>Feature sequence001 <1 733 gene locus_tag LOCUS_00010 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048114.1:polysaccharide biosynthesis C-terminal domain-containing protein 726 2021 gene locus_tag LOCUS_00020 726 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026823914.1 protein_id gnl|my_center|LOCUS_00020 2215 2018 gene locus_tag LOCUS_00030 2215 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2549 2208 gene locus_tag LOCUS_00040 2549 2208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 2642 2571 gene locus_tag LOCUS_t00010 2642 2571 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2846 4072 gene locus_tag LOCUS_00050 2846 4072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4059 4823 gene locus_tag LOCUS_00060 4059 4823 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080966.1 protein_id gnl|my_center|LOCUS_00060 5048 4851 gene locus_tag LOCUS_00070 5048 4851 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005900759.1 protein_id gnl|my_center|LOCUS_00070 5130 5675 gene locus_tag LOCUS_00080 gene thpR 5130 5675 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870382.1 protein_id gnl|my_center|LOCUS_00080 5730 6800 gene locus_tag LOCUS_00090 5730 6800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 6797 9403 gene locus_tag LOCUS_00100 6797 9403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9422 10087 gene locus_tag LOCUS_00110 9422 10087 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887101.1 protein_id gnl|my_center|LOCUS_00110 10090 10554 gene locus_tag LOCUS_00120 10090 10554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 10557 10994 gene locus_tag LOCUS_00130 10557 10994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 11014 12165 gene locus_tag LOCUS_00140 11014 12165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12194 13087 gene locus_tag LOCUS_00150 12194 13087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 13102 13608 gene locus_tag LOCUS_00160 13102 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 13738 14610 gene locus_tag LOCUS_00170 13738 14610 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545362.1 protein_id gnl|my_center|LOCUS_00170 14607 15356 gene locus_tag LOCUS_00180 14607 15356 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405213.1 protein_id gnl|my_center|LOCUS_00180 15375 16334 gene locus_tag LOCUS_00190 15375 16334 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048247.1 protein_id gnl|my_center|LOCUS_00190 16347 17828 gene locus_tag LOCUS_00200 gene hutH 16347 17828 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000631874.1 protein_id gnl|my_center|LOCUS_00200 17879 18511 gene locus_tag LOCUS_00210 17879 18511 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_00210 18511 18948 gene locus_tag LOCUS_00220 18511 18948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 18948 19358 gene locus_tag LOCUS_00230 18948 19358 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000053705.1 protein_id gnl|my_center|LOCUS_00230 19364 20029 gene locus_tag LOCUS_00240 19364 20029 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179862255.1 protein_id gnl|my_center|LOCUS_00240 >Feature sequence002 178 354 gene locus_tag LOCUS_00250 178 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 329 613 gene locus_tag LOCUS_00260 329 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 691 1026 gene locus_tag LOCUS_00270 691 1026 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003534198.1 protein_id gnl|my_center|LOCUS_00270 1043 1783 gene locus_tag LOCUS_00280 1043 1783 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113379.1 protein_id gnl|my_center|LOCUS_00280 1786 2283 gene locus_tag LOCUS_00290 1786 2283 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208547.1 protein_id gnl|my_center|LOCUS_00290 2305 3396 gene locus_tag LOCUS_00300 gene gcvT 2305 3396 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082884.1 protein_id gnl|my_center|LOCUS_00300 3428 4519 gene locus_tag LOCUS_00310 3428 4519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 4528 6513 gene locus_tag LOCUS_00320 4528 6513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 6510 7442 gene locus_tag LOCUS_00330 gene meaB 6510 7442 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867373.1 protein_id gnl|my_center|LOCUS_00330 9816 7795 gene locus_tag LOCUS_00340 9816 7795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 10318 9860 gene locus_tag LOCUS_00350 10318 9860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 10359 11462 gene locus_tag LOCUS_00360 10359 11462 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_00360 11804 12079 gene locus_tag LOCUS_00370 11804 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 12101 13690 gene locus_tag LOCUS_00380 12101 13690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 14594 13692 gene locus_tag LOCUS_00390 14594 13692 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_00390 15249 14596 gene locus_tag LOCUS_00400 15249 14596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 15543 16757 gene locus_tag LOCUS_00410 15543 16757 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963126.1 protein_id gnl|my_center|LOCUS_00410 16768 17355 gene locus_tag LOCUS_00420 16768 17355 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123705.1 protein_id gnl|my_center|LOCUS_00420 17658 18002 gene locus_tag LOCUS_00430 17658 18002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 18100 19422 gene locus_tag LOCUS_00440 gene dnaA 18100 19422 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_00440 20276 19416 gene locus_tag LOCUS_00450 gene rsgA 20276 19416 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865389.1 protein_id gnl|my_center|LOCUS_00450 >Feature sequence003 2046 241 gene locus_tag LOCUS_00460 2046 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 2175 3173 gene locus_tag LOCUS_00470 2175 3173 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_00470 3151 4020 gene locus_tag LOCUS_00480 3151 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 4046 4423 gene locus_tag LOCUS_00490 4046 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 6957 6055 gene locus_tag LOCUS_00500 6957 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 8187 7159 gene locus_tag LOCUS_00510 8187 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 9451 8294 gene locus_tag LOCUS_00520 9451 8294 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250397.1 protein_id gnl|my_center|LOCUS_00520 10362 9448 gene locus_tag LOCUS_00530 10362 9448 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 protein_id gnl|my_center|LOCUS_00530 11222 10359 gene locus_tag LOCUS_00540 11222 10359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 11301 11936 gene locus_tag LOCUS_00550 11301 11936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 12315 13418 gene locus_tag LOCUS_00560 12315 13418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 13333 15180 gene locus_tag LOCUS_00570 13333 15180 CDS product glutamate mutase L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256160.1 protein_id gnl|my_center|LOCUS_00570 15276 16148 gene locus_tag LOCUS_00580 gene murB 15276 16148 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880303.1 protein_id gnl|my_center|LOCUS_00580 16145 17383 gene locus_tag LOCUS_00590 gene ftsA 16145 17383 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656287.1 protein_id gnl|my_center|LOCUS_00590 17408 18532 gene locus_tag LOCUS_00600 gene ftsZ 17408 18532 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880307.1 protein_id gnl|my_center|LOCUS_00600 18520 19803 gene locus_tag LOCUS_00610 gene hisS 18520 19803 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679075.1 protein_id gnl|my_center|LOCUS_00610 20381 19782 gene locus_tag LOCUS_00620 20381 19782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 20472 20290 gene locus_tag LOCUS_00630 20472 20290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 >Feature sequence004 207 2003 gene locus_tag LOCUS_00640 207 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 3754 2432 gene locus_tag LOCUS_00650 gene der 3754 2432 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881253.1 protein_id gnl|my_center|LOCUS_00650 4176 3697 gene locus_tag LOCUS_00660 4176 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 5729 4179 gene locus_tag LOCUS_00670 5729 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 6357 5719 gene locus_tag LOCUS_00680 gene tmk 6357 5719 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715592.1 protein_id gnl|my_center|LOCUS_00680 7437 6358 gene locus_tag LOCUS_00690 7437 6358 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994459.1 protein_id gnl|my_center|LOCUS_00690 8930 7545 gene locus_tag LOCUS_00700 8930 7545 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930810.1 protein_id gnl|my_center|LOCUS_00700 9603 8947 gene locus_tag LOCUS_00710 9603 8947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 9752 10837 gene locus_tag LOCUS_00720 gene waaA 9752 10837 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444132.1 protein_id gnl|my_center|LOCUS_00720 12728 10854 gene locus_tag LOCUS_00730 12728 10854 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_00730 13169 12945 gene locus_tag LOCUS_00740 13169 12945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 13576 13190 gene locus_tag LOCUS_00750 13576 13190 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888250.1 protein_id gnl|my_center|LOCUS_00750 14441 13887 gene locus_tag LOCUS_00760 14441 13887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 14748 14428 gene locus_tag LOCUS_00770 14748 14428 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249651.1 protein_id gnl|my_center|LOCUS_00770 <15866 14745 gene locus_tag LOCUS_00780 <15866 14745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081488.1:tyrosine--tRNA ligase >Feature sequence005 2054 492 gene locus_tag LOCUS_00790 gene pruA 2054 492 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243454.1 protein_id gnl|my_center|LOCUS_00790 3989 2523 gene locus_tag LOCUS_00800 gene accC 3989 2523 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761157.1 protein_id gnl|my_center|LOCUS_00800 4285 7776 gene locus_tag LOCUS_00810 4285 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 7815 8207 gene locus_tag LOCUS_00820 7815 8207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 8567 9316 gene locus_tag LOCUS_00830 8567 9316 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189750.1 protein_id gnl|my_center|LOCUS_00830 9330 10301 gene locus_tag LOCUS_00840 9330 10301 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000072965.1 protein_id gnl|my_center|LOCUS_00840 10301 11683 gene locus_tag LOCUS_00850 10301 11683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 11717 11965 gene locus_tag LOCUS_00860 11717 11965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 11967 12206 gene locus_tag LOCUS_00870 11967 12206 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547534.1 protein_id gnl|my_center|LOCUS_00870 12199 12702 gene locus_tag LOCUS_00880 gene rimM 12199 12702 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583885.1 protein_id gnl|my_center|LOCUS_00880 12795 14210 gene locus_tag LOCUS_00890 gene pyk 12795 14210 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_00890 14395 14739 gene locus_tag LOCUS_00900 14395 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 >Feature sequence006 81 1442 gene locus_tag LOCUS_00910 81 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 1461 2747 gene locus_tag LOCUS_00920 gene pdhC 1461 2747 CDS product pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000863430.1 protein_id gnl|my_center|LOCUS_00920 2786 3178 gene locus_tag LOCUS_00930 2786 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 3178 3546 gene locus_tag LOCUS_00940 3178 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3618 4430 gene locus_tag LOCUS_00950 3618 4430 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479789.1 protein_id gnl|my_center|LOCUS_00950 5014 4454 gene locus_tag LOCUS_00960 5014 4454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 5392 6456 gene locus_tag LOCUS_00970 5392 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 6521 6593 gene locus_tag LOCUS_t00020 6521 6593 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6629 7018 gene locus_tag LOCUS_00980 gene rplS 6629 7018 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228391.1 protein_id gnl|my_center|LOCUS_00980 7045 7488 gene locus_tag LOCUS_00990 gene tsaE 7045 7488 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476188.1 protein_id gnl|my_center|LOCUS_00990 7547 8629 gene locus_tag LOCUS_01000 gene dnaN 7547 8629 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143222.1 protein_id gnl|my_center|LOCUS_01000 8632 9303 gene locus_tag LOCUS_01010 gene clpP 8632 9303 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081059.1 protein_id gnl|my_center|LOCUS_01010 9306 10544 gene locus_tag LOCUS_01020 gene clpX 9306 10544 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_01020 10558 11811 gene locus_tag LOCUS_01030 gene hflX 10558 11811 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016249.1 protein_id gnl|my_center|LOCUS_01030 11837 12034 gene locus_tag LOCUS_01040 11837 12034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 12388 13725 gene locus_tag LOCUS_01050 12388 13725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 >Feature sequence007 625 3159 gene locus_tag LOCUS_01060 625 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3199 3936 gene locus_tag LOCUS_01070 3199 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 5429 3948 gene locus_tag LOCUS_01080 5429 3948 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_01080 6919 5525 gene locus_tag LOCUS_01090 6919 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 7310 6972 gene locus_tag LOCUS_01100 7310 6972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 8167 7313 gene locus_tag LOCUS_01110 gene rfbD 8167 7313 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_01110 9248 8142 gene locus_tag LOCUS_01120 gene wecB 9248 8142 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_01120 9296 11911 gene locus_tag LOCUS_01130 gene leuS 9296 11911 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227747.1 protein_id gnl|my_center|LOCUS_01130 11949 12686 gene locus_tag LOCUS_01140 11949 12686 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842263.1 protein_id gnl|my_center|LOCUS_01140 12689 13297 gene locus_tag LOCUS_01150 12689 13297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 13953 13333 gene locus_tag LOCUS_01160 13953 13333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881344.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence008 753 97 gene locus_tag LOCUS_01170 gene fsa 753 97 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083013.1 protein_id gnl|my_center|LOCUS_01170 907 1530 gene locus_tag LOCUS_01180 907 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 1590 2585 gene locus_tag LOCUS_01190 1590 2585 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_01190 2643 2852 gene locus_tag LOCUS_01200 2643 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 2806 4242 gene locus_tag LOCUS_01210 2806 4242 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582600.1 protein_id gnl|my_center|LOCUS_01210 4239 4967 gene locus_tag LOCUS_01220 4239 4967 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228854.1 protein_id gnl|my_center|LOCUS_01220 4977 5933 gene locus_tag LOCUS_01230 4977 5933 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460383.1 protein_id gnl|my_center|LOCUS_01230 6211 6522 gene locus_tag LOCUS_01240 6211 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 7604 6516 gene locus_tag LOCUS_01250 7604 6516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 8649 7651 gene locus_tag LOCUS_01260 8649 7651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 9629 8697 gene locus_tag LOCUS_01270 9629 8697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 10511 9633 gene locus_tag LOCUS_01280 10511 9633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 10952 10536 gene locus_tag LOCUS_01290 gene cdd 10952 10536 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080780.1 protein_id gnl|my_center|LOCUS_01290 11335 10910 gene locus_tag LOCUS_01300 11335 10910 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249283.1 protein_id gnl|my_center|LOCUS_01300 12229 13521 gene locus_tag LOCUS_01310 12229 13521 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977149.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence009 <1 4184 gene locus_tag LOCUS_01320 <1 4184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707240.1:retention module-containing protein 5093 4218 gene locus_tag LOCUS_01330 5093 4218 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000802593.1 protein_id gnl|my_center|LOCUS_01330 5208 5954 gene locus_tag LOCUS_01340 5208 5954 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_01340 6256 7017 gene locus_tag LOCUS_01350 6256 7017 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 protein_id gnl|my_center|LOCUS_01350 7020 7994 gene locus_tag LOCUS_01360 7020 7994 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103450.1 protein_id gnl|my_center|LOCUS_01360 8477 8025 gene locus_tag LOCUS_01370 gene rpiB 8477 8025 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_01370 9280 8630 gene locus_tag LOCUS_01380 9280 8630 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159394.1 protein_id gnl|my_center|LOCUS_01380 10242 9280 gene locus_tag LOCUS_01390 gene lepB 10242 9280 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_01390 11090 10239 gene locus_tag LOCUS_01400 gene folD 11090 10239 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_01400 11186 11545 gene locus_tag LOCUS_01410 11186 11545 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235932.1 protein_id gnl|my_center|LOCUS_01410 11532 12266 gene locus_tag LOCUS_01420 11532 12266 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_01420 12303 12839 gene locus_tag LOCUS_01430 12303 12839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 >Feature sequence010 3475 1475 gene locus_tag LOCUS_01440 3475 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 3642 5351 gene locus_tag LOCUS_01450 3642 5351 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880592.1 protein_id gnl|my_center|LOCUS_01450 5721 5362 gene locus_tag LOCUS_01460 5721 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 6846 5908 gene locus_tag LOCUS_01470 6846 5908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 8288 6885 gene locus_tag LOCUS_01480 8288 6885 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_01480 8609 8292 gene locus_tag LOCUS_01490 8609 8292 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920741.1 protein_id gnl|my_center|LOCUS_01490 9715 8606 gene locus_tag LOCUS_01500 9715 8606 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174136.1 protein_id gnl|my_center|LOCUS_01500 10449 9781 gene locus_tag LOCUS_01510 gene ubiE 10449 9781 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941531.1 protein_id gnl|my_center|LOCUS_01510 10663 12423 gene locus_tag LOCUS_01520 10663 12423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 12495 12568 gene locus_tag LOCUS_t00030 12495 12568 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12580 12651 gene locus_tag LOCUS_t00040 12580 12651 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence011 <1 589 gene locus_tag LOCUS_01530 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227748.1:30S ribosomal protein S1 650 1873 gene locus_tag LOCUS_01540 gene mtaB 650 1873 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545970.1 protein_id gnl|my_center|LOCUS_01540 1899 2156 gene locus_tag LOCUS_01550 1899 2156 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_01550 2196 3986 gene locus_tag LOCUS_01560 2196 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 4497 4409 gene locus_tag LOCUS_t00050 4497 4409 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4693 4857 gene locus_tag LOCUS_01570 4693 4857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 4850 5317 gene locus_tag LOCUS_01580 4850 5317 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_01580 5304 6980 gene locus_tag LOCUS_01590 5304 6980 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930821.1 protein_id gnl|my_center|LOCUS_01590 7020 7892 gene locus_tag LOCUS_01600 gene cyoE 7020 7892 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722694.1 protein_id gnl|my_center|LOCUS_01600 9247 7889 gene locus_tag LOCUS_01610 9247 7889 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_01610 9863 9279 gene locus_tag LOCUS_01620 9863 9279 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393578.1 protein_id gnl|my_center|LOCUS_01620 12072 9946 gene locus_tag LOCUS_01630 12072 9946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 >Feature sequence012 <1 777 gene locus_tag LOCUS_01640 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707428.1:aspartate kinase 1712 771 gene locus_tag LOCUS_01650 1712 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 2187 2816 gene locus_tag LOCUS_01660 2187 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 2818 3501 gene locus_tag LOCUS_01670 2818 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 3498 3797 gene locus_tag LOCUS_01680 3498 3797 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763041.1 protein_id gnl|my_center|LOCUS_01680 3871 4257 gene locus_tag LOCUS_01690 3871 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 4254 4688 gene locus_tag LOCUS_01700 4254 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 4706 5080 gene locus_tag LOCUS_01710 4706 5080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 5770 5081 gene locus_tag LOCUS_01720 5770 5081 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583690.1 protein_id gnl|my_center|LOCUS_01720 6714 5767 gene locus_tag LOCUS_01730 6714 5767 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_01730 6994 6719 gene locus_tag LOCUS_01740 6994 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8405 7014 gene locus_tag LOCUS_01750 8405 7014 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_01750 9082 8384 gene locus_tag LOCUS_01760 9082 8384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 9771 9079 gene locus_tag LOCUS_01770 9771 9079 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904152.1 protein_id gnl|my_center|LOCUS_01770 10652 9768 gene locus_tag LOCUS_01780 10652 9768 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880033.1 protein_id gnl|my_center|LOCUS_01780 11828 10689 gene locus_tag LOCUS_01790 gene ald 11828 10689 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583412.1 protein_id gnl|my_center|LOCUS_01790 >Feature sequence013 551 213 gene locus_tag LOCUS_01800 551 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 1020 559 gene locus_tag LOCUS_01810 1020 559 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_01810 3058 1061 gene locus_tag LOCUS_01820 3058 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4712 3576 gene locus_tag LOCUS_01830 gene rodA 4712 3576 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546334.1 protein_id gnl|my_center|LOCUS_01830 6283 4688 gene locus_tag LOCUS_01840 gene mrdA 6283 4688 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_01840 6663 6268 gene locus_tag LOCUS_01850 6663 6268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 7066 6674 gene locus_tag LOCUS_01860 7066 6674 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_01860 7117 7953 gene locus_tag LOCUS_01870 gene dat 7117 7953 CDS product D-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000411084.1 protein_id gnl|my_center|LOCUS_01870 9073 7955 gene locus_tag LOCUS_01880 9073 7955 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460037.1 protein_id gnl|my_center|LOCUS_01880 9399 9782 gene locus_tag LOCUS_01890 9399 9782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 10290 9814 gene locus_tag LOCUS_01900 10290 9814 CDS product superoxide dismutase [Ni] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047814912.1 protein_id gnl|my_center|LOCUS_01900 10920 10336 gene locus_tag LOCUS_01910 10920 10336 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732447.