LOCUS_24060 5707 6459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 6460 7824 gene locus_tag LOCUS_24070 6460 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 8929 7859 gene locus_tag LOCUS_24080 gene pseI 8929 7859 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867750.1 protein_id gnl|my_center|LOCUS_24080 9171 9848 gene locus_tag LOCUS_24090 9171 9848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24090 11137 9839 gene locus_tag LOCUS_24100 11137 9839 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763569.1 protein_id gnl|my_center|LOCUS_24100 <11890 11142 gene locus_tag LOCUS_24110 <11890 11142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066867757.1:pseudaminic acid cytidylyltransferase >Feature sequence072 1622 585 gene locus_tag LOCUS_24120 1622 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24120 1825 2295 gene locus_tag LOCUS_24130 1825 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 2292 2780 gene locus_tag LOCUS_24140 2292 2780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24140 3711 2830 gene locus_tag LOCUS_24150 3711 2830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 5709 3883 gene locus_tag LOCUS_24160 5709 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 6236 8515 gene locus_tag LOCUS_24170 6236 8515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 8568 10022 gene locus_tag LOCUS_24180 8568 10022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24180 11056 10133 gene locus_tag LOCUS_24190 11056 10133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24190 11512 11126 gene locus_tag LOCUS_24200 11512 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24200 >Feature sequence073 <1 2790 gene locus_tag LOCUS_24210 <1 2790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038418667.1:RNA polymerase-associated protein RapA 3045 6038 gene locus_tag LOCUS_24220 3045 6038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 6072 6905 gene locus_tag LOCUS_24230 6072 6905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 7569 6916 gene locus_tag LOCUS_24240 7569 6916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 7662 8015 gene locus_tag LOCUS_24250 7662 8015 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141229.1 protein_id gnl|my_center|LOCUS_24250 8404 8024 gene locus_tag LOCUS_24260 8404 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24260 8481 8879 gene locus_tag LOCUS_24270 8481 8879 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_24270 8973 10304 gene locus_tag LOCUS_24280 8973 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24280 10510 10319 gene locus_tag LOCUS_24290 10510 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 11148 10525 gene locus_tag LOCUS_24300 11148 10525 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003706646.1 protein_id gnl|my_center|LOCUS_24300 >Feature sequence074 2134 824 gene locus_tag LOCUS_24310 2134 824 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_24310 2232 2600 gene locus_tag LOCUS_24320 2232 2600 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_24320 4295 3258 gene locus_tag LOCUS_24330 gene rpoS 4295 3258 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209397.1 protein_id gnl|my_center|LOCUS_24330 5456 4536 gene locus_tag LOCUS_24340 5456 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 6069 5494 gene locus_tag LOCUS_24350 6069 5494 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_24350 6742 6077 gene locus_tag LOCUS_24360 6742 6077 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_24360 7498 6758 gene locus_tag LOCUS_24370 gene surE 7498 6758 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073291.1 protein_id gnl|my_center|LOCUS_24370 7493 8104 gene locus_tag LOCUS_24380 7493 8104 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948011.1 protein_id gnl|my_center|LOCUS_24380 8584 8991 gene locus_tag LOCUS_24390 8584 8991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24390 9073 9870 gene locus_tag LOCUS_24400 9073 9870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 10448 10056 gene locus_tag LOCUS_24410 10448 10056 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_24410 10705 10445 gene locus_tag LOCUS_24420 10705 10445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24420 >Feature sequence075 3435 604 gene locus_tag LOCUS_24430 3435 604 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103493.1 protein_id gnl|my_center|LOCUS_24430 4281 3517 gene locus_tag LOCUS_24440 4281 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 4783 4295 gene locus_tag LOCUS_24450 4783 4295 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764092.1 protein_id gnl|my_center|LOCUS_24450 6272 4773 gene locus_tag LOCUS_24460 gene pepA 6272 4773 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175279.1 protein_id gnl|my_center|LOCUS_24460 6428 7522 gene locus_tag LOCUS_24470 gene lptF 6428 7522 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092864.1 protein_id gnl|my_center|LOCUS_24470 7530 8591 gene locus_tag LOCUS_24480 gene lptG 7530 8591 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000472776.1 protein_id gnl|my_center|LOCUS_24480 8973 8596 gene locus_tag LOCUS_24490 8973 8596 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533619.1 protein_id gnl|my_center|LOCUS_24490 9213 10397 gene locus_tag LOCUS_24500 9213 10397 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976357.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence076 <1 712 gene locus_tag LOCUS_24510 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103910.1:MFS transporter 726 1184 gene locus_tag LOCUS_24520 726 1184 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261155.1 protein_id gnl|my_center|LOCUS_24520 1264 3093 gene locus_tag LOCUS_24530 gene glmS 1264 3093 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_24530 3278 4651 gene locus_tag LOCUS_24540 gene miaB 3278 4651 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 protein_id gnl|my_center|LOCUS_24540 4669 5688 gene locus_tag LOCUS_24550 4669 5688 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093159.1 protein_id gnl|my_center|LOCUS_24550 5678 6142 gene locus_tag LOCUS_24560 gene ybeY 5678 6142 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418185.1 protein_id gnl|my_center|LOCUS_24560 6146 6994 gene locus_tag LOCUS_24570 gene corC 6146 6994 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071409.1 protein_id gnl|my_center|LOCUS_24570 6972 8483 gene locus_tag LOCUS_24580 gene lnt 6972 8483 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707020.1 protein_id gnl|my_center|LOCUS_24580 9232 8555 gene locus_tag LOCUS_24590 9232 8555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24590 10064 9534 gene locus_tag LOCUS_24600 10064 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 >Feature sequence077 3 1187 gene locus_tag LOCUS_24610 gene waaA 3 1187 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957353.1 protein_id gnl|my_center|LOCUS_24610 1969 1223 gene locus_tag LOCUS_24620 1969 1223 CDS product 3-deoxy-D-manno-octulosonic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704082.1 protein_id gnl|my_center|LOCUS_24620 2085 2477 gene locus_tag LOCUS_24630 2085 2477 CDS product DUF6165 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036195.1 protein_id gnl|my_center|LOCUS_24630 3454 2474 gene locus_tag LOCUS_24640 3454 2474 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114710.1 protein_id gnl|my_center|LOCUS_24640 3633 3454 gene locus_tag LOCUS_24650 3633 3454 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186709.1 protein_id gnl|my_center|LOCUS_24650 3756 4577 gene locus_tag LOCUS_24660 3756 4577 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100335.1 protein_id gnl|my_center|LOCUS_24660 4588 5208 gene locus_tag LOCUS_24670 gene thiE 4588 5208 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_24670 5242 6513 gene locus_tag LOCUS_24680 gene hemL 5242 6513 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707264.1 protein_id gnl|my_center|LOCUS_24680 6510 6803 gene locus_tag LOCUS_24690 6510 6803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24690 7028 7474 gene locus_tag LOCUS_24700 7028 7474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24700 7717 8157 gene locus_tag LOCUS_24710 7717 8157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24710 8438 8163 gene locus_tag LOCUS_24720 8438 8163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026029251.1 protein_id gnl|my_center|LOCUS_24720 8616 8428 gene locus_tag LOCUS_24730 8616 8428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 