>Feature sequence001 183 500 gene locus_tag LOCUS_00010 183 500 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240464.1 protein_id gnl|my_center|LOCUS_00010 624 1511 gene locus_tag LOCUS_00020 gene tatC 624 1511 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763345.1 protein_id gnl|my_center|LOCUS_00020 1556 2968 gene locus_tag LOCUS_00030 1556 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3673 2957 gene locus_tag LOCUS_00040 3673 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4296 3658 gene locus_tag LOCUS_00050 4296 3658 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088966.1 protein_id gnl|my_center|LOCUS_00050 5213 4311 gene locus_tag LOCUS_00060 5213 4311 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391615.1 protein_id gnl|my_center|LOCUS_00060 5661 6170 gene locus_tag LOCUS_00070 5661 6170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 6440 6144 gene locus_tag LOCUS_00080 6440 6144 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762698.1 protein_id gnl|my_center|LOCUS_00080 7218 6583 gene locus_tag LOCUS_00090 7218 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00090 8386 7145 gene locus_tag LOCUS_00100 8386 7145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00100 7160 7169 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10026 8557 gene locus_tag LOCUS_00110 10026 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10136 11011 gene locus_tag LOCUS_00120 10136 11011 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496405.1 protein_id gnl|my_center|LOCUS_00120 >Feature sequence002 <1 850 gene locus_tag LOCUS_00130 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979307.1:DEAD/DEAH box helicase 936 1898 gene locus_tag LOCUS_00140 936 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 3410 1962 gene locus_tag LOCUS_00150 3410 1962 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590803.1 protein_id gnl|my_center|LOCUS_00150 3601 3407 gene locus_tag LOCUS_00160 3601 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 3691 4629 gene locus_tag LOCUS_00170 3691 4629 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979430.1 protein_id gnl|my_center|LOCUS_00170 4685 5245 gene locus_tag LOCUS_00180 4685 5245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 5263 6210 gene locus_tag LOCUS_00190 5263 6210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 6194 6203 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6377 6526 gene locus_tag LOCUS_00200 6377 6526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 6602 7435 gene locus_tag LOCUS_00210 6602 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00210 7395 7404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7507 7929 gene locus_tag LOCUS_00220 7507 7929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00220 8164 7901 gene locus_tag LOCUS_00230 8164 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 9177 8191 gene locus_tag LOCUS_00240 9177 8191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 8210 8219 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence003 340 561 gene locus_tag LOCUS_00250 340 561 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877821.1 protein_id gnl|my_center|LOCUS_00250 539 973 gene locus_tag LOCUS_00260 539 973 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878587.1 protein_id gnl|my_center|LOCUS_00260 1398 1637 gene locus_tag LOCUS_00270 1398 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 1618 1971 gene locus_tag LOCUS_00280 1618 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 2427 2648 gene locus_tag LOCUS_00290 2427 2648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 2626 3060 gene locus_tag LOCUS_00300 2626 3060 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878587.1 protein_id gnl|my_center|LOCUS_00300 3150 3671 gene locus_tag LOCUS_00310 3150 3671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 3895 3817 gene locus_tag LOCUS_t00010 3895 3817 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4033 8127 gene locus_tag LOCUS_00320 4033 8127 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762428.1 protein_id gnl|my_center|LOCUS_00320 >Feature sequence004 1788 1603 gene locus_tag LOCUS_00330 1788 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 1799 1969 gene locus_tag LOCUS_00340 1799 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 1946 1955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2364 2957 gene locus_tag LOCUS_00350 2364 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 3651 2986 gene locus_tag LOCUS_00360 gene tenA 3651 2986 CDS product thiaminase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868212.1 protein_id gnl|my_center|LOCUS_00360 4227 3664 gene locus_tag LOCUS_00370 4227 3664 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232554.1 protein_id gnl|my_center|LOCUS_00370 4676 5509 gene locus_tag LOCUS_00380 gene cdvB 4676 5509 CDS product cell division protein CdvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979233.1 protein_id gnl|my_center|LOCUS_00380 5551 5847 gene locus_tag LOCUS_00390 5551 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 5798 5807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6038 6706 gene locus_tag LOCUS_00400 6038 6706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 7630 6806 gene locus_tag LOCUS_00410 7630 6806 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868073.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00410 6870 6879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7722 7901 gene locus_tag LOCUS_00420 7722 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 <9046 7907 gene locus_tag LOCUS_00430 <9046 7907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011277826.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase >Feature sequence005 1224 235 gene locus_tag LOCUS_00440 1224 235 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146465.1 protein_id gnl|my_center|LOCUS_00440 1783 1199 gene locus_tag LOCUS_00450 1783 1199 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978294.1 protein_id gnl|my_center|LOCUS_00450 2315 1770 gene locus_tag LOCUS_00460 2315 1770 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_00460 3075 2260 gene locus_tag LOCUS_00470 3075 2260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00470 3395 3114 gene locus_tag LOCUS_00480 3395 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 3121 3130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3906 3397 gene locus_tag LOCUS_00490 3906 3397 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978291.1 protein_id gnl|my_center|LOCUS_00490 4182 5216 gene locus_tag LOCUS_00500 4182 5216 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846270.1 protein_id gnl|my_center|LOCUS_00500 5280 5747 gene locus_tag LOCUS_00510 5280 5747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 5754 6518 gene locus_tag LOCUS_00520 5754 6518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 6867 6541 gene locus_tag LOCUS_00530 6867 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 8062 6770 gene locus_tag LOCUS_00540 gene tgtA 8062 6770 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978287.1 protein_id gnl|my_center|LOCUS_00540 6890 6899 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8554 8108 gene locus_tag LOCUS_00550 8554 8108 CDS product Lsm family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846267.1 protein_id gnl|my_center|LOCUS_00550 8613 8969 gene locus_tag LOCUS_00560 8613 8969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 >Feature sequence006 146 475 gene locus_tag LOCUS_00570 146 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 352 361 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 438 581 gene locus_tag LOCUS_00580 438 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00580 582 833 gene locus_tag LOCUS_00590 582 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 849 1226 gene locus_tag LOCUS_00600 849 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00600 1583 2146 gene locus_tag LOCUS_00610 1583 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 2278 3693 gene locus_tag LOCUS_00620 gene pyk 2278 3693 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762852.1 protein_id gnl|my_center|LOCUS_00620 4018 3740 gene locus_tag LOCUS_00630 4018 3740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 4418 3969 gene locus_tag LOCUS_00640 4418 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00640 3987 3996 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5788 4523 gene locus_tag LOCUS_00650 5788 4523 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240533.1 protein_id gnl|my_center|LOCUS_00650 5986 6987 gene locus_tag LOCUS_00660 5986 6987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 6936 6945 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6947 7132 gene locus_tag LOCUS_00670 6947 7132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 7249 8526 gene locus_tag LOCUS_00680 7249 8526 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_00680 >Feature sequence007 983 1231 gene locus_tag LOCUS_00690 983 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1508 3148 gene locus_tag LOCUS_00700 1508 3148 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 protein_id gnl|my_center|LOCUS_00700 3289 5373 gene locus_tag LOCUS_00710 3289 5373 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879019.1 protein_id gnl|my_center|LOCUS_00710 6022 5444 gene locus_tag LOCUS_00720 6022 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 6126 7004 gene locus_tag LOCUS_00730 6126 7004 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045008.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence008 3495 1054 gene locus_tag LOCUS_00740 3495 1054 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_00740 3618 4070 gene locus_tag LOCUS_00750 3618 4070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 4056 4133 gene locus_tag LOCUS_t00020 4056 4133 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 5263 4157 gene locus_tag LOCUS_00760 5263 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 7212 5359 gene locus_tag LOCUS_00770 7212 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 >Feature sequence009 810 2528 gene locus_tag LOCUS_00780 810 2528 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146467.1 protein_id gnl|my_center|LOCUS_00780 2956 2546 gene locus_tag LOCUS_00790 gene trxA 2956 2546 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700525.1 protein_id gnl|my_center|LOCUS_00790 3064 4857 gene locus_tag LOCUS_00800 3064 4857 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978239.1 protein_id gnl|my_center|LOCUS_00800 5576 4938 gene locus_tag LOCUS_00810 5576 4938 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978238.1 protein_id gnl|my_center|LOCUS_00810 5685 6104 gene locus_tag LOCUS_00820 5685 6104 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980147.1 protein_id gnl|my_center|LOCUS_00820 >Feature sequence010 884 270 gene locus_tag LOCUS_00830 884 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 952 961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1770 1144 gene locus_tag LOCUS_00840 1770 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 2681 2055 gene locus_tag LOCUS_00850 gene hxlB 2681 2055 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978137.1 protein_id gnl|my_center|LOCUS_00850 3796 3026 gene locus_tag LOCUS_00860 3796 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 4214 3864 gene locus_tag LOCUS_00870 4214 3864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 3877 3886 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4327 4536 gene locus_tag LOCUS_00880 4327 4536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 4992 4564 gene locus_tag LOCUS_00890 4992 4564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 5917 5090 gene locus_tag LOCUS_00900 5917 5090 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 protein_id gnl|my_center|LOCUS_00900 >Feature sequence011 <1 839 gene locus_tag LOCUS_00910 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979461.1:phenylalanine--tRNA ligase subunit alpha 854 2518 gene locus_tag LOCUS_00920 gene pheT 854 2518 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979460.1 protein_id gnl|my_center|LOCUS_00920 2488 3375 gene locus_tag LOCUS_00930 gene mptA 2488 3375 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878675.1 protein_id gnl|my_center|LOCUS_00930 3882 3334 gene locus_tag LOCUS_00940 3882 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3997 4881 gene locus_tag LOCUS_00950 3997 4881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 5592 4864 gene locus_tag LOCUS_00960 5592 4864 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978977.1 protein_id gnl|my_center|LOCUS_00960 5677 6510 gene locus_tag LOCUS_00970 5677 6510 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_00970 >Feature sequence012 1357 362 gene locus_tag LOCUS_00980 1357 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 2663 1776 gene locus_tag LOCUS_00990 2663 1776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 5865 2755 gene locus_tag LOCUS_01000 5865 2755 CDS product helicase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080568.1 protein_id gnl|my_center|LOCUS_01000 3255 3264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3793 3802 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6391 5870 gene locus_tag LOCUS_01010 6391 5870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 >Feature sequence013 70 669 gene locus_tag LOCUS_01020 70 669 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762168.1 protein_id gnl|my_center|LOCUS_01020 835 1167 gene locus_tag LOCUS_01030 835 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 1672 1139 gene locus_tag LOCUS_01040 1672 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763023.1 protein_id gnl|my_center|LOCUS_01040 1798 2274 gene locus_tag LOCUS_01050 1798 2274 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990683.1 protein_id gnl|my_center|LOCUS_01050 2961 2275 gene locus_tag LOCUS_01060 2961 2275 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979262.1 protein_id gnl|my_center|LOCUS_01060 3107 3910 gene locus_tag LOCUS_01070 3107 3910 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762318.1 protein_id gnl|my_center|LOCUS_01070 3913 5043 gene locus_tag LOCUS_01080 3913 5043 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650980.1 protein_id gnl|my_center|LOCUS_01080 5125 5901 gene locus_tag LOCUS_01090 5125 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence014 15 755 gene locus_tag LOCUS_01100 15 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846943.1 protein_id gnl|my_center|LOCUS_01100 1631 1023 gene locus_tag LOCUS_01110 1631 1023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 1872 1579 gene locus_tag LOCUS_01120 1872 1579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1956 2900 gene locus_tag LOCUS_01130 gene argF 1956 2900 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_01130 3524 2892 gene locus_tag LOCUS_01140 3524 2892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 3619 4740 gene locus_tag LOCUS_01150 gene prf1 3619 4740 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742617.1 protein_id gnl|my_center|LOCUS_01150 5286 4741 gene locus_tag LOCUS_01160 5286 4741 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878985.1 protein_id gnl|my_center|LOCUS_01160 5473 5808 gene locus_tag LOCUS_01170 5473 5808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979274.1 protein_id gnl|my_center|LOCUS_01170 6181 5885 gene locus_tag LOCUS_01180 6181 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence015 2628 706 gene locus_tag LOCUS_01190 2628 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 3190 2723 gene locus_tag LOCUS_01200 3190 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 2767 2776 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3399 4079 gene locus_tag LOCUS_01210 3399 4079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 >Feature sequence016 3 797 gene locus_tag LOCUS_01220 3 797 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867541.1 protein_id gnl|my_center|LOCUS_01220 800 1612 gene locus_tag LOCUS_01230 800 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 2499 1666 gene locus_tag LOCUS_01240 2499 1666 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146582.1 protein_id gnl|my_center|LOCUS_01240 3266 2661 gene locus_tag LOCUS_01250 3266 2661 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762690.1 protein_id gnl|my_center|LOCUS_01250 3497 3285 gene locus_tag LOCUS_01260 3497 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01260 3861 3514 gene locus_tag LOCUS_01270 3861 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01270 3526 3535 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4048 4965 gene locus_tag LOCUS_01280 4048 4965 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_01280 4947 5765 gene locus_tag LOCUS_01290 gene panB 4947 5765 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978510.1 protein_id gnl|my_center|LOCUS_01290 >Feature sequence017 2197 3483 gene locus_tag LOCUS_01300 gene asnS 2197 3483 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 protein_id gnl|my_center|LOCUS_01300 3662 4657 gene locus_tag LOCUS_01310 3662 4657 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_01310 4657 5505 gene locus_tag LOCUS_01320 4657 5505 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979837.1 protein_id gnl|my_center|LOCUS_01320 >Feature sequence018 487 496 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 612 926 gene locus_tag LOCUS_01330 612 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 923 1405 gene locus_tag LOCUS_01340 923 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 1412 1726 gene locus_tag LOCUS_01350 1412 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 1730 2566 gene locus_tag LOCUS_01360 1730 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01360 2485 3297 gene locus_tag LOCUS_01370 2485 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01370 2510 2519 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3311 5383 gene locus_tag LOCUS_01380 3311 5383 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763355.1 protein_id gnl|my_center|LOCUS_01380 >Feature sequence019 1215 361 gene locus_tag LOCUS_01390 1215 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01390 1359 2243 gene locus_tag LOCUS_01400 1359 2243 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248984.1 protein_id gnl|my_center|LOCUS_01400 3621 2254 gene locus_tag LOCUS_01410 3621 2254 CDS product NCS1 family nucleobase:cation symporter-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227811.1 protein_id gnl|my_center|LOCUS_01410 4186 3713 gene locus_tag LOCUS_01420 4186 3713 CDS product COG2426 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249640.1 protein_id gnl|my_center|LOCUS_01420 4642 4187 gene locus_tag LOCUS_01430 4642 4187 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762286.1 protein_id gnl|my_center|LOCUS_01430 5429 4704 gene locus_tag LOCUS_01440 5429 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 >Feature sequence020 <1 885 gene locus_tag LOCUS_01450 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583129.1:MATE family efflux transporter 1358 882 gene locus_tag LOCUS_01460 1358 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 2365 1598 gene locus_tag LOCUS_01470 2365 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 2996 2409 gene locus_tag LOCUS_01480 2996 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3693 3163 gene locus_tag LOCUS_01490 3693 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 3222 3231 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4439 3813 gene locus_tag LOCUS_01500 4439 3813 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762097.1 protein_id gnl|my_center|LOCUS_01500 4589 5473 gene locus_tag LOCUS_01510 4589 5473 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_01510 >Feature sequence021 1234 545 gene locus_tag LOCUS_01520 1234 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 2067 1126 gene locus_tag LOCUS_01530 2067 1126 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_01530 2217 2651 gene locus_tag LOCUS_01540 2217 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2731 4170 gene locus_tag LOCUS_01550 2731 4170 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979442.1 protein_id gnl|my_center|LOCUS_01550 4167 5606 gene locus_tag LOCUS_01560 4167 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 >Feature sequence022 1482 184 gene locus_tag LOCUS_01570 gene eno 1482 184 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147178.1 protein_id gnl|my_center|LOCUS_01570 1600 2262 gene locus_tag LOCUS_01580 1600 2262 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003413921.1 protein_id gnl|my_center|LOCUS_01580 2278 3096 gene locus_tag LOCUS_01590 2278 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 3102 3413 gene locus_tag LOCUS_01600 3102 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979229.1 protein_id gnl|my_center|LOCUS_01600 5035 3452 gene locus_tag LOCUS_01610 gene guaA 5035 3452 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762354.