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence014 122 715 gene locus_tag LOCUS_01920 122 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 733 951 gene locus_tag LOCUS_01930 gene infA 733 951 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003638082.1 protein_id gnl|my_center|LOCUS_01930 1013 1367 gene locus_tag LOCUS_tm00010 1013 1367 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1508 1580 gene locus_tag LOCUS_t00060 1508 1580 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2440 1649 gene locus_tag LOCUS_01940 2440 1649 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144264.1 protein_id gnl|my_center|LOCUS_01940 4886 2490 gene locus_tag LOCUS_01950 gene rad50 4886 2490 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251161.1 protein_id gnl|my_center|LOCUS_01950 6036 4858 gene locus_tag LOCUS_01960 6036 4858 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870840.1 protein_id gnl|my_center|LOCUS_01960 6288 6917 gene locus_tag LOCUS_01970 6288 6917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 6936 8237 gene locus_tag LOCUS_01980 6936 8237 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545535.1 protein_id gnl|my_center|LOCUS_01980 8891 8262 gene locus_tag LOCUS_01990 8891 8262 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880973.1 protein_id gnl|my_center|LOCUS_01990 9367 9008 gene locus_tag LOCUS_02000 9367 9008 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920154.1 protein_id gnl|my_center|LOCUS_02000 9843 9364 gene locus_tag LOCUS_02010 9843 9364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 10345 9851 gene locus_tag LOCUS_02020 10345 9851 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880689.1 protein_id gnl|my_center|LOCUS_02020 <12319 10385 gene locus_tag LOCUS_02030 <12319 10385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546193.1:isoleucine--tRNA ligase >Feature sequence015 <1 1542 gene locus_tag LOCUS_02040 <1 1542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404985.1:Na-K-Cl cotransporter 2736 1753 gene locus_tag LOCUS_02050 2736 1753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 2816 3412 gene locus_tag LOCUS_02060 2816 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 3465 4568 gene locus_tag LOCUS_02070 gene ispG 3465 4568 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629734.1 protein_id gnl|my_center|LOCUS_02070 4534 5673 gene locus_tag LOCUS_02080 4534 5673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 7340 5691 gene locus_tag LOCUS_02090 gene rpoD 7340 5691 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880967.1 protein_id gnl|my_center|LOCUS_02090 8947 7340 gene locus_tag LOCUS_02100 8947 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 8991 10124 gene locus_tag LOCUS_02110 8991 10124 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496958.1 protein_id gnl|my_center|LOCUS_02110 <11626 10149 gene locus_tag LOCUS_02120 <11626 10149 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249997.1:DNRLRE domain-containing protein >Feature sequence016 1079 777 gene locus_tag LOCUS_02130 1079 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1976 1098 gene locus_tag LOCUS_02140 1976 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 3088 1973 gene locus_tag LOCUS_02150 3088 1973 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931023.1 protein_id gnl|my_center|LOCUS_02150 3465 3073 gene locus_tag LOCUS_02160 gene ybeY 3465 3073 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583684.1 protein_id gnl|my_center|LOCUS_02160 5365 3458 gene locus_tag LOCUS_02170 5365 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 6278 5349 gene locus_tag LOCUS_02180 6278 5349 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228398.1 protein_id gnl|my_center|LOCUS_02180 6999 6322 gene locus_tag LOCUS_02190 6999 6322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7804 7025 gene locus_tag LOCUS_02200 7804 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 8023 9519 gene locus_tag LOCUS_02210 8023 9519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 9549 10847 gene locus_tag LOCUS_02220 gene purB 9549 10847 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080360.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence017 1668 583 gene locus_tag LOCUS_02230 1668 583 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986870.1 protein_id gnl|my_center|LOCUS_02230 1846 1679 gene locus_tag LOCUS_02240 1846 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 2173 1976 gene locus_tag LOCUS_02250 2173 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 2322 2591 gene locus_tag LOCUS_02260 2322 2591 CDS product YfiM family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816956.1 protein_id gnl|my_center|LOCUS_02260 4058 2592 gene locus_tag LOCUS_02270 4058 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 4452 4069 gene locus_tag LOCUS_02280 4452 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4849 7185 gene locus_tag LOCUS_02290 4849 7185 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963833.1 protein_id gnl|my_center|LOCUS_02290 7349 7852 gene locus_tag LOCUS_02300 7349 7852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 7855 9312 gene locus_tag LOCUS_02310 7855 9312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 9346 10248 gene locus_tag LOCUS_02320 9346 10248 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_02320 <11053 10267 gene locus_tag LOCUS_02330 <11053 10267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266682.1:alkaline phosphatase D family protein >Feature sequence018 561 1286 gene locus_tag LOCUS_02340 gene mazG 561 1286 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_02340 1283 2209 gene locus_tag LOCUS_02350 1283 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 2280 2915 gene locus_tag LOCUS_02360 2280 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 3071 3907 gene locus_tag LOCUS_02370 gene arcC 3071 3907 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_02370 4431 3916 gene locus_tag LOCUS_02380 4431 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 5574 4450 gene locus_tag LOCUS_02390 5574 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963909.1 protein_id gnl|my_center|LOCUS_02390 7651 5594 gene locus_tag LOCUS_02400 gene recG 7651 5594 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545417.1 protein_id gnl|my_center|LOCUS_02400 8530 7988 gene locus_tag LOCUS_02410 8530 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 9722 8580 gene locus_tag LOCUS_02420 9722 8580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9836 10099 gene locus_tag LOCUS_02430 9836 10099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 >Feature sequence019 791 1135 gene locus_tag LOCUS_02440 791 1135 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118979.1 protein_id gnl|my_center|LOCUS_02440 2752 1556 gene locus_tag LOCUS_02450 2752 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 3525 2755 gene locus_tag LOCUS_02460 3525 2755 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_02460 3936 3550 gene locus_tag LOCUS_02470 3936 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 5042 3939 gene locus_tag LOCUS_02480 5042 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 6349 5039 gene locus_tag LOCUS_02490 6349 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 6939 6346 gene locus_tag LOCUS_02500 6939 6346 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_02500 7425 6961 gene locus_tag LOCUS_02510 7425 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 8665 7442 gene locus_tag LOCUS_02520 8665 7442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 8699 9688 gene locus_tag LOCUS_02530 8699 9688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 10143 9685 gene locus_tag LOCUS_02540 10143 9685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 10251 10439 gene locus_tag LOCUS_02550 10251 10439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 >Feature sequence020 1531 221 gene locus_tag LOCUS_02560 1531 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 1994 1557 gene locus_tag LOCUS_02570 1994 1557 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583662.1 protein_id gnl|my_center|LOCUS_02570 2884 1991 gene locus_tag LOCUS_02580 2884 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4492 2915 gene locus_tag LOCUS_02590 4492 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 7430 4560 gene locus_tag LOCUS_02600 7430 4560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 8491 7427 gene locus_tag LOCUS_02610 8491 7427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 9642 8494 gene locus_tag LOCUS_02620 9642 8494 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582740.1 protein_id gnl|my_center|LOCUS_02620 9908 9833 gene locus_tag LOCUS_t00070 9908 9833 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10153 9899 gene locus_tag LOCUS_02630 10153 9899 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832208.1 protein_id gnl|my_center|LOCUS_02630 10233 10160 gene locus_tag LOCUS_t00080 10233 10160 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence021 513 692 gene locus_tag LOCUS_02640 513 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1096 701 gene locus_tag LOCUS_02650 1096 701 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962885.1 protein_id gnl|my_center|LOCUS_02650 1385 4075 gene locus_tag LOCUS_02660 1385 4075 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015981.1 protein_id gnl|my_center|LOCUS_02660 4280 5437 gene locus_tag LOCUS_02670 4280 5437 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228614.1 protein_id gnl|my_center|LOCUS_02670 5444 5641 gene locus_tag LOCUS_02680 5444 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 5735 7069 gene locus_tag LOCUS_02690 5735 7069 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012896133.1 protein_id gnl|my_center|LOCUS_02690 7113 7469 gene locus_tag LOCUS_02700 7113 7469 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_02700 7474 8064 gene locus_tag LOCUS_02710 7474 8064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 8061 8540 gene locus_tag LOCUS_02720 8061 8540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 9392 8667 gene locus_tag LOCUS_02730 gene fabG 9392 8667 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099550.1 protein_id gnl|my_center|LOCUS_02730 <10300 9442 gene locus_tag LOCUS_02740 <10300 9442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880276.1:phosphopyruvate hydratase >Feature sequence022 291 671 gene locus_tag LOCUS_02750 291 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 673 1068 gene locus_tag LOCUS_02760 673 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 1055 1648 gene locus_tag LOCUS_02770 1055 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 1623 1928 gene locus_tag LOCUS_02780 1623 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 4395 1930 gene locus_tag LOCUS_02790 gene mutS 4395 1930 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545203.1 protein_id gnl|my_center|LOCUS_02790 4860 5273 gene locus_tag LOCUS_02800 4860 5273 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_02800 5245 5514 gene locus_tag LOCUS_02810 5245 5514 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878321.1 protein_id gnl|my_center|LOCUS_02810 5583 7304 gene locus_tag LOCUS_02820 5583 7304 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_02820 7315 7776 gene locus_tag LOCUS_02830 7315 7776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 7769 8107 gene locus_tag LOCUS_02840 7769 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 8120 8974 gene locus_tag LOCUS_02850 gene sdhB 8120 8974 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_02850 8975 10117 gene locus_tag LOCUS_02860 8975 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 >Feature sequence023 1059 1424 gene locus_tag LOCUS_02870 1059 1424 CDS product DUF2089 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966283.1 protein_id gnl|my_center|LOCUS_02870 1675 1421 gene locus_tag LOCUS_02880 1675 1421 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023253.1 protein_id gnl|my_center|LOCUS_02880 2540 1647 gene locus_tag LOCUS_02890 2540 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 3505 2537 gene locus_tag LOCUS_02900 3505 2537 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731382.1 protein_id gnl|my_center|LOCUS_02900 4307 3480 gene locus_tag LOCUS_02910 4307 3480 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839946.1 protein_id gnl|my_center|LOCUS_02910 4424 5149 gene locus_tag LOCUS_02920 4424 5149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 5146 5664 gene locus_tag LOCUS_02930 5146 5664 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880824.1 protein_id gnl|my_center|LOCUS_02930 6891 5686 gene locus_tag LOCUS_02940 gene nuoD 6891 5686 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_02940 7813 7361 gene locus_tag LOCUS_02950 gene tadA 7813 7361 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545402.1 protein_id gnl|my_center|LOCUS_02950 8229 7810 gene locus_tag LOCUS_02960 8229 7810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 9229 8270 gene locus_tag LOCUS_02970 9229 8270 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387903.1 protein_id gnl|my_center|LOCUS_02970 >Feature sequence024 464 2170 gene locus_tag LOCUS_02980 464 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2192 2875 gene locus_tag LOCUS_02990 2192 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 2872 3252 gene locus_tag LOCUS_03000 2872 3252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3239 3880 gene locus_tag LOCUS_03010 3239 3880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3865 4722 gene locus_tag LOCUS_03020 3865 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6337 5105 gene locus_tag LOCUS_03030 6337 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 6864 6346 gene locus_tag LOCUS_03040 6864 6346 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931010.1 protein_id gnl|my_center|LOCUS_03040 7576 6839 gene locus_tag LOCUS_03050 gene kdsB 7576 6839 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545187.1 protein_id gnl|my_center|LOCUS_03050 7907 7590 gene locus_tag LOCUS_03060 7907 7590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8108 9226 gene locus_tag LOCUS_03070 8108 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 9924 9223 gene locus_tag LOCUS_03080 9924 9223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 >Feature sequence025 684 1529 gene locus_tag LOCUS_03090 684 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1531 2319 gene locus_tag LOCUS_03100 1531 2319 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880470.1 protein_id gnl|my_center|LOCUS_03100 3951 2824 gene locus_tag LOCUS_03110 gene tgt 3951 2824 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546567.1 protein_id gnl|my_center|LOCUS_03110 4800 3955 gene locus_tag LOCUS_03120 4800 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 4984 6765 gene locus_tag LOCUS_03130 4984 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 6762 7718 gene locus_tag LOCUS_03140 6762 7718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 7803 9887 gene locus_tag LOCUS_03150 7803 9887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 >Feature sequence026 587 1585 gene locus_tag LOCUS_03160 587 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 1569 2621 gene locus_tag LOCUS_03170 gene dprA 1569 2621 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943186.1 protein_id gnl|my_center|LOCUS_03170 2642 3130 gene locus_tag LOCUS_03180 2642 3130 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_03180 3206 3134 gene locus_tag LOCUS_t00090 3206 3134 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5122 3641 gene locus_tag LOCUS_03190 gene mutL 5122 3641 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546175.1 protein_id gnl|my_center|LOCUS_03190 5210 5137 gene locus_tag LOCUS_t00100 5210 5137 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 5522 5794 gene locus_tag LOCUS_03200 5522 5794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5857 8316 gene locus_tag LOCUS_03210 5857 8316 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_03210 8482 8558 gene locus_tag LOCUS_t00110 8482 8558 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 2639 567 gene locus_tag LOCUS_03220 2639 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 4162 2639 gene locus_tag LOCUS_03230 4162 2639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 4301 4717 gene locus_tag LOCUS_03240 4301 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 4698 5369 gene locus_tag LOCUS_03250 4698 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 6229 5366 gene locus_tag LOCUS_03260 6229 5366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 7021 6275 gene locus_tag LOCUS_03270 7021 6275 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545091.1 protein_id gnl|my_center|LOCUS_03270 7905 7018 gene locus_tag LOCUS_03280 7905 7018 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_153018271.1 protein_id gnl|my_center|LOCUS_03280 9270 7906 gene locus_tag LOCUS_03290 9270 7906 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 protein_id gnl|my_center|LOCUS_03290 9340 9717 gene locus_tag LOCUS_03300 9340 9717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 >Feature sequence028 87 296 gene locus_tag LOCUS_03310 87 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 333 989 gene locus_tag LOCUS_03320 333 989 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963154.1 protein_id gnl|my_center|LOCUS_03320 1492 2817 gene locus_tag LOCUS_03330 1492 2817 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879947.1 protein_id gnl|my_center|LOCUS_03330 2936 3514 gene locus_tag LOCUS_03340 2936 3514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 3511 5427 gene locus_tag LOCUS_03350 3511 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 5414 6376 gene locus_tag LOCUS_03360 gene nadA 5414 6376 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228349.1 protein_id gnl|my_center|LOCUS_03360 6373 7080 gene locus_tag LOCUS_03370 6373 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 7037 8239 gene locus_tag LOCUS_03380 7037 8239 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880777.1 protein_id gnl|my_center|LOCUS_03380 8650 8267 gene locus_tag LOCUS_03390 gene gcvH 8650 8267 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583866.1 protein_id gnl|my_center|LOCUS_03390 9647 8652 gene locus_tag LOCUS_03400 gene gap 9647 8652 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583911.