>Feature sequence001 326 892 gene locus_tag LOCUS_00010 326 892 CDS product DUF882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705140.1 protein_id gnl|my_center|LOCUS_00010 2419 893 gene locus_tag LOCUS_00020 2419 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 4794 2551 gene locus_tag LOCUS_00030 4794 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 5270 4800 gene locus_tag LOCUS_00040 5270 4800 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066921.1 protein_id gnl|my_center|LOCUS_00040 6220 5267 gene locus_tag LOCUS_00050 6220 5267 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038004.1 protein_id gnl|my_center|LOCUS_00050 6485 6300 gene locus_tag LOCUS_00060 6485 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706655.1 protein_id gnl|my_center|LOCUS_00060 8000 6489 gene locus_tag LOCUS_00070 8000 6489 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545613.1 protein_id gnl|my_center|LOCUS_00070 8427 8044 gene locus_tag LOCUS_00080 8427 8044 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257965.1 protein_id gnl|my_center|LOCUS_00080 8663 8436 gene locus_tag LOCUS_00090 8663 8436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9879 8728 gene locus_tag LOCUS_00100 9879 8728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 10630 10352 gene locus_tag LOCUS_00110 10630 10352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 10899 10627 gene locus_tag LOCUS_00120 10899 10627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 <11488 10954 gene locus_tag LOCUS_00130 <11488 10954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546856.1:type I restriction-modification enzyme R subunit C-terminal domain-containing protein >Feature sequence002 <1 581 gene locus_tag LOCUS_00140 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072773682.1:FAD-dependent oxidoreductase 597 764 gene locus_tag LOCUS_00150 597 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 776 2287 gene locus_tag LOCUS_00160 776 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 2299 2718 gene locus_tag LOCUS_00170 2299 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 2735 4192 gene locus_tag LOCUS_00180 2735 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 4318 4097 gene locus_tag LOCUS_00190 4318 4097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 4503 6401 gene locus_tag LOCUS_00200 4503 6401 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615587.1 protein_id gnl|my_center|LOCUS_00200 6398 8590 gene locus_tag LOCUS_00210 gene hyfB 6398 8590 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089079.1 protein_id gnl|my_center|LOCUS_00210 9676 8591 gene locus_tag LOCUS_00220 9676 8591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 <10248 9708 gene locus_tag LOCUS_00230 <10248 9708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011336894.1:M15 family metallopeptidase >Feature sequence003 1234 152 gene locus_tag LOCUS_00240 gene dctP 1234 152 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_00240 1705 1253 gene locus_tag LOCUS_00250 1705 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 2117 1710 gene locus_tag LOCUS_00260 2117 1710 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595914.1 protein_id gnl|my_center|LOCUS_00260 2421 2128 gene locus_tag LOCUS_00270 2421 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 2534 3214 gene locus_tag LOCUS_00280 2534 3214 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_00280 3211 4554 gene locus_tag LOCUS_00290 3211 4554 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_00290 4554 5168 gene locus_tag LOCUS_00300 gene nudF 4554 5168 CDS product ADP-ribose diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024943166.1 protein_id gnl|my_center|LOCUS_00300 5910 5143 gene locus_tag LOCUS_00310 5910 5143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 5993 6562 gene locus_tag LOCUS_00320 5993 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038181.1 protein_id gnl|my_center|LOCUS_00320 6846 8714 gene locus_tag LOCUS_00330 6846 8714 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_00330 >Feature sequence004 296 1216 gene locus_tag LOCUS_00340 gene miaA 296 1216 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113929.1 protein_id gnl|my_center|LOCUS_00340 1339 2352 gene locus_tag LOCUS_00350 gene gap 1339 2352 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194065.1 protein_id gnl|my_center|LOCUS_00350 2356 3828 gene locus_tag LOCUS_00360 gene pyk 2356 3828 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093930.1 protein_id gnl|my_center|LOCUS_00360 3858 4886 gene locus_tag LOCUS_00370 3858 4886 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_00370 4974 6980 gene locus_tag LOCUS_00380 gene tkt 4974 6980 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110216.1 protein_id gnl|my_center|LOCUS_00380 7002 8048 gene locus_tag LOCUS_00390 gene fba 7002 8048 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084964.1 protein_id gnl|my_center|LOCUS_00390 8134 9198 gene locus_tag LOCUS_00400 gene fba 8134 9198 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084964.1 protein_id gnl|my_center|LOCUS_00400 >Feature sequence005 654 1598 gene locus_tag LOCUS_00410 654 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 2761 1595 gene locus_tag LOCUS_00420 2761 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 2693 3850 gene locus_tag LOCUS_00430 2693 3850 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172006.1 protein_id gnl|my_center|LOCUS_00430 3964 4176 gene locus_tag LOCUS_00440 3964 4176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 4217 5182 gene locus_tag LOCUS_00450 4217 5182 CDS product YVTN family beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532045.1 protein_id gnl|my_center|LOCUS_00450 5653 5189 gene locus_tag LOCUS_00460 5653 5189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 7480 5675 gene locus_tag LOCUS_00470 7480 5675 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840152.1 protein_id gnl|my_center|LOCUS_00470 8190 7480 gene locus_tag LOCUS_00480 8190 7480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 >Feature sequence006 <1 1066 gene locus_tag LOCUS_00490 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957390.1:penicillin-binding protein 2 1066 2505 gene locus_tag LOCUS_00500 1066 2505 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994100.1 protein_id gnl|my_center|LOCUS_00500 2496 3845 gene locus_tag LOCUS_00510 2496 3845 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103103.1 protein_id gnl|my_center|LOCUS_00510 3847 4923 gene locus_tag LOCUS_00520 gene mraY 3847 4923 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_00520 5290 4943 gene locus_tag LOCUS_00530 5290 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 5259 6269 gene locus_tag LOCUS_00540 5259 6269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00540 6251 7414 gene locus_tag LOCUS_00550 gene ftsW 6251 7414 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_00550 >Feature sequence007 <1 546 gene locus_tag LOCUS_00560 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087474.1:cytochrome D1 domain-containing protein 543 875 gene locus_tag LOCUS_00570 543 875 CDS product YqcC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705085.1 protein_id gnl|my_center|LOCUS_00570 878 1174 gene locus_tag LOCUS_00580 878 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947734.1 protein_id gnl|my_center|LOCUS_00580 1223 1298 gene locus_tag LOCUS_t00010 1223 1298 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2506 1478 gene locus_tag LOCUS_00590 2506 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 2941 2669 gene locus_tag LOCUS_00600 2941 2669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00600 3603 3103 gene locus_tag LOCUS_00610 3603 3103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00610 3868 3659 gene locus_tag LOCUS_00620 3868 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 5046 3859 gene locus_tag LOCUS_00630 gene istA 5046 3859 CDS product IS21-like element IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000952372.1 protein_id gnl|my_center|LOCUS_00630 5200 5805 gene locus_tag LOCUS_00640 5200 5805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00640 6033 6404 gene locus_tag LOCUS_00650 6033 6404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 6805 6602 gene locus_tag LOCUS_00660 6805 6602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 >Feature sequence008 1 453 gene locus_tag LOCUS_00670 1 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 481 1299 gene locus_tag LOCUS_00680 481 1299 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257972.1 protein_id gnl|my_center|LOCUS_00680 1344 1805 gene locus_tag LOCUS_00690 1344 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 1816 2250 gene locus_tag LOCUS_00700 1816 2250 CDS product DUF29 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817109.1 protein_id gnl|my_center|LOCUS_00700 2258 2677 gene locus_tag LOCUS_00710 2258 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 2674 2988 gene locus_tag LOCUS_00720 2674 2988 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227670.1 protein_id gnl|my_center|LOCUS_00720 2978 3361 gene locus_tag LOCUS_00730 2978 3361 CDS product HI0074 family nucleotidyltransferase substrate-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118912.1 protein_id gnl|my_center|LOCUS_00730 3512 3919 gene locus_tag LOCUS_00740 3512 3919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 3946 4173 gene locus_tag LOCUS_00750 3946 4173 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_00750 4383 5648 gene locus_tag LOCUS_00760 4383 5648 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963401.1 protein_id gnl|my_center|LOCUS_00760 5599 6213 gene locus_tag LOCUS_00770 5599 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 >Feature sequence009 <1 649 gene locus_tag LOCUS_00780 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_082827560.1:triphosphoribosyl-dephospho-CoA synthase 746 1258 gene locus_tag LOCUS_00790 gene fae 746 1258 CDS product formaldehyde-activating enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532036.1 protein_id gnl|my_center|LOCUS_00790 1965 1279 gene locus_tag LOCUS_00800 1965 1279 CDS product HisA/HisF-related TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082827384.1 protein_id gnl|my_center|LOCUS_00800 1964 2932 gene locus_tag LOCUS_00810 1964 2932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 2929 3969 gene locus_tag LOCUS_00820 2929 3969 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532038.1 protein_id gnl|my_center|LOCUS_00820 3995 5374 gene locus_tag LOCUS_00830 gene pabB 3995 5374 CDS product aminodeoxychorismate synthase component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001063909.1 protein_id gnl|my_center|LOCUS_00830 5367 5957 gene locus_tag LOCUS_00840 5367 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00840 >Feature sequence010 915 310 gene locus_tag LOCUS_00850 915 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 1673 918 gene locus_tag LOCUS_00860 1673 918 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070969.1 protein_id gnl|my_center|LOCUS_00860 1857 1711 gene locus_tag LOCUS_00870 1857 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 3414 1858 gene locus_tag LOCUS_00880 3414 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 3797 3390 gene locus_tag LOCUS_00890 3797 3390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 4117 3794 gene locus_tag LOCUS_00900 4117 3794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 4554 4114 gene locus_tag LOCUS_00910 4554 4114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 4868 4557 gene locus_tag LOCUS_00920 4868 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 5227 5709 gene locus_tag LOCUS_00930 5227 5709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 6525 5917 gene locus_tag LOCUS_00940 6525 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00940 >Feature sequence011 1441 950 gene locus_tag LOCUS_00950 1441 950 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_00950 2226 1447 gene locus_tag LOCUS_00960 gene kdsB 2226 1447 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185994.1 protein_id gnl|my_center|LOCUS_00960 2417 2223 gene locus_tag LOCUS_00970 2417 2223 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947637.1 protein_id gnl|my_center|LOCUS_00970 2838 2422 gene locus_tag LOCUS_00980 2838 2422 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317468.1 protein_id gnl|my_center|LOCUS_00980 3464 2835 gene locus_tag LOCUS_00990 3464 2835 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_00990 3998 3549 gene locus_tag LOCUS_01000 3998 3549 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228706.1 protein_id gnl|my_center|LOCUS_01000 4152 4658 gene locus_tag LOCUS_01010 gene purE 4152 4658 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172593.1 protein_id gnl|my_center|LOCUS_01010 4655 5734 gene locus_tag LOCUS_01020 4655 5734 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227994.1 protein_id gnl|my_center|LOCUS_01020 >Feature sequence012 <1 828 gene locus_tag LOCUS_01030 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268904.1:sulfite exporter TauE/SafE family protein 864 1193 gene locus_tag LOCUS_01040 864 1193 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_01040 1581 1255 gene locus_tag LOCUS_01050 gene rplQ 1581 1255 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036134.1 protein_id gnl|my_center|LOCUS_01050 2693 1671 gene locus_tag LOCUS_01060 gene rpoA 2693 1671 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_01060 1860 1933 gene locus_tag LOCUS_t00020 1860 1933 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3341 2718 gene locus_tag LOCUS_01070 gene rpsD 3341 2718 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 protein_id gnl|my_center|LOCUS_01070 3742 3356 gene locus_tag LOCUS_01080 gene rpsK 3742 3356 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005319702.1 protein_id gnl|my_center|LOCUS_01080 4131 3775 gene locus_tag LOCUS_01090 gene rpsM 4131 3775 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093692.1 protein_id gnl|my_center|LOCUS_01090 5636 4299 gene locus_tag LOCUS_01100 gene secY 5636 4299 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_01100 6091 5654 gene locus_tag LOCUS_01110 gene rplO 6091 5654 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197941.1 protein_id gnl|my_center|LOCUS_01110 6279 6091 gene locus_tag LOCUS_01120 gene rpmD 6279 6091 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806924.1 protein_id gnl|my_center|LOCUS_01120 >Feature sequence013 921 361 gene locus_tag LOCUS_01130 921 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 1007 1408 gene locus_tag LOCUS_01140 1007 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 1496 3175 gene locus_tag LOCUS_01150 1496 3175 CDS product NADH-ubiquinone oxidoreductase-F iron-sulfur binding region domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085104.1 protein_id gnl|my_center|LOCUS_01150 3179 5956 gene locus_tag LOCUS_01160 gene fdhF 3179 5956 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085105.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence014 1394 717 gene locus_tag LOCUS_01170 gene nfi 1394 717 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_01170 2196 1384 gene locus_tag LOCUS_01180 gene mazG 2196 1384 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389380.1 protein_id gnl|my_center|LOCUS_01180 3112 2180 gene locus_tag LOCUS_01190 3112 2180 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_01190 3494 3117 gene locus_tag LOCUS_01200 3494 3117 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706544.1 protein_id gnl|my_center|LOCUS_01200 3880 3494 gene locus_tag LOCUS_01210 gene gcvH 3880 3494 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114050.1 protein_id gnl|my_center|LOCUS_01210 3993 4910 gene locus_tag LOCUS_01220 3993 4910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence015 53 541 gene locus_tag LOCUS_01230 53 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 562 1254 gene locus_tag LOCUS_01240 562 1254 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044988.1 protein_id gnl|my_center|LOCUS_01240 1276 3231 gene locus_tag LOCUS_01250 1276 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 3235 4044 gene locus_tag LOCUS_01260 3235 4044 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037361.1 protein_id gnl|my_center|LOCUS_01260 4057 4557 gene locus_tag LOCUS_01270 4057 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 4554 4973 gene locus_tag LOCUS_01280 4554 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 <6577 4984 gene locus_tag LOCUS_01290 <6577 4984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946755.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence016 322 1452 gene locus_tag LOCUS_01300 322 1452 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242132.1 protein_id gnl|my_center|LOCUS_01300 1516 2892 gene locus_tag LOCUS_01310 gene opmH 1516 2892 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_01310 2876 3934 gene locus_tag LOCUS_01320 2876 3934 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_01320 3915 5633 gene locus_tag LOCUS_01330 3915 5633 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812261.1 protein_id gnl|my_center|LOCUS_01330 6058 5840 gene locus_tag LOCUS_01340 6058 5840 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021610.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence017 <1 519 gene locus_tag LOCUS_01350 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530340.1:DUF937 domain-containing protein 536 976 gene locus_tag LOCUS_01360 gene lysM 536 976 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120434.1 protein_id gnl|my_center|LOCUS_01360 1169 3691 gene locus_tag LOCUS_01370 1169 3691 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393352.1 protein_id gnl|my_center|LOCUS_01370 4648 3698 gene locus_tag LOCUS_01380 4648 3698 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022353.1 protein_id gnl|my_center|LOCUS_01380 5795 4662 gene locus_tag LOCUS_01390 5795 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 <6474 5878 gene locus_tag LOCUS_01400 <6474 5878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:sigma-54 dependent transcriptional regulator >Feature sequence018 211 696 gene locus_tag LOCUS_01410 gene ssb 211 696 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114685.1 protein_id gnl|my_center|LOCUS_01410 703 1371 gene locus_tag LOCUS_01420 703 1371 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949128.1 protein_id gnl|my_center|LOCUS_01420 2275 1361 gene locus_tag LOCUS_01430 2275 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 3998 2370 gene locus_tag LOCUS_01440 3998 2370 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815768.1 protein_id gnl|my_center|LOCUS_01440 4864 3995 gene locus_tag LOCUS_01450 gene sucD 4864 3995 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694247.1 protein_id gnl|my_center|LOCUS_01450 6033 4861 gene locus_tag LOCUS_01460 gene sucC 6033 4861 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006809579.1 protein_id gnl|my_center|LOCUS_01460 >Feature sequence019 436 873 gene locus_tag LOCUS_01470 436 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 907 1503 gene locus_tag LOCUS_01480 907 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 1625 3904 gene locus_tag LOCUS_01490 1625 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 3940 5577 gene locus_tag LOCUS_01500 gene fadD 3940 5577 CDS product long-chain-fatty-acid--CoA ligase FadD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758422.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence020 1287 1628 gene locus_tag LOCUS_01510 1287 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 1646 2005 gene locus_tag LOCUS_01520 1646 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 2707 2012 gene locus_tag LOCUS_01530 2707 2012 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122349.1 protein_id gnl|my_center|LOCUS_01530 2937 3365 gene locus_tag LOCUS_01540 2937 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 5022 3409 gene locus_tag LOCUS_01550 5022 3409 CDS product efflux transporter outer membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940504.1 protein_id gnl|my_center|LOCUS_01550 <6067 5019 gene locus_tag LOCUS_01560 <6067 5019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172625968.1:efflux RND transporter permease subunit VexK >Feature sequence021 494 2116 gene locus_tag LOCUS_01570 494 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 2987 2082 gene locus_tag LOCUS_01580 2987 2082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 3559 2987 gene locus_tag LOCUS_01590 3559 2987 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_01590 3617 4147 gene locus_tag LOCUS_01600 3617 4147 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_01600 4147 6039 gene locus_tag LOCUS_01610 4147 6039 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_01610 >Feature sequence022 <1 1003 gene locus_tag LOCUS_01620 <1 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209665.1:DUF2974 domain-containing protein 1080 1005 gene locus_tag LOCUS_t00030 1080 1005 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1177 1749 gene locus_tag LOCUS_01630 1177 1749 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_01630 2234 1713 gene locus_tag LOCUS_01640 2234 1713 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_01640 3553 2231 gene locus_tag LOCUS_01650 gene rlmD 3553 2231 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_01650 4138 3557 gene locus_tag LOCUS_01660 4138 3557 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943752.1 protein_id gnl|my_center|LOCUS_01660 >Feature sequence023 207 629 gene locus_tag LOCUS_01670 207 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 1074 634 gene locus_tag LOCUS_01680 1074 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1917 1105 gene locus_tag LOCUS_01690 1917 1105 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532025.1 protein_id gnl|my_center|LOCUS_01690 2810 1914 gene locus_tag LOCUS_01700 gene fhcD 2810 1914 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532026.1 protein_id gnl|my_center|LOCUS_01700 4471 2810 gene locus_tag LOCUS_01710 4471 2810 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532027.1 protein_id gnl|my_center|LOCUS_01710 4982 4500 gene locus_tag LOCUS_01720 4982 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 <6029 4979 gene locus_tag LOCUS_01730 <6029 4979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061087.1:formylmethanofuran dehydrogenase subunit B >Feature sequence024 <1 590 gene locus_tag LOCUS_01740 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143634.1:3'(2'),5'-bisphosphate nucleotidase CysQ 955 569 gene locus_tag LOCUS_01750 955 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1637 1149 gene locus_tag LOCUS_01760 1637 1149 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_01760 1884 1639 gene locus_tag LOCUS_01770 1884 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 3076 2012 gene locus_tag LOCUS_01780 3076 2012 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072122.1 protein_id gnl|my_center|LOCUS_01780 >Feature sequence025 <1 679 gene locus_tag LOCUS_01790 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094059.1:chaperonin GroEL 802 1413 gene locus_tag LOCUS_01800 802 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 2309 1725 gene locus_tag LOCUS_01810 2309 1725 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889427.1 protein_id gnl|my_center|LOCUS_01810 2344 3033 gene locus_tag LOCUS_01820 2344 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4708 3044 gene locus_tag LOCUS_01830 4708 3044 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089646.1 protein_id gnl|my_center|LOCUS_01830 5070 4714 gene locus_tag LOCUS_01840 5070 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 <5948 5100 gene locus_tag LOCUS_01850 <5948 5100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085794.1:aminobacteriohopanetriol synthase HpnO >Feature sequence026 892 152 gene locus_tag LOCUS_01860 892 152 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_01860 984 2519 gene locus_tag LOCUS_01870 984 2519 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_01870 2544 4838 gene locus_tag LOCUS_01880 2544 4838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 4835 5698 gene locus_tag LOCUS_01890 4835 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 >Feature sequence027 <1 2409 gene locus_tag LOCUS_01900 <1 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615508.1:mechanosensitive ion channel 2726 2382 gene locus_tag LOCUS_01910 gene hypA 2726 2382 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388923.1 protein_id gnl|my_center|LOCUS_01910 3156 2704 gene locus_tag LOCUS_01920 3156 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 