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence023 169 92 gene locus_tag LOCUS_t00030 169 92 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 327 1709 gene locus_tag LOCUS_01620 gene lpdA 327 1709 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083198.1 protein_id gnl|my_center|LOCUS_01620 3976 1739 gene locus_tag LOCUS_01630 3976 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5047 4046 gene locus_tag LOCUS_01640 5047 4046 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846752.1 protein_id gnl|my_center|LOCUS_01640 >Feature sequence024 1850 405 gene locus_tag LOCUS_01650 1850 405 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274415.1 protein_id gnl|my_center|LOCUS_01650 2428 1889 gene locus_tag LOCUS_01660 2428 1889 CDS product magnesium-dependent phosphatase-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251186.1 protein_id gnl|my_center|LOCUS_01660 2598 2523 gene locus_tag LOCUS_t00040 2598 2523 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2982 3527 gene locus_tag LOCUS_01670 2982 3527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3524 4048 gene locus_tag LOCUS_01680 3524 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4196 4546 gene locus_tag LOCUS_01690 4196 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 <5580 4576 gene locus_tag LOCUS_01700 <5580 4576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878560.1:ATP-binding protein >Feature sequence025 538 1308 gene locus_tag LOCUS_01710 538 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01710 1253 1729 gene locus_tag LOCUS_01720 1253 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 1265 1274 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1726 2217 gene locus_tag LOCUS_01730 1726 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 2182 2191 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2223 3737 gene locus_tag LOCUS_01740 2223 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 4832 3723 gene locus_tag LOCUS_01750 4832 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 5111 4887 gene locus_tag LOCUS_01760 5111 4887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 >Feature sequence026 56 1030 gene locus_tag LOCUS_01770 56 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01770 1038 2129 gene locus_tag LOCUS_01780 1038 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 2690 2121 gene locus_tag LOCUS_01790 2690 2121 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_01790 2869 4056 gene locus_tag LOCUS_01800 2869 4056 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403266.1 protein_id gnl|my_center|LOCUS_01800 4120 5325 gene locus_tag LOCUS_01810 gene mthRnl 4120 5325 CDS product ATP-dependent RNA/DNA ligase MthRnl inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060995.1 protein_id gnl|my_center|LOCUS_01810 >Feature sequence027 170 2221 gene locus_tag LOCUS_01820 gene feoB 170 2221 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01820 1996 2005 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2163 2324 gene locus_tag LOCUS_01830 2163 2324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 2338 2565 gene locus_tag LOCUS_01840 2338 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 2677 3843 gene locus_tag LOCUS_01850 2677 3843 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064618.1 protein_id gnl|my_center|LOCUS_01850 3973 4389 gene locus_tag LOCUS_01860 3973 4389 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240265.1 protein_id gnl|my_center|LOCUS_01860 <5381 4379 gene locus_tag LOCUS_01870 <5381 4379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000045572.1:excinuclease ABC subunit UvrA >Feature sequence028 <1 1172 gene locus_tag LOCUS_01880 <1 1172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004068250.1:ATPase domain-containing protein 1165 1521 gene locus_tag LOCUS_01890 1165 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 3168 1525 gene locus_tag LOCUS_01900 3168 1525 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249641.1 protein_id gnl|my_center|LOCUS_01900 3270 3279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3540 4208 gene locus_tag LOCUS_01910 3540 4208 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_01910 4382 4585 gene locus_tag LOCUS_01920 4382 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4638 4844 gene locus_tag LOCUS_01930 4638 4844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 >Feature sequence029 621 1922 gene locus_tag LOCUS_01940 621 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 2015 3796 gene locus_tag LOCUS_01950 2015 3796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3905 5110 gene locus_tag LOCUS_01960 3905 5110 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762522.1 protein_id gnl|my_center|LOCUS_01960 >Feature sequence030 962 1570 gene locus_tag LOCUS_01970 962 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 1513 1522 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1567 1785 gene locus_tag LOCUS_01980 1567 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 2445 1951 gene locus_tag LOCUS_01990 2445 1951 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250236.1 protein_id gnl|my_center|LOCUS_01990 3594 2527 gene locus_tag LOCUS_02000 3594 2527 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978466.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence031 <1 933 gene locus_tag LOCUS_02010 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251192.1:GHMP kinase 924 2111 gene locus_tag LOCUS_02020 924 2111 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867332.1 protein_id gnl|my_center|LOCUS_02020 3235 2108 gene locus_tag LOCUS_02030 3235 2108 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761948.1 protein_id gnl|my_center|LOCUS_02030 3997 3239 gene locus_tag LOCUS_02040 3997 3239 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867618.1 protein_id gnl|my_center|LOCUS_02040 >Feature sequence032 63 491 gene locus_tag LOCUS_02050 63 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 605 1255 gene locus_tag LOCUS_02060 605 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 1227 1880 gene locus_tag LOCUS_02070 1227 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 1389 1398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2044 3051 gene locus_tag LOCUS_02080 2044 3051 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879275.1 protein_id gnl|my_center|LOCUS_02080 3102 4859 gene locus_tag LOCUS_02090 3102 4859 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879276.1 protein_id gnl|my_center|LOCUS_02090 4769 4778 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence033 81 401 gene locus_tag LOCUS_02100 81 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979309.1 protein_id gnl|my_center|LOCUS_02100 1641 475 gene locus_tag LOCUS_02110 1641 475 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763494.1 protein_id gnl|my_center|LOCUS_02110 2497 1691 gene locus_tag LOCUS_02120 2497 1691 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762180.1 protein_id gnl|my_center|LOCUS_02120 2665 2919 gene locus_tag LOCUS_02130 2665 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 3052 3201 gene locus_tag LOCUS_02140 3052 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 3414 3650 gene locus_tag LOCUS_02150 3414 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 3822 4121 gene locus_tag LOCUS_02160 3822 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 4194 4799 gene locus_tag LOCUS_02170 4194 4799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence034 <1 1957 gene locus_tag LOCUS_02180 <1 1957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979278.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase 2851 2000 gene locus_tag LOCUS_02190 2851 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4093 2927 gene locus_tag LOCUS_02200 gene mpgS 4093 2927 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 protein_id gnl|my_center|LOCUS_02200 4816 4190 gene locus_tag LOCUS_02210 4816 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 4945 4867 gene locus_tag LOCUS_t00050 4945 4867 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence035 1132 2100 gene locus_tag LOCUS_02220 1132 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 2175 3296 gene locus_tag LOCUS_02230 2175 3296 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 protein_id gnl|my_center|LOCUS_02230 3706 4983 gene locus_tag LOCUS_02240 3706 4983 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870779.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence036 1026 157 gene locus_tag LOCUS_02250 1026 157 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_02250 2071 1043 gene locus_tag LOCUS_02260 2071 1043 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_02260 2728 2270 gene locus_tag LOCUS_02270 2728 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 4576 3005 gene locus_tag LOCUS_02280 4576 3005 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence037 1020 616 gene locus_tag LOCUS_02290 1020 616 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980456.1 protein_id gnl|my_center|LOCUS_02290 1290 1958 gene locus_tag LOCUS_02300 1290 1958 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978586.1 protein_id gnl|my_center|LOCUS_02300 2037 2729 gene locus_tag LOCUS_02310 2037 2729 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979569.1 protein_id gnl|my_center|LOCUS_02310 3878 2790 gene locus_tag LOCUS_02320 3878 2790 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762399.1 protein_id gnl|my_center|LOCUS_02320 4720 3878 gene locus_tag LOCUS_02330 4720 3878 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762400.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence038 715 59 gene locus_tag LOCUS_02340 715 59 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3594 754 gene locus_tag LOCUS_02350 3594 754 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979313.1 protein_id gnl|my_center|LOCUS_02350 3745 3990 gene locus_tag LOCUS_02360 3745 3990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846524.1 protein_id gnl|my_center|LOCUS_02360 4075 4785 gene locus_tag LOCUS_02370 gene moaD 4075 4785 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889231.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence039 4627 794 gene locus_tag LOCUS_02380 4627 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 >Feature sequence040 574 38 gene locus_tag LOCUS_02390 574 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 803 561 gene locus_tag LOCUS_02400 803 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 1379 825 gene locus_tag LOCUS_02410 gene rpoE 1379 825 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_02410 2221 1439 gene locus_tag LOCUS_02420 2221 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 2764 2282 gene locus_tag LOCUS_02430 2764 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3975 2728 gene locus_tag LOCUS_02440 gene eif2g 3975 2728 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846878.1 protein_id gnl|my_center|LOCUS_02440 <4656 4103 gene locus_tag LOCUS_02450 <4656 4103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978346.1:30S ribosomal protein S6e >Feature sequence041 355 618 gene locus_tag LOCUS_02460 355 618 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867737.1 protein_id gnl|my_center|LOCUS_02460 632 4183 gene locus_tag LOCUS_02470 632 4183 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978227.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence042 197 994 gene locus_tag LOCUS_02480 197 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 1025 1807 gene locus_tag LOCUS_02490 1025 1807 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867666.1 protein_id gnl|my_center|LOCUS_02490 1812 2942 gene locus_tag LOCUS_02500 gene fni 1812 2942 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980133.1 protein_id gnl|my_center|LOCUS_02500 2939 3955 gene locus_tag LOCUS_02510 gene gds 2939 3955 CDS product geranylgeranyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980132.1 protein_id gnl|my_center|LOCUS_02510 3998 4276 gene locus_tag LOCUS_02520 3998 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 4231 4240 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence043 1080 1595 gene locus_tag LOCUS_02530 1080 1595 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_02530 1592 2008 gene locus_tag LOCUS_02540 1592 2008 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867794.1 protein_id gnl|my_center|LOCUS_02540 3945 2851 gene locus_tag LOCUS_02550 3945 2851 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762417.1 protein_id gnl|my_center|LOCUS_02550 >Feature sequence044 966 133 gene locus_tag LOCUS_02560 966 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 1131 2054 gene locus_tag LOCUS_02570 gene cyoE 1131 2054 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_02570 2060 2836 gene locus_tag LOCUS_02580 2060 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 3851 2736 gene locus_tag LOCUS_02590 gene moaA 3851 2736 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence045 2113 1028 gene locus_tag LOCUS_02600 2113 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 2732 2154 gene locus_tag LOCUS_02610 2732 2154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 2961 4184 gene locus_tag LOCUS_02620 2961 4184 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249778.1 protein_id gnl|my_center|LOCUS_02620 3357 3366 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4283 4519 gene locus_tag LOCUS_02630 4283 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 >Feature sequence046 803 306 gene locus_tag LOCUS_02640 803 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 983 992 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1806 1060 gene locus_tag LOCUS_02650 1806 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 2678 1824 gene locus_tag LOCUS_02660 2678 1824 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496450.1 protein_id gnl|my_center|LOCUS_02660 3050 3059 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3116 4216 gene locus_tag LOCUS_02670 3116 4216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 >Feature sequence047 1078 1503 gene locus_tag LOCUS_02680 1078 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 2075 2084 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3259 2696 gene locus_tag LOCUS_02690 3259 2696 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082498.1 protein_id gnl|my_center|LOCUS_02690 4232 3246 gene locus_tag LOCUS_02700 4232 3246 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496743.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence048 106 990 gene locus_tag LOCUS_02710 106 990 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763567.1 protein_id gnl|my_center|LOCUS_02710 2266 998 gene locus_tag LOCUS_02720 2266 998 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978478.1 protein_id gnl|my_center|LOCUS_02720 3453 2320 gene locus_tag LOCUS_02730 3453 2320 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846352.