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence029 1025 426 gene locus_tag LOCUS_03410 1025 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 2392 1013 gene locus_tag LOCUS_03420 2392 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 2642 4579 gene locus_tag LOCUS_03430 2642 4579 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_03430 4626 5537 gene locus_tag LOCUS_03440 gene pstC 4626 5537 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545177.1 protein_id gnl|my_center|LOCUS_03440 5527 6360 gene locus_tag LOCUS_03450 gene pstA 5527 6360 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582861.1 protein_id gnl|my_center|LOCUS_03450 6353 7135 gene locus_tag LOCUS_03460 gene pstB 6353 7135 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546432.1 protein_id gnl|my_center|LOCUS_03460 7132 7791 gene locus_tag LOCUS_03470 gene phoU 7132 7791 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_03470 8428 7967 gene locus_tag LOCUS_03480 8428 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 <9049 8470 gene locus_tag LOCUS_03490 <9049 8470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_116185855.1:DUF4159 domain-containing protein >Feature sequence030 <1 802 gene locus_tag LOCUS_03500 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941322.1:ribose-phosphate pyrophosphokinase 856 1494 gene locus_tag LOCUS_03510 856 1494 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583150.1 protein_id gnl|my_center|LOCUS_03510 1495 2064 gene locus_tag LOCUS_03520 gene pth 1495 2064 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082100.1 protein_id gnl|my_center|LOCUS_03520 2061 4145 gene locus_tag LOCUS_03530 2061 4145 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583780.1 protein_id gnl|my_center|LOCUS_03530 4216 7005 gene locus_tag LOCUS_03540 gene uvrA 4216 7005 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583250.1 protein_id gnl|my_center|LOCUS_03540 7920 7162 gene locus_tag LOCUS_03550 7920 7162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence031 751 194 gene locus_tag LOCUS_03560 gene frr 751 194 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_03560 1508 795 gene locus_tag LOCUS_03570 gene pyrH 1508 795 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179852.1 protein_id gnl|my_center|LOCUS_03570 2355 1498 gene locus_tag LOCUS_03580 gene tsf 2355 1498 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880428.1 protein_id gnl|my_center|LOCUS_03580 3113 2358 gene locus_tag LOCUS_03590 gene rpsB 3113 2358 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583564.1 protein_id gnl|my_center|LOCUS_03590 3576 3067 gene locus_tag LOCUS_03600 3576 3067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 4019 3573 gene locus_tag LOCUS_03610 gene rplM 4019 3573 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_03610 4345 4022 gene locus_tag LOCUS_03620 gene trxA 4345 4022 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975042.1 protein_id gnl|my_center|LOCUS_03620 4754 4338 gene locus_tag LOCUS_03630 gene rplQ 4754 4338 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081777.1 protein_id gnl|my_center|LOCUS_03630 5753 4761 gene locus_tag LOCUS_03640 5753 4761 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879981.1 protein_id gnl|my_center|LOCUS_03640 6396 5764 gene locus_tag LOCUS_03650 gene rpsD 6396 5764 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583370.1 protein_id gnl|my_center|LOCUS_03650 6782 6396 gene locus_tag LOCUS_03660 gene rpsK 6782 6396 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583369.1 protein_id gnl|my_center|LOCUS_03660 7154 6783 gene locus_tag LOCUS_03670 gene rpsM 7154 6783 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081785.1 protein_id gnl|my_center|LOCUS_03670 7866 7354 gene locus_tag LOCUS_03680 7866 7354 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_03680 7816 8001 gene locus_tag LOCUS_03690 7816 8001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 >Feature sequence032 2705 1281 gene locus_tag LOCUS_03700 2705 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4042 2693 gene locus_tag LOCUS_03710 4042 2693 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_03710 4171 4244 gene locus_tag LOCUS_t00120 4171 4244 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4314 5615 gene locus_tag LOCUS_03720 4314 5615 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097853.1 protein_id gnl|my_center|LOCUS_03720 5818 6585 gene locus_tag LOCUS_03730 gene galE 5818 6585 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880665.1 protein_id gnl|my_center|LOCUS_03730 6955 8637 gene locus_tag LOCUS_03740 6955 8637 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879268.1 protein_id gnl|my_center|LOCUS_03740 8791 8609 gene locus_tag LOCUS_03750 8791 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 >Feature sequence033 83 739 gene locus_tag LOCUS_03760 83 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 723 1241 gene locus_tag LOCUS_03770 723 1241 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888812.1 protein_id gnl|my_center|LOCUS_03770 1246 1623 gene locus_tag LOCUS_03780 1246 1623 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881204.1 protein_id gnl|my_center|LOCUS_03780 1632 1856 gene locus_tag LOCUS_03790 1632 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 1965 2333 gene locus_tag LOCUS_03800 1965 2333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 3480 2362 gene locus_tag LOCUS_03810 3480 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 3549 4058 gene locus_tag LOCUS_03820 3549 4058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 4039 4992 gene locus_tag LOCUS_03830 4039 4992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 4995 5459 gene locus_tag LOCUS_03840 gene sigM 4995 5459 CDS product RNA polymerase sigma factor SigM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224177.1 protein_id gnl|my_center|LOCUS_03840 5534 5462 gene locus_tag LOCUS_t00130 5534 5462 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 5983 6402 gene locus_tag LOCUS_03850 5983 6402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 6407 6952 gene locus_tag LOCUS_03860 6407 6952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 7000 8169 gene locus_tag LOCUS_03870 7000 8169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence034 116 328 gene locus_tag LOCUS_03880 116 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 707 1651 gene locus_tag LOCUS_03890 gene argF 707 1651 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_03890 1648 2199 gene locus_tag LOCUS_03900 1648 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 2196 2447 gene locus_tag LOCUS_03910 2196 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2437 3132 gene locus_tag LOCUS_03920 2437 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 3096 3662 gene locus_tag LOCUS_03930 3096 3662 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_03930 4965 3637 gene locus_tag LOCUS_03940 gene mnmE 4965 3637 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_03940 5581 4955 gene locus_tag LOCUS_03950 5581 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 7020 5647 gene locus_tag LOCUS_03960 7020 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 <8629 7390 gene locus_tag LOCUS_03970 <8629 7390 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544918.1:murein biosynthesis integral membrane protein MurJ >Feature sequence035 481 990 gene locus_tag LOCUS_03980 481 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 980 1726 gene locus_tag LOCUS_03990 gene surE 980 1726 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_03990 2373 1711 gene locus_tag LOCUS_04000 2373 1711 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838698.1 protein_id gnl|my_center|LOCUS_04000 3787 2351 gene locus_tag LOCUS_04010 3787 2351 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249252.1 protein_id gnl|my_center|LOCUS_04010 4589 3789 gene locus_tag LOCUS_04020 4589 3789 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 protein_id gnl|my_center|LOCUS_04020 5482 4586 gene locus_tag LOCUS_04030 5482 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04030 7057 5495 gene locus_tag LOCUS_04040 gene secD 7057 5495 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_04040 7445 7203 gene locus_tag LOCUS_04050 7445 7203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 7856 8263 gene locus_tag LOCUS_04060 7856 8263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence036 2291 192 gene locus_tag LOCUS_04070 2291 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 2746 2288 gene locus_tag LOCUS_04080 2746 2288 CDS product metal-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930815.1 protein_id gnl|my_center|LOCUS_04080 3469 2750 gene locus_tag LOCUS_04090 3469 2750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 4029 3466 gene locus_tag LOCUS_04100 4029 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4122 4048 gene locus_tag LOCUS_t00140 4122 4048 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4235 5323 gene locus_tag LOCUS_04110 4235 5323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 5399 6514 gene locus_tag LOCUS_04120 gene nuoD 5399 6514 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545955.1 protein_id gnl|my_center|LOCUS_04120 >Feature sequence037 1156 203 gene locus_tag LOCUS_04130 1156 203 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335040.1 protein_id gnl|my_center|LOCUS_04130 1602 1180 gene locus_tag LOCUS_04140 1602 1180 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946599.1 protein_id gnl|my_center|LOCUS_04140 1997 1602 gene locus_tag LOCUS_04150 1997 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2092 2017 gene locus_tag LOCUS_t00150 2092 2017 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3481 2123 gene locus_tag LOCUS_04160 3481 2123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4344 3523 gene locus_tag LOCUS_04170 4344 3523 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001817979.1 protein_id gnl|my_center|LOCUS_04170 4865 4344 gene locus_tag LOCUS_04180 4865 4344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5392 4862 gene locus_tag LOCUS_04190 5392 4862 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173701.1 protein_id gnl|my_center|LOCUS_04190 6702 5389 gene locus_tag LOCUS_04200 gene secY 6702 5389 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938618.1 protein_id gnl|my_center|LOCUS_04200 7153 6704 gene locus_tag LOCUS_04210 gene rplO 7153 6704 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357513.1 protein_id gnl|my_center|LOCUS_04210 7332 7150 gene locus_tag LOCUS_04220 gene rpmD 7332 7150 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156497.1 protein_id gnl|my_center|LOCUS_04220 7849 7307 gene locus_tag LOCUS_04230 gene rpsE 7849 7307 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633389.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence038 1646 4798 gene locus_tag LOCUS_04240 1646 4798 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881091.1 protein_id gnl|my_center|LOCUS_04240 5890 4829 gene locus_tag LOCUS_04250 5890 4829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 7473 5887 gene locus_tag LOCUS_04260 7473 5887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence039 1944 1003 gene locus_tag LOCUS_04270 1944 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 2865 1984 gene locus_tag LOCUS_04280 2865 1984 CDS product 1,4-dihydroxy-2-naphthoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460669.1 protein_id gnl|my_center|LOCUS_04280 3173 3643 gene locus_tag LOCUS_04290 3173 3643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4501 3647 gene locus_tag LOCUS_04300 4501 3647 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144155.1 protein_id gnl|my_center|LOCUS_04300 5142 6128 gene locus_tag LOCUS_04310 gene rtcA 5142 6128 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_04310 6139 6945 gene locus_tag LOCUS_04320 6139 6945 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_04320 6942 7643 gene locus_tag LOCUS_04330 6942 7643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence040 91 1347 gene locus_tag LOCUS_04340 91 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 1323 2003 gene locus_tag LOCUS_04350 1323 2003 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545555.1 protein_id gnl|my_center|LOCUS_04350 2066 2734 gene locus_tag LOCUS_04360 2066 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2792 3463 gene locus_tag LOCUS_04370 2792 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 3492 4214 gene locus_tag LOCUS_04380 gene tatC 3492 4214 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880807.1 protein_id gnl|my_center|LOCUS_04380 4201 4557 gene locus_tag LOCUS_04390 4201 4557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 4554 5255 gene locus_tag LOCUS_04400 4554 5255 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_04400 5285 7330 gene locus_tag LOCUS_04410 5285 7330 CDS product PKD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990677.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence041 471 1295 gene locus_tag LOCUS_04420 471 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 1259 1828 gene locus_tag LOCUS_04430 1259 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 3119 1815 gene locus_tag LOCUS_04440 3119 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 3844 3125 gene locus_tag LOCUS_04450 3844 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 4995 3841 gene locus_tag LOCUS_04460 4995 3841 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905558.1 protein_id gnl|my_center|LOCUS_04460 5931 5161 gene locus_tag LOCUS_04470 5931 5161 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085820.1 protein_id gnl|my_center|LOCUS_04470 7626 5941 gene locus_tag LOCUS_04480 7626 5941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence042 1242 1170 gene locus_tag LOCUS_t00160 1242 1170 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2595 1603 gene locus_tag LOCUS_04490 gene recF 2595 1603 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582442.1 protein_id gnl|my_center|LOCUS_04490 2961 2596 gene locus_tag LOCUS_04500 2961 2596 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112869.1 protein_id gnl|my_center|LOCUS_04500 4575 3052 gene locus_tag LOCUS_04510 4575 3052 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881359.1 protein_id gnl|my_center|LOCUS_04510 5470 4547 gene locus_tag LOCUS_04520 gene lpxK 5470 4547 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881075.1 protein_id gnl|my_center|LOCUS_04520 5608 6591 gene locus_tag LOCUS_04530 5608 6591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 >Feature sequence043 2 649 gene locus_tag LOCUS_04540 2 649 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021757.1 protein_id gnl|my_center|LOCUS_04540 609 1211 gene locus_tag LOCUS_04550 609 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 2421 1213 gene locus_tag LOCUS_04560 2421 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2678 2418 gene locus_tag LOCUS_04570 2678 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 3117 2647 gene locus_tag LOCUS_04580 3117 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 3764 3114 gene locus_tag LOCUS_04590 3764 3114 CDS product type 1 glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057804.1 protein_id gnl|my_center|LOCUS_04590 4339 3761 gene locus_tag LOCUS_04600 4339 3761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 4659 4324 gene locus_tag LOCUS_04610 4659 4324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5997 4699 gene locus_tag LOCUS_04620 5997 4699 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870113.1 protein_id gnl|my_center|LOCUS_04620 7326 6634 gene locus_tag LOCUS_04630 7326 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence044 <1 618 gene locus_tag LOCUS_04640 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947556.1:hydroxymethylglutaryl-CoA lyase 774 2042 gene locus_tag LOCUS_04650 774 2042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 2046 2579 gene locus_tag LOCUS_04660 2046 2579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 3030 2581 gene locus_tag LOCUS_04670 3030 2581 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880029.1 protein_id gnl|my_center|LOCUS_04670 3090 3812 gene locus_tag LOCUS_04680 3090 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 4863 3799 gene locus_tag LOCUS_04690 4863 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 5500 4853 gene locus_tag LOCUS_04700 gene queC 5500 4853 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_04700 <7564 5515 gene locus_tag LOCUS_04710 <7564 5515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038134.1:Tol-Pal system beta propeller repeat protein TolB >Feature sequence045 2284 863 gene locus_tag LOCUS_04720 gene putP 2284 863 CDS product sodium/proline symporter PutP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107217.1 protein_id gnl|my_center|LOCUS_04720 2429 3076 gene locus_tag LOCUS_04730 2429 3076 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_04730 3069 4139 gene locus_tag LOCUS_04740 3069 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4464 4336 gene locus_tag LOCUS_04750 4464 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 4608 6257 gene locus_tag LOCUS_04760 4608 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238703.1 protein_id gnl|my_center|LOCUS_04760 6966 6250 gene locus_tag LOCUS_04770 6966 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 >Feature sequence046 1512 262 gene locus_tag LOCUS_04780 1512 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1931 1509 gene locus_tag LOCUS_04790 1931 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 3004 1928 gene locus_tag LOCUS_04800 3004 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4806 2977 gene locus_tag LOCUS_04810 4806 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 4866 6473 gene locus_tag LOCUS_04820 gene pyrG 4866 6473 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320045.1 protein_id gnl|my_center|LOCUS_04820 6763 7161 gene locus_tag LOCUS_04830 6763 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence047 429 1355 gene locus_tag LOCUS_04840 429 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 1352 2962 gene locus_tag LOCUS_04850 1352 2962 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880520.1 protein_id gnl|my_center|LOCUS_04850 2982 4343 gene locus_tag LOCUS_04860 gene accC 2982 4343 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_04860 4655 5059 gene locus_tag LOCUS_04870 4655 5059 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868143.1 protein_id gnl|my_center|LOCUS_04870 5793 5062 gene locus_tag LOCUS_04880 5793 5062 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392865.1 protein_id gnl|my_center|LOCUS_04880 6313 5765 gene locus_tag LOCUS_04890 6313 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 6363 6435 gene locus_tag LOCUS_t00170 6363 6435 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6994 6437 gene locus_tag LOCUS_04900 6994 6437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 >Feature sequence048 <1 1022 gene locus_tag LOCUS_04910 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880501.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase 3742 1040 gene locus_tag LOCUS_04920 3742 1040 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879008.1 protein_id gnl|my_center|LOCUS_04920 3993 6359 gene locus_tag LOCUS_04930 3993 6359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 >Feature sequence049 <1 590 gene locus_tag LOCUS_04940 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546417.1:pitrilysin family protein 562 897 gene locus_tag LOCUS_04950 562 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 1149 850 gene locus_tag LOCUS_04960 1149 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 1192 1713 gene locus_tag LOCUS_04970 1192 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 1757 2308 gene locus_tag LOCUS_04980 gene rsmD 1757 2308 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_04980 2904 3494 gene locus_tag LOCUS_04990 2904 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3537 4331 gene locus_tag LOCUS_05000 3537 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4328 6457 gene locus_tag LOCUS_05010 4328 6457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence050 <1 520 gene locus_tag LOCUS_05020 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880857.1:AmmeMemoRadiSam system protein B 937 2991 gene locus_tag LOCUS_05030 gene fusA 937 2991 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583342.1 protein_id gnl|my_center|LOCUS_05030 3025 4242 gene locus_tag LOCUS_05040 gene tuf 3025 4242 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583343.1 protein_id gnl|my_center|LOCUS_05040 4248 4562 gene locus_tag LOCUS_05050 gene rpsJ 4248 4562 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549023.1 protein_id gnl|my_center|LOCUS_05050 4559 5482 gene locus_tag LOCUS_05060 4559 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 5485 6111 gene locus_tag LOCUS_05070 gene rplD 5485 6111 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_05070 6108 6404 gene locus_tag LOCUS_05080 gene rplW 6108 6404 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879929.1 protein_id gnl|my_center|LOCUS_05080 >Feature sequence051 <1 619 gene locus_tag LOCUS_05090 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005080146.1:NADH-quinone oxidoreductase subunit NuoF 659 1801 gene locus_tag LOCUS_05100 659 1801 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_05100 1815 2102 gene locus_tag LOCUS_05110 gene gatC 1815 2102 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933493.1 protein_id gnl|my_center|LOCUS_05110 2355 3527 gene locus_tag LOCUS_05120 2355 3527 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877762.1 protein_id gnl|my_center|LOCUS_05120 3537 5969 gene locus_tag LOCUS_05130 3537 5969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 6488 5973 gene locus_tag LOCUS_05140 gene ycnK 6488 5973 CDS product copper uptake transcriptional regulator YcnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246724.