9316 8699 gene locus_tag LOCUS_24740 gene ubiX 9316 8699 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093227.1 protein_id gnl|my_center|LOCUS_24740 9511 10092 gene locus_tag LOCUS_24750 9511 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 >Feature sequence078 303 34 gene locus_tag LOCUS_24760 303 34 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 668 309 gene locus_tag LOCUS_24770 668 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 1188 679 gene locus_tag LOCUS_24780 1188 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 1974 1192 gene locus_tag LOCUS_24790 1974 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2289 1984 gene locus_tag LOCUS_24800 2289 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 2871 2293 gene locus_tag LOCUS_24810 2871 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 3196 2885 gene locus_tag LOCUS_24820 3196 2885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24820 3530 3189 gene locus_tag LOCUS_24830 3530 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4838 3540 gene locus_tag LOCUS_24840 4838 3540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 6830 4851 gene locus_tag LOCUS_24850 6830 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 8276 6831 gene locus_tag LOCUS_24860 8276 6831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24860 8848 8273 gene locus_tag LOCUS_24870 8848 8273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24870 9093 8845 gene locus_tag LOCUS_24880 9093 8845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24880 9870 10415 gene locus_tag LOCUS_24890 9870 10415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24890 >Feature sequence079 <1 509 gene locus_tag LOCUS_24900 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331475.1:TraB/VirB10 family protein 506 898 gene locus_tag LOCUS_24910 506 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 898 3378 gene locus_tag LOCUS_24920 898 3378 CDS product TraC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331477.1 protein_id gnl|my_center|LOCUS_24920 3375 3728 gene locus_tag LOCUS_24930 3375 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 3725 4288 gene locus_tag LOCUS_24940 3725 4288 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331480.1 protein_id gnl|my_center|LOCUS_24940 4276 4944 gene locus_tag LOCUS_24950 4276 4944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331481.1 protein_id gnl|my_center|LOCUS_24950 4941 5936 gene locus_tag LOCUS_24960 gene traU 4941 5936 CDS product conjugal transfer pilus assembly protein TraU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331482.1 protein_id gnl|my_center|LOCUS_24960 5897 6694 gene locus_tag LOCUS_24970 gene trbC 5897 6694 CDS product type-F conjugative transfer system pilin assembly protein TrbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331483.1 protein_id gnl|my_center|LOCUS_24970 6691 7866 gene locus_tag LOCUS_24980 6691 7866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 9000 9239 gene locus_tag LOCUS_24990 9000 9239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 9223 9615 gene locus_tag LOCUS_25000 gene traF 9223 9615 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331485.1 protein_id gnl|my_center|LOCUS_25000 9620 10345 gene locus_tag LOCUS_25010 9620 10345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 >Feature sequence080 6364 386 gene locus_tag LOCUS_25020 6364 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25020 7594 6374 gene locus_tag LOCUS_25030 7594 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25030 8424 7924 gene locus_tag LOCUS_25040 8424 7924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 9651 8446 gene locus_tag LOCUS_25050 9651 8446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 9981 10214 gene locus_tag LOCUS_25060 9981 10214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 >Feature sequence081 1572 661 gene locus_tag LOCUS_25070 1572 661 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097179.1 protein_id gnl|my_center|LOCUS_25070 1689 2060 gene locus_tag LOCUS_25080 1689 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 2113 2580 gene locus_tag LOCUS_25090 2113 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25090 3109 2840 gene locus_tag LOCUS_25100 3109 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 3178 5232 gene locus_tag LOCUS_25110 3178 5232 CDS product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 protein_id gnl|my_center|LOCUS_25110 5733 5251 gene locus_tag LOCUS_25120 gene mreD 5733 5251 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094389.1 protein_id gnl|my_center|LOCUS_25120 6592 5723 gene locus_tag LOCUS_25130 gene mreC 6592 5723 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704376.1 protein_id gnl|my_center|LOCUS_25130 7768 6722 gene locus_tag LOCUS_25140 7768 6722 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000473772.1 protein_id gnl|my_center|LOCUS_25140 8185 8472 gene locus_tag LOCUS_25150 gene gatC 8185 8472 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_25150 8481 9941 gene locus_tag LOCUS_25160 gene gatA 8481 9941 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112871.1 protein_id gnl|my_center|LOCUS_25160 >Feature sequence082 354 142 gene locus_tag LOCUS_25170 354 142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 542 1030 gene locus_tag LOCUS_25180 gene nrdR 542 1030 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259262.1 protein_id gnl|my_center|LOCUS_25180 1115 1870 gene locus_tag LOCUS_25190 1115 1870 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889327.1 protein_id gnl|my_center|LOCUS_25190 2074 3129 gene locus_tag LOCUS_25200 2074 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 3465 3722 gene locus_tag LOCUS_25210 3465 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25210 3846 4025 gene locus_tag LOCUS_25220 3846 4025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 4035 4418 gene locus_tag LOCUS_25230 4035 4418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 4604 4419 gene locus_tag LOCUS_25240 4604 4419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 4762 5409 gene locus_tag LOCUS_25250 4762 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 6875 6126 gene locus_tag LOCUS_25260 6875 6126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 7015 8154 gene locus_tag LOCUS_25270 7015 8154 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_25270 8351 9376 gene locus_tag LOCUS_25280 8351 9376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 9382 9585 gene locus_tag LOCUS_25290 9382 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25290 >Feature sequence083 863 1363 gene locus_tag LOCUS_25300 863 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25300 1492 2136 gene locus_tag LOCUS_25310 1492 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 2146 2274 gene locus_tag LOCUS_25320 2146 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 2376 3416 gene locus_tag LOCUS_25330 2376 3416 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167364873.1 protein_id gnl|my_center|LOCUS_25330 3429 5180 gene locus_tag LOCUS_25340 3429 5180 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_25340 6180 5230 gene locus_tag LOCUS_25350 6180 5230 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 protein_id gnl|my_center|LOCUS_25350 6488 7153 gene locus_tag LOCUS_25360 6488 7153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 7174 7440 gene locus_tag LOCUS_25370 7174 7440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 8438 7488 gene locus_tag LOCUS_25380 8438 7488 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 protein_id gnl|my_center|LOCUS_25380 8740 9363 gene locus_tag LOCUS_25390 8740 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 9457 9600 gene locus_tag LOCUS_25400 9457 9600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25400 >Feature sequence084 477 73 gene locus_tag LOCUS_25410 477 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 928 722 gene locus_tag LOCUS_25420 928 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 2084 1548 gene locus_tag LOCUS_25430 2084 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 3505 2786 gene locus_tag LOCUS_25440 3505 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25440 5254 4967 gene locus_tag LOCUS_25450 5254 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 5932 5675 gene locus_tag LOCUS_25460 5932 5675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 7085 7465 gene locus_tag LOCUS_25470 7085 7465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 8982 