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence049 2325 1393 gene locus_tag LOCUS_02740 2325 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 2720 2415 gene locus_tag LOCUS_02750 2720 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 2835 3380 gene locus_tag LOCUS_02760 2835 3380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 3400 3969 gene locus_tag LOCUS_02770 3400 3969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence050 3570 2890 gene locus_tag LOCUS_02780 3570 2890 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876460.1 protein_id gnl|my_center|LOCUS_02780 3686 4342 gene locus_tag LOCUS_02790 3686 4342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence051 159 938 gene locus_tag LOCUS_02800 159 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02800 842 851 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 938 1405 gene locus_tag LOCUS_02810 938 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02810 1422 2327 gene locus_tag LOCUS_02820 1422 2327 CDS product 3-hydroxyacyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879509.1 protein_id gnl|my_center|LOCUS_02820 2303 3967 gene locus_tag LOCUS_02830 2303 3967 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879507.1 protein_id gnl|my_center|LOCUS_02830 >Feature sequence052 97 369 gene locus_tag LOCUS_02840 97 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02840 326 335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 392 829 gene locus_tag LOCUS_02850 392 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02850 890 2152 gene locus_tag LOCUS_02860 gene guaB 890 2152 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002991454.1 protein_id gnl|my_center|LOCUS_02860 2169 2609 gene locus_tag LOCUS_02870 2169 2609 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_02870 4273 3200 gene locus_tag LOCUS_02880 4273 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 >Feature sequence053 1284 247 gene locus_tag LOCUS_02890 1284 247 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979396.1 protein_id gnl|my_center|LOCUS_02890 2521 1292 gene locus_tag LOCUS_02900 2521 1292 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979397.1 protein_id gnl|my_center|LOCUS_02900 2617 3321 gene locus_tag LOCUS_02910 2617 3321 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978516.1 protein_id gnl|my_center|LOCUS_02910 3447 3359 gene locus_tag LOCUS_t00060 3447 3359 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3617 3626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence054 279 1895 gene locus_tag LOCUS_02920 gene thsB 279 1895 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846874.1 protein_id gnl|my_center|LOCUS_02920 2011 2619 gene locus_tag LOCUS_02930 2011 2619 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978114.1 protein_id gnl|my_center|LOCUS_02930 4110 2563 gene locus_tag LOCUS_02940 4110 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 >Feature sequence055 171 749 gene locus_tag LOCUS_02950 171 749 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_02950 703 1401 gene locus_tag LOCUS_02960 703 1401 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249129.1 protein_id gnl|my_center|LOCUS_02960 1382 1603 gene locus_tag LOCUS_02970 1382 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 1616 2089 gene locus_tag LOCUS_02980 1616 2089 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979409.1 protein_id gnl|my_center|LOCUS_02980 2809 2081 gene locus_tag LOCUS_02990 2809 2081 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250440.1 protein_id gnl|my_center|LOCUS_02990 2592 2601 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2924 3436 gene locus_tag LOCUS_03000 2924 3436 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979408.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence056 65 2047 gene locus_tag LOCUS_03010 65 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 2434 2270 gene locus_tag LOCUS_03020 2434 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3591 3058 gene locus_tag LOCUS_03030 gene cyaB 3591 3058 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762860.1 protein_id gnl|my_center|LOCUS_03030 >Feature sequence057 167 871 gene locus_tag LOCUS_03040 167 871 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082259.1 protein_id gnl|my_center|LOCUS_03040 1038 2138 gene locus_tag LOCUS_03050 1038 2138 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763350.1 protein_id gnl|my_center|LOCUS_03050 3415 2135 gene locus_tag LOCUS_03060 3415 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03060 <4182 3436 gene locus_tag LOCUS_03070 <4182 3436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762897.1:DEAD/DEAH box helicase note possible pseudo, frameshifted 3442 3451 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence058 1781 87 gene locus_tag LOCUS_03080 1781 87 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870477.1 protein_id gnl|my_center|LOCUS_03080 2540 1785 gene locus_tag LOCUS_03090 2540 1785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03090 3226 2663 gene locus_tag LOCUS_03100 3226 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03100 2667 2676 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3243 3252 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3978 3451 gene locus_tag LOCUS_03110 3978 3451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence059 1718 612 gene locus_tag LOCUS_03120 1718 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 2010 1702 gene locus_tag LOCUS_03130 2010 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 2092 2514 gene locus_tag LOCUS_03140 2092 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 2549 2558 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3116 2601 gene locus_tag LOCUS_03150 3116 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 <4077 3043 gene locus_tag LOCUS_03160 <4077 3043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846517.1:thermosome subunit alpha 3191 3200 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence060 4059 721 gene locus_tag LOCUS_03170 4059 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 >Feature sequence061 1796 69 gene locus_tag LOCUS_03180 gene hutU 1796 69 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416948.1 protein_id gnl|my_center|LOCUS_03180 1885 2793 gene locus_tag LOCUS_03190 gene speB 1885 2793 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209831.1 protein_id gnl|my_center|LOCUS_03190 2790 4025 gene locus_tag LOCUS_03200 gene hutI 2790 4025 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887529.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence062 1095 157 gene locus_tag LOCUS_03210 gene nrfD 1095 157 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879873.1 protein_id gnl|my_center|LOCUS_03210 1674 1102 gene locus_tag LOCUS_03220 1674 1102 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879872.1 protein_id gnl|my_center|LOCUS_03220 <3978 1667 gene locus_tag LOCUS_03230 <3978 1667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879871.1:molybdopterin-dependent oxidoreductase >Feature sequence063 <1 818 gene locus_tag LOCUS_03240 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879270.1:amino acid permease 1109 1255 gene locus_tag LOCUS_03250 1109 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 1718 1491 gene locus_tag LOCUS_03260 1718 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 3966 1906 gene locus_tag LOCUS_03270 3966 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1913 1922 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence064 683 1279 gene locus_tag LOCUS_03280 683 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 1839 1276 gene locus_tag LOCUS_03290 1839 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03290 2302 1829 gene locus_tag LOCUS_03300 2302 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03300 1931 1940 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2586 2332 gene locus_tag LOCUS_03310 2586 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 <3927 2729 gene locus_tag LOCUS_03320 <3927 2729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762437.1:CDC48 family AAA ATPase >Feature sequence065 <1 694 gene locus_tag LOCUS_03330 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249650.1:TldD/PmbA family protein note possible pseudo, frameshifted 588 597 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 615 1292 gene locus_tag LOCUS_03340 615 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03340 1289 2464 gene locus_tag LOCUS_03350 1289 2464 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978648.1 protein_id gnl|my_center|LOCUS_03350 1788 1797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2699 2708 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3116 3916 gene locus_tag LOCUS_03360 3116 3916 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence066 <1 1224 gene locus_tag LOCUS_03370 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868288.1:alkaline phosphatase family protein 2404 1295 gene locus_tag LOCUS_03380 gene sat 2404 1295 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_03380 2660 2669 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3394 2942 gene locus_tag LOCUS_03390 3394 2942 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846119.1 protein_id gnl|my_center|LOCUS_03390 3678 3373 gene locus_tag LOCUS_03400 3678 3373 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977947.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence067 <1 536 gene locus_tag LOCUS_03410 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250728.1:phosphoglucosamine mutase 1305 550 gene locus_tag LOCUS_03420 1305 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 1374 2492 gene locus_tag LOCUS_03430 1374 2492 CDS product chlorohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763722.1 protein_id gnl|my_center|LOCUS_03430 2833 2489 gene locus_tag LOCUS_03440 2833 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 3256 3265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence068 307 110 gene locus_tag LOCUS_03450 307 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 459 1094 gene locus_tag LOCUS_03460 gene psmB 459 1094 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_03460 1263 3269 gene locus_tag LOCUS_03470 1263 3269 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978304.1 protein_id gnl|my_center|LOCUS_03470 3805 3275 gene locus_tag LOCUS_03480 3805 3275 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870950.1 protein_id gnl|my_center|LOCUS_03480 >Feature sequence069 2165 342 gene locus_tag LOCUS_03490 2165 342 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978275.1 protein_id gnl|my_center|LOCUS_03490 2398 2270 gene locus_tag LOCUS_03500 2398 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2990 2421 gene locus_tag LOCUS_03510 2990 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03510 2430 2439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3406 3077 gene locus_tag LOCUS_03520 3406 3077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence070 2091 3368 gene locus_tag LOCUS_03530 2091 3368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 3326 3335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence071 144 67 gene locus_tag LOCUS_t00070 144 67 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 316 879 gene locus_tag LOCUS_03540 316 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 876 1406 gene locus_tag LOCUS_03550 876 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 2123 1440 gene locus_tag LOCUS_03560 gene pyrH 2123 1440 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_03560 2594 2208 gene locus_tag LOCUS_03570 2594 2208 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_03570 3776 2835 gene locus_tag LOCUS_03580 3776 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence072 <1 1343 gene locus_tag LOCUS_03590 <1 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868870.1:ABC transporter substrate-binding protein 1532 2494 gene locus_tag LOCUS_03600 1532 2494 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_03600 2502 3659 gene locus_tag LOCUS_03610 2502 3659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868866.1 protein_id gnl|my_center|LOCUS_03610 >Feature sequence073 1500 91 gene locus_tag LOCUS_03620 1500 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 2081 1476 gene locus_tag LOCUS_03630 2081 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 3111 2095 gene locus_tag LOCUS_03640 3111 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 2115 2124 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3741 3231 gene locus_tag LOCUS_03650 <3741 3231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978561.1:DHHA1 domain-containing protein >Feature sequence074 <1 1030 gene locus_tag LOCUS_03660 <1 1030 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979490.1:PINc/VapC family ATPase 1510 1079 gene locus_tag LOCUS_03670 1510 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1652 2449 gene locus_tag LOCUS_03680 1652 2449 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_03680 3336 3345 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence075 252 599 gene locus_tag LOCUS_03690 252 599 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846880.1 protein_id gnl|my_center|LOCUS_03690 639 1061 gene locus_tag LOCUS_03700 639 1061 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846308.1 protein_id gnl|my_center|LOCUS_03700 1080 1526 gene locus_tag LOCUS_03710 gene rplX 1080 1526 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 protein_id gnl|my_center|LOCUS_03710 1547 1894 gene locus_tag LOCUS_03720 1547 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03720 1839 1848 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1851 2306 gene locus_tag LOCUS_03730 1851 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03730 2303 2863 gene locus_tag LOCUS_03740 2303 2863 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_03740 2880 3044 gene locus_tag LOCUS_03750 2880 3044 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978389.1 protein_id gnl|my_center|LOCUS_03750 3065 3466 gene locus_tag LOCUS_03760 3065 3466 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978388.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence076 543 319 gene locus_tag LOCUS_03770 543 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1067 816 gene locus_tag LOCUS_03780 1067 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 1145 1444 gene locus_tag LOCUS_03790 1145 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 2368 1415 gene locus_tag LOCUS_03800 2368 1415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 3114 2335 gene locus_tag LOCUS_03810 gene udp 3114 2335 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_03810 3281 3508 gene locus_tag LOCUS_03820 3281 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence077 483 1637 gene locus_tag LOCUS_03830 483 1637 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249334.1 protein_id gnl|my_center|LOCUS_03830 1672 2265 gene locus_tag LOCUS_03840 1672 2265 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_03840 2308 2679 gene locus_tag LOCUS_03850 2308 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 <3676 2718 gene locus_tag LOCUS_03860 <3676 2718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762145.1:ATP-dependent DNA helicase >Feature sequence078 2311 485 gene locus_tag LOCUS_03870 2311 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3570 2275 gene locus_tag LOCUS_03880 3570 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence079 219 1745 gene locus_tag LOCUS_03890 219 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1742 2623 gene locus_tag LOCUS_03900 1742 2623 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156007467.1 protein_id gnl|my_center|LOCUS_03900 3429 2620 gene locus_tag LOCUS_03910 3429 2620 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868725.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence080 1087 224 gene locus_tag LOCUS_03920 1087 224 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990806.1 protein_id gnl|my_center|LOCUS_03920 1767 1066 gene locus_tag LOCUS_03930 1767 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2372 1899 gene locus_tag LOCUS_03940 2372 1899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3531 2653 gene locus_tag LOCUS_03950 3531 2653 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868180.1 protein_id gnl|my_center|LOCUS_03950 >Feature sequence081 <1 613 gene locus_tag LOCUS_03960 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259668.1:aldo/keto reductase 1308 610 gene locus_tag LOCUS_03970 1308 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 3378 1672 gene locus_tag LOCUS_03980 3378 1672 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763167.1 protein_id gnl|my_center|LOCUS_03980 1745 1754 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence082 <1 656 gene locus_tag LOCUS_03990 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879529.1:ribose 1,5-bisphosphate isomerase 1885 776 gene locus_tag LOCUS_04000 1885 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1793 1802 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3097 1889 gene locus_tag LOCUS_04010 3097 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence083 1182 1421 gene locus_tag LOCUS_04020 1182 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 1424 2173 gene locus_tag LOCUS_04030 1424 2173 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_04030 2479 2207 gene locus_tag LOCUS_04040 2479 2207 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_04040 2572 2733 gene locus_tag LOCUS_04050 2572 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3234 2776 gene locus_tag LOCUS_04060 3234 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence084 1431 814 gene locus_tag LOCUS_04070 gene rpsB 1431 814 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867661.1 protein_id gnl|my_center|LOCUS_04070 1661 1428 gene locus_tag LOCUS_04080 1661 1428 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867658.1 protein_id gnl|my_center|LOCUS_04080 2118 1669 gene locus_tag LOCUS_04090 2118 1669 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762448.1 protein_id gnl|my_center|LOCUS_04090 2579 2115 gene locus_tag LOCUS_04100 2579 2115 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980140.1 protein_id gnl|my_center|LOCUS_04100 2955 2593 gene locus_tag LOCUS_04110 2955 2593 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867655.1 protein_id gnl|my_center|LOCUS_04110 <3479 2952 gene locus_tag LOCUS_04120 <3479 2952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875678.1:DNA-directed RNA polymerase subunit D >Feature sequence085 1545 316 gene locus_tag LOCUS_04130 1545 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04130 359 368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1943 1542 gene locus_tag LOCUS_04140 1943 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04140 3234 1990 gene locus_tag LOCUS_04150 3234 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04150 2009 2018 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence086 1085 651 gene locus_tag LOCUS_04160 1085 651 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496977.1 protein_id gnl|my_center|LOCUS_04160 1957 1100 gene locus_tag LOCUS_04170 1957 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_04170 2235 2059 gene locus_tag LOCUS_04180 2235 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 2065 2074 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3326 2253 gene locus_tag LOCUS_04190 3326 2253 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979390.