4658 3153 gene locus_tag LOCUS_01930 4658 3153 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_01930 5190 4651 gene locus_tag LOCUS_01940 5190 4651 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582501.1 protein_id gnl|my_center|LOCUS_01940 5510 5187 gene locus_tag LOCUS_01950 5510 5187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 >Feature sequence028 450 67 gene locus_tag LOCUS_01960 450 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 1069 554 gene locus_tag LOCUS_01970 1069 554 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084400.1 protein_id gnl|my_center|LOCUS_01970 1119 1895 gene locus_tag LOCUS_01980 1119 1895 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_01980 2101 1874 gene locus_tag LOCUS_01990 2101 1874 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317380.1 protein_id gnl|my_center|LOCUS_01990 2158 3546 gene locus_tag LOCUS_02000 gene cysG 2158 3546 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_02000 3546 4508 gene locus_tag LOCUS_02010 3546 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071318.1 protein_id gnl|my_center|LOCUS_02010 4998 4567 gene locus_tag LOCUS_02020 4998 4567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence029 2431 1184 gene locus_tag LOCUS_02030 2431 1184 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197873.1 protein_id gnl|my_center|LOCUS_02030 2901 2497 gene locus_tag LOCUS_02040 2901 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2960 3484 gene locus_tag LOCUS_02050 2960 3484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 3831 3421 gene locus_tag LOCUS_02060 3831 3421 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187552.1 protein_id gnl|my_center|LOCUS_02060 4999 3815 gene locus_tag LOCUS_02070 4999 3815 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_02070 <5839 5104 gene locus_tag LOCUS_02080 <5839 5104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003402969.1:lysophospholipid acyltransferase family protein >Feature sequence030 250 714 gene locus_tag LOCUS_02090 250 714 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533579.1 protein_id gnl|my_center|LOCUS_02090 711 1115 gene locus_tag LOCUS_02100 711 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 1112 1711 gene locus_tag LOCUS_02110 1112 1711 CDS product type II secretion system protein J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_244625321.1 protein_id gnl|my_center|LOCUS_02110 1708 2628 gene locus_tag LOCUS_02120 1708 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 3026 2517 gene locus_tag LOCUS_02130 3026 2517 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027835.1 protein_id gnl|my_center|LOCUS_02130 3925 3023 gene locus_tag LOCUS_02140 3925 3023 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103436.1 protein_id gnl|my_center|LOCUS_02140 4012 4611 gene locus_tag LOCUS_02150 4012 4611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 <5823 4578 gene locus_tag LOCUS_02160 <5823 4578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142029.1:efflux RND transporter permease subunit >Feature sequence031 1094 426 gene locus_tag LOCUS_02170 1094 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 1654 1091 gene locus_tag LOCUS_02180 1654 1091 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532039.1 protein_id gnl|my_center|LOCUS_02180 1956 1681 gene locus_tag LOCUS_02190 1956 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 3152 1953 gene locus_tag LOCUS_02200 3152 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920711.1 protein_id gnl|my_center|LOCUS_02200 3785 3216 gene locus_tag LOCUS_02210 3785 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 4087 3872 gene locus_tag LOCUS_02220 4087 3872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 <5728 4313 gene locus_tag LOCUS_02230 <5728 4313 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532040.1:DUF6513 domain-containing protein >Feature sequence032 275 1900 gene locus_tag LOCUS_02240 gene yidC 275 1900 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401421.1 protein_id gnl|my_center|LOCUS_02240 1897 3231 gene locus_tag LOCUS_02250 gene mnmE 1897 3231 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100248.1 protein_id gnl|my_center|LOCUS_02250 3304 3618 gene locus_tag LOCUS_02260 3304 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 3885 3667 gene locus_tag LOCUS_02270 3885 3667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 4785 3904 gene locus_tag LOCUS_02280 gene ppk2 4785 3904 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121626.1 protein_id gnl|my_center|LOCUS_02280 4925 5384 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cggttcatccccgcacacgcggggaacgcg >Feature sequence033 228 1937 gene locus_tag LOCUS_02290 gene proS 228 1937 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260694.1 protein_id gnl|my_center|LOCUS_02290 1986 2975 gene locus_tag LOCUS_02300 1986 2975 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113857.1 protein_id gnl|my_center|LOCUS_02300 3375 2980 gene locus_tag LOCUS_02310 3375 2980 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969348.1 protein_id gnl|my_center|LOCUS_02310 3602 3372 gene locus_tag LOCUS_02320 3602 3372 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528289.1 protein_id gnl|my_center|LOCUS_02320 3653 4378 gene locus_tag LOCUS_02330 3653 4378 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113858.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence034 548 333 gene locus_tag LOCUS_02340 548 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 677 1966 gene locus_tag LOCUS_02350 677 1966 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_02350 2090 3370 gene locus_tag LOCUS_02360 2090 3370 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946754.1 protein_id gnl|my_center|LOCUS_02360 >Feature sequence035 1488 2153 gene locus_tag LOCUS_02370 1488 2153 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_02370 2259 2417 gene locus_tag LOCUS_02380 2259 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 2651 3031 gene locus_tag LOCUS_02390 2651 3031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 3657 2980 gene locus_tag LOCUS_02400 3657 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 4603 3659 gene locus_tag LOCUS_02410 4603 3659 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771786.1 protein_id gnl|my_center|LOCUS_02410 5361 4588 gene locus_tag LOCUS_02420 5361 4588 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937914.1 protein_id gnl|my_center|LOCUS_02420 >Feature sequence036 1239 148 gene locus_tag LOCUS_02430 gene aroC 1239 148 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087653.1 protein_id gnl|my_center|LOCUS_02430 2163 1243 gene locus_tag LOCUS_02440 gene prmB 2163 1243 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_02440 2265 3617 gene locus_tag LOCUS_02450 2265 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_02450 4945 3608 gene locus_tag LOCUS_02460 4945 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 >Feature sequence037 1628 1260 gene locus_tag LOCUS_02470 1628 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 1983 1759 gene locus_tag LOCUS_02480 1983 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 3307 2264 gene locus_tag LOCUS_02490 gene recA 3307 2264 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_02490 3872 3339 gene locus_tag LOCUS_02500 3872 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 4238 3876 gene locus_tag LOCUS_02510 4238 3876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 4415 4251 gene locus_tag LOCUS_02520 4415 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 4922 4422 gene locus_tag LOCUS_02530 gene pncC 4922 4422 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132231.1 protein_id gnl|my_center|LOCUS_02530 5360 4929 gene locus_tag LOCUS_02540 5360 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence038 4660 1244 gene locus_tag LOCUS_02550 gene recB 4660 1244 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703321.1 protein_id gnl|my_center|LOCUS_02550 <5616 4647 gene locus_tag LOCUS_02560 <5616 4647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932746.1:exodeoxyribonuclease V subunit gamma >Feature sequence039 188 1189 gene locus_tag LOCUS_02570 gene tssA 188 1189 CDS product type VI secretion system protein TssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115054.1 protein_id gnl|my_center|LOCUS_02570 1211 1738 gene locus_tag LOCUS_02580 gene tssB 1211 1738 CDS product type VI secretion system contractile sheath small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083666.1 protein_id gnl|my_center|LOCUS_02580 1742 3238 gene locus_tag LOCUS_02590 gene tssC 1742 3238 CDS product type VI secretion system contractile sheath large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111626.1 protein_id gnl|my_center|LOCUS_02590 3292 3783 gene locus_tag LOCUS_02600 3292 3783 CDS product type VI secretion system tube protein Hcp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369713.1 protein_id gnl|my_center|LOCUS_02600 3790 4587 gene locus_tag LOCUS_02610 gene tagJ 3790 4587 CDS product type VI secretion system accessory protein TagJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119488.1 protein_id gnl|my_center|LOCUS_02610 4591 5211 gene locus_tag LOCUS_02620 4591 5211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 >Feature sequence040 375 1661 gene locus_tag LOCUS_02630 gene nqrF 375 1661 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368114.1 protein_id gnl|my_center|LOCUS_02630 1723 2151 gene locus_tag LOCUS_02640 1723 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2219 3490 gene locus_tag LOCUS_02650 2219 3490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 3484 4554 gene locus_tag LOCUS_02660 3484 4554 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144157.1 protein_id gnl|my_center|LOCUS_02660 >Feature sequence041 <1 586 gene locus_tag LOCUS_02670 <1 586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022405.1:alternate F1F0 ATPase, F1 subunit alpha 2306 567 gene locus_tag LOCUS_02680 2306 567 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205226061.1 protein_id gnl|my_center|LOCUS_02680 2419 3300 gene locus_tag LOCUS_02690 2419 3300 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022404.1 protein_id gnl|my_center|LOCUS_02690 4287 3541 gene locus_tag LOCUS_02700 4287 3541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 >Feature sequence042 716 1147 gene locus_tag LOCUS_02710 gene ndk 716 1147 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958107.1 protein_id gnl|my_center|LOCUS_02710 1140 2225 gene locus_tag LOCUS_02720 1140 2225 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_02720 2222 2935 gene locus_tag LOCUS_02730 gene pilF 2222 2935 CDS product type 4a pilus biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_02730 2948 4222 gene locus_tag LOCUS_02740 gene hisS 2948 4222 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 protein_id gnl|my_center|LOCUS_02740 4233 4874 gene locus_tag LOCUS_02750 4233 4874 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence043 1088 1753 gene locus_tag LOCUS_02760 1088 1753 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124968.1 protein_id gnl|my_center|LOCUS_02760 2837 1803 gene locus_tag LOCUS_02770 2837 1803 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_02770 3384 3004 gene locus_tag LOCUS_02780 3384 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4833 3508 gene locus_tag LOCUS_02790 gene tilS 4833 3508 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994173.1 protein_id gnl|my_center|LOCUS_02790 >Feature sequence044 2912 738 gene locus_tag LOCUS_02800 2912 738 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038749.1 protein_id gnl|my_center|LOCUS_02800 3460 2909 gene locus_tag LOCUS_02810 3460 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 4746 3451 gene locus_tag LOCUS_02820 gene rsmB 4746 3451 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114643.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence045 824 751 gene locus_tag LOCUS_t00040 824 751 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1879 947 gene locus_tag LOCUS_02830 1879 947 CDS product Tim44-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791677.1 protein_id gnl|my_center|LOCUS_02830 2414 1926 gene locus_tag LOCUS_02840 gene moaC 2414 1926 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_02840 2475 2705 gene locus_tag LOCUS_02850 gene moaD 2475 2705 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406746.1 protein_id gnl|my_center|LOCUS_02850 2709 3140 gene locus_tag LOCUS_02860 gene moaE 2709 3140 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535771.1 protein_id gnl|my_center|LOCUS_02860 3703 3155 gene locus_tag LOCUS_02870 gene ppa 3703 3155 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948454.1 protein_id gnl|my_center|LOCUS_02870 3744 4559 gene locus_tag LOCUS_02880 3744 4559 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104990.1 protein_id gnl|my_center|LOCUS_02880 5233 4535 gene locus_tag LOCUS_02890 5233 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence046 2993 975 gene locus_tag LOCUS_02900 gene metG 2993 975 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706089.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence047 2126 1002 gene locus_tag LOCUS_02910 2126 1002 CDS product phytoene/squalene synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144046.1 protein_id gnl|my_center|LOCUS_02910 2037 2396 gene locus_tag LOCUS_02920 2037 2396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 2452 3546 gene locus_tag LOCUS_02930 gene hpnH 2452 3546 CDS product adenosyl-hopene transferase HpnH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387821.1 protein_id gnl|my_center|LOCUS_02930 3557 4666 gene locus_tag LOCUS_02940 3557 4666 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530058.1 protein_id gnl|my_center|LOCUS_02940 >Feature sequence048 334 975 gene locus_tag LOCUS_02950 334 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 968 2281 gene locus_tag LOCUS_02960 968 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 2175 3038 gene locus_tag LOCUS_02970 2175 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 4400 3063 gene locus_tag LOCUS_02980 4400 3063 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108842.1 protein_id gnl|my_center|LOCUS_02980 <5142 4406 gene locus_tag LOCUS_02990 <5142 4406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072721720.1:DUF2330 domain-containing protein >Feature sequence049 <1 1052 gene locus_tag LOCUS_03000 <1 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105001.1:bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ 1102 2001 gene locus_tag LOCUS_03010 1102 2001 CDS product Nudix family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104999.1 protein_id gnl|my_center|LOCUS_03010 2032 3339 gene locus_tag LOCUS_03020 2032 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3345 4649 gene locus_tag LOCUS_03030 3345 4649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence050 129 1484 gene locus_tag LOCUS_03040 gene prsR 129 1484 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_03040 1484 4228 gene locus_tag LOCUS_03050 gene prsT 1484 4228 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_03050 4288 5001 gene locus_tag LOCUS_03060 gene phoU 4288 5001 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071865.1 protein_id gnl|my_center|LOCUS_03060 >Feature sequence051 1220 2128 gene locus_tag LOCUS_03070 gene cyoE 1220 2128 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 protein_id gnl|my_center|LOCUS_03070 3050 2187 gene locus_tag LOCUS_03080 gene rpoH 3050 2187 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084510.1 protein_id gnl|my_center|LOCUS_03080 4089 3166 gene locus_tag LOCUS_03090 gene ftsX 4089 3166 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038856.1 protein_id gnl|my_center|LOCUS_03090 4750 4091 gene locus_tag LOCUS_03100 gene ftsE 4750 4091 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_03100 5102 4758 gene locus_tag LOCUS_03110 5102 4758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 >Feature sequence052 440 1522 gene locus_tag LOCUS_03120 440 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 1728 2474 gene locus_tag LOCUS_03130 1728 2474 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020411.1 protein_id gnl|my_center|LOCUS_03130 2475 2969 gene locus_tag LOCUS_03140 gene ruvC 2475 2969 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169179.1 protein_id gnl|my_center|LOCUS_03140 2992 3183 gene locus_tag LOCUS_03150 2992 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3421 4011 gene locus_tag LOCUS_03160 gene ruvA 3421 4011 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_03160 4008 5048 gene locus_tag LOCUS_03170 gene ruvB 4008 5048 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038139.1 protein_id gnl|my_center|LOCUS_03170 >Feature sequence053 848 1186 gene locus_tag LOCUS_03180 gene glnK 848 1186 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_03180 1229 2479 gene locus_tag LOCUS_03190 1229 2479 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071065.1 protein_id gnl|my_center|LOCUS_03190 2608 3891 gene locus_tag LOCUS_03200 2608 3891 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922914.1 protein_id gnl|my_center|LOCUS_03200 4072 5031 gene locus_tag LOCUS_03210 4072 5031 CDS product LuxR C-terminal-related transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004547256.1 protein_id gnl|my_center|LOCUS_03210 >Feature sequence054 815 1018 gene locus_tag LOCUS_03220 gene rpmE 815 1018 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625828.1 protein_id gnl|my_center|LOCUS_03220 1024 2337 gene locus_tag LOCUS_03230 1024 2337 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763930.1 protein_id gnl|my_center|LOCUS_03230 2918 2328 gene locus_tag LOCUS_03240 2918 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 <5023 2921 gene locus_tag LOCUS_03250 <5023 2921 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958515.1:penicillin-binding protein 1A >Feature sequence055 1326 115 gene locus_tag LOCUS_03260 1326 115 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228203.1 protein_id gnl|my_center|LOCUS_03260 3281 1473 gene locus_tag LOCUS_03270 gene pilB 3281 1473 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546881.1 protein_id gnl|my_center|LOCUS_03270 3914 3297 gene locus_tag LOCUS_03280 3914 3297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 >Feature sequence056 1891 14 gene locus_tag LOCUS_03290 1891 14 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267217.1 protein_id gnl|my_center|LOCUS_03290 2035 1959 gene locus_tag LOCUS_t00050 2035 1959 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2117 2042 gene locus_tag LOCUS_t00060 2117 2042 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2404 2132 gene locus_tag LOCUS_03300 2404 2132 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043034.1 protein_id gnl|my_center|LOCUS_03300 <4893 2609 gene locus_tag LOCUS_03310 <4893 2609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005493728.1:endopeptidase La >Feature sequence057 310 1518 gene locus_tag LOCUS_03320 310 1518 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_03320 1521 2708 gene locus_tag LOCUS_03330 1521 2708 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125074.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence058 1680 553 gene locus_tag LOCUS_03340 1680 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1769 2731 gene locus_tag LOCUS_03350 gene dusA 1769 2731 CDS product tRNA dihydrouridine(20/20a) synthase DusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888333.1 protein_id gnl|my_center|LOCUS_03350 2767 3045 gene locus_tag LOCUS_03360 2767 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 3194 4633 gene locus_tag LOCUS_03370 3194 4633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence059 1123 392 gene locus_tag LOCUS_03380 gene bioH 1123 392 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035639.1 protein_id gnl|my_center|LOCUS_03380 2271 1120 gene locus_tag LOCUS_03390 gene bioF 2271 1120 CDS product 8-amino-7-oxononanoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113248.1 protein_id gnl|my_center|LOCUS_03390 3244 2258 gene locus_tag LOCUS_03400 gene bioB 3244 2258 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705387.1 protein_id gnl|my_center|LOCUS_03400 3280 4014 gene locus_tag LOCUS_03410 3280 4014 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402142.1 protein_id gnl|my_center|LOCUS_03410 <4775 4185 gene locus_tag LOCUS_03420 <4775 4185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704199.1:4-hydroxybenzoate octaprenyltransferase >Feature sequence060 1474 2874 gene locus_tag LOCUS_03430 1474 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 2877 3644 gene locus_tag LOCUS_03440 2877 3644 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094318.1 protein_id gnl|my_center|LOCUS_03440 3657 3809 gene locus_tag LOCUS_03450 3657 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4058 4624 gene locus_tag LOCUS_03460 4058 4624 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930124.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence061 <1 2619 gene locus_tag LOCUS_03470 <1 2619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_091704098.1:CRISPR-associated helicase/endonuclease Cas3 2627 3322 gene locus_tag LOCUS_03480 2627 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 3327 4166 gene locus_tag LOCUS_03490 3327 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03490 4424 4681 gene locus_tag LOCUS_03500 4424 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 >Feature sequence062 143 670 gene locus_tag LOCUS_03510 143 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 777 935 gene locus_tag LOCUS_03520 777 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 1378 2001 gene locus_tag LOCUS_03530 1378 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03530 2034 2393 gene locus_tag LOCUS_03540 2034 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2502 3284 gene locus_tag LOCUS_03550 2502 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence063 826 1698 gene locus_tag LOCUS_03560 826 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1916 2683 gene locus_tag LOCUS_03570 1916 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 2699 3031 gene locus_tag LOCUS_03580 2699 3031 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112869.1 protein_id gnl|my_center|LOCUS_03580 4436 3081 gene locus_tag LOCUS_03590 gene mltD 4436 3081 CDS product murein transglycosylase D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644706.1 protein_id gnl|my_center|LOCUS_03590 >Feature sequence064 20 2533 gene locus_tag LOCUS_03600 20 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 2931 3407 gene locus_tag LOCUS_03610 2931 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 3404 3709 gene locus_tag LOCUS_03620 3404 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 4013 4270 gene locus_tag LOCUS_03630 4013 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence065 76 351 gene locus_tag LOCUS_03640 76 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 436 1146 gene locus_tag LOCUS_03650 436 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1147 1800 gene locus_tag LOCUS_03660 gene modB 1147 1800 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074079.1 protein_id gnl|my_center|LOCUS_03660 1797 2873 gene locus_tag LOCUS_03670 1797 2873 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074078.1 protein_id gnl|my_center|LOCUS_03670 4065 2881 gene locus_tag LOCUS_03680 4065 2881 CDS product EAL domain-containing response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029301722.1 protein_id gnl|my_center|LOCUS_03680 <4638 4080 gene locus_tag LOCUS_03690 <4638 4080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994151.1:ATP-binding protein >Feature sequence066 1531 650 gene locus_tag LOCUS_03700 gene cbiB 1531 650 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103680.1 protein_id gnl|my_center|LOCUS_03700 2187 1528 gene locus_tag LOCUS_03710 gene bluB 2187 1528 CDS product 5,6-dimethylbenzimidazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082592.1 protein_id gnl|my_center|LOCUS_03710 2262 3281 gene locus_tag LOCUS_03720 gene nagZ 2262 3281 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810348.1 protein_id gnl|my_center|LOCUS_03720 3303 3713 gene locus_tag LOCUS_03730 3303 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 3710 4258 gene locus_tag LOCUS_03740 3710 4258 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318214.1 protein_id gnl|my_center|LOCUS_03740 >Feature sequence067 746 261 gene locus_tag LOCUS_03750 746 261 CDS product disulfide bond formation protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099230.1 protein_id gnl|my_center|LOCUS_03750 1048 1287 gene locus_tag LOCUS_03760 1048 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 1795 1301 gene locus_tag LOCUS_03770 1795 1301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 2266 1844 gene locus_tag LOCUS_03780 2266 1844 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_03780 2778 2278 gene locus_tag LOCUS_03790 2778 2278 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198028.1 protein_id gnl|my_center|LOCUS_03790 4045 2747 gene locus_tag LOCUS_03800 4045 2747 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528814.