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence052 2494 1565 gene locus_tag LOCUS_05150 2494 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 3620 2487 gene locus_tag LOCUS_05160 3620 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 3807 5486 gene locus_tag LOCUS_05170 3807 5486 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878783.1 protein_id gnl|my_center|LOCUS_05170 5488 6711 gene locus_tag LOCUS_05180 5488 6711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 6712 7053 gene locus_tag LOCUS_05190 6712 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence053 273 422 gene locus_tag LOCUS_05200 273 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 463 1527 gene locus_tag LOCUS_05210 gene nuoH 463 1527 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109091.1 protein_id gnl|my_center|LOCUS_05210 1535 1990 gene locus_tag LOCUS_05220 1535 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 1987 3063 gene locus_tag LOCUS_05230 1987 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 3067 3354 gene locus_tag LOCUS_05240 3067 3354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3357 4478 gene locus_tag LOCUS_05250 3357 4478 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000415515.1 protein_id gnl|my_center|LOCUS_05250 4501 5277 gene locus_tag LOCUS_05260 4501 5277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 5666 5301 gene locus_tag LOCUS_05270 5666 5301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 5728 6909 gene locus_tag LOCUS_05280 5728 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 >Feature sequence054 <1 778 gene locus_tag LOCUS_05290 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881003.1:KpsF/GutQ family sugar-phosphate isomerase 1592 1164 gene locus_tag LOCUS_05300 1592 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 1663 2769 gene locus_tag LOCUS_05310 1663 2769 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880148.1 protein_id gnl|my_center|LOCUS_05310 2766 3104 gene locus_tag LOCUS_05320 2766 3104 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_05320 3456 3803 gene locus_tag LOCUS_05330 3456 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4168 3800 gene locus_tag LOCUS_05340 4168 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 4734 4168 gene locus_tag LOCUS_05350 gene pdxT 4734 4168 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867915.1 protein_id gnl|my_center|LOCUS_05350 4893 4803 gene locus_tag LOCUS_t00180 4893 4803 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4994 4908 gene locus_tag LOCUS_t00190 4994 4908 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5309 6577 gene locus_tag LOCUS_05360 gene serS 5309 6577 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880145.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence055 <1 748 gene locus_tag LOCUS_05370 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931811.1:sulfide:quinone reductase 2034 892 gene locus_tag LOCUS_05380 2034 892 CDS product glycoside hydrolase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582847.1 protein_id gnl|my_center|LOCUS_05380 2567 2031 gene locus_tag LOCUS_05390 2567 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 3625 2564 gene locus_tag LOCUS_05400 gene spoVE 3625 2564 CDS product stage V sporulation protein E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460697.1 protein_id gnl|my_center|LOCUS_05400 4545 3625 gene locus_tag LOCUS_05410 4545 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 5408 4569 gene locus_tag LOCUS_05420 5408 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 6182 5733 gene locus_tag LOCUS_05430 6182 5733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 6754 6143 gene locus_tag LOCUS_05440 6754 6143 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_05440 >Feature sequence056 <1 4276 gene locus_tag LOCUS_05450 <1 4276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062175791.1:cell surface protein SprA 5580 4900 gene locus_tag LOCUS_05460 5580 4900 CDS product amino acid racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250422.1 protein_id gnl|my_center|LOCUS_05460 6450 5596 gene locus_tag LOCUS_05470 6450 5596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 >Feature sequence057 1502 1050 gene locus_tag LOCUS_05480 1502 1050 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_05480 1954 1499 gene locus_tag LOCUS_05490 gene rplI 1954 1499 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938257.1 protein_id gnl|my_center|LOCUS_05490 2188 1967 gene locus_tag LOCUS_05500 gene rpsR 2188 1967 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831354.1 protein_id gnl|my_center|LOCUS_05500 2653 2198 gene locus_tag LOCUS_05510 gene ssb 2653 2198 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_05510 2943 2653 gene locus_tag LOCUS_05520 2943 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 3320 2940 gene locus_tag LOCUS_05530 3320 2940 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173351.1 protein_id gnl|my_center|LOCUS_05530 3573 3298 gene locus_tag LOCUS_05540 gene rpsT 3573 3298 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771970.1 protein_id gnl|my_center|LOCUS_05540 4509 3592 gene locus_tag LOCUS_05550 4509 3592 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444129.1 protein_id gnl|my_center|LOCUS_05550 5547 4528 gene locus_tag LOCUS_05560 5547 4528 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869715.1 protein_id gnl|my_center|LOCUS_05560 5978 5568 gene locus_tag LOCUS_05570 5978 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 <6822 5980 gene locus_tag LOCUS_05580 <6822 5980 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011017116.1:DNA polymerase III subunit alpha >Feature sequence058 340 1605 gene locus_tag LOCUS_05590 gene murA 340 1605 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082675.1 protein_id gnl|my_center|LOCUS_05590 1750 4293 gene locus_tag LOCUS_05600 1750 4293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 >Feature sequence059 <1 3481 gene locus_tag LOCUS_05610 <1 3481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963516.1:type IX secretion system sortase PorU 3478 5049 gene locus_tag LOCUS_05620 3478 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 5062 5709 gene locus_tag LOCUS_05630 gene atpD 5062 5709 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173332.1 protein_id gnl|my_center|LOCUS_05630 6646 5663 gene locus_tag LOCUS_05640 gene hemW 6646 5663 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203488.1 protein_id gnl|my_center|LOCUS_05640 >Feature sequence060 1374 331 gene locus_tag LOCUS_05650 1374 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1554 3650 gene locus_tag LOCUS_05660 1554 3650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 4701 3637 gene locus_tag LOCUS_05670 gene alr 4701 3637 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010951235.1 protein_id gnl|my_center|LOCUS_05670 4785 4985 gene locus_tag LOCUS_05680 4785 4985 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173482.1 protein_id gnl|my_center|LOCUS_05680 5095 5493 gene locus_tag LOCUS_05690 5095 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 >Feature sequence061 1135 755 gene locus_tag LOCUS_05700 1135 755 CDS product type III-B CRISPR module-associated protein Cmr5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986671.1 protein_id gnl|my_center|LOCUS_05700 1975 1148 gene locus_tag LOCUS_05710 gene cmr4 1975 1148 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986672.1 protein_id gnl|my_center|LOCUS_05710 3081 2005 gene locus_tag LOCUS_05720 3081 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 3640 3074 gene locus_tag LOCUS_05730 3640 3074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 4027 5472 gene locus_tag LOCUS_05740 4027 5472 CDS product IS4-like element ISDha5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808317.1 protein_id gnl|my_center|LOCUS_05740 5521 6120 gene locus_tag LOCUS_05750 5521 6120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 >Feature sequence062 3281 3093 gene locus_tag LOCUS_05760 3281 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4162 3335 gene locus_tag LOCUS_05770 gene phnD 4162 3335 CDS product phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391685.1 protein_id gnl|my_center|LOCUS_05770 4230 5519 gene locus_tag LOCUS_05780 4230 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 6016 5549 gene locus_tag LOCUS_05790 gene folK 6016 5549 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880048.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence063 91 1224 gene locus_tag LOCUS_05800 91 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 2333 1269 gene locus_tag LOCUS_05810 gene rlmN 2333 1269 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431147.1 protein_id gnl|my_center|LOCUS_05810 2781 2293 gene locus_tag LOCUS_05820 2781 2293 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207342.1 protein_id gnl|my_center|LOCUS_05820 2932 4476 gene locus_tag LOCUS_05830 gene pckA 2932 4476 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_05830 4464 5375 gene locus_tag LOCUS_05840 4464 5375 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880440.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence064 4116 1834 gene locus_tag LOCUS_05850 4116 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 4616 4143 gene locus_tag LOCUS_05860 4616 4143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 5076 5438 gene locus_tag LOCUS_05870 gene rplT 5076 5438 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264177.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence065 1337 228 gene locus_tag LOCUS_05880 gene vpsj 1337 228 CDS product exopolysaccharide biosynthesis protein VpsJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000843487.1 protein_id gnl|my_center|LOCUS_05880 1626 1324 gene locus_tag LOCUS_05890 1626 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1743 2033 gene locus_tag LOCUS_05900 gene rpmA 1743 2033 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081742.1 protein_id gnl|my_center|LOCUS_05900 2033 2419 gene locus_tag LOCUS_05910 gene rpsL 2033 2419 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880443.1 protein_id gnl|my_center|LOCUS_05910 2430 2897 gene locus_tag LOCUS_05920 gene rpsG 2430 2897 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001254357.1 protein_id gnl|my_center|LOCUS_05920 3309 4166 gene locus_tag LOCUS_05930 3309 4166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 4181 4918 gene locus_tag LOCUS_05940 4181 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5145 6209 gene locus_tag LOCUS_05950 gene amrS 5145 6209 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence066 2406 1084 gene locus_tag LOCUS_05960 2406 1084 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880656.1 protein_id gnl|my_center|LOCUS_05960 5108 2403 gene locus_tag LOCUS_05970 5108 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5989 5345 gene locus_tag LOCUS_05980 5989 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence067 1137 571 gene locus_tag LOCUS_05990 1137 571 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527296.1 protein_id gnl|my_center|LOCUS_05990 1520 1158 gene locus_tag LOCUS_06000 1520 1158 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927201.1 protein_id gnl|my_center|LOCUS_06000 3856 1517 gene locus_tag LOCUS_06010 3856 1517 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545339.1 protein_id gnl|my_center|LOCUS_06010 4389 3817 gene locus_tag LOCUS_06020 gene pyrR 4389 3817 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869840.1 protein_id gnl|my_center|LOCUS_06020 5224 5475 gene locus_tag LOCUS_06030 5224 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence068 276 908 gene locus_tag LOCUS_06040 276 908 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001053851.1 protein_id gnl|my_center|LOCUS_06040 1041 2618 gene locus_tag LOCUS_06050 1041 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 3618 2608 gene locus_tag LOCUS_06060 3618 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 4094 3585 gene locus_tag LOCUS_06070 4094 3585 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_06070 5272 4100 gene locus_tag LOCUS_06080 5272 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 >Feature sequence069 <1 735 gene locus_tag LOCUS_06090 <1 735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869244.1:adenylosuccinate synthase 732 1607 gene locus_tag LOCUS_06100 732 1607 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_06100 1597 2820 gene locus_tag LOCUS_06110 1597 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2832 3479 gene locus_tag LOCUS_06120 2832 3479 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025306754.1 protein_id gnl|my_center|LOCUS_06120 3490 4530 gene locus_tag LOCUS_06130 3490 4530 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583756.1 protein_id gnl|my_center|LOCUS_06130 4527 5171 gene locus_tag LOCUS_06140 4527 5171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 5194 6063 gene locus_tag LOCUS_06150 gene sucD 5194 6063 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765646.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence070 1034 249 gene locus_tag LOCUS_06160 1034 249 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881296.1 protein_id gnl|my_center|LOCUS_06160 1434 1009 gene locus_tag LOCUS_06170 1434 1009 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393155.1 protein_id gnl|my_center|LOCUS_06170 3125 1605 gene locus_tag LOCUS_06180 3125 1605 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875946.1 protein_id gnl|my_center|LOCUS_06180 3821 3141 gene locus_tag LOCUS_06190 3821 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 4702 3833 gene locus_tag LOCUS_06200 4702 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 5550 4747 gene locus_tag LOCUS_06210 gene kdsA 5550 4747 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_06210 <6044 5541 gene locus_tag LOCUS_06220 <6044 5541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404046.1:cob(I)yrinic acid a,c-diamide adenosyltransferase >Feature sequence071 777 82 gene locus_tag LOCUS_06230 777 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 1523 828 gene locus_tag LOCUS_06240 1523 828 CDS product TIGR00703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870983.1 protein_id gnl|my_center|LOCUS_06240 2067 1516 gene locus_tag LOCUS_06250 2067 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2555 2064 gene locus_tag LOCUS_06260 2555 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880459.1 protein_id gnl|my_center|LOCUS_06260 3366 2548 gene locus_tag LOCUS_06270 3366 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3527 3922 gene locus_tag LOCUS_06280 3527 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 5097 3925 gene locus_tag LOCUS_06290 5097 3925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 <6034 5094 gene locus_tag LOCUS_06300 <6034 5094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765466.1:signal peptide peptidase SppA >Feature sequence072 <1 927 gene locus_tag LOCUS_06310 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870590.1:flippase-like domain-containing protein 1245 973 gene locus_tag LOCUS_06320 1245 973 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011476580.1 protein_id gnl|my_center|LOCUS_06320 3776 1443 gene locus_tag LOCUS_06330 3776 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4137 3784 gene locus_tag LOCUS_06340 4137 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4230 5255 gene locus_tag LOCUS_06350 4230 5255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 5252 5749 gene locus_tag LOCUS_06360 5252 5749 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886218.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence073 1219 926 gene locus_tag LOCUS_06370 1219 926 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404610.1 protein_id gnl|my_center|LOCUS_06370 1500 1219 gene locus_tag LOCUS_06380 1500 1219 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_06380 3644 1500 gene locus_tag LOCUS_06390 3644 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4906 3641 gene locus_tag LOCUS_06400 gene nusA 4906 3641 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583567.1 protein_id gnl|my_center|LOCUS_06400 5355 4909 gene locus_tag LOCUS_06410 gene rimP 5355 4909 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_06410 <5982 5431 gene locus_tag LOCUS_06420 <5982 5431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583188.1:lipid-A-disaccharide synthase >Feature sequence074 1952 570 gene locus_tag LOCUS_06430 1952 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 2751 3707 gene locus_tag LOCUS_06440 gene nuoH 2751 3707 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_06440 3711 4358 gene locus_tag LOCUS_06450 3711 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4355 4852 gene locus_tag LOCUS_06460 4355 4852 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258757.1 protein_id gnl|my_center|LOCUS_06460 4849 5154 gene locus_tag LOCUS_06470 gene nuoK 4849 5154 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404194.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence075 1393 1962 gene locus_tag LOCUS_06480 1393 1962 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985956.1 protein_id gnl|my_center|LOCUS_06480 1964 3664 gene locus_tag LOCUS_06490 1964 3664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3661 3930 gene locus_tag LOCUS_06500 3661 3930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3942 4526 gene locus_tag LOCUS_06510 gene gmk 3942 4526 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086862.1 protein_id gnl|my_center|LOCUS_06510 4520 5218 gene locus_tag LOCUS_06520 4520 5218 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832763.1 protein_id gnl|my_center|LOCUS_06520 >Feature sequence076 <1 523 gene locus_tag LOCUS_06530 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228798.1:recombination mediator RecR 527 1687 gene locus_tag LOCUS_06540 527 1687 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081038.1 protein_id gnl|my_center|LOCUS_06540 1790 2422 gene locus_tag LOCUS_06550 1790 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 2445 2795 gene locus_tag LOCUS_06560 2445 2795 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880519.1 protein_id gnl|my_center|LOCUS_06560 2776 3060 gene locus_tag LOCUS_06570 2776 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 3054 4094 gene locus_tag LOCUS_06580 3054 4094 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880177.1 protein_id gnl|my_center|LOCUS_06580 4123 4857 gene locus_tag LOCUS_06590 4123 4857 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868621.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence077 892 2583 gene locus_tag LOCUS_06600 892 2583 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682243.1 protein_id gnl|my_center|LOCUS_06600 2627 3853 gene locus_tag LOCUS_06610 2627 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3955 4812 gene locus_tag LOCUS_06620 3955 4812 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832012.1 protein_id gnl|my_center|LOCUS_06620 4832 5620 gene locus_tag LOCUS_06630 4832 5620 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003641966.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence078 791 75 gene locus_tag LOCUS_06640 791 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1917 829 gene locus_tag LOCUS_06650 gene prfA 1917 829 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880532.1 protein_id gnl|my_center|LOCUS_06650 2233 1919 gene locus_tag LOCUS_06660 gene rplU 2233 1919 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003516451.1 protein_id gnl|my_center|LOCUS_06660 2630 2259 gene locus_tag LOCUS_06670 2630 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3613 3095 gene locus_tag LOCUS_06680 3613 3095 CDS product DUF429 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878599.1 protein_id gnl|my_center|LOCUS_06680 3687 5051 gene locus_tag LOCUS_06690 gene mgtE 3687 5051 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080209.