8689 gene locus_tag LOCUS_25480 8982 8689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence085 57 1388 gene locus_tag LOCUS_25490 gene aceF 57 1388 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_25490 1501 3258 gene locus_tag LOCUS_25500 gene lpdA 1501 3258 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192702.1 protein_id gnl|my_center|LOCUS_25500 3301 4224 gene locus_tag LOCUS_25510 3301 4224 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328581.1 protein_id gnl|my_center|LOCUS_25510 4221 4982 gene locus_tag LOCUS_25520 4221 4982 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089319.1 protein_id gnl|my_center|LOCUS_25520 5529 4996 gene locus_tag LOCUS_25530 5529 4996 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073158.1 protein_id gnl|my_center|LOCUS_25530 5664 6341 gene locus_tag LOCUS_25540 5664 6341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25540 7834 6377 gene locus_tag LOCUS_25550 gene gcvPB 7834 6377 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_25550 9213 7834 gene locus_tag LOCUS_25560 gene gcvPA 9213 7834 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945877.1 protein_id gnl|my_center|LOCUS_25560 >Feature sequence086 493 107 gene locus_tag LOCUS_25570 gene gcvH 493 107 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001355634.1 protein_id gnl|my_center|LOCUS_25570 1645 542 gene locus_tag LOCUS_25580 gene gcvT 1645 542 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705608.1 protein_id gnl|my_center|LOCUS_25580 3245 2136 gene locus_tag LOCUS_25590 3245 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25590 3734 3291 gene locus_tag LOCUS_25600 3734 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 5040 3844 gene locus_tag LOCUS_25610 5040 3844 CDS product 2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266320.1 protein_id gnl|my_center|LOCUS_25610 6248 5040 gene locus_tag LOCUS_25620 gene ubiH 6248 5040 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_25620 7703 6399 gene locus_tag LOCUS_25630 gene pepP 7703 6399 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_25630 8315 7716 gene locus_tag LOCUS_25640 8315 7716 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945837.1 protein_id gnl|my_center|LOCUS_25640 8455 8667 gene locus_tag LOCUS_25650 8455 8667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 8732 9034 gene locus_tag LOCUS_25660 8732 9034 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096316.1 protein_id gnl|my_center|LOCUS_25660 >Feature sequence087 1064 1909 gene locus_tag LOCUS_25670 1064 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 2574 2104 gene locus_tag LOCUS_25680 gene rlmH 2574 2104 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 protein_id gnl|my_center|LOCUS_25680 2930 2574 gene locus_tag LOCUS_25690 gene rsfS 2930 2574 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_25690 3546 2920 gene locus_tag LOCUS_25700 gene nadD 3546 2920 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210330.1 protein_id gnl|my_center|LOCUS_25700 4038 3691 gene locus_tag LOCUS_25710 4038 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25710 5339 4056 gene locus_tag LOCUS_25720 5339 4056 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_25720 6418 5417 gene locus_tag LOCUS_25730 gene holA 6418 5417 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114330.1 protein_id gnl|my_center|LOCUS_25730 6921 6418 gene locus_tag LOCUS_25740 6921 6418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 <9069 6908 gene locus_tag LOCUS_25750 <9069 6908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_154223677.1:leucine--tRNA ligase >Feature sequence088 467 213 gene locus_tag LOCUS_25760 467 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 825 454 gene locus_tag LOCUS_25770 825 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25770 1339 932 gene locus_tag LOCUS_25780 1339 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25780 1830 1336 gene locus_tag LOCUS_25790 1830 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25790 2223 1906 gene locus_tag LOCUS_25800 2223 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 2781 2530 gene locus_tag LOCUS_25810 2781 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3140 2973 gene locus_tag LOCUS_25820 3140 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25820 4232 3816 gene locus_tag LOCUS_25830 4232 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25830 4356 4559 gene locus_tag LOCUS_25840 4356 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 4780 7179 gene locus_tag LOCUS_25850 4780 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 7506 8252 gene locus_tag LOCUS_25860 7506 8252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25860 >Feature sequence089 <1 8702 gene locus_tag LOCUS_25870 <1 8702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024696519.1:calcium-binding protein >Feature sequence090 145 474 gene locus_tag LOCUS_25880 gene cyaY 145 474 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768497.1 protein_id gnl|my_center|LOCUS_25880 743 564 gene locus_tag LOCUS_25890 743 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 845 1483 gene locus_tag LOCUS_25900 845 1483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 4133 1494 gene locus_tag LOCUS_25910 4133 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25910 5464 4130 gene locus_tag LOCUS_25920 5464 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25920 6168 5479 gene locus_tag LOCUS_25930 6168 5479 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265940.1 protein_id gnl|my_center|LOCUS_25930 6750 6445 gene locus_tag LOCUS_25940 6750 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 7504 6755 gene locus_tag LOCUS_25950 gene moeB 7504 6755 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198009.1 protein_id gnl|my_center|LOCUS_25950 7913 7530 gene locus_tag LOCUS_25960 7913 7530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 8794 7967 gene locus_tag LOCUS_25970 gene prmC 8794 7967 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073596.1 protein_id gnl|my_center|LOCUS_25970 >Feature sequence091 184 3180 gene locus_tag LOCUS_25980 184 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 3335 4687 gene locus_tag LOCUS_25990 3335 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25990 5721 4798 gene locus_tag LOCUS_26000 5721 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 8016 5728 gene locus_tag LOCUS_26010 8016 5728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 8531 8145 gene locus_tag LOCUS_26020 8531 8145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence092 1445 123 gene locus_tag LOCUS_26030 1445 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2318 1980 gene locus_tag LOCUS_26040 2318 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26040 2687 2340 gene locus_tag LOCUS_26050 2687 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26050 3132 2740 gene locus_tag LOCUS_26060 3132 2740 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_26060 3528 3202 gene locus_tag LOCUS_26070 3528 3202 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036235.1 protein_id gnl|my_center|LOCUS_26070 3749 3525 gene locus_tag LOCUS_26080 3749 3525 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402169.1 protein_id gnl|my_center|LOCUS_26080 4686 3820 gene locus_tag LOCUS_26090 gene panC 4686 3820 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071159.1 protein_id gnl|my_center|LOCUS_26090 5511 4693 gene locus_tag LOCUS_26100 gene panB 5511 4693 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_26100 6230 5508 gene locus_tag LOCUS_26110 6230 5508 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_26110 6727 6227 gene locus_tag LOCUS_26120 gene folK 6727 6227 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_26120 8154 6736 gene locus_tag LOCUS_26130 gene pcnB 8154 6736 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026612395.1 protein_id gnl|my_center|LOCUS_26130 <8786 8179 gene locus_tag LOCUS_26140 <8786 8179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_020980579.1:O-methyltransferase >Feature sequence093 183 1493 gene locus_tag LOCUS_26150 gene secY 183 1493 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_26150 1746 2102 gene locus_tag LOCUS_26160 gene rpsM 1746 2102 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 protein_id gnl|my_center|LOCUS_26160 2129 2512 gene locus_tag LOCUS_26170 gene rpsK 2129 2512 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 protein_id gnl|my_center|LOCUS_26170 2527 3147 gene locus_tag LOCUS_26180 gene