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence068 64 219 gene locus_tag LOCUS_03810 64 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 322 900 gene locus_tag LOCUS_03820 322 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 921 2312 gene locus_tag LOCUS_03830 gene mpl 921 2312 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093229.1 protein_id gnl|my_center|LOCUS_03830 3346 2432 gene locus_tag LOCUS_03840 3346 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4071 3379 gene locus_tag LOCUS_03850 4071 3379 CDS product TIGR00703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880457.1 protein_id gnl|my_center|LOCUS_03850 4578 4078 gene locus_tag LOCUS_03860 4578 4078 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968944.1 protein_id gnl|my_center|LOCUS_03860 >Feature sequence069 1609 155 gene locus_tag LOCUS_03870 gene glcD 1609 155 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114372.1 protein_id gnl|my_center|LOCUS_03870 2270 1596 gene locus_tag LOCUS_03880 2270 1596 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 protein_id gnl|my_center|LOCUS_03880 3154 2267 gene locus_tag LOCUS_03890 3154 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407837.1 protein_id gnl|my_center|LOCUS_03890 <4577 3261 gene locus_tag LOCUS_03900 <4577 3261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969575.1:methanol/ethanol family PQQ-dependent dehydrogenase >Feature sequence070 235 858 gene locus_tag LOCUS_03910 235 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2864 813 gene locus_tag LOCUS_03920 2864 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 3756 2974 gene locus_tag LOCUS_03930 3756 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence071 <1 645 gene locus_tag LOCUS_03940 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014327923.1:nitric-oxide reductase large subunit 638 922 gene locus_tag LOCUS_03950 638 922 CDS product DUF4258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928542.1 protein_id gnl|my_center|LOCUS_03950 906 1106 gene locus_tag LOCUS_03960 906 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 1128 2495 gene locus_tag LOCUS_03970 gene atpD 1128 2495 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946152.1 protein_id gnl|my_center|LOCUS_03970 2492 2890 gene locus_tag LOCUS_03980 2492 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946788.1 protein_id gnl|my_center|LOCUS_03980 2883 3170 gene locus_tag LOCUS_03990 2883 3170 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946787.1 protein_id gnl|my_center|LOCUS_03990 3171 3863 gene locus_tag LOCUS_04000 3171 3863 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946786.1 protein_id gnl|my_center|LOCUS_04000 3860 4135 gene locus_tag LOCUS_04010 3860 4135 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019235654.1 protein_id gnl|my_center|LOCUS_04010 >Feature sequence072 <1 842 gene locus_tag LOCUS_04020 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030238.1:acetate kinase 839 1360 gene locus_tag LOCUS_04030 839 1360 CDS product Slp family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036208.1 protein_id gnl|my_center|LOCUS_04030 1468 1698 gene locus_tag LOCUS_04040 1468 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 1698 2120 gene locus_tag LOCUS_04050 1698 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 2990 2133 gene locus_tag LOCUS_04060 2990 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 3888 3010 gene locus_tag LOCUS_04070 3888 3010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 <4563 3901 gene locus_tag LOCUS_04080 <4563 3901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421624.1:ACR3 family arsenite efflux transporter >Feature sequence073 975 217 gene locus_tag LOCUS_04090 gene hisF 975 217 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106334.1 protein_id gnl|my_center|LOCUS_04090 1706 975 gene locus_tag LOCUS_04100 gene hisA 1706 975 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106336.1 protein_id gnl|my_center|LOCUS_04100 2361 1720 gene locus_tag LOCUS_04110 gene hisH 2361 1720 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_04110 2957 2358 gene locus_tag LOCUS_04120 gene hisB 2957 2358 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_04120 <4556 3287 gene locus_tag LOCUS_04130 <4556 3287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890690.1:C1 family peptidase >Feature sequence074 1256 501 gene locus_tag LOCUS_04140 gene ubiE 1256 501 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000227958.1 protein_id gnl|my_center|LOCUS_04140 2581 1256 gene locus_tag LOCUS_04150 gene hslU 2581 1256 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213230.1 protein_id gnl|my_center|LOCUS_04150 3123 2578 gene locus_tag LOCUS_04160 gene hslV 3123 2578 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_04160 4000 3182 gene locus_tag LOCUS_04170 4000 3182 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535365.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence075 261 1574 gene locus_tag LOCUS_04180 gene cptA 261 1574 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_04180 2152 1658 gene locus_tag LOCUS_04190 2152 1658 CDS product DUF934 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191986.1 protein_id gnl|my_center|LOCUS_04190 3788 2139 gene locus_tag LOCUS_04200 3788 2139 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098180.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence076 <1 782 gene locus_tag LOCUS_04210 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003899557.1:PGL/p-HBAD biosynthesis glycosyltransferase 1754 867 gene locus_tag LOCUS_04220 1754 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 3307 1763 gene locus_tag LOCUS_04230 3307 1763 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141163.1 protein_id gnl|my_center|LOCUS_04230 4393 3494 gene locus_tag LOCUS_04240 4393 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence077 <1 962 gene locus_tag LOCUS_04250 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946076.1:elongation factor G 1009 2202 gene locus_tag LOCUS_04260 gene tuf 1009 2202 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943488.1 protein_id gnl|my_center|LOCUS_04260 2210 2524 gene locus_tag LOCUS_04270 gene rpsJ 2210 2524 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070616.1 protein_id gnl|my_center|LOCUS_04270 2536 3183 gene locus_tag LOCUS_04280 gene rplC 2536 3183 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010672559.1 protein_id gnl|my_center|LOCUS_04280 3190 3813 gene locus_tag LOCUS_04290 gene rplD 3190 3813 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093737.1 protein_id gnl|my_center|LOCUS_04290 3810 4103 gene locus_tag LOCUS_04300 gene rplW 3810 4103 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093736.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence078 162 353 gene locus_tag LOCUS_04310 162 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 755 1546 gene locus_tag LOCUS_04320 755 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1563 1904 gene locus_tag LOCUS_04330 1563 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 1906 2121 gene locus_tag LOCUS_04340 1906 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 2125 2370 gene locus_tag LOCUS_04350 2125 2370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 2367 2726 gene locus_tag LOCUS_04360 2367 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2726 3124 gene locus_tag LOCUS_04370 2726 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3125 3862 gene locus_tag LOCUS_04380 3125 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3865 4065 gene locus_tag LOCUS_04390 3865 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence079 258 1373 gene locus_tag LOCUS_04400 258 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 1451 1630 gene locus_tag LOCUS_04410 1451 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 2370 1642 gene locus_tag LOCUS_04420 2370 1642 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106127.1 protein_id gnl|my_center|LOCUS_04420 2616 2371 gene locus_tag LOCUS_04430 2616 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 3449 2613 gene locus_tag LOCUS_04440 gene metF 3449 2613 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765400.1 protein_id gnl|my_center|LOCUS_04440 <4301 3540 gene locus_tag LOCUS_04450 <4301 3540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004198634.1:adenosylhomocysteinase >Feature sequence080 3484 869 gene locus_tag LOCUS_04460 3484 869 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942986.1 protein_id gnl|my_center|LOCUS_04460 <4269 3507 gene locus_tag LOCUS_04470 <4269 3507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141025.1:magnesium/cobalt transporter CorA >Feature sequence081 214 290 gene locus_tag LOCUS_t00070 214 290 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 338 769 gene locus_tag LOCUS_04480 338 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 829 1479 gene locus_tag LOCUS_04490 829 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 1476 3539 gene locus_tag LOCUS_04500 1476 3539 CDS product Hsp70 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004539133.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence082 511 1800 gene locus_tag LOCUS_04510 gene aceF 511 1800 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136429288.1 protein_id gnl|my_center|LOCUS_04510 1814 3226 gene locus_tag LOCUS_04520 gene lpdA 1814 3226 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957594.1 protein_id gnl|my_center|LOCUS_04520 3223 4026 gene locus_tag LOCUS_04530 3223 4026 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390517.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence083 <1 645 gene locus_tag LOCUS_04540 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100240.1:ParB/RepB/Spo0J family partition protein 716 1087 gene locus_tag LOCUS_04550 716 1087 CDS product F0F1 ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948673.1 protein_id gnl|my_center|LOCUS_04550 1094 1852 gene locus_tag LOCUS_04560 gene atpB 1094 1852 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707913.1 protein_id gnl|my_center|LOCUS_04560 1895 2173 gene locus_tag LOCUS_04570 gene atpE 1895 2173 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948671.1 protein_id gnl|my_center|LOCUS_04570 2236 2718 gene locus_tag LOCUS_04580 gene atpF 2236 2718 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 protein_id gnl|my_center|LOCUS_04580 2715 3251 gene locus_tag LOCUS_04590 2715 3251 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105592.1 protein_id gnl|my_center|LOCUS_04590 >Feature sequence084 1078 2970 gene locus_tag LOCUS_04600 1078 2970 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105562.1 protein_id gnl|my_center|LOCUS_04600 3956 2979 gene locus_tag LOCUS_04610 3956 2979 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188687.1 protein_id gnl|my_center|LOCUS_04610 >Feature sequence085 402 97 gene locus_tag LOCUS_04620 402 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04620 987 412 gene locus_tag LOCUS_04630 987 412 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807624.1 protein_id gnl|my_center|LOCUS_04630 1928 984 gene locus_tag LOCUS_04640 gene pip 1928 984 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765551.1 protein_id gnl|my_center|LOCUS_04640 2856 1996 gene locus_tag LOCUS_04650 2856 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence086 554 1942 gene locus_tag LOCUS_04660 gene atpD 554 1942 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173442644.1 protein_id gnl|my_center|LOCUS_04660 1917 2309 gene locus_tag LOCUS_04670 1917 2309 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120166.1 protein_id gnl|my_center|LOCUS_04670 2306 2620 gene locus_tag LOCUS_04680 2306 2620 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120167.1 protein_id gnl|my_center|LOCUS_04680 2640 2897 gene locus_tag LOCUS_04690 2640 2897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2881 3591 gene locus_tag LOCUS_04700 2881 3591 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328512.1 protein_id gnl|my_center|LOCUS_04700 3588 3863 gene locus_tag LOCUS_04710 3588 3863 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328511.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence087 595 1344 gene locus_tag LOCUS_04720 595 1344 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525145.1 protein_id gnl|my_center|LOCUS_04720 2187 1393 gene locus_tag LOCUS_04730 gene trpC 2187 1393 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815394.1 protein_id gnl|my_center|LOCUS_04730 3200 2184 gene locus_tag LOCUS_04740 gene trpD 3200 2184 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085203.1 protein_id gnl|my_center|LOCUS_04740 3790 3200 gene locus_tag LOCUS_04750 3790 3200 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence088 227 1291 gene locus_tag LOCUS_04760 gene hisC 227 1291 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_04760 3076 1379 gene locus_tag LOCUS_04770 gene ubiB 3076 1379 CDS product 2-polyprenylphenol 6-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036897.1 protein_id gnl|my_center|LOCUS_04770 3843 3076 gene locus_tag LOCUS_04780 3843 3076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 3969 4136 gene locus_tag LOCUS_04790 3969 4136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 >Feature sequence089 888 1139 gene locus_tag LOCUS_04800 888 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 1919 1155 gene locus_tag LOCUS_04810 1919 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071003.1 protein_id gnl|my_center|LOCUS_04810 2386 1916 gene locus_tag LOCUS_04820 2386 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 3678 2386 gene locus_tag LOCUS_04830 3678 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 4091 3675 gene locus_tag LOCUS_04840 4091 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 >Feature sequence090 658 470 gene locus_tag LOCUS_04850 658 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1202 723 gene locus_tag LOCUS_04860 1202 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3641 1215 gene locus_tag LOCUS_04870 3641 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 <4173 3669 gene locus_tag LOCUS_04880 <4173 3669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072981.1:EAL domain-containing protein >Feature sequence091 2264 1566 gene locus_tag LOCUS_04890 gene narI 2264 1566 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160113.1 protein_id gnl|my_center|LOCUS_04890 2916 2401 gene locus_tag LOCUS_04900 2916 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 <4167 2913 gene locus_tag LOCUS_04910 <4167 2913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193619.1:nitrate reductase subunit beta >Feature sequence092 <1 2236 gene locus_tag LOCUS_04920 <1 2236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037013.1:carbamoyl-phosphate synthase large subunit 2233 2709 gene locus_tag LOCUS_04930 gene greA 2233 2709 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809615.1 protein_id gnl|my_center|LOCUS_04930 3011 2742 gene locus_tag LOCUS_04940 gene yhbY 3011 2742 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244068.1 protein_id gnl|my_center|LOCUS_04940 3105 3725 gene locus_tag LOCUS_04950 gene rlmE 3105 3725 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_04950 >Feature sequence093 1388 648 gene locus_tag LOCUS_04960 1388 648 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316785.1 protein_id gnl|my_center|LOCUS_04960 2654 1401 gene locus_tag LOCUS_04970 gene flgE 2654 1401 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_04970 3328 2666 gene locus_tag LOCUS_04980 gene flgD 3328 2666 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946950.1 protein_id gnl|my_center|LOCUS_04980 3751 3332 gene locus_tag LOCUS_04990 gene flgC 3751 3332 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_04990 4144 3755 gene locus_tag LOCUS_05000 gene flgB 4144 3755 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_05000 >Feature sequence094 <1 783 gene locus_tag LOCUS_05010 <1 783 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112354.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase 774 1301 gene locus_tag LOCUS_05020 774 1301 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112355.1 protein_id gnl|my_center|LOCUS_05020 1301 2023 gene locus_tag LOCUS_05030 1301 2023 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086787.1 protein_id gnl|my_center|LOCUS_05030 2696 1986 gene locus_tag LOCUS_05040 2696 1986 CDS product ceramidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771218.1 protein_id gnl|my_center|LOCUS_05040 2695 3783 gene locus_tag LOCUS_05050 2695 3783 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009938358.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence095 <1 617 gene locus_tag LOCUS_05060 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919611.1:nitrogen assimilation response regulator NtrX 614 1990 gene locus_tag LOCUS_05070 gene trkA 614 1990 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768190.1 protein_id gnl|my_center|LOCUS_05070 1987 3453 gene locus_tag LOCUS_05080 gene trkH 1987 3453 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211550.1 protein_id gnl|my_center|LOCUS_05080 3455 4045 gene locus_tag LOCUS_05090 3455 4045 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729910.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence096 <1 1317 gene locus_tag LOCUS_05100 <1 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003410309.1:sugar epimerase family protein 1355 2221 gene locus_tag LOCUS_05110 1355 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 >Feature sequence097 1434 1006 gene locus_tag LOCUS_05120 1434 1006 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_05120 1486 1962 gene locus_tag LOCUS_05130 1486 1962 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251069.1 protein_id gnl|my_center|LOCUS_05130 2906 1956 gene locus_tag LOCUS_05140 2906 1956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 3918 2893 gene locus_tag LOCUS_05150 3918 2893 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941710.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence098 798 1742 gene locus_tag LOCUS_05160 798 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1742 2980 gene locus_tag LOCUS_05170 1742 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 >Feature sequence099 473 826 gene locus_tag LOCUS_05180 473 826 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365480.1 protein_id gnl|my_center|LOCUS_05180 1790 810 gene locus_tag LOCUS_05190 1790 810 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000377275.1 protein_id gnl|my_center|LOCUS_05190 2591 1878 gene locus_tag LOCUS_05200 gene sfsA 2591 1878 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_05200 3307 2591 gene locus_tag LOCUS_05210 3307 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence100 <1 1049 gene locus_tag LOCUS_05220 <1 1049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808454.1:asparagine synthase (glutamine-hydrolyzing) 2405 1050 gene locus_tag LOCUS_05230 2405 1050 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942599.1 protein_id gnl|my_center|LOCUS_05230 3514 2402 gene locus_tag LOCUS_05240 3514 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05240 >Feature sequence101 733 819 gene locus_tag LOCUS_t00080 733 819 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 909 1904 gene locus_tag LOCUS_05250 gene rluD 909 1904 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094686.1 protein_id gnl|my_center|LOCUS_05250 1932 2192 gene locus_tag LOCUS_05260 1932 2192 CDS product DUF4160 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392155.1 protein_id gnl|my_center|LOCUS_05260 2198 2455 gene locus_tag LOCUS_05270 2198 2455 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_05270 2455 3210 gene locus_tag LOCUS_05280 gene yfiH 2455 3210 CDS product purine nucleoside phosphorylase YfiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992642.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence102 1381 1169 gene locus_tag LOCUS_05290 1381 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 2315 1386 gene locus_tag LOCUS_05300 gene ilvE 2315 1386 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_05300 <3972 2318 gene locus_tag LOCUS_05310 <3972 2318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266458.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase >Feature sequence103 <1 567 gene locus_tag LOCUS_05320 <1 567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478687.1:EAL domain-containing protein 924 571 gene locus_tag LOCUS_05330 924 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 1153 3906 gene locus_tag LOCUS_05340 gene secA 1153 3906 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073892.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence104 1527 787 gene locus_tag LOCUS_05350 1527 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2520 1528 gene locus_tag LOCUS_05360 2520 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 2547 3626 gene locus_tag LOCUS_05370 2547 3626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 >Feature sequence105 2432 696 gene locus_tag LOCUS_05380 2432 696 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226417.1 protein_id gnl|my_center|LOCUS_05380 3453 2446 gene locus_tag LOCUS_05390 gene hypE 3453 2446 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225638.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence106 1487 537 gene locus_tag LOCUS_05400 gene arsS 1487 537 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_05400 1739 1551 gene locus_tag LOCUS_05410 1739 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 2313 1726 gene locus_tag LOCUS_05420 2313 1726 CDS product RNA polymerase factor sigma-70 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206317.1 protein_id gnl|my_center|LOCUS_05420 3891 2335 gene locus_tag LOCUS_05430 3891 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence107 <1 992 gene locus_tag LOCUS_05440 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011815416.1:EF-P beta-lysylation protein EpmB 1407 3005 gene locus_tag LOCUS_05450 gene gshA 1407 3005 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_05450 3047 3769 gene locus_tag LOCUS_05460 3047 3769 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207530.1 protein_id gnl|my_center|LOCUS_05460 >Feature sequence108 1905 514 gene locus_tag LOCUS_05470 gene pntB 1905 514 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169667.1 protein_id gnl|my_center|LOCUS_05470 3489 1918 gene locus_tag LOCUS_05480 gene pntA 3489 1918 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211019.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence109 <1 598 gene locus_tag LOCUS_05490 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941060.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence110 114 965 gene locus_tag LOCUS_05500 114 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 1096 1407 gene locus_tag LOCUS_05510 1096 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 2309 2019 gene locus_tag LOCUS_05520 2309 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 2921 2331 gene locus_tag LOCUS_05530 2921 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence111 >Feature sequence112 1038 265 gene locus_tag LOCUS_05540 1038 265 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268566.1 protein_id gnl|my_center|LOCUS_05540 1727 1038 gene locus_tag LOCUS_05550 1727 1038 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 protein_id gnl|my_center|LOCUS_05550 2434 1724 gene locus_tag LOCUS_05560 2434 1724 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532296.1 protein_id gnl|my_center|LOCUS_05560 3759 2431 gene locus_tag LOCUS_05570 3759 2431 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_05570 >Feature sequence113 340 1158 gene locus_tag LOCUS_05580 340 1158 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114742.1 protein_id gnl|my_center|LOCUS_05580 1158 3164 gene locus_tag LOCUS_05590 gene tgpA 1158 3164 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_05590 >Feature sequence114 <1 815 gene locus_tag LOCUS_05600 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038356.1:radical SAM family heme chaperone HemW 964 1605 gene locus_tag LOCUS_05610 gene pyrE 964 1605 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703811.1 protein_id gnl|my_center|LOCUS_05610 1636 2676 gene locus_tag LOCUS_05620 1636 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 3531 2620 gene locus_tag LOCUS_05630 gene argB 3531 2620 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence115 1774 320 gene locus_tag LOCUS_05640 1774 320 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000323161.1 protein_id gnl|my_center|LOCUS_05640 2829 1771 gene locus_tag LOCUS_05650 gene hemE 2829 1771 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114569.