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence087 1593 838 gene locus_tag LOCUS_04200 1593 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04200 2998 1532 gene locus_tag LOCUS_04210 2998 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04210 1609 1618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence088 3022 1400 gene locus_tag LOCUS_04220 3022 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence089 686 1519 gene locus_tag LOCUS_04230 686 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 1697 1524 gene locus_tag LOCUS_04240 1697 1524 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429811.1 protein_id gnl|my_center|LOCUS_04240 <3388 1784 gene locus_tag LOCUS_04250 <3388 1784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763174.1:heavy metal translocating P-type ATPase >Feature sequence090 1082 1681 gene locus_tag LOCUS_04260 1082 1681 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251123.1 protein_id gnl|my_center|LOCUS_04260 1699 2265 gene locus_tag LOCUS_04270 1699 2265 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763573.1 protein_id gnl|my_center|LOCUS_04270 3245 2286 gene locus_tag LOCUS_04280 3245 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 2300 2309 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence091 679 476 gene locus_tag LOCUS_04290 679 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 1002 739 gene locus_tag LOCUS_04300 1002 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 798 807 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2036 1206 gene locus_tag LOCUS_04310 2036 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 2880 2023 gene locus_tag LOCUS_04320 2880 2023 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846346.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence092 1015 1674 gene locus_tag LOCUS_04330 1015 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1662 2297 gene locus_tag LOCUS_04340 1662 2297 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878142.1 protein_id gnl|my_center|LOCUS_04340 >Feature sequence093 703 1911 gene locus_tag LOCUS_04350 gene aspS 703 1911 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_04350 935 944 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2354 1929 gene locus_tag LOCUS_04360 2354 1929 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980291.1 protein_id gnl|my_center|LOCUS_04360 <3346 2393 gene locus_tag LOCUS_04370 <3346 2393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251058.1:efflux RND transporter permease subunit >Feature sequence094 438 1187 gene locus_tag LOCUS_04380 438 1187 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867640.1 protein_id gnl|my_center|LOCUS_04380 1200 2078 gene locus_tag LOCUS_04390 1200 2078 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249755.1 protein_id gnl|my_center|LOCUS_04390 2085 2483 gene locus_tag LOCUS_04400 2085 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 >Feature sequence095 448 1164 gene locus_tag LOCUS_04410 448 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 1273 2163 gene locus_tag LOCUS_04420 1273 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 2402 2160 gene locus_tag LOCUS_04430 2402 2160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 3299 2553 gene locus_tag LOCUS_04440 3299 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence096 364 1260 gene locus_tag LOCUS_04450 364 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 1260 1952 gene locus_tag LOCUS_04460 1260 1952 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980156.1 protein_id gnl|my_center|LOCUS_04460 2039 2069 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2681 2175 gene locus_tag LOCUS_04470 2681 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2977 3004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence097 <1 529 gene locus_tag LOCUS_04480 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064502.1:class I SAM-dependent methyltransferase family protein 513 1124 gene locus_tag LOCUS_04490 513 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979538.1 protein_id gnl|my_center|LOCUS_04490 2085 1093 gene locus_tag LOCUS_04500 2085 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 >Feature sequence098 2559 2323 gene locus_tag LOCUS_04510 2559 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 <3254 2581 gene locus_tag LOCUS_04520 <3254 2581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762739.1:zinc metalloprotease HtpX >Feature sequence099 <1 745 gene locus_tag LOCUS_04530 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256515.1:glycerate kinase 1180 761 gene locus_tag LOCUS_04540 1180 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 1601 3091 gene locus_tag LOCUS_04550 gene metG 1601 3091 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930950.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence100 1050 1985 gene locus_tag LOCUS_04560 gene speB 1050 1985 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978315.1 protein_id gnl|my_center|LOCUS_04560 2228 1992 gene locus_tag LOCUS_04570 2228 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence101 <1 1125 gene locus_tag LOCUS_04580 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846316.1:elongation factor EF-2 1381 1791 gene locus_tag LOCUS_04590 1381 1791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 1808 2407 gene locus_tag LOCUS_04600 gene nuoB 1808 2407 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979576.1 protein_id gnl|my_center|LOCUS_04600 2412 2900 gene locus_tag LOCUS_04610 2412 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04610 >Feature sequence102 410 1042 gene locus_tag LOCUS_04620 410 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2576 1029 gene locus_tag LOCUS_04630 gene gcvPB 2576 1029 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979227.1 protein_id gnl|my_center|LOCUS_04630 <3177 2583 gene locus_tag LOCUS_04640 <3177 2583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979226.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPA >Feature sequence103 903 7 gene locus_tag LOCUS_04650 903 7 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931162.1 protein_id gnl|my_center|LOCUS_04650 1655 1014 gene locus_tag LOCUS_04660 1655 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2009 1674 gene locus_tag LOCUS_04670 2009 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763313.1 protein_id gnl|my_center|LOCUS_04670 <3155 2040 gene locus_tag LOCUS_04680 <3155 2040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903127.1:chloride channel protein >Feature sequence104 419 1129 gene locus_tag LOCUS_04690 419 1129 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980208.1 protein_id gnl|my_center|LOCUS_04690 1853 1137 gene locus_tag LOCUS_04700 1853 1137 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867461.1 protein_id gnl|my_center|LOCUS_04700 >Feature sequence105 816 1016 gene locus_tag LOCUS_04710 816 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 994 1003 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1006 1626 gene locus_tag LOCUS_04720 1006 1626 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240513.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04720 1652 2317 gene locus_tag LOCUS_04730 gene pyrF 1652 2317 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251226.1 protein_id gnl|my_center|LOCUS_04730 >Feature sequence106 <1 2132 gene locus_tag LOCUS_04740 <1 2132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228149.1:aconitate hydratase AcnA 2517 2134 gene locus_tag LOCUS_04750 2517 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2970 2638 gene locus_tag LOCUS_04760 2970 2638 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_04760 >Feature sequence107 274 1215 gene locus_tag LOCUS_04770 gene ftsY 274 1215 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922948.1 protein_id gnl|my_center|LOCUS_04770 2072 1212 gene locus_tag LOCUS_04780 2072 1212 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060997.1 protein_id gnl|my_center|LOCUS_04780 3046 2093 gene locus_tag LOCUS_04790 3046 2093 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876848.1 protein_id gnl|my_center|LOCUS_04790 >Feature sequence108 2163 1147 gene locus_tag LOCUS_04800 2163 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 2346 2510 gene locus_tag LOCUS_04810 2346 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 >Feature sequence109 754 605 gene locus_tag LOCUS_04820 754 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1761 2441 gene locus_tag LOCUS_04830 1761 2441 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_04830 2556 2479 gene locus_tag LOCUS_t00080 2556 2479 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3048 2617 gene locus_tag LOCUS_04840 3048 2617 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980194.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence110 75 434 gene locus_tag LOCUS_04850 75 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1664 459 gene locus_tag LOCUS_04860 1664 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 1986 2591 gene locus_tag LOCUS_04870 1986 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence111 71 316 gene locus_tag LOCUS_04880 71 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 686 695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 752 1381 gene locus_tag LOCUS_04890 752 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04890 1427 1822 gene locus_tag LOCUS_04900 1427 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 1836 2483 gene locus_tag LOCUS_04910 1836 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 >Feature sequence112 356 1204 gene locus_tag LOCUS_04920 356 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1211 2590 gene locus_tag LOCUS_04930 1211 2590 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878369.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence113 >Feature sequence114 <1 785 gene locus_tag LOCUS_04940 <1 785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002213192.1:Gfo/Idh/MocA family oxidoreductase 814 1017 gene locus_tag LOCUS_04950 814 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 1107 1616 gene locus_tag LOCUS_04960 1107 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 2036 1620 gene locus_tag LOCUS_04970 2036 1620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 2506 2084 gene locus_tag LOCUS_04980 2506 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04980 2092 2101 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2630 2965 gene locus_tag LOCUS_04990 2630 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence115 <1 856 gene locus_tag LOCUS_05000 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250850.1:DNA repair and recombination protein RadA 1059 1199 gene locus_tag LOCUS_05010 1059 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 1484 2710 gene locus_tag LOCUS_05020 1484 2710 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963766.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence116 655 167 gene locus_tag LOCUS_05030 655 167 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_05030 1403 720 gene locus_tag LOCUS_05040 1403 720 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763581.1 protein_id gnl|my_center|LOCUS_05040 1804 1535 gene locus_tag LOCUS_05050 1804 1535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 2453 1821 gene locus_tag LOCUS_05060 2453 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2784 2497 gene locus_tag LOCUS_05070 2784 2497 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763639.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence117 <1 652 gene locus_tag LOCUS_05080 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762155.1:FAD-dependent oxidoreductase 1614 700 gene locus_tag LOCUS_05090 1614 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 2618 1611 gene locus_tag LOCUS_05100 2618 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 1648 1657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence118 76 432 gene locus_tag LOCUS_05110 76 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 329 338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 498 725 gene locus_tag LOCUS_05120 498 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 1071 715 gene locus_tag LOCUS_05130 1071 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 2069 1146 gene locus_tag LOCUS_05140 gene arcC 2069 1146 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_05140 <3021 2151 gene locus_tag LOCUS_05150 <3021 2151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147002.1:cyclic 2,3-diphosphoglycerate synthase 2578 2587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence119 1781 1077 gene locus_tag LOCUS_05160 1781 1077 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980610.1 protein_id gnl|my_center|LOCUS_05160 2316 1786 gene locus_tag LOCUS_05170 2316 1786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 2822 2337 gene locus_tag LOCUS_05180 2822 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence120 1338 259 gene locus_tag LOCUS_05190 1338 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 2462 1449 gene locus_tag LOCUS_05200 2462 1449 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762696.1 protein_id gnl|my_center|LOCUS_05200 2926 2474 gene locus_tag LOCUS_05210 2926 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence121 2554 2563 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence122 169 912 gene locus_tag LOCUS_05220 169 912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 956 1234 gene locus_tag LOCUS_05230 956 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 1179 1188 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1209 1388 gene locus_tag LOCUS_05240 1209 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2822 1422 gene locus_tag LOCUS_05250 2822 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence123 125 781 gene locus_tag LOCUS_05260 125 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 911 1687 gene locus_tag LOCUS_05270 911 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1732 2928 gene locus_tag LOCUS_05280 1732 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence124 909 340 gene locus_tag LOCUS_05290 gene thpR 909 340 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_05290 1017 1601 gene locus_tag LOCUS_05300 1017 1601 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870916.1 protein_id gnl|my_center|LOCUS_05300 1564 2004 gene locus_tag LOCUS_05310 1564 2004 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978945.1 protein_id gnl|my_center|LOCUS_05310 2896 1955 gene locus_tag LOCUS_05320 gene rnz 2896 1955 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978944.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence125 597 460 gene locus_tag LOCUS_05330 597 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1051 1665 gene locus_tag LOCUS_05340 gene psmB 1051 1665 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978284.1 protein_id gnl|my_center|LOCUS_05340 1669 2424 gene locus_tag LOCUS_05350 1669 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 <2965 2348 gene locus_tag LOCUS_05360 <2965 2348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979298.1:DUF357 domain-containing protein >Feature sequence126 >Feature sequence127 329 1060 gene locus_tag LOCUS_05370 329 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 1860 1219 gene locus_tag LOCUS_05380 1860 1219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2299 1853 gene locus_tag LOCUS_05390 2299 1853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 2743 2456 gene locus_tag LOCUS_05400 2743 2456 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979487.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence128 630 31 gene locus_tag LOCUS_05410 630 31 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_05410 1350 631 gene locus_tag LOCUS_05420 1350 631 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978327.1 protein_id gnl|my_center|LOCUS_05420 1255 1264 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2387 1326 gene locus_tag LOCUS_05430 gene kae1 2387 1326 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978326.1 protein_id gnl|my_center|LOCUS_05430 2532 2350 gene locus_tag LOCUS_05440 2532 2350 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978325.1 protein_id gnl|my_center|LOCUS_05440 2897 2550 gene locus_tag LOCUS_05450 2897 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence129 237 150 gene locus_tag LOCUS_t00090 237 150 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 428 1471 gene locus_tag LOCUS_05460 428 1471 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846754.1 protein_id gnl|my_center|LOCUS_05460 1532 2566 gene locus_tag LOCUS_05470 1532 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence130 1723 422 gene locus_tag LOCUS_05480 1723 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 1997 1665 gene locus_tag LOCUS_05490 1997 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 2352 2687 gene locus_tag LOCUS_05500 2352 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence131 464 12 gene locus_tag LOCUS_05510 464 12 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776788.1 protein_id gnl|my_center|LOCUS_05510 466 475 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 649 1206 gene locus_tag LOCUS_05520 649 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248978.1 protein_id gnl|my_center|LOCUS_05520 1556 1242 gene locus_tag LOCUS_05530 1556 1242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2532 1654 gene locus_tag LOCUS_05540 2532 1654 CDS product TFIIB-type zinc ribbon-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761775.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence132 281 1048 gene locus_tag LOCUS_05550 gene nucS 281 1048 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 protein_id gnl|my_center|LOCUS_05550 1233 1242 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1701 1429 gene locus_tag LOCUS_05560 1701 1429 CDS product U6 snRNA-associated Sm-like protein LSm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846864.1 protein_id gnl|my_center|LOCUS_05560 2142 1819 gene locus_tag LOCUS_05570 2142 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2632 2165 gene locus_tag LOCUS_05580 2632 2165 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868556.1 protein_id gnl|my_center|LOCUS_05580 2483 2492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence133 1250 1672 gene locus_tag LOCUS_05590 gene gcvH 1250 1672 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846941.1 protein_id gnl|my_center|LOCUS_05590 1820 2713 gene locus_tag LOCUS_05600 1820 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence134 1175 888 gene locus_tag LOCUS_05610 1175 888 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846653.1 protein_id gnl|my_center|LOCUS_05610 1790 1248 gene locus_tag LOCUS_05620 1790 1248 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979580.1 protein_id gnl|my_center|LOCUS_05620 1965 2444 gene locus_tag LOCUS_05630 1965 2444 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763493.