rpsD 2527 3147 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 protein_id gnl|my_center|LOCUS_26180 3162 4142 gene locus_tag LOCUS_26190 gene rpoA 3162 4142 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_26190 4193 4573 gene locus_tag LOCUS_26200 gene rplQ 4193 4573 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417273.1 protein_id gnl|my_center|LOCUS_26200 5062 4682 gene locus_tag LOCUS_26210 5062 4682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 8089 5147 gene locus_tag LOCUS_26220 gene uvrA 8089 5147 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_26220 >Feature sequence094 <1 860 gene locus_tag LOCUS_26230 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706139.1:quinone-dependent dihydroorotate dehydrogenase 956 1351 gene locus_tag LOCUS_26240 956 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26240 1358 3793 gene locus_tag LOCUS_26250 1358 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 4346 3798 gene locus_tag LOCUS_26260 4346 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 4832 4380 gene locus_tag LOCUS_26270 4832 4380 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090444.1 protein_id gnl|my_center|LOCUS_26270 5977 4829 gene locus_tag LOCUS_26280 5977 4829 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403536.1 protein_id gnl|my_center|LOCUS_26280 7578 6208 gene locus_tag LOCUS_26290 gene purB 7578 6208 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence095 881 1231 gene locus_tag LOCUS_26300 881 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 1281 2012 gene locus_tag LOCUS_26310 1281 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26310 2425 2153 gene locus_tag LOCUS_26320 2425 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 2703 2452 gene locus_tag LOCUS_26330 2703 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26330 3720 3094 gene locus_tag LOCUS_26340 3720 3094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 4202 3819 gene locus_tag LOCUS_26350 4202 3819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 4538 5569 gene locus_tag LOCUS_26360 4538 5569 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001072162.1 protein_id gnl|my_center|LOCUS_26360 5721 6617 gene locus_tag LOCUS_26370 5721 6617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 7137 8294 gene locus_tag LOCUS_26380 7137 8294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 >Feature sequence096 <1 879 gene locus_tag LOCUS_26390 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093159.1:PhoH family protein 869 1333 gene locus_tag LOCUS_26400 gene ybeY 869 1333 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005663323.1 protein_id gnl|my_center|LOCUS_26400 1337 2191 gene locus_tag LOCUS_26410 gene corC 1337 2191 CDS product CNNM family magnesium/cobalt transport protein CorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071409.1 protein_id gnl|my_center|LOCUS_26410 2193 3683 gene locus_tag LOCUS_26420 gene lnt 2193 3683 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707020.1 protein_id gnl|my_center|LOCUS_26420 3777 4121 gene locus_tag LOCUS_26430 3777 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 4123 4404 gene locus_tag LOCUS_26440 4123 4404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26440 4459 5910 gene locus_tag LOCUS_26450 4459 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 5927 6346 gene locus_tag LOCUS_26460 5927 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 6358 6789 gene locus_tag LOCUS_26470 6358 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 6971 7726 gene locus_tag LOCUS_26480 6971 7726 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942188.1 protein_id gnl|my_center|LOCUS_26480 >Feature sequence097 527 111 gene locus_tag LOCUS_26490 527 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 1326 544 gene locus_tag LOCUS_26500 1326 544 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207575.1 protein_id gnl|my_center|LOCUS_26500 1214 1426 gene locus_tag LOCUS_26510 1214 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26510 1792 2913 gene locus_tag LOCUS_26520 1792 2913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26520 2928 3449 gene locus_tag LOCUS_26530 2928 3449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26530 3466 4854 gene locus_tag LOCUS_26540 3466 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26540 6306 5047 gene locus_tag LOCUS_26550 6306 5047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26550 6947 6303 gene locus_tag LOCUS_26560 6947 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 7569 6976 gene locus_tag LOCUS_26570 7569 6976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26570 7853 7566 gene locus_tag LOCUS_26580 7853 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26580 >Feature sequence098 1427 42 gene locus_tag LOCUS_26590 1427 42 CDS product restriction endonuclease subunit S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110093.1 protein_id gnl|my_center|LOCUS_26590 4194 1429 gene locus_tag LOCUS_26600 4194 1429 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_26600 4708 4205 gene locus_tag LOCUS_26610 4708 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 4891 5235 gene locus_tag LOCUS_26620 4891 5235 CDS product type II toxin-antitoxin system MqsR family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461871.1 protein_id gnl|my_center|LOCUS_26620 5243 6259 gene locus_tag LOCUS_26630 5243 6259 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461870.1 protein_id gnl|my_center|LOCUS_26630 7283 7834 gene locus_tag LOCUS_26640 7283 7834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence099 4425 121 gene locus_tag LOCUS_26650 4425 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26650 4590 5189 gene locus_tag LOCUS_26660 4590 5189 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327233.1 protein_id gnl|my_center|LOCUS_26660 6434 7201 gene locus_tag LOCUS_26670 6434 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26670 >Feature sequence100 120 962 gene locus_tag LOCUS_26680 120 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26680 2247 4412 gene locus_tag LOCUS_26690 2247 4412 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268199.1 protein_id gnl|my_center|LOCUS_26690 4409 5776 gene locus_tag LOCUS_26700 4409 5776 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_26700 6258 6533 gene locus_tag LOCUS_26710 6258 6533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 >Feature sequence101 1843 1193 gene locus_tag LOCUS_26720 1843 1193 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_26720 2606 1989 gene locus_tag LOCUS_26730 2606 1989 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011215625.1 protein_id gnl|my_center|LOCUS_26730 2734 3381 gene locus_tag LOCUS_26740 2734 3381 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947024.1 protein_id gnl|my_center|LOCUS_26740 3386 3685 gene locus_tag LOCUS_26750 3386 3685 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_26750 3745 3831 gene locus_tag LOCUS_t00270 3745 3831 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3874 4131 gene locus_tag LOCUS_26760 3874 4131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26760 4510 4917 gene locus_tag LOCUS_26770 4510 4917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26770 5543 4980 gene locus_tag LOCUS_26780 5543 4980 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_26780 5922 5629 gene locus_tag LOCUS_26790 5922 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26790 6683 7240 gene locus_tag LOCUS_26800 6683 7240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 >Feature sequence102 2758 1400 gene locus_tag LOCUS_26810 2758 1400 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_26810 2934 2749 gene locus_tag LOCUS_26820 2934 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 3108 3773 gene locus_tag LOCUS_26830 3108 3773 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_26830 3760 5193 gene locus_tag LOCUS_26840 3760 5193 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_26840 5270 5932 gene locus_tag LOCUS_26850 5270 5932 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189255.1 protein_id gnl|my_center|LOCUS_26850 6865 6287 gene locus_tag LOCUS_26860 6865 6287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 >Feature sequence103 751 116 gene locus_tag LOCUS_26870 gene rsxG 751 116 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_26870 1788 748 gene locus_tag LOCUS_26880 gene rsxD 1788 748 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_26880 3476 1788 gene locus_tag LOCUS_26890 3476 