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence116 1955 1128 gene locus_tag LOCUS_05660 gene cpdA 1955 1128 CDS product 3',5'-cyclic-AMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056616.1 protein_id gnl|my_center|LOCUS_05660 3253 1931 gene locus_tag LOCUS_05670 gene argA 3253 1931 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763455.1 protein_id gnl|my_center|LOCUS_05670 >Feature sequence117 2294 1725 gene locus_tag LOCUS_05680 2294 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence118 <1 1209 gene locus_tag LOCUS_05690 <1 1209 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256867.1:multicopper oxidase domain-containing protein 2361 1264 gene locus_tag LOCUS_05700 gene dnaN 2361 1264 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421522.1 protein_id gnl|my_center|LOCUS_05700 <3698 2372 gene locus_tag LOCUS_05710 <3698 2372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070424.1:chromosomal replication initiator protein DnaA >Feature sequence119 321 1049 gene locus_tag LOCUS_05720 321 1049 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115034.1 protein_id gnl|my_center|LOCUS_05720 1051 1659 gene locus_tag LOCUS_05730 1051 1659 CDS product DUF1326 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531653.1 protein_id gnl|my_center|LOCUS_05730 1656 2231 gene locus_tag LOCUS_05740 1656 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2242 2667 gene locus_tag LOCUS_05750 2242 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 2698 3276 gene locus_tag LOCUS_05760 2698 3276 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005085913.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence120 <1 1125 gene locus_tag LOCUS_05770 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460337.1:HDOD domain-containing protein 1209 1604 gene locus_tag LOCUS_05780 gene hslR 1209 1604 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660483.1 protein_id gnl|my_center|LOCUS_05780 1613 2983 gene locus_tag LOCUS_05790 gene xseA 1613 2983 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113813.1 protein_id gnl|my_center|LOCUS_05790 3608 3006 gene locus_tag LOCUS_05800 3608 3006 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence121 2857 1112 gene locus_tag LOCUS_05810 2857 1112 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337736.1 protein_id gnl|my_center|LOCUS_05810 >Feature sequence122 633 1223 gene locus_tag LOCUS_05820 633 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 1229 2179 gene locus_tag LOCUS_05830 1229 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2176 3051 gene locus_tag LOCUS_05840 2176 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 >Feature sequence123 446 102 gene locus_tag LOCUS_05850 446 102 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417282.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05850 1890 598 gene locus_tag LOCUS_05860 1890 598 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001310055.1 protein_id gnl|my_center|LOCUS_05860 2192 1962 gene locus_tag LOCUS_05870 2192 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 <3680 2440 gene locus_tag LOCUS_05880 <3680 2440 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104661.1:two-component system response regulator NtrC >Feature sequence124 2274 721 gene locus_tag LOCUS_05890 2274 721 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 protein_id gnl|my_center|LOCUS_05890 2991 2365 gene locus_tag LOCUS_05900 2991 2365 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628135.1 protein_id gnl|my_center|LOCUS_05900 <3677 2988 gene locus_tag LOCUS_05910 <3677 2988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003973239.1:HAMP domain-containing sensor histidine kinase >Feature sequence125 <1 685 gene locus_tag LOCUS_05920 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958256.1:slipin family protein 657 1094 gene locus_tag LOCUS_05930 gene dtd 657 1094 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038819.1 protein_id gnl|my_center|LOCUS_05930 1764 1315 gene locus_tag LOCUS_05940 gene rplI 1764 1315 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317208.1 protein_id gnl|my_center|LOCUS_05940 2692 1793 gene locus_tag LOCUS_05950 2692 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620823.1 protein_id gnl|my_center|LOCUS_05950 2939 2712 gene locus_tag LOCUS_05960 gene rpsR 2939 2712 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_05960 3376 2960 gene locus_tag LOCUS_05970 3376 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 >Feature sequence126 404 1156 gene locus_tag LOCUS_05980 gene surE 404 1156 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036883.1 protein_id gnl|my_center|LOCUS_05980 1153 1812 gene locus_tag LOCUS_05990 1153 1812 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_05990 1812 2390 gene locus_tag LOCUS_06000 1812 2390 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_06000 2927 2400 gene locus_tag LOCUS_06010 2927 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 <3672 3012 gene locus_tag LOCUS_06020 <3672 3012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389280.1:energy-dependent translational throttle protein EttA >Feature sequence127 376 182 gene locus_tag LOCUS_06030 376 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 744 499 gene locus_tag LOCUS_06040 744 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 1023 2114 gene locus_tag LOCUS_06050 1023 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 2695 2108 gene locus_tag LOCUS_06060 2695 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2821 3186 gene locus_tag LOCUS_06070 2821 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence128 888 58 gene locus_tag LOCUS_06080 888 58 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_06080 1832 927 gene locus_tag LOCUS_06090 1832 927 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence129 245 1135 gene locus_tag LOCUS_06100 245 1135 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_06100 1132 2346 gene locus_tag LOCUS_06110 1132 2346 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_06110 2394 3449 gene locus_tag LOCUS_06120 2394 3449 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_140590772.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence130 1210 386 gene locus_tag LOCUS_06130 1210 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 <3654 1275 gene locus_tag LOCUS_06140 <3654 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_022951227.1:glycogen/starch/alpha-glucan phosphorylase >Feature sequence131 872 387 gene locus_tag LOCUS_06150 gene rimP 872 387 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_06150 1048 972 gene locus_tag LOCUS_t00090 1048 972 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1769 1287 gene locus_tag LOCUS_06160 gene pgpA 1769 1287 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816908.1 protein_id gnl|my_center|LOCUS_06160 2716 1766 gene locus_tag LOCUS_06170 gene thiL 2716 1766 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_06170 3162 2719 gene locus_tag LOCUS_06180 gene nusB 3162 2719 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_06180 >Feature sequence132 2041 314 gene locus_tag LOCUS_06190 gene lbcA 2041 314 CDS product proteolytic complex protein LbcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004352693.1 protein_id gnl|my_center|LOCUS_06190 2161 3411 gene locus_tag LOCUS_06200 gene hemA 2161 3411 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095001.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence133 893 1702 gene locus_tag LOCUS_06210 893 1702 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_06210 1748 3043 gene locus_tag LOCUS_06220 gene tagH 1748 3043 CDS product type VI secretion system-associated FHA domain protein TagH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003147054.1 protein_id gnl|my_center|LOCUS_06220 3043 3507 gene locus_tag LOCUS_06230 gene tssJ 3043 3507 CDS product type VI secretion system lipoprotein TssJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114612.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence134 2149 620 gene locus_tag LOCUS_06240 2149 620 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073167.1 protein_id gnl|my_center|LOCUS_06240 2294 2133 gene locus_tag LOCUS_06250 2294 2133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 3531 2284 gene locus_tag LOCUS_06260 3531 2284 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259724.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence135 22 501 gene locus_tag LOCUS_06270 22 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 501 1331 gene locus_tag LOCUS_06280 gene truA 501 1331 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768766.1 protein_id gnl|my_center|LOCUS_06280 1312 1941 gene locus_tag LOCUS_06290 1312 1941 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_06290 1925 3145 gene locus_tag LOCUS_06300 gene trpB 1925 3145 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528977.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence136 1952 777 gene locus_tag LOCUS_06310 1952 777 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_06310 3021 1945 gene locus_tag LOCUS_06320 gene serC 3021 1945 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207406.1 protein_id gnl|my_center|LOCUS_06320 <3591 3022 gene locus_tag LOCUS_06330 <3591 3022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003314654.1:DNA gyrase subunit A >Feature sequence137 1354 542 gene locus_tag LOCUS_06340 1354 542 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_06340 1770 1351 gene locus_tag LOCUS_06350 gene xcpT 1770 1351 CDS product GspG family T2SS major pseudopilin variant XcpT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119751.1 protein_id gnl|my_center|LOCUS_06350 2550 1789 gene locus_tag LOCUS_06360 gene tatC 2550 1789 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115041.1 protein_id gnl|my_center|LOCUS_06360 2836 2534 gene locus_tag LOCUS_06370 2836 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 3097 2843 gene locus_tag LOCUS_06380 gene tatA 3097 2843 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368844.1 protein_id gnl|my_center|LOCUS_06380 3435 3106 gene locus_tag LOCUS_06390 3435 3106 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943715.1 protein_id gnl|my_center|LOCUS_06390 >Feature sequence138 950 543 gene locus_tag LOCUS_06400 950 543 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809153.1 protein_id gnl|my_center|LOCUS_06400 1617 1042 gene locus_tag LOCUS_06410 1617 1042 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392254.1 protein_id gnl|my_center|LOCUS_06410 2948 1614 gene locus_tag LOCUS_06420 2948 1614 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526169.1 protein_id gnl|my_center|LOCUS_06420 3523 2945 gene locus_tag LOCUS_06430 3523 2945 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_06430 >Feature sequence139 1690 539 gene locus_tag LOCUS_06440 1690 539 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_06440 3206 1680 gene locus_tag LOCUS_06450 gene xrtA 3206 1680 CDS product exosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390868.1 protein_id gnl|my_center|LOCUS_06450 3577 3203 gene locus_tag LOCUS_06460 3577 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence140 2030 360 gene locus_tag LOCUS_06470 2030 360 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396100.1 protein_id gnl|my_center|LOCUS_06470 2514 2167 gene locus_tag LOCUS_06480 2514 2167 CDS product DUF5335 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880739.1 protein_id gnl|my_center|LOCUS_06480 2901 2584 gene locus_tag LOCUS_06490 gene tusE 2901 2584 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 protein_id gnl|my_center|LOCUS_06490 3185 2910 gene locus_tag LOCUS_06500 3185 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3540 3187 gene locus_tag LOCUS_06510 3540 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence141 272 1363 gene locus_tag LOCUS_06520 gene ychF 272 1363 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002050104.1 protein_id gnl|my_center|LOCUS_06520 1591 1424 gene locus_tag LOCUS_06530 1591 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 1770 3275 gene locus_tag LOCUS_06540 gene gndA 1770 3275 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072009.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence142 1444 1932 gene locus_tag LOCUS_06550 1444 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence143 227 658 gene locus_tag LOCUS_06560 227 658 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000785857.1 protein_id gnl|my_center|LOCUS_06560 984 661 gene locus_tag LOCUS_06570 984 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 1428 2819 gene locus_tag LOCUS_06580 gene gltX 1428 2819 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958261.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence144 206 943 gene locus_tag LOCUS_06590 206 943 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073973.1 protein_id gnl|my_center|LOCUS_06590 955 2091 gene locus_tag LOCUS_06600 955 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2107 3363 gene locus_tag LOCUS_06610 2107 3363 CDS product heme biosynthesis protein HemY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772915.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence145 71 766 gene locus_tag LOCUS_06620 71 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 763 1845 gene locus_tag LOCUS_06630 gene alr 763 1845 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817869.1 protein_id gnl|my_center|LOCUS_06630 1820 3184 gene locus_tag LOCUS_06640 gene radA 1820 3184 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094867.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence146 1103 1780 gene locus_tag LOCUS_06650 gene radC 1103 1780 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_06650 2670 1777 gene locus_tag LOCUS_06660 2670 1777 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809513.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence147 <3523 2021 gene locus_tag LOCUS_06670 <3523 2021 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669362.1:V-type ATP synthase subunit A >Feature sequence148 164 1132 gene locus_tag LOCUS_06680 gene csy2 164 1132 CDS product type I-F CRISPR-associated protein Csy2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211868.1 protein_id gnl|my_center|LOCUS_06680 1116 2165 gene locus_tag LOCUS_06690 gene csy3 1116 2165 CDS product type I-F CRISPR-associated protein Csy3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211867.1 protein_id gnl|my_center|LOCUS_06690 2169 2732 gene locus_tag LOCUS_06700 gene cas6f 2169 2732 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211866.1 protein_id gnl|my_center|LOCUS_06700 2901 >3517 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcactgccgcacaggcagctcagaaa >Feature sequence149 408 40 gene locus_tag LOCUS_06710 408 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 781 413 gene locus_tag LOCUS_06720 781 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 1154 786 gene locus_tag LOCUS_06730 1154 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2165 1158 gene locus_tag LOCUS_06740 gene sctW 2165 1158 CDS product type III secretion system gatekeeper subunit SctW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176684.1 protein_id gnl|my_center|LOCUS_06740 2357 2698 gene locus_tag LOCUS_06750 2357 2698 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939281.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence150 934 5 gene locus_tag LOCUS_06760 gene truB 934 5 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958222.1 protein_id gnl|my_center|LOCUS_06760 1289 927 gene locus_tag LOCUS_06770 gene rbfA 1289 927 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095188.1 protein_id gnl|my_center|LOCUS_06770 <3504 1294 gene locus_tag LOCUS_06780 <3504 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958223.1:translation initiation factor IF-2 >Feature sequence151 2435 1380 gene locus_tag LOCUS_06790 2435 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 <3491 2432 gene locus_tag LOCUS_06800 <3491 2432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113934.1:GspD family T2SS secretin variant XcpQ >Feature sequence152 <1 860 gene locus_tag LOCUS_06810 <1 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003122524.1:ABC transporter permease 1470 919 gene locus_tag LOCUS_06820 1470 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2460 1555 gene locus_tag LOCUS_06830 2460 1555 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114915.1 protein_id gnl|my_center|LOCUS_06830 2686 2450 gene locus_tag LOCUS_06840 gene xseB 2686 2450 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124935.1 protein_id gnl|my_center|LOCUS_06840 2756 3031 gene locus_tag LOCUS_06850 2756 3031 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249855.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence153 2484 181 gene locus_tag LOCUS_06860 gene topA 2484 181 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958589.1 protein_id gnl|my_center|LOCUS_06860 2978 2514 gene locus_tag LOCUS_06870 2978 2514 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_06870 >Feature sequence154 664 1815 gene locus_tag LOCUS_06880 664 1815 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957826.1 protein_id gnl|my_center|LOCUS_06880 2209 1856 gene locus_tag LOCUS_06890 2209 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 <3479 2273 gene locus_tag LOCUS_06900 <3479 2273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039227.1:ATP-binding protein >Feature sequence155 2309 1008 gene locus_tag LOCUS_06910 2309 1008 CDS product TIGR02270 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943798.1 protein_id gnl|my_center|LOCUS_06910 3381 2302 gene locus_tag LOCUS_06920 3381 2302 CDS product 3-oxoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115088.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence156 <3476 336 gene locus_tag LOCUS_06930 <3476 336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024299434.1:transcription-repair coupling factor >Feature sequence157 <1 652 gene locus_tag LOCUS_06940 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005051889.1:fatty acyl-AMP ligase 656 1588 gene locus_tag LOCUS_06950 656 1588 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077137.1 protein_id gnl|my_center|LOCUS_06950 1613 1861 gene locus_tag LOCUS_06960 1613 1861 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248097.1 protein_id gnl|my_center|LOCUS_06960 1858 3051 gene locus_tag LOCUS_06970 1858 3051 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence158 546 169 gene locus_tag LOCUS_06980 546 169 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940617.1 protein_id gnl|my_center|LOCUS_06980 1573 551 gene locus_tag LOCUS_06990 1573 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 >Feature sequence159 >Feature sequence160 27 248 gene locus_tag LOCUS_07000 27 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 260 613 gene locus_tag LOCUS_07010 260 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 617 1390 gene locus_tag LOCUS_07020 gene sctJ 617 1390 CDS product type III secretion inner membrane ring lipoprotein SctJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064253017.1 protein_id gnl|my_center|LOCUS_07020 1341 2018 gene locus_tag LOCUS_07030 1341 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 2115 2020 gene locus_tag LOCUS_t00100 2115 2020 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2726 3187 gene locus_tag LOCUS_07040 2726 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence161 740 408 gene locus_tag LOCUS_07050 740 408 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530441.1 protein_id gnl|my_center|LOCUS_07050 2823 949 gene locus_tag LOCUS_07060 2823 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence162 1514 756 gene locus_tag LOCUS_07070 gene rpsB 1514 756 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036567.1 protein_id gnl|my_center|LOCUS_07070 1683 2501 gene locus_tag LOCUS_07080 gene map 1683 2501 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence163 <1 1115 gene locus_tag LOCUS_07090 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_026080084.1:DEAD/DEAH box helicase 1222 1662 gene locus_tag LOCUS_07100 1222 1662 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909403.1 protein_id gnl|my_center|LOCUS_07100 1667 2674 gene locus_tag LOCUS_07110 1667 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 3144 2671 gene locus_tag LOCUS_07120 gene bcp 3144 2671 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228578.1 protein_id gnl|my_center|LOCUS_07120 >Feature sequence164 3211 2072 gene locus_tag LOCUS_07130 3211 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 >Feature sequence165 739 14 gene locus_tag LOCUS_07140 739 14 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_07140 811 1122 gene locus_tag LOCUS_07150 811 1122 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942208.1 protein_id gnl|my_center|LOCUS_07150 2021 1137 gene locus_tag LOCUS_07160 gene ttcA 2021 1137 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477636.1 protein_id gnl|my_center|LOCUS_07160 3235 2018 gene locus_tag LOCUS_07170 gene fabB 3235 2018 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925736.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence166 64 2406 gene locus_tag LOCUS_07180 gene feoB 64 2406 CDS product Fe(2+) transporter permease subunit FeoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390223.1 protein_id gnl|my_center|LOCUS_07180 2403 2660 gene locus_tag LOCUS_07190 2403 2660 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958427.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence167 101 871 gene locus_tag LOCUS_07200 101 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1722 859 gene locus_tag LOCUS_07210 1722 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence168 <1 1227 gene locus_tag LOCUS_07220 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022627.1:phosphoenolpyruvate synthase 1655 1221 gene locus_tag LOCUS_07230 1655 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1888 1652 gene locus_tag LOCUS_07240 1888 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 1965 2936 gene locus_tag LOCUS_07250 gene cas1f 1965 2936 CDS product type I-F CRISPR-associated endonuclease Cas1f inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210191.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence169 <3317 1751 gene locus_tag LOCUS_07260 <3317 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085184.1:choline dehydrogenase >Feature sequence170 272 1594 gene locus_tag LOCUS_07270 272 1594 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247057.1 protein_id gnl|my_center|LOCUS_07270 2670 1546 gene locus_tag LOCUS_07280 gene pilU 2670 1546 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_07280 <3315 2682 gene locus_tag LOCUS_07290 <3315 2682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003489919.1:type IV pilus twitching motility protein PilT >Feature sequence171 703 1230 gene locus_tag LOCUS_07300 703 1230 CDS product GreA/GreB family elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337154.1 protein_id gnl|my_center|LOCUS_07300 1227 1811 gene locus_tag LOCUS_07310 1227 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 1811 3175 gene locus_tag LOCUS_07320 1811 3175 CDS product PFL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989505.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence172 976 59 gene locus_tag LOCUS_07330 976 59 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000610709.1 protein_id gnl|my_center|LOCUS_07330 1537 1028 gene locus_tag LOCUS_07340 1537 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1632 2351 gene locus_tag LOCUS_07350 1632 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 <3301 2624 gene locus_tag LOCUS_07360 <3301 2624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005765555.1:DUF3999 domain-containing protein >Feature sequence173 188 2548 gene locus_tag LOCUS_07370 188 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 2942 2505 gene locus_tag LOCUS_07380 2942 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence174 417 1184 gene locus_tag LOCUS_07390 gene pssA 417 1184 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_07390 1490 1188 gene locus_tag LOCUS_07400 1490 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 <3284 1507 gene locus_tag LOCUS_07410 <3284 1507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086886.