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence135 >Feature sequence136 2201 1335 gene locus_tag LOCUS_05640 2201 1335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05640 2658 2263 gene locus_tag LOCUS_05650 2658 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05650 2287 2296 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence137 1542 664 gene locus_tag LOCUS_05660 1542 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761958.1 protein_id gnl|my_center|LOCUS_05660 <2734 1556 gene locus_tag LOCUS_05670 <2734 1556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761956.1:nickel-dependent hydrogenase large subunit 2313 2322 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence138 631 640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2000 1044 gene locus_tag LOCUS_05680 2000 1044 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence139 103 450 gene locus_tag LOCUS_05690 103 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 1391 483 gene locus_tag LOCUS_05700 1391 483 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761913.1 protein_id gnl|my_center|LOCUS_05700 1507 1881 gene locus_tag LOCUS_05710 1507 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 2401 1934 gene locus_tag LOCUS_05720 2401 1934 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_05720 >Feature sequence140 170 466 gene locus_tag LOCUS_05730 170 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 451 460 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 585 1190 gene locus_tag LOCUS_05740 585 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 1166 1762 gene locus_tag LOCUS_05750 1166 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 1884 2282 gene locus_tag LOCUS_05760 1884 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 2225 2234 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence141 515 1663 gene locus_tag LOCUS_05770 515 1663 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763686.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence142 2433 1756 gene locus_tag LOCUS_05780 2433 1756 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941056.1 protein_id gnl|my_center|LOCUS_05780 2657 2475 gene locus_tag LOCUS_05790 2657 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 >Feature sequence143 2 1168 gene locus_tag LOCUS_05800 gene thiI 2 1168 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_05800 2007 1213 gene locus_tag LOCUS_05810 2007 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence144 1090 95 gene locus_tag LOCUS_05820 1090 95 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846871.1 protein_id gnl|my_center|LOCUS_05820 1276 1782 gene locus_tag LOCUS_05830 1276 1782 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868691.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence145 482 141 gene locus_tag LOCUS_05840 482 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 883 722 gene locus_tag LOCUS_05850 883 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1122 1379 gene locus_tag LOCUS_05860 1122 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 1329 1338 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1471 1896 gene locus_tag LOCUS_05870 1471 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence146 289 1155 gene locus_tag LOCUS_05880 289 1155 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_05880 1725 2357 gene locus_tag LOCUS_05890 1725 2357 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_05890 >Feature sequence147 >Feature sequence148 912 103 gene locus_tag LOCUS_05900 912 103 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763580.1 protein_id gnl|my_center|LOCUS_05900 2156 930 gene locus_tag LOCUS_05910 2156 930 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868540.1 protein_id gnl|my_center|LOCUS_05910 >Feature sequence149 1567 1010 gene locus_tag LOCUS_05920 1567 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence150 2198 1278 gene locus_tag LOCUS_05930 gene map 2198 1278 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870846.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence151 1275 1550 gene locus_tag LOCUS_05940 1275 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence152 1275 208 gene locus_tag LOCUS_05950 gene trm14 1275 208 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147322.1 protein_id gnl|my_center|LOCUS_05950 1966 1235 gene locus_tag LOCUS_05960 gene trmJ 1966 1235 CDS product tRNA (cytidine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978427.1 protein_id gnl|my_center|LOCUS_05960 <2523 1971 gene locus_tag LOCUS_05970 <2523 1971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867555.1:class I SAM-dependent methyltransferase >Feature sequence153 1414 884 gene locus_tag LOCUS_05980 gene dcd 1414 884 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846226.1 protein_id gnl|my_center|LOCUS_05980 1534 1884 gene locus_tag LOCUS_05990 1534 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence154 724 1044 gene locus_tag LOCUS_06000 724 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1046 1240 gene locus_tag LOCUS_06010 1046 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 1233 2195 gene locus_tag LOCUS_06020 1233 2195 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868784.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence155 748 539 gene locus_tag LOCUS_06030 748 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 562 571 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1259 801 gene locus_tag LOCUS_06040 1259 801 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868849.1 protein_id gnl|my_center|LOCUS_06040 2085 1408 gene locus_tag LOCUS_06050 2085 1408 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978423.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence156 876 118 gene locus_tag LOCUS_06060 gene sufC 876 118 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846505.1 protein_id gnl|my_center|LOCUS_06060 1504 1037 gene locus_tag LOCUS_06070 1504 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 2043 1534 gene locus_tag LOCUS_06080 2043 1534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence157 505 1008 gene locus_tag LOCUS_06090 505 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 1088 1927 gene locus_tag LOCUS_06100 1088 1927 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_06100 2011 2337 gene locus_tag LOCUS_06110 2011 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 >Feature sequence158 1287 973 gene locus_tag LOCUS_06120 1287 973 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000813947.1 protein_id gnl|my_center|LOCUS_06120 2472 1291 gene locus_tag LOCUS_06130 2472 1291 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583698.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence159 <1 630 gene locus_tag LOCUS_06140 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878782.1:AMP-binding protein 830 2161 gene locus_tag LOCUS_06150 830 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence160 428 937 gene locus_tag LOCUS_06160 428 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 844 853 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2464 962 gene locus_tag LOCUS_06170 2464 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence161 735 744 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1838 2026 gene locus_tag LOCUS_06180 1838 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1993 2002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2068 2424 gene locus_tag LOCUS_06190 2068 2424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence162 9 818 gene locus_tag LOCUS_06200 9 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 943 1272 gene locus_tag LOCUS_06210 943 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1236 2081 gene locus_tag LOCUS_06220 1236 2081 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234329.1 protein_id gnl|my_center|LOCUS_06220 2291 2094 gene locus_tag LOCUS_06230 2291 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence163 214 1590 gene locus_tag LOCUS_06240 214 1590 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_06240 2205 1630 gene locus_tag LOCUS_06250 gene rimI 2205 1630 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence164 633 205 gene locus_tag LOCUS_06260 633 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 787 1212 gene locus_tag LOCUS_06270 787 1212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 1198 1207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1251 1985 gene locus_tag LOCUS_06280 1251 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence165 33 1319 gene locus_tag LOCUS_06290 33 1319 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679275.1 protein_id gnl|my_center|LOCUS_06290 1301 1999 gene locus_tag LOCUS_06300 1301 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2193 1996 gene locus_tag LOCUS_06310 2193 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 >Feature sequence166 2393 2148 gene locus_tag LOCUS_06320 2393 2148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 >Feature sequence167 <1 627 gene locus_tag LOCUS_06330 <1 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250886.1:ABC transporter ATP-binding protein 2180 708 gene locus_tag LOCUS_06340 2180 708 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868194.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence168 1043 1052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence169 1 429 gene locus_tag LOCUS_06350 1 429 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979318.1 protein_id gnl|my_center|LOCUS_06350 288 297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 606 1556 gene locus_tag LOCUS_06360 606 1556 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979838.1 protein_id gnl|my_center|LOCUS_06360 1558 2367 gene locus_tag LOCUS_06370 1558 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence170 717 1136 gene locus_tag LOCUS_06380 717 1136 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251243.1 protein_id gnl|my_center|LOCUS_06380 1752 1129 gene locus_tag LOCUS_06390 1752 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 1996 1802 gene locus_tag LOCUS_06400 1996 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 1808 1817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence171 900 37 gene locus_tag LOCUS_06410 900 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 1836 1060 gene locus_tag LOCUS_06420 1836 1060 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_06420 >Feature sequence172 152 532 gene locus_tag LOCUS_06430 152 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1351 599 gene locus_tag LOCUS_06440 1351 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 <2366 1484 gene locus_tag LOCUS_06450 <2366 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762324.1:CCA tRNA nucleotidyltransferase 1498 1507 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence173 1376 651 gene locus_tag LOCUS_06460 1376 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 1714 2193 gene locus_tag LOCUS_06470 1714 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 2061 2070 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence174 56 292 gene locus_tag LOCUS_06480 56 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1207 296 gene locus_tag LOCUS_06490 1207 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1317 1745 gene locus_tag LOCUS_06500 gene ndk 1317 1745 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_06500 <2354 1760 gene locus_tag LOCUS_06510 <2354 1760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978230.1:translation initiation factor IF-2 >Feature sequence175 1493 273 gene locus_tag LOCUS_06520 1493 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 <2350 1490 gene locus_tag LOCUS_06530 <2350 1490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846723.1:DNA double-strand break repair ATPase Rad50 >Feature sequence176 1034 1121 gene locus_tag LOCUS_t00100 1034 1121 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1244 2218 gene locus_tag LOCUS_06540 1244 2218 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846717.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence177 813 2321 gene locus_tag LOCUS_06550 813 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence178 <1 1598 gene locus_tag LOCUS_06560 <1 1598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198429806.1:ATP-dependent helicase 2322 1570 gene locus_tag LOCUS_06570 2322 1570 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979450.1 protein_id gnl|my_center|LOCUS_06570 >Feature sequence179 1143 1535 gene locus_tag LOCUS_06580 1143 1535 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762965.1 protein_id gnl|my_center|LOCUS_06580 <2339 1532 gene locus_tag LOCUS_06590 <2339 1532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003643773.1:glycerol kinase GlpK >Feature sequence180 >Feature sequence181 1032 355 gene locus_tag LOCUS_06600 gene cdvB1/B2 1032 355 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846860.1 protein_id gnl|my_center|LOCUS_06600 1155 1856 gene locus_tag LOCUS_06610 gene cdvA 1155 1856 CDS product cell division protein CdvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979232.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence182 990 1418 gene locus_tag LOCUS_06620 990 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence183 126 581 gene locus_tag LOCUS_06630 126 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 891 900 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence184 1972 1076 gene locus_tag LOCUS_06640 1972 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06640 >Feature sequence185 16 792 gene locus_tag LOCUS_06650 16 792 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979223.1 protein_id gnl|my_center|LOCUS_06650 821 1258 gene locus_tag LOCUS_06660 821 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 <2306 1261 gene locus_tag LOCUS_06670 <2306 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257680.1:heterodisulfide reductase-related iron-sulfur binding cluster 1378 1387 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence186 798 325 gene locus_tag LOCUS_06680 798 325 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978397.1 protein_id gnl|my_center|LOCUS_06680 1250 813 gene locus_tag LOCUS_06690 1250 813 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978398.1 protein_id gnl|my_center|LOCUS_06690 1866 1363 gene locus_tag LOCUS_06700 1866 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1885 1894 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence187 791 561 gene locus_tag LOCUS_06710 791 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 903 1799 gene locus_tag LOCUS_06720 903 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence188 1126 1135 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence189 <1 725 gene locus_tag LOCUS_06730 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269380.1:acetyl-CoA hydrolase/transferase family protein 900 2138 gene locus_tag LOCUS_06740 900 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 >Feature sequence190 <1 1581 gene locus_tag LOCUS_06750 <1 1581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762431.1:radical SAM protein >Feature sequence191 474 1055 gene locus_tag LOCUS_06760 474 1055 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545244.1 protein_id gnl|my_center|LOCUS_06760 1174 1052 gene locus_tag LOCUS_06770 1174 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2063 1518 gene locus_tag LOCUS_06780 gene endA 2063 1518 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence192 993 1002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1329 1799 gene locus_tag LOCUS_06790 1329 1799 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680818.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence193 1137 64 gene locus_tag LOCUS_06800 gene amrS 1137 64 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249844.1 protein_id gnl|my_center|LOCUS_06800 1982 1077 gene locus_tag LOCUS_06810 1982 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 >Feature sequence194 641 150 gene locus_tag LOCUS_06820 641 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 626 635 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1432 794 gene locus_tag LOCUS_06830 1432 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1679 2089 gene locus_tag LOCUS_06840 1679 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence195 643 981 gene locus_tag LOCUS_06850 643 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 1038 1047 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1298 2032 gene locus_tag LOCUS_06860 1298 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence196 952 1122 gene locus_tag LOCUS_06870 952 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence197 <2207 1227 gene locus_tag LOCUS_06880 <2207 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146706.1:M20/M25/M40 family metallo-hydrolase >Feature sequence198 1118 1127 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence199 <2185 846 gene locus_tag LOCUS_06890 <2185 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836965.1:dihydrolipoyl dehydrogenase >Feature sequence200 1411 1995 gene locus_tag LOCUS_06900 1411 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence201 2 511 gene locus_tag LOCUS_06910 2 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1994 621 gene locus_tag LOCUS_06920 1994 621 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868191.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence202 >Feature sequence203 206 733 gene locus_tag LOCUS_06930 206 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 740 1222 gene locus_tag LOCUS_06940 740 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06940 1268 2098 gene locus_tag LOCUS_06950 1268 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06950 >Feature sequence204 431 1336 gene locus_tag LOCUS_06960 431 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1623 1333 gene locus_tag LOCUS_06970 1623 1333 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846969.