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26890 4078 3509 gene locus_tag LOCUS_26900 gene rsxB 4078 3509 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 protein_id gnl|my_center|LOCUS_26900 4675 4094 gene locus_tag LOCUS_26910 gene rsxA 4675 4094 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418573.1 protein_id gnl|my_center|LOCUS_26910 4870 5373 gene locus_tag LOCUS_26920 4870 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26920 <7019 5422 gene locus_tag LOCUS_26930 <7019 5422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816718.1:methionine--tRNA ligase >Feature sequence104 531 232 gene locus_tag LOCUS_26940 gene yhbY 531 232 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001054291.1 protein_id gnl|my_center|LOCUS_26940 688 1314 gene locus_tag LOCUS_26950 gene rlmE 688 1314 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313635.1 protein_id gnl|my_center|LOCUS_26950 1502 3442 gene locus_tag LOCUS_26960 gene ftsH 1502 3442 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_26960 3612 4463 gene locus_tag LOCUS_26970 gene folP 3612 4463 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071428.1 protein_id gnl|my_center|LOCUS_26970 4500 5846 gene locus_tag LOCUS_26980 gene glmM 4500 5846 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095196.1 protein_id gnl|my_center|LOCUS_26980 >Feature sequence105 2302 341 gene locus_tag LOCUS_26990 gene mnmC 2302 341 CDS product bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114497.1 protein_id gnl|my_center|LOCUS_26990 2379 3125 gene locus_tag LOCUS_27000 2379 3125 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261672.1 protein_id gnl|my_center|LOCUS_27000 4182 3157 gene locus_tag LOCUS_27010 4182 3157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 5069 4218 gene locus_tag LOCUS_27020 gene rluB 5069 4218 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210627.1 protein_id gnl|my_center|LOCUS_27020 5905 5093 gene locus_tag LOCUS_27030 5905 5093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 6555 5947 gene locus_tag LOCUS_27040 6555 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27040 >Feature sequence106 191 2500 gene locus_tag LOCUS_27050 gene rnr 191 2500 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112282.1 protein_id gnl|my_center|LOCUS_27050 2497 3267 gene locus_tag LOCUS_27060 gene rlmB 2497 3267 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414481.1 protein_id gnl|my_center|LOCUS_27060 3276 4286 gene locus_tag LOCUS_27070 3276 4286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27070 4357 6057 gene locus_tag LOCUS_27080 gene recJ 4357 6057 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence107 2894 2526 gene locus_tag LOCUS_27090 2894 2526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 3083 2907 gene locus_tag LOCUS_27100 3083 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 3481 3732 gene locus_tag LOCUS_27110 3481 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 4425 4231 gene locus_tag LOCUS_27120 4425 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27120 6097 5753 gene locus_tag LOCUS_27130 6097 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27130 >Feature sequence108 213 3605 gene locus_tag LOCUS_27140 gene addA 213 3605 CDS product double-strand break repair helicase AddA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528327.1 protein_id gnl|my_center|LOCUS_27140 4358 3606 gene locus_tag LOCUS_27150 gene dsbC 4358 3606 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_27150 5463 4522 gene locus_tag LOCUS_27160 gene xerD 5463 4522 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707046.1 protein_id gnl|my_center|LOCUS_27160 6021 5635 gene locus_tag LOCUS_27170 6021 5635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27170 >Feature sequence109 1466 3421 gene locus_tag LOCUS_27180 1466 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 3469 4431 gene locus_tag LOCUS_27190 3469 4431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 4467 5303 gene locus_tag LOCUS_27200 4467 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence110 228 656 gene locus_tag LOCUS_27210 gene rplM 228 656 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094164.1 protein_id gnl|my_center|LOCUS_27210 666 1055 gene locus_tag LOCUS_27220 gene rpsI 666 1055 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083052.1 protein_id gnl|my_center|LOCUS_27220 1521 1594 gene locus_tag LOCUS_t00280 1521 1594 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2066 3073 gene locus_tag LOCUS_27230 2066 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 3868 3200 gene locus_tag LOCUS_27240 gene rpiA 3868 3200 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_27240 4092 5609 gene locus_tag LOCUS_27250 gene ilvA 4092 5609 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_27250 >Feature sequence111 596 2134 gene locus_tag LOCUS_27260 596 2134 CDS product phosphoethanolamine--lipid A transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104785.1 protein_id gnl|my_center|LOCUS_27260 2265 2978 gene locus_tag LOCUS_27270 2265 2978 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706252.1 protein_id gnl|my_center|LOCUS_27270 4394 3159 gene locus_tag LOCUS_27280 gene glcF 4394 3159 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813047.1 protein_id gnl|my_center|LOCUS_27280 <5435 4394 gene locus_tag LOCUS_27290 <5435 4394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000943059.1:glycolate oxidase subunit GlcE >Feature sequence112 336 590 gene locus_tag LOCUS_27300 336 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2533 1073 gene locus_tag LOCUS_27310 gene merA 2533 1073 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105636.1 protein_id gnl|my_center|LOCUS_27310 2969 2526 gene locus_tag LOCUS_27320 gene merC 2969 2526 CDS product organomercurial transporter MerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000522996.1 protein_id gnl|my_center|LOCUS_27320 3733 3095 gene locus_tag LOCUS_27330 gene plsY 3733 3095 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_27330 3823 4599 gene locus_tag LOCUS_27340 gene bioH 3823 4599 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208922.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence113 1028 639 gene locus_tag LOCUS_27350 1028 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 2703 1039 gene locus_tag LOCUS_27360 2703 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 2898 2713 gene locus_tag LOCUS_27370 2898 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 3447 2941 gene locus_tag LOCUS_27380 3447 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27380 >Feature sequence114 215 1249 gene locus_tag LOCUS_27390 gene pilT 215 1249 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084552.1 protein_id gnl|my_center|LOCUS_27390 1291 2460 gene locus_tag LOCUS_27400 1291 2460 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003704392.1 protein_id gnl|my_center|LOCUS_27400 2894 3418 gene locus_tag LOCUS_27410 2894 3418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 3589 4722 gene locus_tag LOCUS_27420 3589 4722 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439300.1 protein_id gnl|my_center|LOCUS_27420 >Feature sequence115 174 100 gene locus_tag LOCUS_t00290 174 100 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1285 428 gene locus_tag LOCUS_27430 gene ispE 1285 428 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706938.1 protein_id gnl|my_center|LOCUS_27430 1950 1291 gene locus_tag LOCUS_27440 gene lolB 1950 1291 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365627.1 protein_id gnl|my_center|LOCUS_27440 3608 1947 gene locus_tag LOCUS_27450 gene lbcA 3608 1947 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_27450 >Feature sequence116 335 1723 gene locus_tag LOCUS_27460 335 1723 CDS product conjugal transfer protein TraH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331488.1 protein_id gnl|my_center|LOCUS_27460 >Feature sequence117 894 607 gene locus_tag LOCUS_27470 894 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27470 2072 915 gene locus_tag LOCUS_27480 2072 915 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014070847.1 protein_id gnl|my_center|LOCUS_27480 2301 2065 gene locus_tag LOCUS_27490 2301 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27490 2441 2680 gene locus_tag LOCUS_27500 2441 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence118 663 373 gene locus_tag LOCUS_27510 663 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 1116 1250 gene locus_tag LOCUS_27520 