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence175 <1 915 gene locus_tag LOCUS_07420 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965761.1:FAD-dependent oxidoreductase 903 2702 gene locus_tag LOCUS_07430 903 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence176 161 2722 gene locus_tag LOCUS_07440 161 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 <3267 2729 gene locus_tag LOCUS_07450 <3267 2729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258090.1:response regulator >Feature sequence177 <3260 816 gene locus_tag LOCUS_07460 <3260 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113794.1:valine--tRNA ligase >Feature sequence178 557 1462 gene locus_tag LOCUS_07470 gene htpX 557 1462 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004397849.1 protein_id gnl|my_center|LOCUS_07470 1915 1502 gene locus_tag LOCUS_07480 1915 1502 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143896.1 protein_id gnl|my_center|LOCUS_07480 2870 1971 gene locus_tag LOCUS_07490 2870 1971 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence179 <1 1088 gene locus_tag LOCUS_07500 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112843.1:DUF1631 domain-containing protein 3098 1083 gene locus_tag LOCUS_07510 3098 1083 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_07510 >Feature sequence180 274 699 gene locus_tag LOCUS_07520 274 699 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707154.1 protein_id gnl|my_center|LOCUS_07520 1913 687 gene locus_tag LOCUS_07530 1913 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 2129 1920 gene locus_tag LOCUS_07540 2129 1920 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613459.1 protein_id gnl|my_center|LOCUS_07540 3052 2165 gene locus_tag LOCUS_07550 3052 2165 CDS product EcsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118012.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence181 187 1059 gene locus_tag LOCUS_07560 187 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1818 1060 gene locus_tag LOCUS_07570 1818 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1985 2428 gene locus_tag LOCUS_07580 1985 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 >Feature sequence182 411 28 gene locus_tag LOCUS_07590 411 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1223 408 gene locus_tag LOCUS_07600 1223 408 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689299.1 protein_id gnl|my_center|LOCUS_07600 2509 1220 gene locus_tag LOCUS_07610 2509 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 >Feature sequence183 960 67 gene locus_tag LOCUS_07620 960 67 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101427.1 protein_id gnl|my_center|LOCUS_07620 1813 992 gene locus_tag LOCUS_07630 1813 992 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730500.1 protein_id gnl|my_center|LOCUS_07630 2785 2027 gene locus_tag LOCUS_07640 2785 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence184 378 860 gene locus_tag LOCUS_07650 378 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 1294 2472 gene locus_tag LOCUS_07660 1294 2472 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946820.1 protein_id gnl|my_center|LOCUS_07660 2475 2696 gene locus_tag LOCUS_07670 2475 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 2686 2943 gene locus_tag LOCUS_07680 2686 2943 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679713.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence185 <1 1185 gene locus_tag LOCUS_07690 <1 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947270.1:ribosome biogenesis GTPase Der 2859 1240 gene locus_tag LOCUS_07700 2859 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 3211 2840 gene locus_tag LOCUS_07710 3211 2840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence186 <1 561 gene locus_tag LOCUS_07720 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704441.1:serine endoprotease DegP 2339 618 gene locus_tag LOCUS_07730 gene polX 2339 618 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_07730 2448 3092 gene locus_tag LOCUS_07740 2448 3092 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence187 242 2452 gene locus_tag LOCUS_07750 242 2452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence188 1870 785 gene locus_tag LOCUS_07760 gene leuB 1870 785 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769662.1 protein_id gnl|my_center|LOCUS_07760 2694 2050 gene locus_tag LOCUS_07770 gene leuD 2694 2050 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_07770 <3193 2694 gene locus_tag LOCUS_07780 <3193 2694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930379.1:3-isopropylmalate dehydratase large subunit >Feature sequence189 >Feature sequence190 <1 1151 gene locus_tag LOCUS_07790 <1 1151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947568.1:DNA helicase II 1162 1704 gene locus_tag LOCUS_07800 1162 1704 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124030.1 protein_id gnl|my_center|LOCUS_07800 1729 2289 gene locus_tag LOCUS_07810 1729 2289 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887114.1 protein_id gnl|my_center|LOCUS_07810 2887 2276 gene locus_tag LOCUS_07820 2887 2276 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261211.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence191 <1 896 gene locus_tag LOCUS_07830 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112465.1:diguanylate cyclase 1435 875 gene locus_tag LOCUS_07840 1435 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 1673 2941 gene locus_tag LOCUS_07850 1673 2941 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039620.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence192 1017 241 gene locus_tag LOCUS_07860 1017 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2830 1025 gene locus_tag LOCUS_07870 gene lepA 2830 1025 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958269.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence193 <1 808 gene locus_tag LOCUS_07880 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141101.1:aspartyl/asparaginyl beta-hydroxylase domain-containing protein 801 1823 gene locus_tag LOCUS_07890 801 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2719 1820 gene locus_tag LOCUS_07900 2719 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence194 24 1247 gene locus_tag LOCUS_07910 24 1247 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738812.1 protein_id gnl|my_center|LOCUS_07910 1942 2946 gene locus_tag LOCUS_07920 1942 2946 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258874.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence195 1244 339 gene locus_tag LOCUS_07930 gene murB 1244 339 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016357031.1 protein_id gnl|my_center|LOCUS_07930 2686 1241 gene locus_tag LOCUS_07940 gene murC 2686 1241 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094121.1 protein_id gnl|my_center|LOCUS_07940 >Feature sequence196 <1 915 gene locus_tag LOCUS_07950 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109118.1:flagellar basal-body MS-ring/collar protein FliF 902 1903 gene locus_tag LOCUS_07960 gene fliG 902 1903 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082212.1 protein_id gnl|my_center|LOCUS_07960 1890 2720 gene locus_tag LOCUS_07970 gene fliH 1890 2720 CDS product flagellar assembly protein FliH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705274.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence197 1903 1052 gene locus_tag LOCUS_07980 1903 1052 CDS product transporter associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957666.1 protein_id gnl|my_center|LOCUS_07980 2370 1900 gene locus_tag LOCUS_07990 gene ybeY 2370 1900 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105185.1 protein_id gnl|my_center|LOCUS_07990 <3123 2374 gene locus_tag LOCUS_08000 <3123 2374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093159.1:PhoH family protein >Feature sequence198 258 1694 gene locus_tag LOCUS_08010 gene gatB 258 1694 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence199 1167 751 gene locus_tag LOCUS_08020 1167 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 1376 1140 gene locus_tag LOCUS_08030 1376 1140 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507842.1 protein_id gnl|my_center|LOCUS_08030 2155 1373 gene locus_tag LOCUS_08040 2155 1373 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528877.1 protein_id gnl|my_center|LOCUS_08040 <3115 2157 gene locus_tag LOCUS_08050 <3115 2157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024265974.1:succinate dehydrogenase flavoprotein subunit >Feature sequence200 342 734 gene locus_tag LOCUS_08060 342 734 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126719.1 protein_id gnl|my_center|LOCUS_08060 731 1003 gene locus_tag LOCUS_08070 731 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1008 1799 gene locus_tag LOCUS_08080 1008 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 1796 2131 gene locus_tag LOCUS_08090 1796 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2131 2358 gene locus_tag LOCUS_08100 2131 2358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2342 2662 gene locus_tag LOCUS_08110 2342 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence201 699 2288 gene locus_tag LOCUS_08120 699 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence202 2229 208 gene locus_tag LOCUS_08130 gene ligA 2229 208 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957648.1 protein_id gnl|my_center|LOCUS_08130 2922 2230 gene locus_tag LOCUS_08140 2922 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 3084 2935 gene locus_tag LOCUS_08150 3084 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 >Feature sequence203 489 881 gene locus_tag LOCUS_08160 gene gloA 489 881 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216418.1 protein_id gnl|my_center|LOCUS_08160 1341 1796 gene locus_tag LOCUS_08170 1341 1796 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770670.1 protein_id gnl|my_center|LOCUS_08170 2320 1802 gene locus_tag LOCUS_08180 2320 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 >Feature sequence204 1880 882 gene locus_tag LOCUS_08190 1880 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 <3055 1859 gene locus_tag LOCUS_08200 <3055 1859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289079.1:ABC transporter ATP-binding protein >Feature sequence205 1390 200 gene locus_tag LOCUS_08210 1390 200 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_08210 203 283 gene locus_tag LOCUS_t00110 203 283 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence206 <1 647 gene locus_tag LOCUS_08220 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036126.1:30S ribosomal protein S3 666 1079 gene locus_tag LOCUS_08230 gene rplP 666 1079 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215430.1 protein_id gnl|my_center|LOCUS_08230 1079 1276 gene locus_tag LOCUS_08240 gene rpmC 1079 1276 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771530.1 protein_id gnl|my_center|LOCUS_08240 1273 1527 gene locus_tag LOCUS_08250 gene rpsQ 1273 1527 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093717.1 protein_id gnl|my_center|LOCUS_08250 1541 1909 gene locus_tag LOCUS_08260 gene rplN 1541 1909 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307975.1 protein_id gnl|my_center|LOCUS_08260 1929 2246 gene locus_tag LOCUS_08270 gene rplX 1929 2246 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555478.1 protein_id gnl|my_center|LOCUS_08270 2259 2804 gene locus_tag LOCUS_08280 gene rplE 2259 2804 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070624.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence207 291 818 gene locus_tag LOCUS_08290 291 818 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085759.1 protein_id gnl|my_center|LOCUS_08290 829 2352 gene locus_tag LOCUS_08300 gene cetA 829 2352 CDS product bipartate energy taxis response protein CetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002790076.1 protein_id gnl|my_center|LOCUS_08300 2948 2412 gene locus_tag LOCUS_08310 gene cobO 2948 2412 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086769.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence208 <1 761 gene locus_tag LOCUS_08320 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532031.1:methylenetetrahydromethanopterin dehydrogenase 783 1688 gene locus_tag LOCUS_08330 783 1688 CDS product methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532031.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence209 167 1234 gene locus_tag LOCUS_08340 gene aroG 167 1234 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001109183.1 protein_id gnl|my_center|LOCUS_08340 1231 2226 gene locus_tag LOCUS_08350 1231 2226 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084517.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence210 2102 885 gene locus_tag LOCUS_08360 gene kch 2102 885 CDS product voltage-gated potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064633.1 protein_id gnl|my_center|LOCUS_08360 2149 2787 gene locus_tag LOCUS_08370 2149 2787 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence211 807 547 gene locus_tag LOCUS_08380 807 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 1804 836 gene locus_tag LOCUS_08390 gene dusB 1804 836 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399694.1 protein_id gnl|my_center|LOCUS_08390 2727 1837 gene locus_tag LOCUS_08400 2727 1837 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007339817.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence212 <1 576 gene locus_tag LOCUS_08410 <1 576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011975314.1:citrate synthase 580 2427 gene locus_tag LOCUS_08420 580 2427 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948679.1 protein_id gnl|my_center|LOCUS_08420 2405 2767 gene locus_tag LOCUS_08430 2405 2767 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098898.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence213 <1 1125 gene locus_tag LOCUS_08440 <1 1125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140176.1:ABC transporter ATP-binding protein <2941 1122 gene locus_tag LOCUS_08450 <2941 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205537.1:Hsp70 family protein >Feature sequence214 <1 711 gene locus_tag LOCUS_08460 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074019.1:DUF3014 domain-containing protein 1454 759 gene locus_tag LOCUS_08470 1454 759 CDS product tellurite resistance TerB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705529.1 protein_id gnl|my_center|LOCUS_08470 <2938 1562 gene locus_tag LOCUS_08480 <2938 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088915.1:endopeptidase La >Feature sequence215 351 1235 gene locus_tag LOCUS_08490 gene rfbA 351 1235 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439277.1 protein_id gnl|my_center|LOCUS_08490 1232 1789 gene locus_tag LOCUS_08500 gene rfbC 1232 1789 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870350.1 protein_id gnl|my_center|LOCUS_08500 1786 2673 gene locus_tag LOCUS_08510 gene rfbD 1786 2673 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112614.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence216 1324 1563 gene locus_tag LOCUS_08520 1324 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 1968 1570 gene locus_tag LOCUS_08530 gene dksA 1968 1570 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920436.1 protein_id gnl|my_center|LOCUS_08530 2540 1983 gene locus_tag LOCUS_08540 2540 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2830 2510 gene locus_tag LOCUS_08550 2830 2510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 >Feature sequence217 <2913 1112 gene locus_tag LOCUS_08560 <2913 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852012.1:CsgG/HfaB family protein >Feature sequence218 302 493 gene locus_tag LOCUS_08570 302 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 597 848 gene locus_tag LOCUS_08580 597 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 943 2163 gene locus_tag LOCUS_08590 943 2163 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_08590 <2911 2212 gene locus_tag LOCUS_08600 <2911 2212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930426.1:sigma-54 dependent transcriptional regulator >Feature sequence219 685 1491 gene locus_tag LOCUS_08610 685 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 1493 2797 gene locus_tag LOCUS_08620 1493 2797 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895536.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence220 1503 259 gene locus_tag LOCUS_08630 1503 259 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384483.1 protein_id gnl|my_center|LOCUS_08630 1604 1528 gene locus_tag LOCUS_t00120 1604 1528 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1687 1611 gene locus_tag LOCUS_t00130 1687 1611 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <2898 1893 gene locus_tag LOCUS_08640 <2898 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_178372678.1:TonB-dependent receptor >Feature sequence221 2586 517 gene locus_tag LOCUS_08650 2586 517 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262350.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence222 426 1328 gene locus_tag LOCUS_08660 426 1328 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382947.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence223 1821 1234 gene locus_tag LOCUS_08670 1821 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence224 946 23 gene locus_tag LOCUS_08680 946 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 1001 1690 gene locus_tag LOCUS_08690 gene rpe 1001 1690 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869007.1 protein_id gnl|my_center|LOCUS_08690 1708 2769 gene locus_tag LOCUS_08700 1708 2769 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941279.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence225 2041 728 gene locus_tag LOCUS_08710 2041 728 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence226 >Feature sequence227 75 515 gene locus_tag LOCUS_08720 75 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 528 953 gene locus_tag LOCUS_08730 gene fliS 528 953 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_08730 982 1350 gene locus_tag LOCUS_08740 982 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1355 1654 gene locus_tag LOCUS_08750 1355 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 1651 1920 gene locus_tag LOCUS_08760 1651 1920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2698 1901 gene locus_tag LOCUS_08770 2698 1901 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence228 2549 2184 gene locus_tag LOCUS_08780 2549 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence229 1039 392 gene locus_tag LOCUS_08790 1039 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1407 1036 gene locus_tag LOCUS_08800 1407 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 2530 1427 gene locus_tag LOCUS_08810 2530 1427 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028328040.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence230 938 138 gene locus_tag LOCUS_08820 938 138 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073090.1 protein_id gnl|my_center|LOCUS_08820 1740 940 gene locus_tag LOCUS_08830 gene motD 1740 940 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083090.1 protein_id gnl|my_center|LOCUS_08830 2477 1737 gene locus_tag LOCUS_08840 2477 1737 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003378725.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence231 <1 564 gene locus_tag LOCUS_08850 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005647567.1:LPS export ABC transporter ATP-binding protein 642 1409 gene locus_tag LOCUS_08860 gene zapD 642 1409 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_08860 1413 1595 gene locus_tag LOCUS_08870 1413 1595 CDS product DNA gyrase inhibitor YacG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945977.1 protein_id gnl|my_center|LOCUS_08870 1672 2493 gene locus_tag LOCUS_08880 1672 2493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence232 152 490 gene locus_tag LOCUS_08890 152 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 584 1024 gene locus_tag LOCUS_08900 584 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 1037 1327 gene locus_tag LOCUS_08910 1037 1327 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093079.1 protein_id gnl|my_center|LOCUS_08910 1324 1557 gene locus_tag LOCUS_08920 1324 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1733 1939 gene locus_tag LOCUS_08930 1733 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1939 2259 gene locus_tag LOCUS_08940 1939 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2256 2660 gene locus_tag LOCUS_08950 2256 2660 CDS product regulatory protein GemA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939964.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence233 1177 629 gene locus_tag LOCUS_08960 1177 629 CDS product DUF3486 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018652012.1 protein_id gnl|my_center|LOCUS_08960 1469 1179 gene locus_tag LOCUS_08970 1469 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1800 1462 gene locus_tag LOCUS_08980 1800 1462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2156 1797 gene locus_tag LOCUS_08990 2156 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2415 2158 gene locus_tag LOCUS_09000 2415 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 2768 2412 gene locus_tag LOCUS_09010 2768 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence234 <1 1222 gene locus_tag LOCUS_09020 <1 1222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615873.1:Swt1 family HEPN domain-containing protein 1228 2124 gene locus_tag LOCUS_09030 1228 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence235 364 1656 gene locus_tag LOCUS_09040 gene purD 364 1656 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000866836.1 protein_id gnl|my_center|LOCUS_09040 1653 2036 gene locus_tag LOCUS_09050 1653 2036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 2609 2028 gene locus_tag LOCUS_09060 2609 2028 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence236 1496 342 gene locus_tag LOCUS_09070 gene dnaJ 1496 342 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001118464.1 protein_id gnl|my_center|LOCUS_09070 <2796 1653 gene locus_tag LOCUS_09080 <2796 1653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770882.1:molecular chaperone DnaK >Feature sequence237 2245 425 gene locus_tag LOCUS_09090 gene uvrC 2245 425 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence238 561 1 gene locus_tag LOCUS_09100 gene msrA 561 1 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870242.1 protein_id gnl|my_center|LOCUS_09100 1009 551 gene locus_tag LOCUS_09110 gene msrB 1009 551 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173510038.1 protein_id gnl|my_center|LOCUS_09110 1777 1154 gene locus_tag LOCUS_09120 1777 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence239 671 423 gene locus_tag LOCUS_09130 gene hfq 671 423 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095657.1 protein_id gnl|my_center|LOCUS_09130 824 1768 gene locus_tag LOCUS_09140 gene ispH 824 1768 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_09140 <2775 1765 gene locus_tag LOCUS_09150 <2775 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546063.1:potassium channel protein >Feature sequence240 33 704 gene locus_tag LOCUS_09160 gene nth 33 704 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813856.1 protein_id gnl|my_center|LOCUS_09160 897 1463 gene locus_tag LOCUS_09170 897 1463 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_09170 1510 2691 gene locus_tag LOCUS_09180 1510 2691 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence241 500 1273 gene locus_tag LOCUS_09190 500 1273 CDS product heme ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457654.1 protein_id gnl|my_center|LOCUS_09190 1273 1440 gene locus_tag LOCUS_09200 1273 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 1437 1898 gene locus_tag LOCUS_09210 gene ccmE 1437 1898 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence242 <1 1178 gene locus_tag LOCUS_09220 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_054993407.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 1178 1795 gene locus_tag LOCUS_09230 gene rsmG 1178 1795 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707917.1 protein_id gnl|my_center|LOCUS_09230 1792 2577 gene locus_tag LOCUS_09240 1792 2577 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707916.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence243 1038 574 gene locus_tag LOCUS_09250 1038 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1117 2397 gene locus_tag LOCUS_09260 gene yegQ 1117 2397 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105560.