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence205 58 492 gene locus_tag LOCUS_06980 58 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 436 445 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 510 1664 gene locus_tag LOCUS_06990 510 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 1679 1864 gene locus_tag LOCUS_07000 1679 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 1835 1844 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence206 1775 1053 gene locus_tag LOCUS_07010 1775 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence207 1069 659 gene locus_tag LOCUS_07020 1069 659 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_07020 1700 1167 gene locus_tag LOCUS_07030 1700 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1930 1757 gene locus_tag LOCUS_07040 1930 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence208 <1 701 gene locus_tag LOCUS_07050 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256769.1:mevalonate kinase 837 1760 gene locus_tag LOCUS_07060 837 1760 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence209 1577 1056 gene locus_tag LOCUS_07070 1577 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence210 538 110 gene locus_tag LOCUS_07080 538 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07080 1631 498 gene locus_tag LOCUS_07090 1631 498 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_07090 1904 1698 gene locus_tag LOCUS_07100 1904 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 >Feature sequence211 720 286 gene locus_tag LOCUS_07110 720 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 1257 784 gene locus_tag LOCUS_07120 1257 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence212 <1 575 gene locus_tag LOCUS_07130 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_180546217.1:ABC transporter ATP-binding protein 589 1593 gene locus_tag LOCUS_07140 589 1593 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence213 586 299 gene locus_tag LOCUS_07150 586 299 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762873.1 protein_id gnl|my_center|LOCUS_07150 1241 660 gene locus_tag LOCUS_07160 1241 660 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_07160 1468 1196 gene locus_tag LOCUS_07170 1468 1196 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250466.1 protein_id gnl|my_center|LOCUS_07170 1952 1521 gene locus_tag LOCUS_07180 1952 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence214 529 538 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 607 1218 gene locus_tag LOCUS_07190 607 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence215 719 728 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 919 2013 gene locus_tag LOCUS_07200 919 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence216 738 935 gene locus_tag LOCUS_07210 738 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 932 1378 gene locus_tag LOCUS_07220 932 1378 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 protein_id gnl|my_center|LOCUS_07220 1452 1793 gene locus_tag LOCUS_07230 1452 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 >Feature sequence217 1133 1618 gene locus_tag LOCUS_07240 1133 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 >Feature sequence218 2 1444 gene locus_tag LOCUS_07250 gene gatA 2 1444 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846522.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence219 >Feature sequence220 30 1121 gene locus_tag LOCUS_07260 30 1121 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867210.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence221 121 912 gene locus_tag LOCUS_07270 121 912 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267572.1 protein_id gnl|my_center|LOCUS_07270 <2058 928 gene locus_tag LOCUS_07280 <2058 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240344.1:FAD-binding oxidoreductase >Feature sequence222 325 882 gene locus_tag LOCUS_07290 325 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 1316 1325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence223 457 1596 gene locus_tag LOCUS_07300 457 1596 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979266.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence224 >Feature sequence225 1028 321 gene locus_tag LOCUS_07310 1028 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1411 989 gene locus_tag LOCUS_07320 1411 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 1716 1408 gene locus_tag LOCUS_07330 1716 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 1414 1423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence226 620 1285 gene locus_tag LOCUS_07340 620 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1293 1931 gene locus_tag LOCUS_07350 1293 1931 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943961.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence227 139 381 gene locus_tag LOCUS_07360 139 381 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_07360 451 1857 gene locus_tag LOCUS_07370 451 1857 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762913.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence228 234 689 gene locus_tag LOCUS_07380 gene ribH 234 689 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846879.1 protein_id gnl|my_center|LOCUS_07380 774 1109 gene locus_tag LOCUS_07390 774 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07390 1086 1098 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1160 1450 gene locus_tag LOCUS_07400 1160 1450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence229 349 1503 gene locus_tag LOCUS_07410 349 1503 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876399.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence230 1396 785 gene locus_tag LOCUS_07420 1396 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1739 1434 gene locus_tag LOCUS_07430 1739 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence231 507 851 gene locus_tag LOCUS_07440 507 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 <1994 985 gene locus_tag LOCUS_07450 <1994 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707115.1:sodium/pantothenate symporter >Feature sequence232 40 786 gene locus_tag LOCUS_07460 40 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1881 766 gene locus_tag LOCUS_07470 gene truD 1881 766 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867746.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence233 154 570 gene locus_tag LOCUS_07480 154 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 658 1461 gene locus_tag LOCUS_07490 658 1461 CDS product extragenic suppressor protein suhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978527.1 protein_id gnl|my_center|LOCUS_07490 1697 1458 gene locus_tag LOCUS_07500 1697 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence234 43 121 gene locus_tag LOCUS_t00110 43 121 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1482 193 gene locus_tag LOCUS_07510 1482 193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07510 1518 1527 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence235 >Feature sequence236 >Feature sequence237 1262 285 gene locus_tag LOCUS_07520 1262 285 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878312.1 protein_id gnl|my_center|LOCUS_07520 1596 1246 gene locus_tag LOCUS_07530 1596 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence238 265 38 gene locus_tag LOCUS_07540 265 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 885 229 gene locus_tag LOCUS_07550 885 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979738.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence239 <1 986 gene locus_tag LOCUS_07560 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081432771.1:magnesium transporter >Feature sequence240 381 857 gene locus_tag LOCUS_07570 381 857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence241 <1 1655 gene locus_tag LOCUS_07580 <1 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978180.1:CTP synthase >Feature sequence242 >Feature sequence243 435 707 gene locus_tag LOCUS_07590 435 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1097 768 gene locus_tag LOCUS_07600 1097 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 773 782 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1383 1141 gene locus_tag LOCUS_07610 1383 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1539 1387 gene locus_tag LOCUS_07620 1539 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1911 1561 gene locus_tag LOCUS_07630 1911 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 >Feature sequence244 834 361 gene locus_tag LOCUS_07640 834 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1923 886 gene locus_tag LOCUS_07650 1923 886 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878139.1 protein_id gnl|my_center|LOCUS_07650 >Feature sequence245 >Feature sequence246 338 895 gene locus_tag LOCUS_07660 338 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07660 1416 1425 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence247 <1931 745 gene locus_tag LOCUS_07670 <1931 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010904193.1:type B DNA-directed DNA polymerase >Feature sequence248 587 1561 gene locus_tag LOCUS_07680 587 1561 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240578.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence249 >Feature sequence250 1206 1592 gene locus_tag LOCUS_07690 1206 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1578 1587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence251 <1916 50 gene locus_tag LOCUS_07700 <1916 50 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978008.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein >Feature sequence252 >Feature sequence253 <1 1402 gene locus_tag LOCUS_07710 <1 1402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141570.1:nitrate reductase >Feature sequence254 816 103 gene locus_tag LOCUS_07720 816 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 1640 828 gene locus_tag LOCUS_07730 1640 828 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141109.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence255 1453 566 gene locus_tag LOCUS_07740 1453 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978174.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence256 >Feature sequence257 <1 784 gene locus_tag LOCUS_07750 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003809683.1:branched-chain amino acid ABC transporter permease 802 1593 gene locus_tag LOCUS_07760 802 1593 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence258 1047 433 gene locus_tag LOCUS_07770 1047 433 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978535.1 protein_id gnl|my_center|LOCUS_07770 771 780 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1411 1058 gene locus_tag LOCUS_07780 1411 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 >Feature sequence259 614 623 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1878 664 gene locus_tag LOCUS_07790 <1878 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979478.1:V-type ATP synthase subunit I >Feature sequence260 516 79 gene locus_tag LOCUS_07800 516 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 1230 526 gene locus_tag LOCUS_07810 1230 526 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846944.1 protein_id gnl|my_center|LOCUS_07810 <1869 1237 gene locus_tag LOCUS_07820 <1869 1237 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_156014546.1:C/D box methylation guide ribonucleoprotein complex aNOP56 subunit >Feature sequence261 1598 492 gene locus_tag LOCUS_07830 1598 492 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence262 545 1747 gene locus_tag LOCUS_07840 545 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence263 209 454 gene locus_tag LOCUS_07850 209 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 487 1191 gene locus_tag LOCUS_07860 gene serB 487 1191 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000084504.1 protein_id gnl|my_center|LOCUS_07860 <1866 1210 gene locus_tag LOCUS_07870 <1866 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878150.1:isocitrate dehydrogenase (NADP(+)) >Feature sequence264 1278 1829 gene locus_tag LOCUS_07880 1278 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence265 411 420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 768 1469 gene locus_tag LOCUS_07890 768 1469 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240232.1 protein_id gnl|my_center|LOCUS_07890 1412 1421 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence266 773 267 gene locus_tag LOCUS_07900 773 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1098 883 gene locus_tag LOCUS_07910 1098 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 893 902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1847 1215 gene locus_tag LOCUS_07920 <1847 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060810.1:4Fe-4S binding protein >Feature sequence267 1592 1293 gene locus_tag LOCUS_07930 1592 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence268 <1 1023 gene locus_tag LOCUS_07940 <1 1023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444167.1:cbb3-type cytochrome c oxidase subunit I 1708 1118 gene locus_tag LOCUS_07950 1708 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence269 677 93 gene locus_tag LOCUS_07960 677 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 942 664 gene locus_tag LOCUS_07970 942 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence270 1543 371 gene locus_tag LOCUS_07980 1543 371 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868011.1 protein_id gnl|my_center|LOCUS_07980 383 392 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence271 484 1416 gene locus_tag LOCUS_07990 484 1416 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869579.1 protein_id gnl|my_center|LOCUS_07990 1432 1441 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence272 >Feature sequence273 1325 1401 gene locus_tag LOCUS_t00120 1325 1401 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence274 614 997 gene locus_tag LOCUS_08000 gene speD 614 997 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650921.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence275 872 330 gene locus_tag LOCUS_08010 gene pyrE 872 330 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762261.1 protein_id gnl|my_center|LOCUS_08010 1367 918 gene locus_tag LOCUS_08020 1367 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence276 >Feature sequence277 <1 683 gene locus_tag LOCUS_08030 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979307.1:DEAD/DEAH box helicase 1585 707 gene locus_tag LOCUS_08040 gene sucD 1585 707 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742632.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence278 792 1463 gene locus_tag LOCUS_08050 792 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence279 149 490 gene locus_tag LOCUS_08060 149 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08060 466 475 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 712 1065 gene locus_tag LOCUS_08070 712 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08070 1071 1553 gene locus_tag LOCUS_08080 gene pyrI 1071 1553 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846971.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence280 <1795 645 gene locus_tag LOCUS_08090 <1795 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240382.1:ferredoxin oxidoreductase >Feature sequence281 192 491 gene locus_tag LOCUS_08100 192 491 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250247.1 protein_id gnl|my_center|LOCUS_08100 642 1436 gene locus_tag LOCUS_08110 642 1436 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence282 49 681 gene locus_tag LOCUS_08120 49 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 684 995 gene locus_tag LOCUS_08130 684 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1048 1057 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence283 431 117 gene locus_tag LOCUS_08140 431 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1568 432 gene locus_tag LOCUS_08150 1568 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence284 >Feature sequence285 1429 1438 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence286 >Feature sequence287 507 433 gene locus_tag LOCUS_t00130 507 433 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 613 1026 gene locus_tag LOCUS_08160 613 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 1566 1114 gene locus_tag LOCUS_08170 1566 1114 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence288 180 455 gene locus_tag LOCUS_08180 180 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08180 424 433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence289 689 907 gene locus_tag LOCUS_08190 689 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08190 947 1411 gene locus_tag LOCUS_08200 947 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08200 >Feature sequence290 1305 178 gene locus_tag LOCUS_08210 1305 178 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979428.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence291 1 720 gene locus_tag LOCUS_08220 1 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 1033 818 gene locus_tag LOCUS_08230 1033 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 <1748 1146 gene locus_tag LOCUS_08240 <1748 1146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978015.1:acyl-CoA dehydrogenase family protein >Feature sequence292 1205 1214 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1741 1241 gene locus_tag LOCUS_08250 <1741 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251163.1:DNA double-strand break repair helicase HerA >Feature sequence293 >Feature sequence294 142 459 gene locus_tag LOCUS_08260 142 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 395 404 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 416 847 gene locus_tag LOCUS_08270 416 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 936 1295 gene locus_tag LOCUS_08280 936 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 >Feature sequence295 >Feature sequence296 3 443 gene locus_tag LOCUS_08290 3 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 675 1220 gene locus_tag LOCUS_08300 675 1220 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173934.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence297 >Feature sequence298 1188 547 gene locus_tag LOCUS_08310 1188 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 605 614 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1708 1194 gene locus_tag LOCUS_08320 <1708 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867988.1:NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit alpha >Feature sequence299 1494 661 gene locus_tag LOCUS_08330 1494 661 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250014.