1116 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 2613 2359 gene locus_tag LOCUS_27530 2613 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27530 3266 3583 gene locus_tag LOCUS_27540 3266 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 3917 4156 gene locus_tag LOCUS_27550 3917 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence119 591 1418 gene locus_tag LOCUS_27560 591 1418 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_27560 1472 2164 gene locus_tag LOCUS_27570 1472 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 2614 2186 gene locus_tag LOCUS_27580 2614 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 3378 2650 gene locus_tag LOCUS_27590 gene lpxH 3378 2650 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036171.1 protein_id gnl|my_center|LOCUS_27590 3889 3389 gene locus_tag LOCUS_27600 3889 3389 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_27600 3992 3916 gene locus_tag LOCUS_t00300 3992 3916 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence120 256 3513 gene locus_tag LOCUS_27610 256 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27610 >Feature sequence121 1847 936 gene locus_tag LOCUS_27620 1847 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 2184 1876 gene locus_tag LOCUS_27630 2184 1876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 2199 2298 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3622 3032 gene locus_tag LOCUS_27640 3622 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27640 >Feature sequence122 26 100 gene locus_tag LOCUS_t00310 26 100 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 3489 193 gene locus_tag LOCUS_27650 3489 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27650 >Feature sequence123 2470 935 gene locus_tag LOCUS_27660 gene gspE 2470 935 CDS product type II secretion system ATPase GspE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070564.1 protein_id gnl|my_center|LOCUS_27660 <3742 2454 gene locus_tag LOCUS_27670 <3742 2454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086028586.1:type II secretion system secretin GspD >Feature sequence124 1445 486 gene locus_tag LOCUS_27680 1445 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27680 2101 1469 gene locus_tag LOCUS_27690 gene parA 2101 1469 CDS product ParA family partition ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022836937.1 protein_id gnl|my_center|LOCUS_27690 2942 2127 gene locus_tag LOCUS_27700 2942 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27700 3439 3011 gene locus_tag LOCUS_27710 3439 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 >Feature sequence125 <1 694 gene locus_tag LOCUS_27720 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405200.1:response regulator transcription factor 699 2174 gene locus_tag LOCUS_27730 699 2174 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_27730 2322 2993 gene locus_tag LOCUS_27740 2322 2993 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_27740 >Feature sequence126 2668 1052 gene locus_tag LOCUS_27750 gene terL 2668 1052 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003751157.1 protein_id gnl|my_center|LOCUS_27750 3114 2665 gene locus_tag LOCUS_27760 3114 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence127 1348 185 gene locus_tag LOCUS_27770 1348 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2683 1505 gene locus_tag LOCUS_27780 2683 1505 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_27780 <3336 2800 gene locus_tag LOCUS_27790 <3336 2800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390821.1:phosphatase PAP2 family protein >Feature sequence128 <1 1175 gene locus_tag LOCUS_27800 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260968.1:glutamate--ammonia ligase 1285 1941 gene locus_tag LOCUS_27810 1285 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2153 3229 gene locus_tag LOCUS_27820 gene ntrB 2153 3229 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_27820 >Feature sequence129 66 1019 gene locus_tag LOCUS_27830 gene trxB 66 1019 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097640.1 protein_id gnl|my_center|LOCUS_27830 1031 2143 gene locus_tag LOCUS_27840 1031 2143 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192390.1 protein_id gnl|my_center|LOCUS_27840 2158 2829 gene locus_tag LOCUS_27850 gene aat 2158 2829 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072572.1 protein_id gnl|my_center|LOCUS_27850 >Feature sequence130 997 212 gene locus_tag LOCUS_27860 gene istB 997 212 CDS product IS21-like element ISMt2 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418125.1 protein_id gnl|my_center|LOCUS_27860 2573 1023 gene locus_tag LOCUS_27870 2573 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 >Feature sequence131 1328 1894 gene locus_tag LOCUS_27880 1328 1894 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_27880 1909 2499 gene locus_tag LOCUS_27890 1909 2499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27890 <3117 2612 gene locus_tag LOCUS_27900 <3117 2612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918954.1:peptide chain release factor 3 >Feature sequence132 980 825 gene locus_tag LOCUS_27910 980 825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 1274 2266 gene locus_tag LOCUS_27920 1274 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_27920 >Feature sequence133 482 333 gene locus_tag LOCUS_27930 482 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 >Feature sequence134 3025 197 gene locus_tag LOCUS_27940 3025 197 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence135 1177 1025 gene locus_tag LOCUS_27950 1177 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27950 2383 2482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence136 234 243 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 693 433 gene locus_tag LOCUS_27960 693 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27960 >Feature sequence137 1684 1250 gene locus_tag LOCUS_27970 gene rplO 1684 1250 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 protein_id gnl|my_center|LOCUS_27970 1869 1684 gene locus_tag LOCUS_27980 gene rpmD 1869 1684 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215447.1 protein_id gnl|my_center|LOCUS_27980 2400 1891 gene locus_tag LOCUS_27990 gene rpsE 2400 1891 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486682.1 protein_id gnl|my_center|LOCUS_27990 2759 2403 gene locus_tag LOCUS_28000 gene rplR 2759 2403 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099023.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence138 <1 724 gene locus_tag LOCUS_28010 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005416792.1:glycine--tRNA ligase subunit alpha 760 1122 gene locus_tag LOCUS_28020 760 1122 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence139 <1 2389 gene locus_tag LOCUS_28030 <1 2389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036532.1:TonB-dependent receptor >Feature sequence140 205 624 gene locus_tag LOCUS_28040 205 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 654 2654 gene locus_tag LOCUS_28050 654 2654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 >Feature sequence141 >Feature sequence142 2305 1634 gene locus_tag LOCUS_28060 gene queC 2305 1634 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_28060 >Feature sequence143 575 1534 gene locus_tag LOCUS_28070 575 1534 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_28070 1650 2300 gene locus_tag LOCUS_28080 1650 2300 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948352.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence144 39 407 gene locus_tag LOCUS_28090 gene rplN 39 407 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_28090 421 738 gene locus_tag LOCUS_28100 gene rplX 421 738 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021594.1 protein_id gnl|my_center|LOCUS_28100 773 1312 gene locus_tag LOCUS_28110 gene rplE 773 1312 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215436.1 protein_id gnl|my_center|LOCUS_28110 1335 1625 gene locus_tag LOCUS_28120 gene rpsN 1335 1625 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_28120 1639 2028 gene locus_tag LOCUS_28130 gene rpsH 1639 2028 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007644434.1 protein_id gnl|my_center|LOCUS_28130 2039 2572 gene locus_tag LOCUS_28140 gene rplF 2039 2572 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_28140 >Feature sequence145 565 1443 gene locus_tag LOCUS_28150 565 1443 CDS product zincin-like metallopeptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011313588.1 protein_id gnl|my_center|LOCUS_28150 1482 1676 gene locus_tag LOCUS_28160 1482 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 1790 2032 gene locus_tag LOCUS_28170 1790 2032 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530070.