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence244 <2757 383 gene locus_tag LOCUS_09270 <2757 383 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002221142.1:type I-F CRISPR-associated helicase Cas3f >Feature sequence245 861 2057 gene locus_tag LOCUS_09280 gene purT 861 2057 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186479.1 protein_id gnl|my_center|LOCUS_09280 2094 2663 gene locus_tag LOCUS_09290 2094 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence246 516 94 gene locus_tag LOCUS_09300 516 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 603 1022 gene locus_tag LOCUS_09310 gene fur 603 1022 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_09310 1022 2269 gene locus_tag LOCUS_09320 1022 2269 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence247 1 2310 gene locus_tag LOCUS_09330 gene polA 1 2310 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704214.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence248 <1 979 gene locus_tag LOCUS_09340 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162470631.1:tyrosine-type recombinase/integrase note possible pseudo, frameshifted 1048 1251 gene locus_tag LOCUS_09350 1048 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09350 2250 1303 gene locus_tag LOCUS_09360 2250 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence249 1041 553 gene locus_tag LOCUS_09370 1041 553 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809919.1 protein_id gnl|my_center|LOCUS_09370 <2727 1113 gene locus_tag LOCUS_09380 <2727 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076053568.1:SpoIIE family protein phosphatase >Feature sequence250 2 307 gene locus_tag LOCUS_09390 2 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 324 1724 gene locus_tag LOCUS_09400 324 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 2148 1729 gene locus_tag LOCUS_09410 2148 1729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 2378 2145 gene locus_tag LOCUS_09420 2378 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 >Feature sequence251 2111 57 gene locus_tag LOCUS_09430 gene recG 2111 57 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425918.1 protein_id gnl|my_center|LOCUS_09430 <2719 2116 gene locus_tag LOCUS_09440 <2719 2116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_144347086.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence252 316 2016 gene locus_tag LOCUS_09450 316 2016 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_09450 2385 1987 gene locus_tag LOCUS_09460 2385 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 >Feature sequence253 <1 1062 gene locus_tag LOCUS_09470 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243259.1:assimilatory sulfite reductase (NADPH) flavoprotein subunit 1079 1834 gene locus_tag LOCUS_09480 1079 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence254 751 1359 gene locus_tag LOCUS_09490 751 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 2455 1361 gene locus_tag LOCUS_09500 gene nadA 2455 1361 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_09500 >Feature sequence255 912 70 gene locus_tag LOCUS_09510 gene rsmI 912 70 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243679.1 protein_id gnl|my_center|LOCUS_09510 1085 909 gene locus_tag LOCUS_09520 1085 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence256 1961 324 gene locus_tag LOCUS_09530 gene cysN 1961 324 CDS product sulfate adenylyltransferase subunit CysN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110029.1 protein_id gnl|my_center|LOCUS_09530 <2639 2126 gene locus_tag LOCUS_09540 <2639 2126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000140408.1:sulfate adenylyltransferase subunit CysD >Feature sequence257 <1 2501 gene locus_tag LOCUS_09550 <1 2501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015774797.1:cytochrome ubiquinol oxidase subunit I >Feature sequence258 <1 1198 gene locus_tag LOCUS_09560 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003123571.1:N-acetylmuramoyl-L-alanine amidase AmiB >Feature sequence259 1551 610 gene locus_tag LOCUS_09570 gene pfkB 1551 610 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_09570 1677 2480 gene locus_tag LOCUS_09580 1677 2480 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855402.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence260 >Feature sequence261 688 1362 gene locus_tag LOCUS_09590 688 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1362 2420 gene locus_tag LOCUS_09600 1362 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence262 206 1675 gene locus_tag LOCUS_09610 gene sbcB 206 1675 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123272.1 protein_id gnl|my_center|LOCUS_09610 1722 2309 gene locus_tag LOCUS_09620 1722 2309 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087475.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence263 1039 254 gene locus_tag LOCUS_09630 1039 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09630 1393 1614 gene locus_tag LOCUS_09640 1393 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 >Feature sequence264 162 238 gene locus_tag LOCUS_t00140 162 238 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 265 340 gene locus_tag LOCUS_t00150 265 340 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1432 599 gene locus_tag LOCUS_09650 1432 599 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258850.1 protein_id gnl|my_center|LOCUS_09650 2202 1432 gene locus_tag LOCUS_09660 2202 1432 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence265 1112 570 gene locus_tag LOCUS_09670 1112 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1777 1304 gene locus_tag LOCUS_09680 1777 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 1991 1725 gene locus_tag LOCUS_09690 1991 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence266 972 454 gene locus_tag LOCUS_09700 972 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 1056 2240 gene locus_tag LOCUS_09710 1056 2240 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003122598.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence267 313 387 gene locus_tag LOCUS_t00160 313 387 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 547 1161 gene locus_tag LOCUS_09720 547 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence268 <1 739 gene locus_tag LOCUS_09730 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941156.1:thioredoxin-disulfide reductase 746 1435 gene locus_tag LOCUS_09740 gene aat 746 1435 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405081.1 protein_id gnl|my_center|LOCUS_09740 1438 2157 gene locus_tag LOCUS_09750 1438 2157 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814165.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence269 >Feature sequence270 >Feature sequence271 532 705 gene locus_tag LOCUS_09760 532 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 >Feature sequence272 1431 886 gene locus_tag LOCUS_09770 gene rnhB 1431 886 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_09770 1892 1446 gene locus_tag LOCUS_09780 gene fabZ 1892 1446 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071795.1 protein_id gnl|my_center|LOCUS_09780 2429 1923 gene locus_tag LOCUS_09790 2429 1923 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence273 69 2168 gene locus_tag LOCUS_09800 gene pnp 69 2168 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037640.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence274 <1 998 gene locus_tag LOCUS_09810 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545591.1:1,4-alpha-glucan branching protein GlgB 1008 2456 gene locus_tag LOCUS_09820 gene glgA 1008 2456 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197660.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence275 >Feature sequence276 399 94 gene locus_tag LOCUS_09830 399 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 477 1115 gene locus_tag LOCUS_09840 477 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1112 1426 gene locus_tag LOCUS_09850 1112 1426 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947507.1 protein_id gnl|my_center|LOCUS_09850 1836 1417 gene locus_tag LOCUS_09860 1836 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 2448 1972 gene locus_tag LOCUS_09870 2448 1972 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298836.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence277 1071 502 gene locus_tag LOCUS_09880 1071 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 1951 1076 gene locus_tag LOCUS_09890 gene dapA 1951 1076 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_09890 2097 2525 gene locus_tag LOCUS_09900 2097 2525 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence278 756 304 gene locus_tag LOCUS_09910 756 304 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_09910 2006 756 gene locus_tag LOCUS_09920 2006 756 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_09920 <2564 2003 gene locus_tag LOCUS_09930 <2564 2003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016194301.1:Fe-S cluster assembly protein SufD >Feature sequence279 691 110 gene locus_tag LOCUS_09940 691 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2014 767 gene locus_tag LOCUS_09950 2014 767 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence280 <1 2196 gene locus_tag LOCUS_09960 <1 2196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388324.1:FAD-dependent oxidoreductase 2224 2433 gene locus_tag LOCUS_09970 2224 2433 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966063.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence281 1770 775 gene locus_tag LOCUS_09980 gene lipA 1770 775 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555327.1 protein_id gnl|my_center|LOCUS_09980 2425 1754 gene locus_tag LOCUS_09990 gene lipB 2425 1754 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707033.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence282 1582 656 gene locus_tag LOCUS_10000 1582 656 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090885.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence283 1079 465 gene locus_tag LOCUS_10010 1079 465 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384435.1 protein_id gnl|my_center|LOCUS_10010 1707 1081 gene locus_tag LOCUS_10020 gene ccmA 1707 1081 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525610.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence284 282 1631 gene locus_tag LOCUS_10030 282 1631 CDS product nitrate/nitrite transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003525898.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence285 <1 696 gene locus_tag LOCUS_10040 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880200.1:type III-B CRISPR module RAMP protein Cmr4 710 1105 gene locus_tag LOCUS_10050 710 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 1518 1111 gene locus_tag LOCUS_10060 1518 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1730 1515 gene locus_tag LOCUS_10070 1730 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1784 2476 gene locus_tag LOCUS_10080 1784 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence286 538 2430 gene locus_tag LOCUS_10090 538 2430 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence287 155 71 gene locus_tag LOCUS_t00170 155 71 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 798 220 gene locus_tag LOCUS_10100 gene pth 798 220 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099278.1 protein_id gnl|my_center|LOCUS_10100 1418 795 gene locus_tag LOCUS_10110 1418 795 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_10110 2392 1442 gene locus_tag LOCUS_10120 2392 1442 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036108.1 protein_id gnl|my_center|LOCUS_10120 2514 2440 gene locus_tag LOCUS_t00180 2514 2440 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence288 <1 662 gene locus_tag LOCUS_10130 <1 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707907.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU 677 2506 gene locus_tag LOCUS_10140 gene glmS 677 2506 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074325.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence289 1 924 gene locus_tag LOCUS_10150 1 924 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095644.1 protein_id gnl|my_center|LOCUS_10150 937 2229 gene locus_tag LOCUS_10160 937 2229 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence290 <2534 1509 gene locus_tag LOCUS_10170 <2534 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930878.1:ATP-dependent RNA helicase HrpA >Feature sequence291 <1 879 gene locus_tag LOCUS_10180 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957671.1:acetyl-CoA C-acetyltransferase >Feature sequence292 <1 520 gene locus_tag LOCUS_10190 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387961.1:DEAD/DEAH box helicase 646 1101 gene locus_tag LOCUS_10200 646 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 2416 1160 gene locus_tag LOCUS_10210 2416 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence293 >Feature sequence294 2187 1084 gene locus_tag LOCUS_10220 2187 1084 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence295 134 958 gene locus_tag LOCUS_10230 134 958 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_10230 970 1536 gene locus_tag LOCUS_10240 970 1536 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_10240 1529 1963 gene locus_tag LOCUS_10250 gene ruvX 1529 1963 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356737.1 protein_id gnl|my_center|LOCUS_10250 1960 2472 gene locus_tag LOCUS_10260 gene pyrR 1960 2472 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266430.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence296 2498 2253 gene locus_tag LOCUS_10270 2498 2253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence297 532 287 gene locus_tag LOCUS_10280 532 287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 522 1115 gene locus_tag LOCUS_10290 gene moaB 522 1115 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091240.1 protein_id gnl|my_center|LOCUS_10290 1132 1815 gene locus_tag LOCUS_10300 1132 1815 CDS product NnrU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391054.1 protein_id gnl|my_center|LOCUS_10300 1815 2186 gene locus_tag LOCUS_10310 1815 2186 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405261.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence298 2098 833 gene locus_tag LOCUS_10320 2098 833 CDS product DotU family type VI secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039003.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence299 1449 469 gene locus_tag LOCUS_10330 gene moaA 1449 469 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104052.1 protein_id gnl|my_center|LOCUS_10330 <2481 1454 gene locus_tag LOCUS_10340 <2481 1454 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704629.1:signal recognition particle protein >Feature sequence300 <1 652 gene locus_tag LOCUS_10350 <1 652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091442.1:30S ribosomal protein S1 717 1034 gene locus_tag LOCUS_10360 717 1034 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213349.1 protein_id gnl|my_center|LOCUS_10360 1044 2318 gene locus_tag LOCUS_10370 gene serS 1044 2318 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence301 <1 568 gene locus_tag LOCUS_10380 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089020.1:homoserine O-succinyltransferase 958 575 gene locus_tag LOCUS_10390 958 575 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403158.1 protein_id gnl|my_center|LOCUS_10390 1080 1913 gene locus_tag LOCUS_10400 1080 1913 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966732.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence302 <1 733 gene locus_tag LOCUS_10410 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207213.1:bifunctional prephenate dehydrogenase/3-phosphoshikimate 1-carboxyvinyltransferase 726 1421 gene locus_tag LOCUS_10420 gene cmk 726 1421 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence303 930 577 gene locus_tag LOCUS_10430 930 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence304 <1 847 gene locus_tag LOCUS_10440 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011213323.1:ATP-dependent Clp protease ATP-binding subunit ClpA 1080 862 gene locus_tag LOCUS_10450 gene infA 1080 862 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040192.1 protein_id gnl|my_center|LOCUS_10450 1117 2352 gene locus_tag LOCUS_10460 1117 2352 CDS product YihY family inner membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112579.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence305 >Feature sequence306 128 961 gene locus_tag LOCUS_10470 gene kdsA 128 961 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_10470 991 2271 gene locus_tag LOCUS_10480 gene eno 991 2271 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence307 970 305 gene locus_tag LOCUS_10490 970 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1636 977 gene locus_tag LOCUS_10500 1636 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2079 1633 gene locus_tag LOCUS_10510 2079 1633 CDS product ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871651.1 protein_id gnl|my_center|LOCUS_10510 >Feature sequence308 923 1699 gene locus_tag LOCUS_10520 923 1699 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence309 <1 1607 gene locus_tag LOCUS_10530 <1 1607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032802289.1:DNA-directed RNA polymerase subunit beta' 1818 2192 gene locus_tag LOCUS_10540 gene rpsL 1818 2192 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543325.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence310 <1 825 gene locus_tag LOCUS_10550 <1 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922508.1:POT family MFS transporter 822 1307 gene locus_tag LOCUS_10560 822 1307 CDS product MEKHLA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192119.1 protein_id gnl|my_center|LOCUS_10560 1794 1252 gene locus_tag LOCUS_10570 1794 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1850 2299 gene locus_tag LOCUS_10580 1850 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence311 <1 1875 gene locus_tag LOCUS_10590 <1 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011338264.1:carbamoyltransferase HypF 1880 2134 gene locus_tag LOCUS_10600 gene hybG 1880 2134 CDS product hydrogenase maturation factor HybG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000334887.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence312 <1 2173 gene locus_tag LOCUS_10610 <1 2173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004555870.1:nitrate reductase subunit alpha >Feature sequence313 199 1530 gene locus_tag LOCUS_10620 199 1530 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_10620 1514 2074 gene locus_tag LOCUS_10630 gene rsmD 1514 2074 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003455683.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence314 618 313 gene locus_tag LOCUS_10640 618 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 592 774 gene locus_tag LOCUS_10650 592 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1990 1133 gene locus_tag LOCUS_10660 1990 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 2262 2017 gene locus_tag LOCUS_10670 2262 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence315 <1 693 gene locus_tag LOCUS_10680 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114912.1:GldG family protein 1124 729 gene locus_tag LOCUS_10690 1124 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1349 1152 gene locus_tag LOCUS_10700 1349 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 <2373 1346 gene locus_tag LOCUS_10710 <2373 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002227821.1:FAD:protein FMN transferase >Feature sequence316 <1 719 gene locus_tag LOCUS_10720 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266972.1:[protein-PII] uridylyltransferase 1085 705 gene locus_tag LOCUS_10730 1085 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 2006 1089 gene locus_tag LOCUS_10740 2006 1089 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388796.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence317 >Feature sequence318 <1 1180 gene locus_tag LOCUS_10750 <1 1180 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001235051.1:ATP-dependent chaperone ClpB 1616 1254 gene locus_tag LOCUS_10760 1616 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10760 2333 1632 gene locus_tag LOCUS_10770 2333 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence319 >Feature sequence320 1034 234 gene locus_tag LOCUS_10780 1034 234 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069503024.1 protein_id gnl|my_center|LOCUS_10780 1473 1042 gene locus_tag LOCUS_10790 gene holC 1473 1042 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_10790 <2351 1473 gene locus_tag LOCUS_10800 <2351 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003092867.1:leucyl aminopeptidase >Feature sequence321 65 424 gene locus_tag LOCUS_10810 65 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 434 1255 gene locus_tag LOCUS_10820 434 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227200.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence322 591 962 gene locus_tag LOCUS_10830 591 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 967 1767 gene locus_tag LOCUS_10840 967 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 <2339 1769 gene locus_tag LOCUS_10850 <2339 1769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948228.1:Dot/Icm T4SS effector MavL >Feature sequence323 146 1336 gene locus_tag LOCUS_10860 146 1336 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770586.1 protein_id gnl|my_center|LOCUS_10860 1338 2141 gene locus_tag LOCUS_10870 1338 2141 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence324 >Feature sequence325 1552 374 gene locus_tag LOCUS_10880 gene dacB 1552 374 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839168.1 protein_id gnl|my_center|LOCUS_10880 2271 1567 gene locus_tag LOCUS_10890 2271 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence326 <1 1412 gene locus_tag LOCUS_10900 <1 1412 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_049733735.1:phosphomannomutase 2263 1409 gene locus_tag LOCUS_10910 2263 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence327 1248 1439 gene locus_tag LOCUS_10920 1248 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence328 <1 696 gene locus_tag LOCUS_10930 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836183.1:sulfotransferase 693 1655 gene locus_tag LOCUS_10940 693 1655 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889298.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence329 238 1701 gene locus_tag LOCUS_10950 238 1701 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946783.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence330 <1 650 gene locus_tag LOCUS_10960 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947122.1:phosphate acyltransferase PlsX note possible pseudo, frameshifted 644 1033 gene locus_tag LOCUS_10970 644 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10970 1030 1992 gene locus_tag LOCUS_10980 1030 1992 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097122.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence331 1016 408 gene locus_tag LOCUS_10990 1016 408 CDS product methylthioribulose 1-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103182.1 protein_id gnl|my_center|LOCUS_10990 1849 1013 gene locus_tag LOCUS_11000 gene panC 1849 1013 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815587.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence332 1647 538 gene locus_tag LOCUS_11010 1647 538 CDS product DUF6094 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104230471.1 protein_id gnl|my_center|LOCUS_11010 2146 1778 gene locus_tag LOCUS_11020 2146 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence333 456 1874 gene locus_tag LOCUS_11030 456 1874 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence334 1171 554 gene locus_tag LOCUS_11040 1171 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2098 1430 gene locus_tag LOCUS_11050 2098 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence335 <1 1455 gene locus_tag LOCUS_11060 <1 1455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005457720.1:M48 family metallopeptidase <2252 1452 gene locus_tag LOCUS_11070 <2252 1452 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071414.1:FAD-dependent monooxygenase >Feature sequence336 <1 729 gene locus_tag LOCUS_11080 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015443933.1:YeaH/YhbH family protein >Feature sequence337 1369 665 gene locus_tag LOCUS_11090 1369 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 <2228 1363 gene locus_tag LOCUS_11100 <2228 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004190626.1:squalene--hopene cyclase >Feature sequence338 <1 2159 gene locus_tag LOCUS_11110 <1 2159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117769.1:ATP-binding protein note possible pseudo, frameshifted >Feature sequence339 1282 65 gene locus_tag LOCUS_11120 gene ccmI 1282 65 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_11120 1755 1279 gene locus_tag LOCUS_11130 1755 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence340 349 729 gene locus_tag LOCUS_11140 gene rplL 349 729 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence341 1597 863 gene locus_tag LOCUS_11150 1597 863 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074036.1 protein_id gnl|my_center|LOCUS_11150 2054 1587 gene locus_tag LOCUS_11160 2054 1587 CDS product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418359.