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence079 316 1140 gene locus_tag LOCUS_06700 316 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1835 1116 gene locus_tag LOCUS_06710 1835 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 2243 4957 gene locus_tag LOCUS_06720 2243 4957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 5483 4989 gene locus_tag LOCUS_06730 5483 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence080 606 121 gene locus_tag LOCUS_06740 606 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1936 584 gene locus_tag LOCUS_06750 1936 584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2172 2666 gene locus_tag LOCUS_06760 2172 2666 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942294.1 protein_id gnl|my_center|LOCUS_06760 2692 3933 gene locus_tag LOCUS_06770 2692 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3955 5403 gene locus_tag LOCUS_06780 3955 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 >Feature sequence081 1467 874 gene locus_tag LOCUS_06790 1467 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2245 1442 gene locus_tag LOCUS_06800 gene thyX 2245 1442 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081517.1 protein_id gnl|my_center|LOCUS_06800 2822 2247 gene locus_tag LOCUS_06810 2822 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5218 2828 gene locus_tag LOCUS_06820 gene gyrA 5218 2828 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence082 1290 1087 gene locus_tag LOCUS_06830 1290 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06830 2101 1400 gene locus_tag LOCUS_06840 2101 1400 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402944.1 protein_id gnl|my_center|LOCUS_06840 3155 2088 gene locus_tag LOCUS_06850 3155 2088 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942993.1 protein_id gnl|my_center|LOCUS_06850 3224 4612 gene locus_tag LOCUS_06860 3224 4612 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081291.1 protein_id gnl|my_center|LOCUS_06860 5066 5488 gene locus_tag LOCUS_06870 5066 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence083 994 455 gene locus_tag LOCUS_06880 994 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1398 1009 gene locus_tag LOCUS_06890 1398 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 1645 2943 gene locus_tag LOCUS_06900 gene miaB 1645 2943 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000114512.1 protein_id gnl|my_center|LOCUS_06900 3087 3773 gene locus_tag LOCUS_06910 3087 3773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 4123 4743 gene locus_tag LOCUS_06920 4123 4743 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990144.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence084 23 1701 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtggtttgattaaaatcgttctttgacaatatt 2138 1809 gene locus_tag LOCUS_06930 gene cas2 2138 1809 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963639.1 protein_id gnl|my_center|LOCUS_06930 3013 2129 gene locus_tag LOCUS_06940 gene cas1 3013 2129 CDS product type II CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963638.1 protein_id gnl|my_center|LOCUS_06940 >Feature sequence085 651 190 gene locus_tag LOCUS_06950 651 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 1304 648 gene locus_tag LOCUS_06960 1304 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 2241 1345 gene locus_tag LOCUS_06970 gene prfB 2241 1345 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 protein_id gnl|my_center|LOCUS_06970 3173 2421 gene locus_tag LOCUS_06980 gene paaG 3173 2421 CDS product 2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase PaaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046117561.1 protein_id gnl|my_center|LOCUS_06980 3621 4256 gene locus_tag LOCUS_06990 gene udg 3621 4256 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980322.1 protein_id gnl|my_center|LOCUS_06990 4229 5191 gene locus_tag LOCUS_07000 4229 5191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence086 1624 923 gene locus_tag LOCUS_07010 1624 923 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259013.1 protein_id gnl|my_center|LOCUS_07010 2411 1614 gene locus_tag LOCUS_07020 2411 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 3411 2338 gene locus_tag LOCUS_07030 3411 2338 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880445.1 protein_id gnl|my_center|LOCUS_07030 3453 3779 gene locus_tag LOCUS_07040 3453 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 3776 4786 gene locus_tag LOCUS_07050 gene mtnA 3776 4786 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_07050 >Feature sequence087 162 695 gene locus_tag LOCUS_07060 162 695 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_07060 725 2149 gene locus_tag LOCUS_07070 725 2149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 2182 3876 gene locus_tag LOCUS_07080 2182 3876 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880188.1 protein_id gnl|my_center|LOCUS_07080 3926 4852 gene locus_tag LOCUS_07090 3926 4852 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545553.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence088 831 286 gene locus_tag LOCUS_07100 gene rplF 831 286 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393922.1 protein_id gnl|my_center|LOCUS_07100 1237 833 gene locus_tag LOCUS_07110 gene rpsH 1237 833 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003720937.1 protein_id gnl|my_center|LOCUS_07110 1437 1252 gene locus_tag LOCUS_07120 1437 1252 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545654.1 protein_id gnl|my_center|LOCUS_07120 1992 1441 gene locus_tag LOCUS_07130 gene rplE 1992 1441 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011183032.1 protein_id gnl|my_center|LOCUS_07130 2321 1992 gene locus_tag LOCUS_07140 gene rplX 2321 1992 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000558200.1 protein_id gnl|my_center|LOCUS_07140 2701 2321 gene locus_tag LOCUS_07150 gene rplN 2701 2321 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081816.1 protein_id gnl|my_center|LOCUS_07150 2946 2698 gene locus_tag LOCUS_07160 2946 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3146 2943 gene locus_tag LOCUS_07170 gene rpmC 3146 2943 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_07170 3565 3146 gene locus_tag LOCUS_07180 gene rplP 3565 3146 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081822.1 protein_id gnl|my_center|LOCUS_07180 4226 3579 gene locus_tag LOCUS_07190 gene rpsC 4226 3579 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879933.1 protein_id gnl|my_center|LOCUS_07190 4648 4226 gene locus_tag LOCUS_07200 gene rplV 4648 4226 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_07200 4934 4650 gene locus_tag LOCUS_07210 gene rpsS 4934 4650 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583349.1 protein_id gnl|my_center|LOCUS_07210 <5458 4934 gene locus_tag LOCUS_07220 <5458 4934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879930.1:50S ribosomal protein L2 >Feature sequence089 70 603 gene locus_tag LOCUS_07230 70 603 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870634.1 protein_id gnl|my_center|LOCUS_07230 772 3063 gene locus_tag LOCUS_07240 772 3063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 3132 3204 gene locus_tag LOCUS_t00200 3132 3204 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3223 4056 gene locus_tag LOCUS_07250 3223 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 4079 4282 gene locus_tag LOCUS_07260 4079 4282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 5131 4283 gene locus_tag LOCUS_07270 5131 4283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5346 5128 gene locus_tag LOCUS_07280 5346 5128 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057829.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence090 624 265 gene locus_tag LOCUS_07290 624 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 2451 748 gene locus_tag LOCUS_07300 2451 748 CDS product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266151.1 protein_id gnl|my_center|LOCUS_07300 2648 3406 gene locus_tag LOCUS_07310 gene sufC 2648 3406 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_07310 3408 4823 gene locus_tag LOCUS_07320 gene sufB 3408 4823 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259322.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence091 <1 1396 gene locus_tag LOCUS_07330 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804130.1:iron ABC transporter permease 1387 2049 gene locus_tag LOCUS_07340 1387 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 4103 2127 gene locus_tag LOCUS_07350 gene tkt 4103 2127 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165438795.1 protein_id gnl|my_center|LOCUS_07350 <5398 4336 gene locus_tag LOCUS_07360 <5398 4336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868896.1:aminomethyl-transferring glycine dehydrogenase subunit GcvPB >Feature sequence092 322 2127 gene locus_tag LOCUS_07370 322 2127 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545590.1 protein_id gnl|my_center|LOCUS_07370 3605 2115 gene locus_tag LOCUS_07380 3605 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 3722 4387 gene locus_tag LOCUS_07390 3722 4387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4359 4946 gene locus_tag LOCUS_07400 gene nadD 4359 4946 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003360011.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence093 2094 322 gene locus_tag LOCUS_07410 2094 322 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902257.1 protein_id gnl|my_center|LOCUS_07410 2769 2182 gene locus_tag LOCUS_07420 2769 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 3076 2771 gene locus_tag LOCUS_07430 3076 2771 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173338.1 protein_id gnl|my_center|LOCUS_07430 4907 3066 gene locus_tag LOCUS_07440 4907 3066 CDS product V-type ATPase 116kDa subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228564.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence094 961 749 gene locus_tag LOCUS_07450 961 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1618 974 gene locus_tag LOCUS_07460 gene rpe 1618 974 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589959.1 protein_id gnl|my_center|LOCUS_07460 2181 1618 gene locus_tag LOCUS_07470 2181 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 2456 2214 gene locus_tag LOCUS_07480 2456 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3123 2458 gene locus_tag LOCUS_07490 3123 2458 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583598.1 protein_id gnl|my_center|LOCUS_07490 3800 3129 gene locus_tag LOCUS_07500 3800 3129 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867624.1 protein_id gnl|my_center|LOCUS_07500 4565 5219 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcggaagactacccataggggaatggcgac >Feature sequence095 722 144 gene locus_tag LOCUS_07510 gene pdxH 722 144 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918802.1 protein_id gnl|my_center|LOCUS_07510 1049 741 gene locus_tag LOCUS_07520 1049 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 1400 1092 gene locus_tag LOCUS_07530 1400 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 1816 2289 gene locus_tag LOCUS_07540 1816 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 2335 2670 gene locus_tag LOCUS_07550 2335 2670 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976256.1 protein_id gnl|my_center|LOCUS_07550 2702 2908 gene locus_tag LOCUS_07560 2702 2908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 2905 4830 gene locus_tag LOCUS_07570 2905 4830 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880789.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence096 178 693 gene locus_tag LOCUS_07580 gene pgsA 178 693 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966859.1 protein_id gnl|my_center|LOCUS_07580 1596 697 gene locus_tag LOCUS_07590 gene era 1596 697 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546764.1 protein_id gnl|my_center|LOCUS_07590 1972 1727 gene locus_tag LOCUS_07600 1972 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 2240 3484 gene locus_tag LOCUS_07610 gene ahcY 2240 3484 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_07610 3481 4620 gene locus_tag LOCUS_07620 3481 4620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence097 198 2450 gene locus_tag LOCUS_07630 198 2450 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918700.1 protein_id gnl|my_center|LOCUS_07630 3323 4786 gene locus_tag LOCUS_07640 3323 4786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence098 194 1507 gene locus_tag LOCUS_07650 194 1507 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940529.1 protein_id gnl|my_center|LOCUS_07650 1520 2545 gene locus_tag LOCUS_07660 gene cydB 1520 2545 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_07660 3341 3718 gene locus_tag LOCUS_07670 3341 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 5074 3695 gene locus_tag LOCUS_07680 5074 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 >Feature sequence099 1389 1027 gene locus_tag LOCUS_07690 1389 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2105 1401 gene locus_tag LOCUS_07700 2105 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 4069 2105 gene locus_tag LOCUS_07710 4069 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4331 4080 gene locus_tag LOCUS_07720 4331 4080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 4623 4354 gene locus_tag LOCUS_07730 gene cas2 4623 4354 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_07730 4865 5099 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccaatccccattgggtagttctccgacttt >Feature sequence100 2442 2092 gene locus_tag LOCUS_07740 2442 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 3100 2432 gene locus_tag LOCUS_07750 3100 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 3254 3871 gene locus_tag LOCUS_07760 3254 3871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 3805 4728 gene locus_tag LOCUS_07770 gene xerD 3805 4728 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence101 1014 2009 gene locus_tag LOCUS_07780 1014 2009 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_07780 3044 2286 gene locus_tag LOCUS_07790 3044 2286 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880910.1 protein_id gnl|my_center|LOCUS_07790 3813 3007 gene locus_tag LOCUS_07800 3813 3007 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880910.1 protein_id gnl|my_center|LOCUS_07800 3909 4616 gene locus_tag LOCUS_07810 3909 4616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence102 1701 1096 gene locus_tag LOCUS_07820 1701 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 1943 2314 gene locus_tag LOCUS_07830 1943 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2311 3789 gene locus_tag LOCUS_07840 2311 3789 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870741.1 protein_id gnl|my_center|LOCUS_07840 3791 4687 gene locus_tag LOCUS_07850 3791 4687 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986194.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence103 2477 1518 gene locus_tag LOCUS_07860 2477 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3597 3767 gene locus_tag LOCUS_07870 3597 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 4409 4546 gene locus_tag LOCUS_07880 4409 4546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence104 4415 885 gene locus_tag LOCUS_07890 4415 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence105 206 1618 gene locus_tag LOCUS_07900 gene gatA 206 1618 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880108.1 protein_id gnl|my_center|LOCUS_07900 1599 3131 gene locus_tag LOCUS_07910 1599 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 3731 3135 gene locus_tag LOCUS_07920 3731 3135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 4279 3722 gene locus_tag LOCUS_07930 4279 3722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence106 627 190 gene locus_tag LOCUS_07940 627 190 CDS product divergent PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810945.1 protein_id gnl|my_center|LOCUS_07940 1447 620 gene locus_tag LOCUS_07950 1447 620 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140419.1 protein_id gnl|my_center|LOCUS_07950 2473 1460 gene locus_tag LOCUS_07960 2473 1460 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 protein_id gnl|my_center|LOCUS_07960 2560 2474 gene locus_tag LOCUS_t00210 2560 2474 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2916 2833 gene locus_tag LOCUS_t00220 2916 2833 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3216 4520 gene locus_tag LOCUS_07970 gene asnS 3216 4520 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_07970 >Feature sequence107 898 275 gene locus_tag LOCUS_07980 898 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1568 885 gene locus_tag LOCUS_07990 1568 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 3098 1623 gene locus_tag LOCUS_08000 3098 1623 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545685.1 protein_id gnl|my_center|LOCUS_08000 4113 3091 gene locus_tag LOCUS_08010 4113 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 4664 4113 gene locus_tag LOCUS_08020 4664 4113 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081962.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence108 1875 1510 gene locus_tag LOCUS_08030 1875 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2600 1872 gene locus_tag LOCUS_08040 2600 1872 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_08040 4229 2622 gene locus_tag LOCUS_08050 4229 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 4501 4232 gene locus_tag LOCUS_08060 4501 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence109 2191 923 gene locus_tag LOCUS_08070 2191 923 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_08070 2458 3654 gene locus_tag LOCUS_08080 2458 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 4747 3701 gene locus_tag LOCUS_08090 4747 3701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence110 <1 532 gene locus_tag LOCUS_08100 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880031.1:cytochrome-c peroxidase 1249 566 gene locus_tag LOCUS_08110 gene sfsA 1249 566 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_08110 1908 1246 gene locus_tag LOCUS_08120 1908 1246 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403642.1 protein_id gnl|my_center|LOCUS_08120 2036 2278 gene locus_tag LOCUS_08130 2036 2278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 2334 3506 gene locus_tag LOCUS_08140 gene lhgO 2334 3506 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_08140 4730 3525 gene locus_tag LOCUS_08150 4730 3525 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000167314.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence111 1254 505 gene locus_tag LOCUS_08160 gene lpxA 1254 505 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_08160 2252 1251 gene locus_tag LOCUS_08170 2252 1251 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966462.1 protein_id gnl|my_center|LOCUS_08170 3562 2240 gene locus_tag LOCUS_08180 gene radA 3562 2240 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545683.1 protein_id gnl|my_center|LOCUS_08180 4446 3562 gene locus_tag LOCUS_08190 4446 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 >Feature sequence112 14 787 gene locus_tag LOCUS_08200 14 787 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963758.1 protein_id gnl|my_center|LOCUS_08200 3042 796 gene locus_tag LOCUS_08210 3042 796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 <4851 3241 gene locus_tag LOCUS_08220 <4851 3241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880268.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence113 596 513 gene locus_tag LOCUS_t00230 596 513 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1701 835 gene locus_tag LOCUS_08230 gene rsmH 1701 835 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080729.1 protein_id gnl|my_center|LOCUS_08230 3343 1688 gene locus_tag LOCUS_08240 3343 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 3978 4051 gene locus_tag LOCUS_t00240 3978 4051 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 4069 4473 gene locus_tag LOCUS_08250 4069 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence114 1420 185 gene locus_tag LOCUS_08260 1420 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 2517 1618 gene locus_tag LOCUS_08270 2517 1618 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_08270 3289 2498 gene locus_tag LOCUS_08280 3289 2498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 3992 3333 gene locus_tag LOCUS_08290 3992 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 4585 3989 gene locus_tag LOCUS_08300 4585 3989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 4786 4586 gene locus_tag LOCUS_08310 4786 4586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence115 630 136 gene locus_tag LOCUS_08320 630 136 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583986.1 protein_id gnl|my_center|LOCUS_08320 1014 736 gene locus_tag LOCUS_08330 1014 736 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545173.1 protein_id gnl|my_center|LOCUS_08330 1133 1945 gene locus_tag LOCUS_08340 gene xerD 1133 1945 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204200.1 protein_id gnl|my_center|LOCUS_08340 2554 1922 gene locus_tag LOCUS_08350 2554 1922 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_08350 2886 3866 gene locus_tag LOCUS_08360 2886 3866 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880856.1 protein_id gnl|my_center|LOCUS_08360 3888 4193 gene locus_tag LOCUS_08370 3888 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 4263 4173 gene locus_tag LOCUS_t00250 4263 4173 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4549 4292 gene locus_tag LOCUS_08380 4549 4292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08380 >Feature sequence116 306 1100 gene locus_tag LOCUS_08390 gene speB 306 1100 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808139.1 protein_id gnl|my_center|LOCUS_08390 1122 2102 gene locus_tag LOCUS_08400 1122 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2099 3574 gene locus_tag LOCUS_08410 gene lnt 2099 3574 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence117 1475 315 gene locus_tag LOCUS_08420 gene acdA 1475 315 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000545544.1 protein_id gnl|my_center|LOCUS_08420 4610 1485 gene locus_tag LOCUS_08430 4610 1485 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883927.1 protein_id gnl|my_center|LOCUS_08430 >Feature sequence118 286 17 gene locus_tag LOCUS_08440 286 17 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002987671.1 protein_id gnl|my_center|LOCUS_08440 1247 273 gene locus_tag LOCUS_08450 1247 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2284 1271 gene locus_tag LOCUS_08460 2284 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 3005 3616 gene locus_tag LOCUS_08470 3005 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3592 3969 gene locus_tag LOCUS_08480 gene rsfS 3592 3969 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633572.1 protein_id gnl|my_center|LOCUS_08480 4666 3977 gene locus_tag LOCUS_08490 4666 3977 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249637.