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence146 368 126 gene locus_tag LOCUS_28180 368 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 713 1264 gene locus_tag LOCUS_28190 713 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28190 1602 1270 gene locus_tag LOCUS_28200 1602 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 2204 1641 gene locus_tag LOCUS_28210 2204 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28210 >Feature sequence147 1353 55 gene locus_tag LOCUS_28220 1353 55 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534099.1 protein_id gnl|my_center|LOCUS_28220 2474 1668 gene locus_tag LOCUS_28230 2474 1668 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_28230 >Feature sequence148 2469 934 gene locus_tag LOCUS_28240 2469 934 CDS product IS1182-like element ISMac1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020521.1 protein_id gnl|my_center|LOCUS_28240 >Feature sequence149 >Feature sequence150 600 1241 gene locus_tag LOCUS_28250 600 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267038.1 protein_id gnl|my_center|LOCUS_28250 1519 2010 gene locus_tag LOCUS_28260 1519 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 >Feature sequence151 156 983 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttaatacccctacaaacgattacctgctacaat <2489 1082 gene locus_tag LOCUS_28270 <2489 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206966.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence152 900 301 gene locus_tag LOCUS_28280 900 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28280 2371 1145 gene locus_tag LOCUS_28290 2371 1145 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530116.1 protein_id gnl|my_center|LOCUS_28290 >Feature sequence153 1301 354 gene locus_tag LOCUS_28300 1301 354 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706646.1 protein_id gnl|my_center|LOCUS_28300 1905 1408 gene locus_tag LOCUS_28310 1905 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 2239 1919 gene locus_tag LOCUS_28320 gene flgM 2239 1919 CDS product flagellar biosynthesis anti-sigma factor FlgM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420410.1 protein_id gnl|my_center|LOCUS_28320 >Feature sequence154 2012 1191 gene locus_tag LOCUS_28330 2012 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence155 1011 688 gene locus_tag LOCUS_28340 1011 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 2009 1191 gene locus_tag LOCUS_28350 2009 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28350 >Feature sequence156 >Feature sequence157 <1 539 gene locus_tag LOCUS_28360 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331473.1:TraE/TraK family type IV conjugative transfer system protein 536 1234 gene locus_tag LOCUS_28370 536 1234 CDS product type-F conjugative transfer system secretin TraK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331474.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence158 >Feature sequence159 >Feature sequence160 30 1325 gene locus_tag LOCUS_28380 30 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 >Feature sequence161 >Feature sequence162 444 133 gene locus_tag LOCUS_28390 gene rplU 444 133 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000271393.1 protein_id gnl|my_center|LOCUS_28390 642 1667 gene locus_tag LOCUS_28400 gene ispB 642 1667 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_28400 >Feature sequence163 <1 1232 gene locus_tag LOCUS_28410 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947796.1:type-F conjugative transfer system mating-pair stabilization protein TraN >Feature sequence164 619 1101 gene locus_tag LOCUS_28420 619 1101 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 protein_id gnl|my_center|LOCUS_28420 1253 1621 gene locus_tag LOCUS_28430 1253 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 >Feature sequence165 256 32 gene locus_tag LOCUS_28440 256 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 468 253 gene locus_tag LOCUS_28450 468 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 804 481 gene locus_tag LOCUS_28460 804 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28460 1758 811 gene locus_tag LOCUS_28470 1758 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 >Feature sequence166 290 1108 gene locus_tag LOCUS_28480 290 1108 CDS product TIGR03761 family integrating conjugative element protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038897.1 protein_id gnl|my_center|LOCUS_28480 1118 1252 gene locus_tag LOCUS_28490 1118 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28490 1240 1572 gene locus_tag LOCUS_28500 1240 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence167 123 704 gene locus_tag LOCUS_28510 123 704 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_28510 >Feature sequence168 <1 977 gene locus_tag LOCUS_28520 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002221064.1:IS30-like element IS1655 family transposase >Feature sequence169 3 434 gene locus_tag LOCUS_28530 3 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence170 1165 77 gene locus_tag LOCUS_28540 1165 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 >Feature sequence171 468 253 gene locus_tag LOCUS_28550 468 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 521 876 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccgcgcgcccgtgatgggcgcg 1361 1068 gene locus_tag LOCUS_28560 gene cas2 1361 1068 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787408.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence172 231 1421 gene locus_tag LOCUS_28570 231 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 >Feature sequence173 >Feature sequence174 558 1505 gene locus_tag LOCUS_28580 558 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 >Feature sequence175 817 1266 gene locus_tag LOCUS_28590 817 1266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence176 1199 144 gene locus_tag LOCUS_28600 1199 144 CDS product IS5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009348805.1 protein_id gnl|my_center|LOCUS_28600 1384 1656 gene locus_tag LOCUS_28610 1384 1656 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812626.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence177 <1715 166 gene locus_tag LOCUS_28620 <1715 166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546063.1:potassium channel protein >Feature sequence178 >Feature sequence179 565 38 gene locus_tag LOCUS_28630 565 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 1298 579 gene locus_tag LOCUS_28640 1298 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28640 >Feature sequence180 342 1373 gene locus_tag LOCUS_28650 342 1373 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_128929876.1 protein_id gnl|my_center|LOCUS_28650 >Feature sequence181 <1639 415 gene locus_tag LOCUS_28660 <1639 415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119671.1:transposase 1188 1197 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence182 >Feature sequence183 488 174 gene locus_tag LOCUS_28670 gene rplU 488 174 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094761.1 protein_id gnl|my_center|LOCUS_28670 <1635 589 gene locus_tag LOCUS_28680 <1635 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012067720.1:YDG domain-containing protein >Feature sequence184 <1 803 gene locus_tag LOCUS_28690 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390866.1:Wzz/FepE/Etk N-terminal domain-containing protein >Feature sequence185 1529 486 gene locus_tag LOCUS_28700 1529 486 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_28700 >Feature sequence186 1526 483 gene locus_tag LOCUS_28710 1526 483 CDS product IS110-like element ISGsu4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941629.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence187 487 1017 gene locus_tag LOCUS_28720 487 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 >Feature sequence188 625 329 gene locus_tag LOCUS_28730 625 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28730 876 625 gene locus_tag LOCUS_28740 876 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence189 62 724 gene locus_tag LOCUS_28750 62 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 851 1429 gene locus_tag LOCUS_28760 851 1429 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552315.