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence342 1874 483 gene locus_tag LOCUS_11170 gene argH 1874 483 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_11170 >Feature sequence343 286 26 gene locus_tag LOCUS_11180 gene grxC 286 26 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200200.1 protein_id gnl|my_center|LOCUS_11180 412 1095 gene locus_tag LOCUS_11190 gene rpe 412 1095 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869007.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence344 533 1138 gene locus_tag LOCUS_11200 533 1138 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092073.1 protein_id gnl|my_center|LOCUS_11200 1492 1199 gene locus_tag LOCUS_11210 1492 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence345 1085 450 gene locus_tag LOCUS_11220 1085 450 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583068.1 protein_id gnl|my_center|LOCUS_11220 1138 2001 gene locus_tag LOCUS_11230 1138 2001 CDS product NADP-dependent methylenetetrahydromethanopterin/methylenetetrahydrofolate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122705.1 protein_id gnl|my_center|LOCUS_11230 >Feature sequence346 <1 1068 gene locus_tag LOCUS_11240 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459803.1:UPF0182 family protein 1782 1120 gene locus_tag LOCUS_11250 gene rpiA 1782 1120 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071382.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence347 1180 170 gene locus_tag LOCUS_11260 1180 170 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_11260 <2190 1177 gene locus_tag LOCUS_11270 <2190 1177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073077.1:Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB >Feature sequence348 1104 637 gene locus_tag LOCUS_11280 1104 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1426 1133 gene locus_tag LOCUS_11290 1426 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 <2183 1492 gene locus_tag LOCUS_11300 <2183 1492 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037118.1:flagellar basal body P-ring formation chaperone FlgA >Feature sequence349 8 2164 gene locus_tag LOCUS_11310 8 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 >Feature sequence350 669 352 gene locus_tag LOCUS_11320 669 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence351 1964 18 gene locus_tag LOCUS_11330 1964 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence352 603 376 gene locus_tag LOCUS_11340 603 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence353 >Feature sequence354 91 762 gene locus_tag LOCUS_11350 91 762 CDS product TIGR04211 family SH3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000733229.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence355 1952 1572 gene locus_tag LOCUS_11360 1952 1572 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918726.1 protein_id gnl|my_center|LOCUS_11360 2167 1949 gene locus_tag LOCUS_11370 2167 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence356 >Feature sequence357 <1 1281 gene locus_tag LOCUS_11380 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257348.1:BTAD domain-containing putative transcriptional regulator >Feature sequence358 >Feature sequence359 1898 483 gene locus_tag LOCUS_11390 1898 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence360 <1 994 gene locus_tag LOCUS_11400 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705495.1:molybdopterin molybdotransferase MoeA 984 1619 gene locus_tag LOCUS_11410 gene bioD 984 1619 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921893.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence361 2063 1185 gene locus_tag LOCUS_11420 2063 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence362 2041 1865 gene locus_tag LOCUS_11430 2041 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence363 568 1380 gene locus_tag LOCUS_11440 gene mutM 568 1380 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763611.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence364 204 1379 gene locus_tag LOCUS_11450 204 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence365 277 555 gene locus_tag LOCUS_11460 277 555 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_11460 561 1448 gene locus_tag LOCUS_11470 561 1448 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191958.1 protein_id gnl|my_center|LOCUS_11470 <2135 1498 gene locus_tag LOCUS_11480 <2135 1498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036487.1:diguanylate cyclase >Feature sequence366 <1 982 gene locus_tag LOCUS_11490 <1 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706536.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit >Feature sequence367 1524 1222 gene locus_tag LOCUS_11500 1524 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1761 1582 gene locus_tag LOCUS_11510 1761 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 >Feature sequence368 1413 622 gene locus_tag LOCUS_11520 1413 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 1904 1410 gene locus_tag LOCUS_11530 1904 1410 CDS product YbaK/EbsC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228850.1 protein_id gnl|my_center|LOCUS_11530 >Feature sequence369 1092 1703 gene locus_tag LOCUS_11540 1092 1703 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_11540 2056 1778 gene locus_tag LOCUS_11550 2056 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence370 754 230 gene locus_tag LOCUS_11560 gene cobU 754 230 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_11560 <2125 766 gene locus_tag LOCUS_11570 <2125 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112353.1:cobyric acid synthase >Feature sequence371 <1 542 gene locus_tag LOCUS_11580 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458190.1:cell division protein FtsW 539 1615 gene locus_tag LOCUS_11590 gene murG 539 1615 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707580.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence372 1334 219 gene locus_tag LOCUS_11600 1334 219 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532032.1 protein_id gnl|my_center|LOCUS_11600 <2122 1322 gene locus_tag LOCUS_11610 <2122 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013532030.1:beta-ribofuranosylaminobenzene 5'-phosphate synthase >Feature sequence373 <1 856 gene locus_tag LOCUS_11620 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269067.1:EAL domain-containing protein 1116 853 gene locus_tag LOCUS_11630 1116 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11630 1322 1113 gene locus_tag LOCUS_11640 1322 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1849 1295 gene locus_tag LOCUS_11650 1849 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence374 <1 1874 gene locus_tag LOCUS_11660 <1 1874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895493.1:type VI secretion system membrane subunit TssM >Feature sequence375 1685 723 gene locus_tag LOCUS_11670 1685 723 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence376 >Feature sequence377 382 1269 gene locus_tag LOCUS_11680 382 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 <2112 1263 gene locus_tag LOCUS_11690 <2112 1263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064474.1:ATP-binding protein >Feature sequence378 <2102 90 gene locus_tag LOCUS_11700 <2102 90 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016356688.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence379 57 662 gene locus_tag LOCUS_11710 57 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 1164 667 gene locus_tag LOCUS_11720 1164 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 1798 1145 gene locus_tag LOCUS_11730 1798 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence380 709 224 gene locus_tag LOCUS_11740 709 224 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404314.1 protein_id gnl|my_center|LOCUS_11740 1469 696 gene locus_tag LOCUS_11750 gene gloB 1469 696 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391018.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence381 453 1004 gene locus_tag LOCUS_11760 453 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1006 1962 gene locus_tag LOCUS_11770 1006 1962 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192760.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence382 458 763 gene locus_tag LOCUS_11780 458 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 760 1359 gene locus_tag LOCUS_11790 760 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence383 >Feature sequence384 1247 144 gene locus_tag LOCUS_11800 gene wecB 1247 144 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582948.1 protein_id gnl|my_center|LOCUS_11800 <2083 1244 gene locus_tag LOCUS_11810 <2083 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390863.1:XrtA-associated ATPase >Feature sequence385 <1 587 gene locus_tag LOCUS_11820 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941690.1:carbon-nitrogen hydrolase 934 584 gene locus_tag LOCUS_11830 934 584 CDS product H-NS histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000801427.1 protein_id gnl|my_center|LOCUS_11830 1000 1686 gene locus_tag LOCUS_11840 1000 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence386 1241 27 gene locus_tag LOCUS_11850 1241 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 1675 1238 gene locus_tag LOCUS_11860 1675 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence387 1106 270 gene locus_tag LOCUS_11870 1106 270 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403241.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence388 455 871 gene locus_tag LOCUS_11880 455 871 CDS product type II toxin-antitoxin system antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073052.1 protein_id gnl|my_center|LOCUS_11880 864 1283 gene locus_tag LOCUS_11890 864 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence389 <1 633 gene locus_tag LOCUS_11900 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225519.1:UTP--glucose-1-phosphate uridylyltransferase GalU 1570 596 gene locus_tag LOCUS_11910 1570 596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458989.1 protein_id gnl|my_center|LOCUS_11910 <2073 1567 gene locus_tag LOCUS_11920 <2073 1567 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039039.1:energy transducer TonB >Feature sequence390 363 1583 gene locus_tag LOCUS_11930 gene xanA2 363 1583 CDS product xanthomonadin biosynthesis 3-hydroxybenozate--AMP ligase XanA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014506148.1 protein_id gnl|my_center|LOCUS_11930 <2066 1561 gene locus_tag LOCUS_11940 <2066 1561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225878.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence391 539 1168 gene locus_tag LOCUS_11950 539 1168 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192132.1 protein_id gnl|my_center|LOCUS_11950 1181 1831 gene locus_tag LOCUS_11960 1181 1831 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021249004.1 protein_id gnl|my_center|LOCUS_11960 >Feature sequence392 634 1272 gene locus_tag LOCUS_11970 634 1272 CDS product DUF2959 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456820.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence393 <2064 628 gene locus_tag LOCUS_11980 <2064 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769277.1:ATP-binding protein >Feature sequence394 214 468 gene locus_tag LOCUS_11990 214 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 666 1370 gene locus_tag LOCUS_12000 666 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 <2062 1367 gene locus_tag LOCUS_12010 <2062 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895678.1:glycine oxidase ThiO >Feature sequence395 122 883 gene locus_tag LOCUS_12020 122 883 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704670.1 protein_id gnl|my_center|LOCUS_12020 1896 874 gene locus_tag LOCUS_12030 gene rtcA 1896 874 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001335950.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence396 1212 82 gene locus_tag LOCUS_12040 1212 82 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388823.1 protein_id gnl|my_center|LOCUS_12040 1666 1199 gene locus_tag LOCUS_12050 gene iscR 1666 1199 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092836.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence397 <2053 86 gene locus_tag LOCUS_12060 <2053 86 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039076.1:MMPL family transporter >Feature sequence398 868 83 gene locus_tag LOCUS_12070 gene fabI 868 83 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_12070 1851 913 gene locus_tag LOCUS_12080 1851 913 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545151.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence399 1928 834 gene locus_tag LOCUS_12090 gene apbC 1928 834 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004567450.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence400 3 1319 gene locus_tag LOCUS_12100 3 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12100 1328 1555 gene locus_tag LOCUS_12110 1328 1555 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119787.1 protein_id gnl|my_center|LOCUS_12110 1552 1836 gene locus_tag LOCUS_12120 1552 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence401 1191 139 gene locus_tag LOCUS_12130 gene purM 1191 139 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457724.1 protein_id gnl|my_center|LOCUS_12130 1272 1835 gene locus_tag LOCUS_12140 1272 1835 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence402 577 17 gene locus_tag LOCUS_12150 577 17 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092665.1 protein_id gnl|my_center|LOCUS_12150 1020 574 gene locus_tag LOCUS_12160 1020 574 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095013.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence403 839 597 gene locus_tag LOCUS_12170 839 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1002 1271 gene locus_tag LOCUS_12180 1002 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence404 <2029 1480 gene locus_tag LOCUS_12190 <2029 1480 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_176994151.1:ATP-binding protein >Feature sequence405 <1 1131 gene locus_tag LOCUS_12200 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037909.1:M20 family metallopeptidase >Feature sequence406 <1 1265 gene locus_tag LOCUS_12210 <1 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112546.1:M48 family metallopeptidase 1520 1906 gene locus_tag LOCUS_12220 gene soxX 1520 1906 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence407 <1 784 gene locus_tag LOCUS_12230 <1 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920470.1:guanine deaminase <2018 776 gene locus_tag LOCUS_12240 <2018 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007327432.1:SLC13 family permease >Feature sequence408 >Feature sequence409 55 696 gene locus_tag LOCUS_12250 55 696 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088434.1 protein_id gnl|my_center|LOCUS_12250 1284 682 gene locus_tag LOCUS_12260 1284 682 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405010.1 protein_id gnl|my_center|LOCUS_12260 >Feature sequence410 671 186 gene locus_tag LOCUS_12270 671 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1195 668 gene locus_tag LOCUS_12280 1195 668 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224883.1 protein_id gnl|my_center|LOCUS_12280 <2012 1195 gene locus_tag LOCUS_12290 <2012 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707617.1:KpsF/GutQ family sugar-phosphate isomerase >Feature sequence411 <1 857 gene locus_tag LOCUS_12300 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004556617.1:aldehyde dehydrogenase family protein 923 1294 gene locus_tag LOCUS_12310 923 1294 CDS product DUF779 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057670999.1 protein_id gnl|my_center|LOCUS_12310 1354 1563 gene locus_tag LOCUS_12320 1354 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1567 1944 gene locus_tag LOCUS_12330 1567 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence412 1115 864 gene locus_tag LOCUS_12340 1115 864 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958608.1 protein_id gnl|my_center|LOCUS_12340 1234 1572 gene locus_tag LOCUS_12350 gene glnK 1234 1572 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence413 955 548 gene locus_tag LOCUS_12360 955 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 <2001 952 gene locus_tag LOCUS_12370 <2001 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267020.1:conjugative transfer ATPase >Feature sequence414 <1 961 gene locus_tag LOCUS_12380 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003813306.1:M48 family metallopeptidase 958 1854 gene locus_tag LOCUS_12390 gene rsgA 958 1854 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763005.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence415 >Feature sequence416 >Feature sequence417 698 468 gene locus_tag LOCUS_12400 698 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 935 702 gene locus_tag LOCUS_12410 935 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 <1984 940 gene locus_tag LOCUS_12420 <1984 940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011216651.1:PrkA family serine protein kinase >Feature sequence418 806 108 gene locus_tag LOCUS_12430 806 108 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532066.1 protein_id gnl|my_center|LOCUS_12430 1540 803 gene locus_tag LOCUS_12440 1540 803 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173656.1 protein_id gnl|my_center|LOCUS_12440 >Feature sequence419 1914 1180 gene locus_tag LOCUS_12450 1914 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 >Feature sequence420 142 972 gene locus_tag LOCUS_12460 gene serB 142 972 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225307.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence421 <1 595 gene locus_tag LOCUS_12470 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705040.1:UDP-glucose 4-epimerase GalE 1521 847 gene locus_tag LOCUS_12480 1521 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence422 1126 1617 gene locus_tag LOCUS_12490 1126 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence423 >Feature sequence424 39 905 gene locus_tag LOCUS_12500 39 905 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259184.1 protein_id gnl|my_center|LOCUS_12500 1053 1886 gene locus_tag LOCUS_12510 1053 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 >Feature sequence425 250 1131 gene locus_tag LOCUS_12520 gene era 250 1131 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_12520 1134 1829 gene locus_tag LOCUS_12530 gene recO 1134 1829 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209680.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence426 572 1000 gene locus_tag LOCUS_12540 572 1000 CDS product DUF2267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228678.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence427 1288 338 gene locus_tag LOCUS_12550 gene ribF 1288 338 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence428 <1947 963 gene locus_tag LOCUS_12560 <1947 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390861.1:FemAB family PEP-CTERM system-associated protein >Feature sequence429 941 357 gene locus_tag LOCUS_12570 941 357 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073963.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence430 266 1696 gene locus_tag LOCUS_12580 266 1696 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626578.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence431 1177 605 gene locus_tag LOCUS_12590 gene folE 1177 605 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091896.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence432 1426 527 gene locus_tag LOCUS_12600 1426 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence433 241 1050 gene locus_tag LOCUS_12610 gene folP 241 1050 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921057.1 protein_id gnl|my_center|LOCUS_12610 1103 1483 gene locus_tag LOCUS_12620 1103 1483 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532029.1 protein_id gnl|my_center|LOCUS_12620 1939 1739 gene locus_tag LOCUS_12630 1939 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence434 <1 506 gene locus_tag LOCUS_12640 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase 527 1669 gene locus_tag LOCUS_12650 527 1669 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973142.1 protein_id gnl|my_center|LOCUS_12650 1937 1623 gene locus_tag LOCUS_12660 1937 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 >Feature sequence435 <1 922 gene locus_tag LOCUS_12670 <1 922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100607.1:tRNA guanosine(34) transglycosylase Tgt 972 1340 gene locus_tag LOCUS_12680 gene yajC 972 1340 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003015446.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence436 131 805 gene locus_tag LOCUS_12690 131 805 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_12690 817 1683 gene locus_tag LOCUS_12700 817 1683 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256595.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence437 897 61 gene locus_tag LOCUS_12710 897 61 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478523.1 protein_id gnl|my_center|LOCUS_12710 <1929 917 gene locus_tag LOCUS_12720 <1929 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003016296.1:dCTP deaminase >Feature sequence438 <1929 424 gene locus_tag LOCUS_12730 <1929 424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082235.1:DNA mismatch repair protein MutS >Feature sequence439 <1 1007 gene locus_tag LOCUS_12740 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392125.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 1754 1011 gene locus_tag LOCUS_12750 gene cysZ 1754 1011 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244082.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence440 1603 164 gene locus_tag LOCUS_12760 1603 164 CDS product glutamate synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090469.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence441 <1927 1022 gene locus_tag LOCUS_12770 <1927 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946303.1:fatty acid desaturase >Feature sequence442 1890 4 gene locus_tag LOCUS_12780 gene dxs 1890 4 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence443 1407 1105 gene locus_tag LOCUS_12790 1407 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1880 1404 gene locus_tag LOCUS_12800 gene mlaD 1880 1404 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence444 510 184 gene locus_tag LOCUS_12810 510 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1568 513 gene locus_tag LOCUS_12820 1568 513 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence445 828 220 gene locus_tag LOCUS_12830 828 220 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002556694.1 protein_id gnl|my_center|LOCUS_12830 <1918 831 gene locus_tag LOCUS_12840 <1918 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002669361.1:V-type ATP synthase subunit B >Feature sequence446 105 923 gene locus_tag LOCUS_12850 105 923 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_12850 1413 886 gene locus_tag LOCUS_12860 gene folA 1413 886 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707142.1 protein_id gnl|my_center|LOCUS_12860 <1913 1410 gene locus_tag LOCUS_12870 <1913 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015369929.1:thymidylate synthase >Feature sequence447 307 68 gene locus_tag LOCUS_12880 307 68 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144103.1 protein_id gnl|my_center|LOCUS_12880 570 1271 gene locus_tag LOCUS_12890 gene narI 570 1271 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096259.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence448 <1 952 gene locus_tag LOCUS_12900 <1 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037738.1:YhdP family protein 959 1774 gene locus_tag LOCUS_12910 959 1774 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813061.