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence119 985 497 gene locus_tag LOCUS_08500 985 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2163 997 gene locus_tag LOCUS_08510 2163 997 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256474.1 protein_id gnl|my_center|LOCUS_08510 2433 3968 gene locus_tag LOCUS_08520 2433 3968 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546463.1 protein_id gnl|my_center|LOCUS_08520 <4728 3959 gene locus_tag LOCUS_08530 <4728 3959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880663.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA >Feature sequence120 1233 385 gene locus_tag LOCUS_08540 1233 385 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940917.1 protein_id gnl|my_center|LOCUS_08540 1982 1230 gene locus_tag LOCUS_08550 1982 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 2629 1979 gene locus_tag LOCUS_08560 gene dapB 2629 1979 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_08560 2739 3182 gene locus_tag LOCUS_08570 gene mscL 2739 3182 CDS product large conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943421.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence121 2910 3806 gene locus_tag LOCUS_08580 2910 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence122 1074 298 gene locus_tag LOCUS_08590 gene phnE 1074 298 CDS product phosphonate ABC transporter, permease protein PhnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001000750.1 protein_id gnl|my_center|LOCUS_08590 1805 1059 gene locus_tag LOCUS_08600 gene phnC 1805 1059 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_08600 1951 2718 gene locus_tag LOCUS_08610 gene cdaA 1951 2718 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_08610 2705 3370 gene locus_tag LOCUS_08620 2705 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 3327 4433 gene locus_tag LOCUS_08630 gene ispD 3327 4433 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546162.1 protein_id gnl|my_center|LOCUS_08630 >Feature sequence123 2903 1830 gene locus_tag LOCUS_08640 2903 1830 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023151.1 protein_id gnl|my_center|LOCUS_08640 4211 3057 gene locus_tag LOCUS_08650 4211 3057 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259012.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence124 354 1067 gene locus_tag LOCUS_08660 354 1067 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868133.1 protein_id gnl|my_center|LOCUS_08660 1027 1827 gene locus_tag LOCUS_08670 1027 1827 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003695633.1 protein_id gnl|my_center|LOCUS_08670 1880 3034 gene locus_tag LOCUS_08680 1880 3034 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879620.1 protein_id gnl|my_center|LOCUS_08680 3031 3594 gene locus_tag LOCUS_08690 gene coaE 3031 3594 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029495251.1 protein_id gnl|my_center|LOCUS_08690 3591 4433 gene locus_tag LOCUS_08700 3591 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence125 914 1762 gene locus_tag LOCUS_08710 914 1762 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881303.1 protein_id gnl|my_center|LOCUS_08710 1773 2891 gene locus_tag LOCUS_08720 1773 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 2854 4056 gene locus_tag LOCUS_08730 2854 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence126 1859 1125 gene locus_tag LOCUS_08740 1859 1125 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250628.1 protein_id gnl|my_center|LOCUS_08740 2020 2709 gene locus_tag LOCUS_08750 2020 2709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 4267 2732 gene locus_tag LOCUS_08760 4267 2732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence127 <1 1834 gene locus_tag LOCUS_08770 <1 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114867.1:copper resistance system multicopper oxidase >Feature sequence128 913 116 gene locus_tag LOCUS_08780 913 116 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258499.1 protein_id gnl|my_center|LOCUS_08780 1418 2299 gene locus_tag LOCUS_08790 gene rfbA 1418 2299 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877393.1 protein_id gnl|my_center|LOCUS_08790 2292 2837 gene locus_tag LOCUS_08800 gene rfbC 2292 2837 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_08800 2825 4000 gene locus_tag LOCUS_08810 2825 4000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence129 <1 1143 gene locus_tag LOCUS_08820 <1 1143 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880318.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1420 1917 gene locus_tag LOCUS_08830 1420 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 2076 4067 gene locus_tag LOCUS_08840 gene nosZ 2076 4067 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence130 1055 306 gene locus_tag LOCUS_08850 1055 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 1107 1820 gene locus_tag LOCUS_08860 gene truA 1107 1820 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966380.1 protein_id gnl|my_center|LOCUS_08860 3436 1811 gene locus_tag LOCUS_08870 3436 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence131 554 1102 gene locus_tag LOCUS_08880 554 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2025 1333 gene locus_tag LOCUS_08890 2025 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2663 2022 gene locus_tag LOCUS_08900 2663 2022 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582678.1 protein_id gnl|my_center|LOCUS_08900 3964 2681 gene locus_tag LOCUS_08910 3964 2681 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880977.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence132 3864 3478 gene locus_tag LOCUS_08920 gene rplL 3864 3478 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence133 543 471 gene locus_tag LOCUS_t00260 543 471 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1243 965 gene locus_tag LOCUS_08930 1243 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2139 1240 gene locus_tag LOCUS_08940 2139 1240 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081596.1 protein_id gnl|my_center|LOCUS_08940 3122 2106 gene locus_tag LOCUS_08950 gene mltG 3122 2106 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933876.1 protein_id gnl|my_center|LOCUS_08950 <4272 3119 gene locus_tag LOCUS_08960 <4272 3119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228994.1:glutamine--fructose-6-phosphate transaminase (isomerizing) >Feature sequence134 2414 222 gene locus_tag LOCUS_08970 2414 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3326 2421 gene locus_tag LOCUS_08980 3326 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 3773 3327 gene locus_tag LOCUS_08990 gene rpiB 3773 3327 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080405.1 protein_id gnl|my_center|LOCUS_08990 4266 3691 gene locus_tag LOCUS_09000 4266 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence135 538 170 gene locus_tag LOCUS_09010 538 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 2422 560 gene locus_tag LOCUS_09020 gene asnB 2422 560 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868273.1 protein_id gnl|my_center|LOCUS_09020 3892 2429 gene locus_tag LOCUS_09030 3892 2429 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582544.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence136 1906 221 gene locus_tag LOCUS_09040 1906 221 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_09040 3880 1940 gene locus_tag LOCUS_09050 3880 1940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence137 2153 708 gene locus_tag LOCUS_09060 2153 708 CDS product glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228022.1 protein_id gnl|my_center|LOCUS_09060 3518 2625 gene locus_tag LOCUS_09070 3518 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 3859 3542 gene locus_tag LOCUS_09080 3859 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 >Feature sequence138 1074 25 gene locus_tag LOCUS_09090 1074 25 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526112.1 protein_id gnl|my_center|LOCUS_09090 2198 1059 gene locus_tag LOCUS_09100 2198 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 3340 2204 gene locus_tag LOCUS_09110 3340 2204 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496748.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence139 <1 1304 gene locus_tag LOCUS_09120 <1 1304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582491.1:phosphomannomutase/phosphoglucomutase 1394 1756 gene locus_tag LOCUS_09130 1394 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2025 1768 gene locus_tag LOCUS_09140 2025 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 2048 2674 gene locus_tag LOCUS_09150 gene radC 2048 2674 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881044.1 protein_id gnl|my_center|LOCUS_09150 3127 4059 gene locus_tag LOCUS_09160 3127 4059 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405853.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence140 113 1186 gene locus_tag LOCUS_09170 113 1186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 1199 2770 gene locus_tag LOCUS_09180 1199 2770 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence141 <1 1861 gene locus_tag LOCUS_09190 <1 1861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938574.1:ATP-dependent zinc metalloprotease FtsH 2817 1858 gene locus_tag LOCUS_09200 gene hldA 2817 1858 CDS product ADP-heptose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217546.1 protein_id gnl|my_center|LOCUS_09200 3410 2814 gene locus_tag LOCUS_09210 3410 2814 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000372459.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence142 1628 657 gene locus_tag LOCUS_09220 gene cas7i 1628 657 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_09220 3654 1618 gene locus_tag LOCUS_09230 3654 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 >Feature sequence143 976 1051 gene locus_tag LOCUS_t00270 976 1051 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1640 1059 gene locus_tag LOCUS_09240 1640 1059 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545229.1 protein_id gnl|my_center|LOCUS_09240 2008 1637 gene locus_tag LOCUS_09250 2008 1637 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888655.1 protein_id gnl|my_center|LOCUS_09250 3862 2027 gene locus_tag LOCUS_09260 3862 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 >Feature sequence144 567 3398 gene locus_tag LOCUS_09270 567 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence145 1715 606 gene locus_tag LOCUS_09280 1715 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2501 1740 gene locus_tag LOCUS_09290 2501 1740 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768560.1 protein_id gnl|my_center|LOCUS_09290 2574 2502 gene locus_tag LOCUS_t00280 2574 2502 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence146 1134 448 gene locus_tag LOCUS_09300 1134 448 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932277.1 protein_id gnl|my_center|LOCUS_09300 2056 1109 gene locus_tag LOCUS_09310 2056 1109 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_09310 2110 3564 gene locus_tag LOCUS_09320 gene dnaX 2110 3564 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081077.1 protein_id gnl|my_center|LOCUS_09320 3568 3897 gene locus_tag LOCUS_09330 3568 3897 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546807.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence147 2361 58 gene locus_tag LOCUS_09340 2361 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 3519 2383 gene locus_tag LOCUS_09350 3519 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence148 1644 1060 gene locus_tag LOCUS_09360 1644 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2470 1622 gene locus_tag LOCUS_09370 2470 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 2623 3705 gene locus_tag LOCUS_09380 2623 3705 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965395.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence149 2342 399 gene locus_tag LOCUS_09390 2342 399 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000806472.1 protein_id gnl|my_center|LOCUS_09390 2431 2748 gene locus_tag LOCUS_09400 2431 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 >Feature sequence150 177 773 gene locus_tag LOCUS_09410 gene plsY 177 773 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880403.1 protein_id gnl|my_center|LOCUS_09410 813 1325 gene locus_tag LOCUS_09420 813 1325 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880367.1 protein_id gnl|my_center|LOCUS_09420 1338 2018 gene locus_tag LOCUS_09430 1338 2018 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583126.1 protein_id gnl|my_center|LOCUS_09430 2021 2230 gene locus_tag LOCUS_09440 2021 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2223 3239 gene locus_tag LOCUS_09450 gene plsX 2223 3239 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_09450 <3945 3244 gene locus_tag LOCUS_09460 <3945 3244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881444.1:undecaprenyl-diphosphatase UppP >Feature sequence151 <1 699 gene locus_tag LOCUS_09470 <1 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986803.1:FAD/NAD(P)-binding protein 2068 821 gene locus_tag LOCUS_09480 2068 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2347 2910 gene locus_tag LOCUS_09490 2347 2910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3482 2928 gene locus_tag LOCUS_09500 3482 2928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence152 310 1008 gene locus_tag LOCUS_09510 310 1008 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880134.1 protein_id gnl|my_center|LOCUS_09510 2295 985 gene locus_tag LOCUS_09520 2295 985 CDS product undecaprenyl-phosphate galactose phosphotransferase WbaP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368710.1 protein_id gnl|my_center|LOCUS_09520 3513 2302 gene locus_tag LOCUS_09530 3513 2302 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228201.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence153 29 982 gene locus_tag LOCUS_09540 29 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 1940 1005 gene locus_tag LOCUS_09550 1940 1005 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870998.1 protein_id gnl|my_center|LOCUS_09550 3628 1937 gene locus_tag LOCUS_09560 3628 1937 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904125.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence154 144 1340 gene locus_tag LOCUS_09570 144 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 1344 1874 gene locus_tag LOCUS_09580 1344 1874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 >Feature sequence155 1085 306 gene locus_tag LOCUS_09590 1085 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1163 2362 gene locus_tag LOCUS_09600 gene tig 1163 2362 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930702.1 protein_id gnl|my_center|LOCUS_09600 2365 2712 gene locus_tag LOCUS_09610 2365 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 3259 2726 gene locus_tag LOCUS_09620 3259 2726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 3800 3222 gene locus_tag LOCUS_09630 gene gmhA 3800 3222 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205222.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence156 325 1992 gene locus_tag LOCUS_09640 325 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2012 3298 gene locus_tag LOCUS_09650 gene dacB 2012 3298 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201838.1 protein_id gnl|my_center|LOCUS_09650 3305 3790 gene locus_tag LOCUS_09660 3305 3790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence157 1236 2483 gene locus_tag LOCUS_09670 1236 2483 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_09670 2480 2956 gene locus_tag LOCUS_09680 2480 2956 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338789.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence158 453 1235 gene locus_tag LOCUS_09690 gene prmC 453 1235 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081478.1 protein_id gnl|my_center|LOCUS_09690 1375 2409 gene locus_tag LOCUS_09700 1375 2409 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879978.1 protein_id gnl|my_center|LOCUS_09700 2432 3511 gene locus_tag LOCUS_09710 2432 3511 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003640873.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence159 1197 2615 gene locus_tag LOCUS_09720 gene gltX 1197 2615 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_09720 2615 3040 gene locus_tag LOCUS_09730 2615 3040 CDS product bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902274.1 protein_id gnl|my_center|LOCUS_09730 3042 3542 gene locus_tag LOCUS_09740 3042 3542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence160 1621 1854 gene locus_tag LOCUS_09750 1621 1854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2841 1861 gene locus_tag LOCUS_09760 2841 1861 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence161 463 924 gene locus_tag LOCUS_09770 463 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 1222 1395 gene locus_tag LOCUS_09780 1222 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1796 1470 gene locus_tag LOCUS_09790 1796 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 <3710 1868 gene locus_tag LOCUS_09800 <3710 1868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258712.1:SBBP repeat-containing protein >Feature sequence162 <1 625 gene locus_tag LOCUS_09810 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784415.1:DUF4476 domain-containing protein 600 1154 gene locus_tag LOCUS_09820 600 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1165 1950 gene locus_tag LOCUS_09830 1165 1950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1959 2957 gene locus_tag LOCUS_09840 1959 2957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2954 3430 gene locus_tag LOCUS_09850 2954 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence163 2656 560 gene locus_tag LOCUS_09860 2656 560 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545662.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence164 252 1511 gene locus_tag LOCUS_09870 252 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 1514 3061 gene locus_tag LOCUS_09880 gene recJ 1514 3061 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence165 <1 1363 gene locus_tag LOCUS_09890 <1 1363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927134.1:DUF2723 domain-containing protein 1365 2483 gene locus_tag LOCUS_09900 1365 2483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence166 885 1910 gene locus_tag LOCUS_09910 885 1910 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545565.1 protein_id gnl|my_center|LOCUS_09910 2767 2012 gene locus_tag LOCUS_09920 2767 2012 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891672.1 protein_id gnl|my_center|LOCUS_09920 3279 2743 gene locus_tag LOCUS_09930 3279 2743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence167 373 552 gene locus_tag LOCUS_09940 373 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 788 570 gene locus_tag LOCUS_09950 788 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 884 2224 gene locus_tag LOCUS_09960 gene gcvPA 884 2224 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393441.1 protein_id gnl|my_center|LOCUS_09960 2226 2630 gene locus_tag LOCUS_09970 gene ribE 2226 2630 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001008549.1 protein_id gnl|my_center|LOCUS_09970 3386 2604 gene locus_tag LOCUS_09980 3386 2604 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence168 863 78 gene locus_tag LOCUS_09990 863 78 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582729.1 protein_id gnl|my_center|LOCUS_09990 898 2223 gene locus_tag LOCUS_10000 898 2223 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_10000 2264 2422 gene locus_tag LOCUS_10010 2264 2422 CDS product DUF1427 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417708.1 protein_id gnl|my_center|LOCUS_10010 2470 3363 gene locus_tag LOCUS_10020 2470 3363 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence169 <1 1073 gene locus_tag LOCUS_10030 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963010.1:phosphoglucosamine mutase 2430 1102 gene locus_tag LOCUS_10040 2430 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3270 2464 gene locus_tag LOCUS_10050 3270 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence170 1916 1539 gene locus_tag LOCUS_10060 1916 1539 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001278842.1 protein_id gnl|my_center|LOCUS_10060 3119 1944 gene locus_tag LOCUS_10070 3119 1944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence171 1018 401 gene locus_tag LOCUS_10080 1018 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3297 1099 gene locus_tag LOCUS_10090 3297 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence172 2230 1883 gene locus_tag LOCUS_10100 2230 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 2458 2252 gene locus_tag LOCUS_10110 gene rpmI 2458 2252 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082029.1 protein_id gnl|my_center|LOCUS_10110 3527 2520 gene locus_tag LOCUS_10120 3527 2520 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108151.