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence190 145 1530 gene locus_tag LOCUS_28770 145 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28770 >Feature sequence191 1247 339 gene locus_tag LOCUS_28780 1247 339 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047816295.1 protein_id gnl|my_center|LOCUS_28780 >Feature sequence192 >Feature sequence193 546 1028 gene locus_tag LOCUS_28790 546 1028 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942768.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence194 183 956 gene locus_tag LOCUS_28800 183 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28800 >Feature sequence195 212 1279 gene locus_tag LOCUS_28810 212 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28810 >Feature sequence196 >Feature sequence197 1310 288 gene locus_tag LOCUS_28820 1310 288 CDS product IS110-like element ISCc4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640573.1 protein_id gnl|my_center|LOCUS_28820 >Feature sequence198 <1 1176 gene locus_tag LOCUS_28830 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016190692.1:STY4528 family pathogenicity island replication protein >Feature sequence199 <1 692 gene locus_tag LOCUS_28840 <1 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090919.1:IS21 family transposase 679 1407 gene locus_tag LOCUS_28850 gene istB 679 1407 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971012.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence200 <1 1443 gene locus_tag LOCUS_28860 <1 1443 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104442.1:IS66 family transposase >Feature sequence201 195 380 gene locus_tag LOCUS_28870 195 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28870 348 357 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence202 1240 44 gene locus_tag LOCUS_28880 1240 44 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544973.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence203 >Feature sequence204 58 390 gene locus_tag LOCUS_28890 58 390 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000165309.1 protein_id gnl|my_center|LOCUS_28890 483 1292 gene locus_tag LOCUS_28900 483 1292 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001299612.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence205 >Feature sequence206 <1414 555 gene locus_tag LOCUS_28910 <1414 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172724492.1:IS3 family transposase >Feature sequence207 424 152 gene locus_tag LOCUS_28920 424 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 571 939 gene locus_tag LOCUS_28930 571 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331471.1 protein_id gnl|my_center|LOCUS_28930 986 1267 gene locus_tag LOCUS_28940 gene traL 986 1267 CDS product type IV conjugative transfer system protein TraL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331472.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence208 >Feature sequence209 1059 1319 gene locus_tag LOCUS_28950 1059 1319 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074406.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence210 1075 14 gene locus_tag LOCUS_28960 1075 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28960 >Feature sequence211 >Feature sequence212 1167 85 gene locus_tag LOCUS_28970 gene prfA 1167 85 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019960.1 protein_id gnl|my_center|LOCUS_28970 >Feature sequence213 111 383 gene locus_tag LOCUS_28980 111 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 373 720 gene locus_tag LOCUS_28990 373 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28990 1245 1337 gene locus_tag LOCUS_t00320 1245 1337 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence214 1159 800 gene locus_tag LOCUS_29000 gene tnpB 1159 800 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005747908.1 protein_id gnl|my_center|LOCUS_29000 >Feature sequence215 >Feature sequence216 3 716 gene locus_tag LOCUS_29010 3 716 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268269.1 protein_id gnl|my_center|LOCUS_29010 789 1103 gene locus_tag LOCUS_29020 gene bolA 789 1103 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456570.1 protein_id gnl|my_center|LOCUS_29020 >Feature sequence217 72 614 gene locus_tag LOCUS_29030 72 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29030 >Feature sequence218 >Feature sequence219 1163 837 gene locus_tag LOCUS_29040 1163 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29040 >Feature sequence220 114 422 gene locus_tag LOCUS_29050 114 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29050 422 1249 gene locus_tag LOCUS_29060 422 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29060 >Feature sequence221 >Feature sequence222 >Feature sequence223 1241 33 gene locus_tag LOCUS_29070 1241 33 CDS product IS256-like element ISSod5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074120.1 protein_id gnl|my_center|LOCUS_29070 >Feature sequence224 1169 216 gene locus_tag LOCUS_29080 1169 216 CDS product DUF4268 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403858.1 protein_id gnl|my_center|LOCUS_29080 >Feature sequence225 <1 1091 gene locus_tag LOCUS_29090 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005007934.1:ribonucleotide-diphosphate reductase subunit beta >Feature sequence226 838 86 gene locus_tag LOCUS_29100 838 86 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420296.1 protein_id gnl|my_center|LOCUS_29100 >Feature sequence227 504 1170 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcagttgctctcttctgagcatggtctgaaac >Feature sequence228 >Feature sequence229 >Feature sequence230 >Feature sequence231 87 605 gene locus_tag LOCUS_29110 87 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence232 >Feature sequence233 >Feature sequence234 >Feature sequence235 >Feature sequence236 >Feature sequence237 193 1140 gene locus_tag LOCUS_29120 193 1140 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095835446.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence238 >Feature sequence239 >Feature sequence240 >Feature sequence241 102 470 gene locus_tag LOCUS_29130 gene rplN 102 470 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722508.1 protein_id gnl|my_center|LOCUS_29130 470 784 gene locus_tag LOCUS_29140 gene rplX 470 784 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385312.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence242 >Feature sequence243 >Feature sequence244 <1137 506 gene locus_tag LOCUS_29150 <1137 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152945460.1:efflux RND transporter permease subunit >Feature sequence245 >Feature sequence246 867 1035 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ccttctaagctggacgcatggttctgac >Feature sequence247 56 961 gene locus_tag LOCUS_29160 56 961 CDS product L-lactate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684979.1 protein_id gnl|my_center|LOCUS_29160 >Feature sequence248 <1 696 gene locus_tag LOCUS_29170 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812141.1:TRAP transporter large permease >Feature sequence249 <1 591 gene locus_tag LOCUS_29180 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005620333.1:ATP-binding cassette domain-containing protein >Feature sequence250 385 116 gene locus_tag LOCUS_29190 gene rpsQ 385 116 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_29190 586 392 gene locus_tag LOCUS_29200 gene rpmC 586 392 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417238.1 protein_id gnl|my_center|LOCUS_29200 999 586 gene locus_tag LOCUS_29210 gene rplP 999 586 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_29210 >Feature sequence251 932 150 gene locus_tag LOCUS_29220 gene proC 932 150 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_29220 >Feature sequence252 >Feature sequence253 >Feature sequence254 22 1059 gene locus_tag LOCUS_29230 22 1059 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_29230 >Feature sequence255 513 181 gene locus_tag LOCUS_29240 513 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29240 >Feature sequence256 >Feature sequence257 316 774 gene locus_tag LOCUS_29250 316 774 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_29250 >Feature sequence258 817 990 gene locus_tag LOCUS_29260 817 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29260 >Feature sequence259 <1065 422 gene locus_tag LOCUS_29270 <1065 422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266425.1:homoserine O-acetyltransferase >Feature sequence260 >Feature sequence261 >Feature sequence262 >Feature sequence263 321 118 gene locus_tag LOCUS_29280 321 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280