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence449 >Feature sequence450 665 198 gene locus_tag LOCUS_12920 665 198 CDS product DUF2244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197998.1 protein_id gnl|my_center|LOCUS_12920 747 1652 gene locus_tag LOCUS_12930 747 1652 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532094.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence451 1549 575 gene locus_tag LOCUS_12940 1549 575 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390200.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence452 1092 499 gene locus_tag LOCUS_12950 1092 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815732.1 protein_id gnl|my_center|LOCUS_12950 1820 1089 gene locus_tag LOCUS_12960 1820 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119510.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence453 634 365 gene locus_tag LOCUS_12970 gene fliQ 634 365 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367302.1 protein_id gnl|my_center|LOCUS_12970 1304 639 gene locus_tag LOCUS_12980 gene fliP 1304 639 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083052.1 protein_id gnl|my_center|LOCUS_12980 1777 1373 gene locus_tag LOCUS_12990 1777 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence454 1574 486 gene locus_tag LOCUS_13000 gene aroB 1574 486 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_13000 >Feature sequence455 1335 418 gene locus_tag LOCUS_13010 gene hemF 1335 418 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704273.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence456 <1870 861 gene locus_tag LOCUS_13020 <1870 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028993.1:methyltransferase domain-containing protein >Feature sequence457 69 878 gene locus_tag LOCUS_13030 69 878 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_13030 1357 851 gene locus_tag LOCUS_13040 1357 851 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957861.1 protein_id gnl|my_center|LOCUS_13040 <1869 1347 gene locus_tag LOCUS_13050 <1869 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001125199.1:7-methyl-GTP pyrophosphatase >Feature sequence458 147 1013 gene locus_tag LOCUS_13060 147 1013 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_13060 1014 1622 gene locus_tag LOCUS_13070 gene coaE 1014 1622 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112838.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence459 <1 1067 gene locus_tag LOCUS_13080 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880454.1:DUF505 domain-containing protein 1108 1467 gene locus_tag LOCUS_13090 1108 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence460 1110 283 gene locus_tag LOCUS_13100 gene nadC 1110 283 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104915.1 protein_id gnl|my_center|LOCUS_13100 <1863 1107 gene locus_tag LOCUS_13110 <1863 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005173449.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence461 <1862 738 gene locus_tag LOCUS_13120 <1862 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003377649.1:cell division protein FtsA >Feature sequence462 1429 233 gene locus_tag LOCUS_13130 1429 233 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence463 >Feature sequence464 >Feature sequence465 1244 561 gene locus_tag LOCUS_13140 1244 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_13140 <1853 1244 gene locus_tag LOCUS_13150 <1853 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004528372.1:NADH-quinone oxidoreductase subunit H >Feature sequence466 2 208 gene locus_tag LOCUS_13160 2 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 >Feature sequence467 763 1485 gene locus_tag LOCUS_13170 gene trmJ 763 1485 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113799.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence468 >Feature sequence469 >Feature sequence470 1841 744 gene locus_tag LOCUS_13180 gene pstC 1841 744 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence471 1102 173 gene locus_tag LOCUS_13190 1102 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286902.1 protein_id gnl|my_center|LOCUS_13190 1456 1115 gene locus_tag LOCUS_13200 1456 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence472 <1 573 gene locus_tag LOCUS_13210 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015866.1:dihydroxyacetone kinase subunit DhaL 1561 575 gene locus_tag LOCUS_13220 gene dhaK 1561 575 CDS product dihydroxyacetone kinase subunit DhaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528089.1 protein_id gnl|my_center|LOCUS_13220 1781 1578 gene locus_tag LOCUS_13230 1781 1578 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence473 697 161 gene locus_tag LOCUS_13240 697 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 792 1316 gene locus_tag LOCUS_13250 792 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 <1835 1317 gene locus_tag LOCUS_13260 <1835 1317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_234837589.1:molecular chaperone TorD family protein >Feature sequence474 >Feature sequence475 1258 527 gene locus_tag LOCUS_13270 1258 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence476 <1831 1075 gene locus_tag LOCUS_13280 <1831 1075 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114045.1:Xaa-Pro aminopeptidase >Feature sequence477 602 516 gene locus_tag LOCUS_t00190 602 516 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 658 1317 gene locus_tag LOCUS_13290 658 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1317 1808 gene locus_tag LOCUS_13300 1317 1808 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705368.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence478 1392 940 gene locus_tag LOCUS_13310 1392 940 CDS product SUF system Fe-S cluster assembly regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037893.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence479 >Feature sequence480 6 710 gene locus_tag LOCUS_13320 gene ybgF 6 710 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943188.1 protein_id gnl|my_center|LOCUS_13320 714 1358 gene locus_tag LOCUS_13330 gene queE 714 1358 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038131.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence481 >Feature sequence482 >Feature sequence483 234 413 gene locus_tag LOCUS_13340 234 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 1132 431 gene locus_tag LOCUS_13350 1132 431 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000352.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence484 >Feature sequence485 454 1500 gene locus_tag LOCUS_13360 454 1500 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence486 967 395 gene locus_tag LOCUS_13370 967 395 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007331723.1 protein_id gnl|my_center|LOCUS_13370 1794 964 gene locus_tag LOCUS_13380 1794 964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence487 >Feature sequence488 <1 1005 gene locus_tag LOCUS_13390 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005992021.1:Mu transposase C-terminal domain-containing protein note possible pseudo, internal stop codon 1087 1404 gene locus_tag LOCUS_13400 1087 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence489 323 120 gene locus_tag LOCUS_13410 323 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1529 345 gene locus_tag LOCUS_13420 gene alaC 1529 345 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947188.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence490 >Feature sequence491 1434 448 gene locus_tag LOCUS_13430 gene hemB 1434 448 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027069842.1 protein_id gnl|my_center|LOCUS_13430 >Feature sequence492 249 944 gene locus_tag LOCUS_13440 249 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 <1797 941 gene locus_tag LOCUS_13450 <1797 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957545.1:murein biosynthesis integral membrane protein MurJ >Feature sequence493 905 108 gene locus_tag LOCUS_13460 gene panB 905 108 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194137.1 protein_id gnl|my_center|LOCUS_13460 1390 902 gene locus_tag LOCUS_13470 gene folK 1390 902 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707280.1 protein_id gnl|my_center|LOCUS_13470 1794 1387 gene locus_tag LOCUS_13480 1794 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence494 150 980 gene locus_tag LOCUS_13490 gene dapF 150 980 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704447.1 protein_id gnl|my_center|LOCUS_13490 977 1678 gene locus_tag LOCUS_13500 977 1678 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence495 1601 846 gene locus_tag LOCUS_13510 1601 846 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266288.1 protein_id gnl|my_center|LOCUS_13510 1780 1601 gene locus_tag LOCUS_13520 1780 1601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence496 1 1206 gene locus_tag LOCUS_13530 1 1206 CDS product alpha-isopropylmalate synthase regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000169689.1 protein_id gnl|my_center|LOCUS_13530 1203 1496 gene locus_tag LOCUS_13540 1203 1496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence497 1 516 gene locus_tag LOCUS_13550 gene ampD 1 516 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000923703.1 protein_id gnl|my_center|LOCUS_13550 510 1271 gene locus_tag LOCUS_13560 510 1271 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268978.1 protein_id gnl|my_center|LOCUS_13560 >Feature sequence498 1542 226 gene locus_tag LOCUS_13570 1542 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1775 1560 gene locus_tag LOCUS_13580 1775 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence499 >Feature sequence500 1222 581 gene locus_tag LOCUS_13590 1222 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 <1772 1219 gene locus_tag LOCUS_13600 <1772 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263213.1:DUF1566 domain-containing protein >Feature sequence501 1256 294 gene locus_tag LOCUS_13610 1256 294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060827.1 protein_id gnl|my_center|LOCUS_13610 <1771 1253 gene locus_tag LOCUS_13620 <1771 1253 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943339.1:ABC transporter permease >Feature sequence502 906 133 gene locus_tag LOCUS_13630 906 133 CDS product DUF3450 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707199.1 protein_id gnl|my_center|LOCUS_13630 <1770 908 gene locus_tag LOCUS_13640 <1770 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461874.1:heavy metal translocating P-type ATPase >Feature sequence503 <1 1020 gene locus_tag LOCUS_13650 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256545.1:kelch repeat-containing protein <1767 1056 gene locus_tag LOCUS_13660 <1767 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207107.1:ion transporter >Feature sequence504 <1 1027 gene locus_tag LOCUS_13670 <1 1027 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986854.1:Fic family protein 1024 1743 gene locus_tag LOCUS_13680 gene rpe 1024 1743 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence505 1345 77 gene locus_tag LOCUS_13690 1345 77 CDS product phage portal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000523689.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence506 1683 1360 gene locus_tag LOCUS_13700 gene iscA 1683 1360 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000028953.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence507 1691 738 gene locus_tag LOCUS_13710 gene accD 1691 738 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104199.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence508 418 158 gene locus_tag LOCUS_13720 418 158 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125708.1 protein_id gnl|my_center|LOCUS_13720 1759 572 gene locus_tag LOCUS_13730 1759 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence509 <1761 770 gene locus_tag LOCUS_13740 <1761 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109023.1:4-hydroxythreonine-4-phosphate dehydrogenase PdxA >Feature sequence510 >Feature sequence511 >Feature sequence512 1297 95 gene locus_tag LOCUS_13750 gene ispG 1297 95 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810695.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence513 2 700 gene locus_tag LOCUS_13760 2 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 697 1518 gene locus_tag LOCUS_13770 697 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence514 >Feature sequence515 >Feature sequence516 1509 736 gene locus_tag LOCUS_13780 gene sufC 1509 736 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141371.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence517 148 489 gene locus_tag LOCUS_13790 148 489 CDS product zinc ribbon domain-containing protein YjdM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101229.1 protein_id gnl|my_center|LOCUS_13790 496 906 gene locus_tag LOCUS_13800 496 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence518 539 1102 gene locus_tag LOCUS_13810 539 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1198 1122 gene locus_tag LOCUS_t00200 1198 1122 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <1724 1212 gene locus_tag LOCUS_13820 <1724 1212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003381308.1:polyprenyl synthetase family protein >Feature sequence519 >Feature sequence520 883 197 gene locus_tag LOCUS_13830 883 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 1617 880 gene locus_tag LOCUS_13840 1617 880 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196311.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence521 <1 1363 gene locus_tag LOCUS_13850 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269402.1:sodium-extruding oxaloacetate decarboxylase subunit alpha >Feature sequence522 <1717 421 gene locus_tag LOCUS_13860 <1717 421 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958000.1:NAD(P)H-hydrate dehydratase >Feature sequence523 >Feature sequence524 404 1138 gene locus_tag LOCUS_13870 404 1138 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence525 176 451 gene locus_tag LOCUS_13880 gene rpsT 176 451 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117906.1 protein_id gnl|my_center|LOCUS_13880 1639 515 gene locus_tag LOCUS_13890 gene proB 1639 515 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094756.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence526 285 1403 gene locus_tag LOCUS_13900 285 1403 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880692.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence527 174 1529 gene locus_tag LOCUS_13910 174 1529 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044950.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence528 1460 1173 gene locus_tag LOCUS_13920 gene gatC 1460 1173 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence529 >Feature sequence530 <1684 920 gene locus_tag LOCUS_13930 <1684 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769976.1:glycine--tRNA ligase subunit alpha >Feature sequence531 304 1665 gene locus_tag LOCUS_13940 gene glrR 304 1665 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703177.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence532 1656 160 gene locus_tag LOCUS_13950 1656 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 >Feature sequence533 1112 387 gene locus_tag LOCUS_13960 gene proC 1112 387 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13960 1484 1251 gene locus_tag LOCUS_13970 1484 1251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence534 496 783 gene locus_tag LOCUS_13980 496 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 839 1199 gene locus_tag LOCUS_tm00010 839 1199 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1261 1512 gene locus_tag LOCUS_13990 1261 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence535 55 318 gene locus_tag LOCUS_14000 55 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 305 724 gene locus_tag LOCUS_14010 305 724 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181771.1 protein_id gnl|my_center|LOCUS_14010 1080 1640 gene locus_tag LOCUS_14020 1080 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14020 >Feature sequence536 798 238 gene locus_tag LOCUS_14030 gene folE 798 238 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011216616.1 protein_id gnl|my_center|LOCUS_14030 >Feature sequence537 >Feature sequence538 >Feature sequence539 >Feature sequence540 1586 909 gene locus_tag LOCUS_14040 1586 909 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010777.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence541 764 189 gene locus_tag LOCUS_14050 764 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence542 >Feature sequence543 <1 798 gene locus_tag LOCUS_14060 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772919.1:peptide chain release factor 1 >Feature sequence544 >Feature sequence545 322 17 gene locus_tag LOCUS_14070 gene merP 322 17 CDS product mercury resistance system periplasmic binding protein MerP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000732292.1 protein_id gnl|my_center|LOCUS_14070 723 340 gene locus_tag LOCUS_14080 723 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1171 776 gene locus_tag LOCUS_14090 gene zntR 1171 776 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174611.1 protein_id gnl|my_center|LOCUS_14090 1620 1159 gene locus_tag LOCUS_14100 1620 1159 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880938.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence546 773 39 gene locus_tag LOCUS_14110 773 39 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528736.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence547 1142 621 gene locus_tag LOCUS_14120 1142 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence548 130 858 gene locus_tag LOCUS_14130 gene pyrH 130 858 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_14130 851 1408 gene locus_tag LOCUS_14140 gene frr 851 1408 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence549 >Feature sequence550 >Feature sequence551 342 770 gene locus_tag LOCUS_14150 gene rplM 342 770 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073682.1 protein_id gnl|my_center|LOCUS_14150 781 1176 gene locus_tag LOCUS_14160 gene rpsI 781 1176 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005631594.1 protein_id gnl|my_center|LOCUS_14160 1188 1261 gene locus_tag LOCUS_t00210 1188 1261 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence552 311 1024 gene locus_tag LOCUS_14170 gene pgl 311 1024 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence553 <1 975 gene locus_tag LOCUS_14180 <1 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444186.1:SulP family inorganic anion transporter 950 1588 gene locus_tag LOCUS_14190 gene can 950 1588 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence554 <1596 394 gene locus_tag LOCUS_14200 <1596 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004197731.1:nitrite reductase large subunit NirB >Feature sequence555 151 567 gene locus_tag LOCUS_14210 gene nsrR 151 567 CDS product nitric oxide-sensing transcriptional repressor NsrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245378.1 protein_id gnl|my_center|LOCUS_14210 >Feature sequence556 1314 493 gene locus_tag LOCUS_14220 1314 493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011728387.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence557 <1592 662 gene locus_tag LOCUS_14230 <1592 662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390842.1:putative O-glycosylation ligase, exosortase A system-associated >Feature sequence558 >Feature sequence559 >Feature sequence560 397 843 gene locus_tag LOCUS_14240 397 843 CDS product TIGR03751 family conjugal transfer lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038861.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence561 973 629 gene locus_tag LOCUS_14250 973 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1186 977 gene locus_tag LOCUS_14260 1186 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence562 >Feature sequence563 198 1388 gene locus_tag LOCUS_14270 198 1388 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476620.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence564 213 914 gene locus_tag LOCUS_14280 gene dnaQ 213 914 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087958.1 protein_id gnl|my_center|LOCUS_14280 953 1040 gene locus_tag LOCUS_t00220 953 1040 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence565 >Feature sequence566 705 385 gene locus_tag LOCUS_14290 gene mazF9 705 385 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_14290 922 692 gene locus_tag LOCUS_14300 922 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1445 981 gene locus_tag LOCUS_14310 1445 981 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407330.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence567 >Feature sequence568 347 733 gene locus_tag LOCUS_14320 347 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 931 1404 gene locus_tag LOCUS_14330 931 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence569 <1570 729 gene locus_tag LOCUS_14340 <1570 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071681.1:glucose-1-phosphate adenylyltransferase >Feature sequence570 451 179 gene locus_tag LOCUS_14350 451 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 840 448 gene locus_tag LOCUS_14360 840 448 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000126719.1 protein_id gnl|my_center|LOCUS_14360 1265 843 gene locus_tag LOCUS_14370 1265 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence571 1166 300 gene locus_tag LOCUS_14380 1166 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence572 <1 658 gene locus_tag LOCUS_14390 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037226281.1:glycosyltransferase family 4 protein >Feature sequence573 1133 261 gene locus_tag LOCUS_14400 1133 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 >Feature sequence574 <1546 442 gene locus_tag LOCUS_14410 <1546 442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004406264.1:succinyldiaminopimelate transaminase >Feature sequence575 115 1170 gene locus_tag LOCUS_14420 115 1170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 >Feature sequence576 1061 708 gene locus_tag LOCUS_14430 1061 708 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence577 <1 563 gene locus_tag LOCUS_14440 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071948.1:energy transducer TonB >Feature sequence578 187 849 gene locus_tag LOCUS_14450 187 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence579 78 542 gene locus_tag LOCUS_14460 78 542 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence580 1072 236 gene locus_tag LOCUS_14470 1072 236 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094343.1 protein_id gnl|my_center|LOCUS_14470 >Feature sequence581 >Feature sequence582 239 586 gene locus_tag LOCUS_14480 gene hinT 239 586 CDS product purine nucleoside phosphoramidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461572.1 protein_id gnl|my_center|LOCUS_14480 <1522 629 gene locus_tag LOCUS_14490 <1522 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005175670.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence583 1488 904 gene locus_tag LOCUS_14500 1488 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 >Feature sequence584 >Feature sequence585 417 1025 gene locus_tag LOCUS_14510 gene nqrE 417 1025 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091182.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence586 516 121 gene locus_tag LOCUS_14520 gene zntR 516 121 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309469.1 protein_id gnl|my_center|LOCUS_14520 1465 494 gene locus_tag LOCUS_14530 1465 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence587 >Feature sequence588 74 511 gene locus_tag LOCUS_14540 74 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence589 <1515 513 gene locus_tag LOCUS_14550 <1515 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032828680.1:ABC transporter substrate-binding protein >Feature sequence590 185 95 gene locus_tag LOCUS_t00230 185 95 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 <1515 233 gene locus_tag LOCUS_14560 <1515 233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986802.1:L,D-transpeptidase family protein >Feature sequence591 245 1420 gene locus_tag LOCUS_14570 245 1420 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039570.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence592 1020 361 gene locus_tag LOCUS_14580 1020 361 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941521.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence593 >Feature sequence594 1509 478 gene locus_tag LOCUS_14590 1509 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence595 415 1110 gene locus_tag LOCUS_14600 gene rplA 415 1110 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262793.1 protein_id gnl|my_center|LOCUS_14600 >Feature sequence596 >Feature sequence597 >Feature sequence598