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence173 799 155 gene locus_tag LOCUS_10130 799 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1601 816 gene locus_tag LOCUS_10140 1601 816 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880957.1 protein_id gnl|my_center|LOCUS_10140 <3522 1685 gene locus_tag LOCUS_10150 <3522 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986787.1:polyribonucleotide nucleotidyltransferase >Feature sequence174 <1 2016 gene locus_tag LOCUS_10160 <1 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762065.1:efflux RND transporter permease subunit 2074 2754 gene locus_tag LOCUS_10170 2074 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2762 3037 gene locus_tag LOCUS_10180 2762 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 >Feature sequence175 <1 2006 gene locus_tag LOCUS_10190 <1 2006 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233919.1:DNA helicase PcrA 2470 2003 gene locus_tag LOCUS_10200 2470 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 2835 2467 gene locus_tag LOCUS_10210 2835 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 2992 3432 gene locus_tag LOCUS_10220 2992 3432 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249701.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence176 1089 76 gene locus_tag LOCUS_10230 gene pstS 1089 76 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881320.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence177 >Feature sequence178 2 817 gene locus_tag LOCUS_10240 2 817 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081773.1 protein_id gnl|my_center|LOCUS_10240 905 1993 gene locus_tag LOCUS_10250 905 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2871 2113 gene locus_tag LOCUS_10260 2871 2113 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence179 <1 834 gene locus_tag LOCUS_10270 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391318.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase 850 1245 gene locus_tag LOCUS_10280 gene ruvX 850 1245 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259679.1 protein_id gnl|my_center|LOCUS_10280 1305 1445 gene locus_tag LOCUS_10290 1305 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1427 1621 gene locus_tag LOCUS_10300 1427 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1804 2475 gene locus_tag LOCUS_10310 1804 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2459 3100 gene locus_tag LOCUS_10320 2459 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence180 <1 1605 gene locus_tag LOCUS_10330 <1 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942344.1:NADP-dependent malic enzyme >Feature sequence181 2254 1067 gene locus_tag LOCUS_10340 2254 1067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 <3321 2342 gene locus_tag LOCUS_10350 <3321 2342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007328922.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence182 1563 895 gene locus_tag LOCUS_10360 1563 895 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881257.1 protein_id gnl|my_center|LOCUS_10360 1961 1560 gene locus_tag LOCUS_10370 1961 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3134 1971 gene locus_tag LOCUS_10380 3134 1971 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027828.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence183 673 1656 gene locus_tag LOCUS_10390 673 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence184 148 1050 gene locus_tag LOCUS_10400 148 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1820 2539 gene locus_tag LOCUS_10410 1820 2539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2554 3066 gene locus_tag LOCUS_10420 2554 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence185 750 433 gene locus_tag LOCUS_10430 750 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 2827 806 gene locus_tag LOCUS_10440 2827 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3086 2817 gene locus_tag LOCUS_10450 3086 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence186 1084 653 gene locus_tag LOCUS_10460 gene rplK 1084 653 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_10460 1681 1100 gene locus_tag LOCUS_10470 gene nusG 1681 1100 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384125.1 protein_id gnl|my_center|LOCUS_10470 1890 1699 gene locus_tag LOCUS_10480 gene secE 1890 1699 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390511.1 protein_id gnl|my_center|LOCUS_10480 2045 1896 gene locus_tag LOCUS_10490 gene rpmG 2045 1896 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_10490 2151 2077 gene locus_tag LOCUS_t00290 2151 2077 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2238 2163 gene locus_tag LOCUS_t00300 2238 2163 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3158 2430 gene locus_tag LOCUS_10500 3158 2430 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980932.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence187 1031 393 gene locus_tag LOCUS_10510 1031 393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence188 <1 774 gene locus_tag LOCUS_10520 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003690033.1:RIP metalloprotease RseP 753 1037 gene locus_tag LOCUS_10530 753 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1092 3176 gene locus_tag LOCUS_10540 gene rnr 1092 3176 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881339.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence189 2234 273 gene locus_tag LOCUS_10550 2234 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 >Feature sequence190 710 1072 gene locus_tag LOCUS_10560 gene acpS 710 1072 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882961.1 protein_id gnl|my_center|LOCUS_10560 1294 1088 gene locus_tag LOCUS_10570 1294 1088 CDS product CDGSH iron-sulfur domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227652.1 protein_id gnl|my_center|LOCUS_10570 2294 1284 gene locus_tag LOCUS_10580 2294 1284 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867187.1 protein_id gnl|my_center|LOCUS_10580 2715 2296 gene locus_tag LOCUS_10590 2715 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence191 324 1076 gene locus_tag LOCUS_10600 324 1076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_10600 2494 1421 gene locus_tag LOCUS_10610 2494 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence192 1410 487 gene locus_tag LOCUS_10620 1410 487 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_10620 2117 1488 gene locus_tag LOCUS_10630 2117 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967367.1 protein_id gnl|my_center|LOCUS_10630 <3062 2537 gene locus_tag LOCUS_10640 <3062 2537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888996.1:dihydrolipoyl dehydrogenase >Feature sequence193 >Feature sequence194 268 2085 gene locus_tag LOCUS_10650 gene asnB 268 2085 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003703387.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence195 949 401 gene locus_tag LOCUS_10660 949 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1913 903 gene locus_tag LOCUS_10670 gene murG 1913 903 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880740.1 protein_id gnl|my_center|LOCUS_10670 2685 1906 gene locus_tag LOCUS_10680 gene panB 2685 1906 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence196 1191 607 gene locus_tag LOCUS_10690 1191 607 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147367246.1 protein_id gnl|my_center|LOCUS_10690 1771 1154 gene locus_tag LOCUS_10700 gene pgsA 1771 1154 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 protein_id gnl|my_center|LOCUS_10700 2759 1758 gene locus_tag LOCUS_10710 gene lpxD 2759 1758 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583184.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence197 1024 68 gene locus_tag LOCUS_10720 1024 68 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083050.1 protein_id gnl|my_center|LOCUS_10720 2803 1037 gene locus_tag LOCUS_10730 gene uvrC 2803 1037 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876080.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence198 1116 2798 gene locus_tag LOCUS_10740 1116 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence199 1043 483 gene locus_tag LOCUS_10750 gene efp 1043 483 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583400.1 protein_id gnl|my_center|LOCUS_10750 1126 1677 gene locus_tag LOCUS_10760 1126 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 2689 1694 gene locus_tag LOCUS_10770 2689 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence200 811 314 gene locus_tag LOCUS_10780 811 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 2340 862 gene locus_tag LOCUS_10790 2340 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence201 284 1384 gene locus_tag LOCUS_10800 gene lptG 284 1384 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870030.1 protein_id gnl|my_center|LOCUS_10800 2108 1368 gene locus_tag LOCUS_10810 2108 1368 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941690.1 protein_id gnl|my_center|LOCUS_10810 2131 >2953 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcacattccacacaggtcagatgaggac >Feature sequence202 1505 654 gene locus_tag LOCUS_10820 1505 654 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173325.1 protein_id gnl|my_center|LOCUS_10820 <2939 1864 gene locus_tag LOCUS_10830 <2939 1864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082160.1:pyrimidine-nucleoside phosphorylase >Feature sequence203 <1 595 gene locus_tag LOCUS_10840 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083171.1:aminopeptidase 602 1546 gene locus_tag LOCUS_10850 602 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1543 2604 gene locus_tag LOCUS_10860 1543 2604 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250672.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence204 1170 904 gene locus_tag LOCUS_10870 1170 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 <2869 1161 gene locus_tag LOCUS_10880 <2869 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114291.1:heme lyase CcmF/NrfE family subunit >Feature sequence205 840 1880 gene locus_tag LOCUS_10890 840 1880 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_10890 1906 2079 gene locus_tag LOCUS_10900 1906 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 2121 2363 gene locus_tag LOCUS_10910 2121 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence206 <2819 768 gene locus_tag LOCUS_10920 <2819 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence207 2469 703 gene locus_tag LOCUS_10930 2469 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 >Feature sequence208 58 594 gene locus_tag LOCUS_10940 58 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 954 1925 gene locus_tag LOCUS_10950 954 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_10950 >Feature sequence209 588 977 gene locus_tag LOCUS_10960 588 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence210 342 989 gene locus_tag LOCUS_10970 342 989 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_10970 1247 1456 gene locus_tag LOCUS_10980 1247 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 <2773 1481 gene locus_tag LOCUS_10990 <2773 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016727.1:TonB-dependent receptor >Feature sequence211 <1 1099 gene locus_tag LOCUS_11000 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010971276.1:saccharopine dehydrogenase family protein 1104 2516 gene locus_tag LOCUS_11010 gene gatB 1104 2516 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880264.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence212 2 334 gene locus_tag LOCUS_11020 2 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 334 1167 gene locus_tag LOCUS_11030 334 1167 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867380.1 protein_id gnl|my_center|LOCUS_11030 2078 1164 gene locus_tag LOCUS_11040 2078 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence213 813 19 gene locus_tag LOCUS_11050 813 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 <2732 830 gene locus_tag LOCUS_11060 <2732 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_158298054.1:Eco57I restriction-modification methylase domain-containing protein >Feature sequence214 348 1202 gene locus_tag LOCUS_11070 348 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 1199 1852 gene locus_tag LOCUS_11080 1199 1852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1907 2398 gene locus_tag LOCUS_11090 gene lspA 1907 2398 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390715.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence215 >Feature sequence216 <1 546 gene locus_tag LOCUS_11100 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003243908.1:formimidoylglutamase 561 1259 gene locus_tag LOCUS_11110 gene lepB 561 1259 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_11110 1259 1477 gene locus_tag LOCUS_11120 1259 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1464 1943 gene locus_tag LOCUS_11130 1464 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence217 >Feature sequence218 1624 335 gene locus_tag LOCUS_11140 1624 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533119.1 protein_id gnl|my_center|LOCUS_11140 2304 1744 gene locus_tag LOCUS_11150 2304 1744 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813216.1 protein_id gnl|my_center|LOCUS_11150 2663 2295 gene locus_tag LOCUS_11160 2663 2295 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence219 <1 731 gene locus_tag LOCUS_11170 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057638.1:CapA family protein 928 2622 gene locus_tag LOCUS_11180 928 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence220 780 205 gene locus_tag LOCUS_11190 780 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2236 830 gene locus_tag LOCUS_11200 gene glnA 2236 830 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_11200 2388 2315 gene locus_tag LOCUS_t00310 2388 2315 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence221 164 1519 gene locus_tag LOCUS_11210 164 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence222 >Feature sequence223 1554 1303 gene locus_tag LOCUS_11220 1554 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence224 1069 497 gene locus_tag LOCUS_11230 1069 497 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173882.1 protein_id gnl|my_center|LOCUS_11230 1614 1069 gene locus_tag LOCUS_11240 gene def 1614 1069 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392416.1 protein_id gnl|my_center|LOCUS_11240 1920 1618 gene locus_tag LOCUS_11250 1920 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2330 1917 gene locus_tag LOCUS_11260 gene speD 2330 1917 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868894.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence225 43 780 gene locus_tag LOCUS_11270 43 780 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147802.1 protein_id gnl|my_center|LOCUS_11270 977 2470 gene locus_tag LOCUS_11280 977 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence226 24 638 gene locus_tag LOCUS_11290 24 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence227 152 1087 gene locus_tag LOCUS_11300 152 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1146 1454 gene locus_tag LOCUS_11310 1146 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 1459 1992 gene locus_tag LOCUS_11320 1459 1992 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000673968.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence228 1457 189 gene locus_tag LOCUS_11330 1457 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2467 1481 gene locus_tag LOCUS_11340 2467 1481 CDS product TIM barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460424.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence229 1575 445 gene locus_tag LOCUS_11350 1575 445 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_11350 <2583 1553 gene locus_tag LOCUS_11360 <2583 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056499.1:ribonuclease R >Feature sequence230 746 228 gene locus_tag LOCUS_11370 746 228 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343928.1 protein_id gnl|my_center|LOCUS_11370 1722 799 gene locus_tag LOCUS_11380 1722 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1800 2363 gene locus_tag LOCUS_11390 1800 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence231 174 863 gene locus_tag LOCUS_11400 gene lipB 174 863 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174104.1 protein_id gnl|my_center|LOCUS_11400 856 1941 gene locus_tag LOCUS_11410 gene bcd 856 1941 CDS product branched-chain amino acid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230309.1 protein_id gnl|my_center|LOCUS_11410 1989 2062 gene locus_tag LOCUS_t00320 1989 2062 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence232 33 107 gene locus_tag LOCUS_t00330 33 107 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1161 109 gene locus_tag LOCUS_11420 1161 109 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583463.1 protein_id gnl|my_center|LOCUS_11420 2348 1161 gene locus_tag LOCUS_11430 2348 1161 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_11430 2564 2364 gene locus_tag LOCUS_11440 2564 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence233 1520 222 gene locus_tag LOCUS_11450 1520 222 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048117.1 protein_id gnl|my_center|LOCUS_11450 2115 1477 gene locus_tag LOCUS_11460 2115 1477 CDS product exopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986982.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence234 >Feature sequence235 499 1005 gene locus_tag LOCUS_11470 499 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2434 1031 gene locus_tag LOCUS_11480 2434 1031 CDS product V-type ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173333.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence236 >Feature sequence237 2215 1061 gene locus_tag LOCUS_11490 gene rlmD 2215 1061 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485149.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence238 663 16 gene locus_tag LOCUS_11500 663 16 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357235.1 protein_id gnl|my_center|LOCUS_11500 1480 728 gene locus_tag LOCUS_11510 gene map 1480 728 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_11510 1987 1505 gene locus_tag LOCUS_11520 1987 1505 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228705.1 protein_id gnl|my_center|LOCUS_11520 2511 1984 gene locus_tag LOCUS_11530 2511 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence239 117 977 gene locus_tag LOCUS_11540 gene hslO 117 977 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228278.1 protein_id gnl|my_center|LOCUS_11540 1552 1289 gene locus_tag LOCUS_11550 1552 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence240 1621 329 gene locus_tag LOCUS_11560 gene rimO 1621 329 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583816.1 protein_id gnl|my_center|LOCUS_11560 2078 1728 gene locus_tag LOCUS_11570 2078 1728 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082088.1 protein_id gnl|my_center|LOCUS_11570 >Feature sequence241 <1 756 gene locus_tag LOCUS_11580 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081967.1:cyclodeaminase/cyclohydrolase family protein 815 1273 gene locus_tag LOCUS_11590 815 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1285 1743 gene locus_tag LOCUS_11600 1285 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence242 508 1107 gene locus_tag LOCUS_11610 508 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 1107 1781 gene locus_tag LOCUS_11620 1107 1781 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939611.