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence300 129 719 gene locus_tag LOCUS_08340 129 719 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250983.1 protein_id gnl|my_center|LOCUS_08340 423 432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence301 188 116 gene locus_tag LOCUS_t00140 188 116 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1067 291 gene locus_tag LOCUS_08350 1067 291 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979881.1 protein_id gnl|my_center|LOCUS_08350 1624 1229 gene locus_tag LOCUS_08360 1624 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence302 790 269 gene locus_tag LOCUS_08370 790 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1109 1540 gene locus_tag LOCUS_08380 1109 1540 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876531.1 protein_id gnl|my_center|LOCUS_08380 1603 1690 gene locus_tag LOCUS_t00150 1603 1690 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence303 710 1411 gene locus_tag LOCUS_08390 710 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence304 853 862 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 880 1191 gene locus_tag LOCUS_08400 880 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence305 1409 675 gene locus_tag LOCUS_08410 gene deoC 1409 675 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949107.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence306 <1 637 gene locus_tag LOCUS_08420 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978418.1:ribosome assembly factor SBDS 637 1326 gene locus_tag LOCUS_08430 gene rrp4 637 1326 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978417.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence307 >Feature sequence308 24 1202 gene locus_tag LOCUS_08440 24 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1354 1267 gene locus_tag LOCUS_t00160 1354 1267 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence309 542 306 gene locus_tag LOCUS_08450 542 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 <1658 715 gene locus_tag LOCUS_08460 <1658 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289101.1:aldo/keto reductase >Feature sequence310 319 328 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 391 948 gene locus_tag LOCUS_08470 391 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 >Feature sequence311 1 546 gene locus_tag LOCUS_08480 1 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 841 575 gene locus_tag LOCUS_08490 841 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1478 924 gene locus_tag LOCUS_08500 gene dps 1478 924 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250010.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence312 <1 663 gene locus_tag LOCUS_08510 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198429779.1:RimK family alpha-L-glutamate ligase 1518 772 gene locus_tag LOCUS_08520 gene pcn 1518 772 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978351.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence313 1393 329 gene locus_tag LOCUS_08530 1393 329 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249506.1 protein_id gnl|my_center|LOCUS_08530 1510 1587 gene locus_tag LOCUS_t00170 1510 1587 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence314 884 477 gene locus_tag LOCUS_08540 884 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08540 1611 787 gene locus_tag LOCUS_08550 1611 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08550 >Feature sequence315 1273 41 gene locus_tag LOCUS_08560 1273 41 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763576.1 protein_id gnl|my_center|LOCUS_08560 1577 1386 gene locus_tag LOCUS_08570 1577 1386 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence316 300 1055 gene locus_tag LOCUS_08580 300 1055 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763546.1 protein_id gnl|my_center|LOCUS_08580 <1625 1065 gene locus_tag LOCUS_08590 <1625 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868261.1:TIGR00289 family protein >Feature sequence317 >Feature sequence318 >Feature sequence319 <1 1061 gene locus_tag LOCUS_08600 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876381.1:phenylalanine--tRNA ligase subunit alpha 952 961 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence320 <1 1553 gene locus_tag LOCUS_08610 <1 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761834.1:metallophosphoesterase >Feature sequence321 869 723 gene locus_tag LOCUS_08620 869 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence322 817 269 gene locus_tag LOCUS_08630 817 269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 <1609 918 gene locus_tag LOCUS_08640 <1609 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877604.1:MBL fold metallo-hydrolase >Feature sequence323 761 919 gene locus_tag LOCUS_08650 761 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1051 1060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence324 <1 608 gene locus_tag LOCUS_08660 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240243.1:hydrogenase formation protein HypD 632 934 gene locus_tag LOCUS_08670 632 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence325 >Feature sequence326 <1 781 gene locus_tag LOCUS_08680 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081868529.1:thiolase domain-containing protein 799 1083 gene locus_tag LOCUS_08690 799 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08690 993 1002 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence327 >Feature sequence328 <1 1101 gene locus_tag LOCUS_08700 <1 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762251.1:nucleotide sugar dehydrogenase >Feature sequence329 1435 665 gene locus_tag LOCUS_08710 1435 665 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979296.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence330 >Feature sequence331 1184 876 gene locus_tag LOCUS_08720 1184 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence332 828 1136 gene locus_tag LOCUS_08730 828 1136 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867536.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence333 580 1059 gene locus_tag LOCUS_08740 580 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 <1575 1072 gene locus_tag LOCUS_08750 <1575 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878861.1:redox-regulated ATPase YchF >Feature sequence334 >Feature sequence335 >Feature sequence336 >Feature sequence337 <1553 687 gene locus_tag LOCUS_08760 <1553 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763487.1:pyridoxal-phosphate dependent enzyme >Feature sequence338 479 1162 gene locus_tag LOCUS_08770 479 1162 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328869.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence339 176 251 gene locus_tag LOCUS_t00180 176 251 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1220 390 gene locus_tag LOCUS_08780 1220 390 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846976.1 protein_id gnl|my_center|LOCUS_08780 685 694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence340 35 439 gene locus_tag LOCUS_08790 35 439 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763571.1 protein_id gnl|my_center|LOCUS_08790 533 745 gene locus_tag LOCUS_08800 533 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 728 737 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1543 800 gene locus_tag LOCUS_08810 <1543 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979517.1:serine--tRNA ligase >Feature sequence341 750 37 gene locus_tag LOCUS_08820 750 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 >Feature sequence342 223 606 gene locus_tag LOCUS_08830 223 606 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980344.1 protein_id gnl|my_center|LOCUS_08830 588 788 gene locus_tag LOCUS_08840 588 788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence343 245 1468 gene locus_tag LOCUS_08850 245 1468 CDS product IS256-like element ISTth4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227798.1 protein_id gnl|my_center|LOCUS_08850 >Feature sequence344 782 1456 gene locus_tag LOCUS_08860 782 1456 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_08860 >Feature sequence345 304 528 gene locus_tag LOCUS_08870 304 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 627 899 gene locus_tag LOCUS_08880 627 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence346 >Feature sequence347 >Feature sequence348 696 1127 gene locus_tag LOCUS_08890 696 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence349 217 1293 gene locus_tag LOCUS_08900 217 1293 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979540.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence350 352 930 gene locus_tag LOCUS_08910 352 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 >Feature sequence351 248 1015 gene locus_tag LOCUS_08920 248 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1012 1476 gene locus_tag LOCUS_08930 1012 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence352 >Feature sequence353 >Feature sequence354 237 440 gene locus_tag LOCUS_08940 237 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 <1506 391 gene locus_tag LOCUS_08950 <1506 391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868458.1:threonine--tRNA ligase >Feature sequence355 >Feature sequence356 <1 861 gene locus_tag LOCUS_08960 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249983.1:AIR synthase family protein 1129 848 gene locus_tag LOCUS_08970 1129 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_08970 >Feature sequence357 >Feature sequence358 >Feature sequence359 328 122 gene locus_tag LOCUS_08980 328 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 631 1383 gene locus_tag LOCUS_08990 631 1383 CDS product DUF2192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846962.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence360 899 312 gene locus_tag LOCUS_09000 899 312 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763044.1 protein_id gnl|my_center|LOCUS_09000 335 344 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1494 908 gene locus_tag LOCUS_09010 <1494 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763591.1:50S ribosomal protein L18 >Feature sequence361 249 1064 gene locus_tag LOCUS_09020 249 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 >Feature sequence362 >Feature sequence363 443 943 gene locus_tag LOCUS_09030 443 943 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_09030 966 1367 gene locus_tag LOCUS_09040 966 1367 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762295.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence364 >Feature sequence365 1047 286 gene locus_tag LOCUS_09050 1047 286 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147021.1 protein_id gnl|my_center|LOCUS_09050 >Feature sequence366 683 264 gene locus_tag LOCUS_09060 683 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 334 343 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1344 934 gene locus_tag LOCUS_09070 1344 934 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979318.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence367 453 91 gene locus_tag LOCUS_09080 453 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 988 467 gene locus_tag LOCUS_09090 988 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 1068 1077 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence368 <1473 373 gene locus_tag LOCUS_09100 <1473 373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978219.1:translation elongation factor EF-1 subunit alpha >Feature sequence369 >Feature sequence370 >Feature sequence371 >Feature sequence372 1174 911 gene locus_tag LOCUS_09110 1174 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09110 >Feature sequence373 391 400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 555 881 gene locus_tag LOCUS_09120 555 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence374 >Feature sequence375 <1 766 gene locus_tag LOCUS_09130 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978500.1:type II/IV secretion system ATPase subunit >Feature sequence376 116 1096 gene locus_tag LOCUS_09140 116 1096 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250169.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence377 180 617 gene locus_tag LOCUS_09150 180 617 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_09150 683 1126 gene locus_tag LOCUS_09160 683 1126 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence378 >Feature sequence379 <1441 757 gene locus_tag LOCUS_09170 <1441 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868079.1:aspartate--tRNA(Asn) ligase >Feature sequence380 1320 955 gene locus_tag LOCUS_09180 1320 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence381 <1 1111 gene locus_tag LOCUS_09190 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879310.1:aspartate aminotransferase family protein >Feature sequence382 582 58 gene locus_tag LOCUS_09200 582 58 CDS product C-GCAxxG-C-C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877963.1 protein_id gnl|my_center|LOCUS_09200 1384 572 gene locus_tag LOCUS_09210 1384 572 CDS product DUF169 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095636.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence383 821 1333 gene locus_tag LOCUS_09220 821 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence384 <1424 37 gene locus_tag LOCUS_09230 <1424 37 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979482.1:ATP synthase subunit B >Feature sequence385 >Feature sequence386 112 624 gene locus_tag LOCUS_09240 112 624 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867435.1 protein_id gnl|my_center|LOCUS_09240 597 902 gene locus_tag LOCUS_09250 597 902 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867436.1 protein_id gnl|my_center|LOCUS_09250 895 1014 gene locus_tag LOCUS_09260 895 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 984 993 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence387 1371 796 gene locus_tag LOCUS_09270 1371 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence388 294 502 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttaaaaacaagcaaaacaaagag >Feature sequence389 >Feature sequence390 638 195 gene locus_tag LOCUS_09280 638 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence391 <1410 653 gene locus_tag LOCUS_09290 <1410 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240542.1:DNA topoisomerase VI subunit B >Feature sequence392 579 229 gene locus_tag LOCUS_09300 579 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 859 470 gene locus_tag LOCUS_09310 859 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 <1410 840 gene locus_tag LOCUS_09320 <1410 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978165.1:ATP-dependent DNA ligase >Feature sequence393 >Feature sequence394 638 192 gene locus_tag LOCUS_09330 638 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 >Feature sequence395 <1 1132 gene locus_tag LOCUS_09340 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868529.1:MATE family efflux transporter >Feature sequence396 <1 1306 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttctattctcttttgagtattc >Feature sequence397 1068 469 gene locus_tag LOCUS_09350 1068 469 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867177.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence398 1265 39 gene locus_tag LOCUS_09360 1265 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence399 1313 330 gene locus_tag LOCUS_09370 1313 330 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879105.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence400 163 1245 gene locus_tag LOCUS_09380 gene twy1 163 1245 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979301.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence401 >Feature sequence402 250 38 gene locus_tag LOCUS_09390 250 38 CDS product chromatin protein Cren7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846948.1 protein_id gnl|my_center|LOCUS_09390 952 437 gene locus_tag LOCUS_09400 952 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence403 >Feature sequence404 584 958 gene locus_tag LOCUS_09410 584 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1332 955 gene locus_tag LOCUS_09420 1332 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence405 <1 988 gene locus_tag LOCUS_09430 <1 988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980518.1:2-oxoacid:ferredoxin oxidoreductase subunit beta 424 433 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence406 >Feature sequence407 157 888 gene locus_tag LOCUS_09440 157 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 >Feature sequence408 3 1160 gene locus_tag LOCUS_09450 3 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence409 148 756 gene locus_tag LOCUS_09460 gene hxlB 148 756 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978137.1 protein_id gnl|my_center|LOCUS_09460 769 1224 gene locus_tag LOCUS_09470 gene hypA 769 1224 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867705.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence410 <1344 34 gene locus_tag LOCUS_09480 <1344 34 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013267177.1:AMP-binding protein >Feature sequence411 75 620 gene locus_tag LOCUS_09490 75 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1208 645 gene locus_tag LOCUS_09500 1208 645 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249257.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence412 1237 932 gene locus_tag LOCUS_09510 1237 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence413 43 504 gene locus_tag LOCUS_09520 43 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 491 1207 gene locus_tag LOCUS_09530 491 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence414 <1 1035 gene locus_tag LOCUS_09540 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846515.1:Nre family DNA repair protein >Feature sequence415 <1327 672 gene locus_tag LOCUS_09550 <1327 672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143274415.1:aspartate aminotransferase family protein >Feature sequence416 >Feature sequence417 <1319 445 gene locus_tag LOCUS_09560 <1319 445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240222.1:Lrp/AsnC family transcriptional regulator >Feature sequence418 9 86 gene locus_tag LOCUS_t00190 9 86 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence419 177 329 gene locus_tag LOCUS_09570 177 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09570 316 325 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence420 674 952 gene locus_tag LOCUS_09580 674 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1157 1244 gene locus_tag LOCUS_t00200 1157 1244 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence421 >Feature sequence422 >Feature sequence423 >Feature sequence424 <1 522 gene locus_tag LOCUS_09590 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867386.1:SDR family oxidoreductase 796 560 gene locus_tag LOCUS_09600 796 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 843 852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence425 <1 556 gene locus_tag LOCUS_09610 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980734.1:type I-A CRISPR-associated protein Cas5a >Feature sequence426 <1 792 gene locus_tag LOCUS_09620 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010885176.1:5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase >Feature sequence427 >Feature sequence428 371 1213 gene locus_tag LOCUS_09630 gene proC 371 1213 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978628.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence429 <1277 648 gene locus_tag LOCUS_09640 <1277 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933689.1:homoserine kinase >Feature sequence430 >Feature sequence431 31 651 gene locus_tag LOCUS_09650 31 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 446 455 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 644 1093 gene locus_tag LOCUS_09660 644 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence432 >Feature sequence433 1143 985 gene locus_tag LOCUS_09670 1143 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09670 >Feature sequence434 1247 816 gene locus_tag LOCUS_09680 1247 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence435 249 1052 gene locus_tag LOCUS_09690 249 1052 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence436 503 3 gene locus_tag LOCUS_09700 503 3 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846721.1 protein_id gnl|my_center|LOCUS_09700 <1264 595 gene locus_tag LOCUS_09710 <1264 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064408.1:mechanosensitive ion channel family protein >Feature sequence437 >Feature sequence438 <1 555 gene locus_tag LOCUS_09720 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762363.1:putative 4-hydroxybenzoate polyprenyltransferase <1260 629 gene locus_tag LOCUS_09730 <1260 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868647.1:M20/M25/M40 family metallo-hydrolase >Feature sequence439 >Feature sequence440 >Feature sequence441 692 96 gene locus_tag LOCUS_09740 692 96 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250877.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence442 528 151 gene locus_tag LOCUS_09750 528 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence443 <1 844 gene locus_tag LOCUS_09760 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249089.1:histone deacetylase family protein >Feature sequence444 >Feature sequence445 >Feature sequence446 42 251 gene locus_tag LOCUS_09770 42 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 424 1155 gene locus_tag LOCUS_09780 424 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 >Feature sequence447 3 776 gene locus_tag LOCUS_09790 3 776 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081007.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence448 1215 496 gene locus_tag LOCUS_09800 1215 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence449 >Feature sequence450 600 676 gene locus_tag LOCUS_t00210 600 676 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence451 >Feature sequence452 41 859 gene locus_tag LOCUS_09810 41 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence453 >Feature sequence454 >Feature sequence455 >Feature sequence456 858 124 gene locus_tag LOCUS_09820 gene sfsA 858 124 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence457 815 737 gene locus_tag LOCUS_t00220 815 737 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence458 >Feature sequence459 306 22 gene locus_tag LOCUS_09830 306 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 <1219 251 gene locus_tag LOCUS_09840 <1219 251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146584.1:AIR synthase family protein >Feature sequence460 >Feature sequence461 <1214 152 gene locus_tag LOCUS_09850 <1214 152 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250736.1:class I SAM-dependent rRNA methyltransferase >Feature sequence462 423 244 gene locus_tag LOCUS_09860 423 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 460 469 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence463 477 1202 gene locus_tag LOCUS_09870 gene rnhB 477 1202 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978497.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence464 454 463 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1209 557 gene locus_tag LOCUS_09880 <1209 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978239.1:radical SAM protein >Feature sequence465 <1206 621 gene locus_tag LOCUS_09890 <1206 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249091.1:indolepyruvate ferredoxin oxidoreductase subunit alpha note possible pseudo, frameshifted 624 633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence466 137 292 gene locus_tag LOCUS_09900 137 292 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_09900 332 691 gene locus_tag LOCUS_09910 332 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence467 <1205 228 gene locus_tag LOCUS_09920 <1205 228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980299.1:NADH-quinone oxidoreductase subunit D >Feature sequence468 608 129 gene locus_tag LOCUS_09930 608 129 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763400.1 protein_id gnl|my_center|LOCUS_09930 1086 613 gene locus_tag LOCUS_09940 1086 613 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284194.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence469 16 468 gene locus_tag LOCUS_09950 gene moaC 16 468 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867492.1 protein_id gnl|my_center|LOCUS_09950 <1193 465 gene locus_tag LOCUS_09960 <1193 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846342.1:replication factor C large subunit >Feature sequence470 <1 526 gene locus_tag LOCUS_09970 <1 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762711.1:DNA primase DnaG >Feature sequence471 >Feature sequence472 >Feature sequence473 103 522 gene locus_tag LOCUS_09980 gene pfdA 103 522 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880460.1 protein_id gnl|my_center|LOCUS_09980 680 892 gene locus_tag LOCUS_09990 680 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 800 809 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence474 >Feature sequence475 >Feature sequence476 128 1135 gene locus_tag LOCUS_10000 128 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence477 <1183 259 gene locus_tag LOCUS_10010 <1183 259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064511.1:radical SAM protein >Feature sequence478 <1 551 gene locus_tag LOCUS_10020 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946745.1:cation-translocating P-type ATPase >Feature sequence479 688 1083 gene locus_tag LOCUS_10030 688 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence480 >Feature sequence481 <1 851 gene locus_tag LOCUS_10040 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198429732.1:ORC1-type DNA replication protein 865 1125 gene locus_tag LOCUS_10050 865 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence482 774 783 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence483 >Feature sequence484 1166 522 gene locus_tag LOCUS_10060 1166 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence485 997 227 gene locus_tag LOCUS_10070 997 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence486 >Feature sequence487 998 468 gene locus_tag LOCUS_10080 998 468 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979867.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence488 116 610 gene locus_tag LOCUS_10090 116 610 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_10090 434 443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1152 652 gene locus_tag LOCUS_10100 <1152 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933743.1:maltose alpha-D-glucosyltransferase >Feature sequence489 >Feature sequence490 >Feature sequence491 69 374 gene locus_tag LOCUS_10110 gene yciH 69 374 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978313.1 protein_id gnl|my_center|LOCUS_10110 1120 437 gene locus_tag LOCUS_10120 1120 437 CDS product archaetidylserine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060953.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence492 >Feature sequence493 958 665 gene locus_tag LOCUS_10130 958 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence494 >Feature sequence495 813 379 gene locus_tag LOCUS_10140 813 379 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868728.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence496 >Feature sequence497 45 767 gene locus_tag LOCUS_10150 45 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence498 <1142 148 gene locus_tag LOCUS_10160 <1142 148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867839.1:phosphoadenosine phosphosulfate reductase family protein >Feature sequence499 647 656 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence500 <1141 306 gene locus_tag LOCUS_10170 <1141 306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064561.1:aconitase X >Feature sequence501 >Feature sequence502 <1 728 gene locus_tag LOCUS_10180 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007054642.1:potassium channel family protein >Feature sequence503 837 196 gene locus_tag LOCUS_10190 837 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence504 >Feature sequence505 25 216 gene locus_tag LOCUS_10200 25 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence506 >Feature sequence507 >Feature sequence508 <1 618 gene locus_tag LOCUS_10210 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056506.1:16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA >Feature sequence509 <1 612 gene locus_tag LOCUS_10220 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879266.1:ABC transporter ATP-binding protein 805 814 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence510 >Feature sequence511 >Feature sequence512 <1 741 gene locus_tag LOCUS_10230 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978315.1:agmatinase 1017 814 gene locus_tag LOCUS_10240 1017 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 >Feature sequence513 1 351 gene locus_tag LOCUS_10250 1 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10250 309 318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 417 827 gene locus_tag LOCUS_10260 417 827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10260 >Feature sequence514 >Feature sequence515 988 56 gene locus_tag LOCUS_10270 988 56 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762917.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence516 <1109 12 gene locus_tag LOCUS_10280 <1109 12 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878549.1:ATPase, T2SS/T4P/T4SS family >Feature sequence517 >Feature sequence518 431 1027 gene locus_tag LOCUS_10290 431 1027 CDS product TIGR00267 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870150.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence519 >Feature sequence520 175 951 gene locus_tag LOCUS_10300 175 951 CDS product nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240366.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence521 493 502 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1097 540 gene locus_tag LOCUS_10310 <1097 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980611.1:type II/IV secretion system ATPase subunit >Feature sequence522 >Feature sequence523 989 69 gene locus_tag LOCUS_10320 989 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence524 943 413 gene locus_tag LOCUS_10330 gene ppa 943 413 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846890.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence525 >Feature sequence526 <1 587 gene locus_tag LOCUS_10340 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793956.1:cytochrome-c peroxidase >Feature sequence527 1074 184 gene locus_tag LOCUS_10350 1074 184 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence528 >Feature sequence529 531 540 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence530 37 1065 gene locus_tag LOCUS_10360 37 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence531 616 302 gene locus_tag LOCUS_10370 616 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence532 762 493 gene locus_tag LOCUS_10380 762 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 505 514 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence533 >Feature sequence534 497 141 gene locus_tag LOCUS_10390 497 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846359.1 protein_id gnl|my_center|LOCUS_10390 675 845 gene locus_tag LOCUS_10400 675 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence535 996 127 gene locus_tag LOCUS_10410 996 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence536 415 293 gene locus_tag LOCUS_10420 415 293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 <1073 435 gene locus_tag LOCUS_10430 <1073 435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391701.1:aldehyde ferredoxin oxidoreductase family protein note possible pseudo, internal stop codon, frameshifted 441 450 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence537 566 15 gene locus_tag LOCUS_10440 566 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence538 <1 821 gene locus_tag LOCUS_10450 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979496.1:50S ribosome-binding GTPase >Feature sequence539 >Feature sequence540 >Feature sequence541 871 449 gene locus_tag LOCUS_10460 871 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence542 >Feature sequence543 676 218 gene locus_tag LOCUS_10470 676 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 741 750 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence544 >Feature sequence545 863 390 gene locus_tag LOCUS_10480 863 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 401 410 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence546 <1 898 gene locus_tag LOCUS_10490 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762966.1:aldehyde ferredoxin oxidoreductase N-terminal domain-containing protein >Feature sequence547 >Feature sequence548 791 306 gene locus_tag LOCUS_10500 791 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence549 302 311 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1058 561 gene locus_tag LOCUS_10510 1058 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence550 446 123 gene locus_tag LOCUS_10520 446 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1000 701 gene locus_tag LOCUS_10530 1000 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10530 732 741 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence551 <1 947 gene locus_tag LOCUS_10540 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_209320021.1:DUF401 family protein >Feature sequence552 >Feature sequence553 291 686 gene locus_tag LOCUS_10550 291 686 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146466.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence554 >Feature sequence555 >Feature sequence556 39 905 gene locus_tag LOCUS_10560 39 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence557 <1043 113 gene locus_tag LOCUS_10570 <1043 113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846776.1:cobalamin biosynthesis protein >Feature sequence558 >Feature sequence559 131 961 gene locus_tag LOCUS_10580 131 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence560 >Feature sequence561 >Feature sequence562 >Feature sequence563 >Feature sequence564 <1035 416 gene locus_tag LOCUS_10590 <1035 416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249890.1:GHMP kinase 453 462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence565 9 86 gene locus_tag LOCUS_t00230 9 86 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 964 179 gene locus_tag LOCUS_10600 964 179 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763580.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence566 486 1004 gene locus_tag LOCUS_10610 486 1004 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871125.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence567 662 671 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence568 324 94 gene locus_tag LOCUS_10620 324 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 661 317 gene locus_tag LOCUS_10630 661 317 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980344.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence569 904 515 gene locus_tag LOCUS_10640 904 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence570 >Feature sequence571 <1 781 gene locus_tag LOCUS_10650 <1 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013684142.1:CBS domain-containing protein >Feature sequence572 >Feature sequence573 898 485 gene locus_tag LOCUS_10660 898 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence574 >Feature sequence575 >Feature sequence576 749 459 gene locus_tag LOCUS_10670 749 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence577 >Feature sequence578 >Feature sequence579 >Feature sequence580 >Feature sequence581 926 681 gene locus_tag LOCUS_10680 926 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence582 >Feature sequence583 445 582 gene locus_tag LOCUS_10690 445 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 452 461 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence584 >Feature sequence585 >Feature sequence586 271 543 gene locus_tag LOCUS_10700 271 543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 476 485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence587 <1010 356 gene locus_tag LOCUS_10710 <1010 356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582434.1:alkaline phosphatase family protein >Feature sequence588 >Feature sequence589 >Feature sequence590 <1006 64 gene locus_tag LOCUS_10720 <1006 64 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761873.1:TIGR04053 family radical SAM/SPASM domain-containing protein >Feature sequence591 115 828 gene locus_tag LOCUS_10730 115 828 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020313.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence592 >Feature sequence593