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence243 2134 1271 gene locus_tag LOCUS_11630 2134 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence244 99 15 gene locus_tag LOCUS_t00340 99 15 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 587 192 gene locus_tag LOCUS_11640 587 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 1570 710 gene locus_tag LOCUS_11650 gene mtnP 1570 710 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880337.1 protein_id gnl|my_center|LOCUS_11650 1951 1580 gene locus_tag LOCUS_11660 1951 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 2156 1887 gene locus_tag LOCUS_11670 2156 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 >Feature sequence245 2435 1434 gene locus_tag LOCUS_11680 2435 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence246 <1 585 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgccaatccccattgggtagtcttccgac 1374 2240 gene locus_tag LOCUS_11690 gene lipA 1374 2240 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174105.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence247 499 1278 gene locus_tag LOCUS_11700 499 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11700 1250 1780 gene locus_tag LOCUS_11710 gene cas4 1250 1780 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930592.1 protein_id gnl|my_center|LOCUS_11710 1848 2108 gene locus_tag LOCUS_11720 1848 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 2099 2456 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttcacattccacacaggtcagatg >Feature sequence248 1964 1071 gene locus_tag LOCUS_11730 1964 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence249 <1 1150 gene locus_tag LOCUS_11740 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867150.1:ABC transporter substrate-binding protein 1160 2014 gene locus_tag LOCUS_11750 1160 2014 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867149.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence250 1573 908 gene locus_tag LOCUS_11760 1573 908 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881085.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence251 714 196 gene locus_tag LOCUS_11770 gene hpt 714 196 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019306.1 protein_id gnl|my_center|LOCUS_11770 2014 722 gene locus_tag LOCUS_11780 gene rho 2014 722 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545880.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence252 1526 1008 gene locus_tag LOCUS_11790 1526 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 <2422 1501 gene locus_tag LOCUS_11800 <2422 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011182961.1:thioredoxin-disulfide reductase >Feature sequence253 69 563 gene locus_tag LOCUS_11810 69 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 583 1653 gene locus_tag LOCUS_11820 583 1653 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 protein_id gnl|my_center|LOCUS_11820 1852 2352 gene locus_tag LOCUS_11830 1852 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence254 >Feature sequence255 1802 690 gene locus_tag LOCUS_11840 1802 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1879 1806 gene locus_tag LOCUS_t00350 1879 1806 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1969 1885 gene locus_tag LOCUS_t00360 1969 1885 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 2052 1979 gene locus_tag LOCUS_t00370 2052 1979 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence256 1316 429 gene locus_tag LOCUS_11850 1316 429 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902307.1 protein_id gnl|my_center|LOCUS_11850 <2353 1306 gene locus_tag LOCUS_11860 <2353 1306 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000804320.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence257 <2350 319 gene locus_tag LOCUS_11870 <2350 319 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948472.1:NADH-quinone oxidoreductase subunit NuoG >Feature sequence258 >Feature sequence259 <2345 1382 gene locus_tag LOCUS_11880 <2345 1382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868104.1:methionine--tRNA ligase >Feature sequence260 <1 889 gene locus_tag LOCUS_11890 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122543.1:nucleoside transporter C-terminal domain-containing protein 886 1110 gene locus_tag LOCUS_11900 886 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1908 1117 gene locus_tag LOCUS_11910 1908 1117 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence261 1080 67 gene locus_tag LOCUS_11920 1080 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2005 1055 gene locus_tag LOCUS_11930 2005 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence262 209 886 gene locus_tag LOCUS_11940 209 886 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202004.1 protein_id gnl|my_center|LOCUS_11940 1852 887 gene locus_tag LOCUS_11950 1852 887 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence263 <1 716 gene locus_tag LOCUS_11960 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881267.1:DNA-directed RNA polymerase subunit beta >Feature sequence264 <1 799 gene locus_tag LOCUS_11970 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259168.1:M20/M25/M40 family metallo-hydrolase 801 1898 gene locus_tag LOCUS_11980 gene mraY 801 1898 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence265 <1 723 gene locus_tag LOCUS_11990 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392083.1:chaperonin GroEL 789 1673 gene locus_tag LOCUS_12000 789 1673 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582467.1 protein_id gnl|my_center|LOCUS_12000 1676 1912 gene locus_tag LOCUS_12010 1676 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence266 449 1084 gene locus_tag LOCUS_12020 449 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 <2258 1087 gene locus_tag LOCUS_12030 <2258 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545253.1:helicase-related protein >Feature sequence267 1263 325 gene locus_tag LOCUS_12040 1263 325 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942051.1 protein_id gnl|my_center|LOCUS_12040 2029 1244 gene locus_tag LOCUS_12050 2029 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence268 >Feature sequence269 1843 23 gene locus_tag LOCUS_12060 1843 23 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence270 <1 1583 gene locus_tag LOCUS_12070 <1 1583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878662.1:ATP synthase subunit A >Feature sequence271 >Feature sequence272 1437 655 gene locus_tag LOCUS_12080 1437 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1850 1434 gene locus_tag LOCUS_12090 1850 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 >Feature sequence273 262 1506 gene locus_tag LOCUS_12100 262 1506 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_12100 1513 2121 gene locus_tag LOCUS_12110 1513 2121 CDS product MjaI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545491.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence274 <1 977 gene locus_tag LOCUS_12120 <1 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003723609.1:arginine--tRNA ligase 1103 1627 gene locus_tag LOCUS_12130 1103 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 >Feature sequence275 >Feature sequence276 92 176 gene locus_tag LOCUS_t00380 92 176 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 182 255 gene locus_tag LOCUS_t00390 182 255 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 276 581 gene locus_tag LOCUS_12140 276 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 584 1483 gene locus_tag LOCUS_12150 584 1483 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410917.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence277 <1 1072 gene locus_tag LOCUS_12160 <1 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880274.1:serine hydroxymethyltransferase 1103 1720 gene locus_tag LOCUS_12170 1103 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence278 697 1101 gene locus_tag LOCUS_12180 697 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12180 >Feature sequence279 2 370 gene locus_tag LOCUS_12190 2 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 <2198 590 gene locus_tag LOCUS_12200 <2198 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867965.1:methylmalonyl-CoA mutase family protein >Feature sequence280 <1 1999 gene locus_tag LOCUS_12210 <1 1999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258712.1:SBBP repeat-containing protein >Feature sequence281 1455 970 gene locus_tag LOCUS_12220 1455 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 2089 1529 gene locus_tag LOCUS_12230 2089 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808194.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence282 870 184 gene locus_tag LOCUS_12240 gene rsmI 870 184 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_12240 1040 1408 gene locus_tag LOCUS_12250 1040 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 <2177 1368 gene locus_tag LOCUS_12260 <2177 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480207.1:patatin-like phospholipase family protein >Feature sequence283 1009 590 gene locus_tag LOCUS_12270 1009 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1699 1049 gene locus_tag LOCUS_12280 1699 1049 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772758.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence284 <1 772 gene locus_tag LOCUS_12290 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880419.1:molecular chaperone DnaJ 773 1483 gene locus_tag LOCUS_12300 gene rlmB 773 1483 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881235.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence285 <1 722 gene locus_tag LOCUS_12310 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812939.1:recombinase RecA 694 927 gene locus_tag LOCUS_12320 694 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1565 945 gene locus_tag LOCUS_12330 gene ccmB 1565 945 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457672.1 protein_id gnl|my_center|LOCUS_12330 2118 1546 gene locus_tag LOCUS_12340 2118 1546 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878484.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence286 1246 242 gene locus_tag LOCUS_12350 gene tsaD 1246 242 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357496.1 protein_id gnl|my_center|LOCUS_12350 1797 1246 gene locus_tag LOCUS_12360 1797 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 2070 1807 gene locus_tag LOCUS_12370 2070 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence287 >Feature sequence288 >Feature sequence289 118 774 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcggagaactacccaatggggattggcgac 925 1626 gene locus_tag LOCUS_12380 925 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 >Feature sequence290 1 507 gene locus_tag LOCUS_12390 1 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 620 1693 gene locus_tag LOCUS_12400 620 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence291 35 109 gene locus_tag LOCUS_t00400 35 109 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 <2113 117 gene locus_tag LOCUS_12410 <2113 117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797373.1:YfhO family protein >Feature sequence292 <1 736 gene locus_tag LOCUS_12420 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140133.1:oligopeptidase B 774 1421 gene locus_tag LOCUS_12430 774 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1767 1606 gene locus_tag LOCUS_12440 1767 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence293 <1 1130 gene locus_tag LOCUS_12450 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880881.1:bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase 1132 1317 gene locus_tag LOCUS_12460 1132 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1308 1574 gene locus_tag LOCUS_12470 1308 1574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1590 2051 gene locus_tag LOCUS_12480 1590 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence294 584 1255 gene locus_tag LOCUS_12490 584 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence295 >Feature sequence296 >Feature sequence297 <1 707 gene locus_tag LOCUS_12500 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583832.1:ATP-dependent Clp protease ATP-binding subunit >Feature sequence298 <2095 825 gene locus_tag LOCUS_12510 <2095 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947898.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence299 463 783 gene locus_tag LOCUS_12520 463 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 796 1602 gene locus_tag LOCUS_12530 796 1602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1669 1971 gene locus_tag LOCUS_12540 1669 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence300 1273 656 gene locus_tag LOCUS_12550 1273 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 1776 1291 gene locus_tag LOCUS_12560 1776 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence301 1111 2075 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctccatctgacctgtgtggaatgtgaac >Feature sequence302 >Feature sequence303 2082 1195 gene locus_tag LOCUS_12570 2082 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 >Feature sequence304 490 1941 gene locus_tag LOCUS_12580 490 1941 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence305 <1 1254 gene locus_tag LOCUS_12590 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005098467.1:aldehyde dehydrogenase family protein 1265 1978 gene locus_tag LOCUS_12600 1265 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence306 1839 1006 gene locus_tag LOCUS_12610 1839 1006 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083187.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence307 1830 160 gene locus_tag LOCUS_12620 1830 160 CDS product formate--tetrahydrofolate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966477.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence308 379 1482 gene locus_tag LOCUS_12630 379 1482 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence309 1484 198 gene locus_tag LOCUS_12640 1484 198 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081535.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence310 >Feature sequence311 1439 1197 gene locus_tag LOCUS_12650 gene acpP 1439 1197 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_12650 <2018 1472 gene locus_tag LOCUS_12660 <2018 1472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867673.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence312 642 1889 gene locus_tag LOCUS_12670 642 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence313 <2013 179 gene locus_tag LOCUS_12680 <2013 179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017140422.1:SdrD B-like domain-containing protein >Feature sequence314 <1 1105 gene locus_tag LOCUS_12690 <1 1105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249995.1:MFS transporter 1621 1106 gene locus_tag LOCUS_12700 1621 1106 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence315 295 1263 gene locus_tag LOCUS_12710 gene thiL 295 1263 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392671.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence316 192 263 gene locus_tag LOCUS_t00410 192 263 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 271 525 gene locus_tag LOCUS_12720 271 525 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832208.1 protein_id gnl|my_center|LOCUS_12720 516 591 gene locus_tag LOCUS_t00420 516 591 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1970 1056 gene locus_tag LOCUS_12730 1970 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 >Feature sequence317 >Feature sequence318 1803 763 gene locus_tag LOCUS_12740 1803 763 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404177.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence319 <1 541 gene locus_tag LOCUS_12750 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000089239.1:ankyrin repeat domain-containing protein 534 1646 gene locus_tag LOCUS_12760 534 1646 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815915.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence320 945 112 gene locus_tag LOCUS_12770 945 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 1649 930 gene locus_tag LOCUS_12780 1649 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence321 1212 1622 gene locus_tag LOCUS_12790 1212 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence322 209 1513 gene locus_tag LOCUS_12800 209 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence323 407 99 gene locus_tag LOCUS_12810 407 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 631 392 gene locus_tag LOCUS_12820 631 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12820 1794 628 gene locus_tag LOCUS_12830 1794 628 CDS product ImmA/IrrE family metallo-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546117.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence324 1389 388 gene locus_tag LOCUS_12840 1389 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 <1929 1422 gene locus_tag LOCUS_12850 <1929 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014205903.1:NADH-quinone oxidoreductase subunit NuoN >Feature sequence325 <1926 178 gene locus_tag LOCUS_12860 <1926 178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881403.1:glycine--tRNA ligase subunit beta >Feature sequence326 497 1183 gene locus_tag LOCUS_12870 497 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 1180 1758 gene locus_tag LOCUS_12880 1180 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence327 1595 171 gene locus_tag LOCUS_12890 1595 171 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943972.1 protein_id gnl|my_center|LOCUS_12890 >Feature sequence328 949 128 gene locus_tag LOCUS_12900 949 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 1160 1393 gene locus_tag LOCUS_12910 1160 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence329 465 1322 gene locus_tag LOCUS_12920 465 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 1800 1285 gene locus_tag LOCUS_12930 1800 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence330 <1 951 gene locus_tag LOCUS_12940 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256684.1:phospholipase D-like domain-containing protein >Feature sequence331 >Feature sequence332 844 260 gene locus_tag LOCUS_12950 844 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence333 116 1741 gene locus_tag LOCUS_12960 116 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence334 155 643 gene locus_tag LOCUS_12970 155 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1691 630 gene locus_tag LOCUS_12980 1691 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 >Feature sequence335 491 908 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttaaattccacacaggtcagatg <1848 1233 gene locus_tag LOCUS_12990 <1848 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203293.1:signal peptide peptidase SppA >Feature sequence336 1385 1137 gene locus_tag LOCUS_13000 1385 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence337 >Feature sequence338 <1813 658 gene locus_tag LOCUS_13010 <1813 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545225.1:elongation factor G >Feature sequence339 >Feature sequence340 1200 1505 gene locus_tag LOCUS_13020 1200 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence341 56 451 gene locus_tag LOCUS_13030 56 451 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903023.1 protein_id gnl|my_center|LOCUS_13030 <1792 764 gene locus_tag LOCUS_13040 <1792 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000668687.1:tRNA 4-thiouridine(8) synthase ThiI >Feature sequence342 1377 352 gene locus_tag LOCUS_13050 1377 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence343 1323 811 gene locus_tag LOCUS_13060 1323 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence344 >Feature sequence345 267 605 gene locus_tag LOCUS_13070 267 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence346 >Feature sequence347 1043 150 gene locus_tag LOCUS_13080 1043 150 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942733.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence348 975 211 gene locus_tag LOCUS_13090 975 211 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence349 1078 164 gene locus_tag LOCUS_13100 1078 164 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689819.1 protein_id gnl|my_center|LOCUS_13100 1527 1114 gene locus_tag LOCUS_13110 1527 1114 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583624.1 protein_id gnl|my_center|LOCUS_13110 >Feature sequence350 2 241 gene locus_tag LOCUS_13120 2 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence351 337 1476 gene locus_tag LOCUS_13130 337 1476 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926921.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence352 <1704 525 gene locus_tag LOCUS_13140 <1704 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530880.1:autotransporter assembly complex family protein >Feature sequence353 >Feature sequence354 >Feature sequence355 1055 156 gene locus_tag LOCUS_13150 1055 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 <1691 1052 gene locus_tag LOCUS_13160 <1691 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957337.1:SDR family oxidoreductase >Feature sequence356 <1 544 gene locus_tag LOCUS_13170 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927165.1:Xaa-Pro peptidase family protein 552 1571 gene locus_tag LOCUS_13180 552 1571 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227794.1 protein_id gnl|my_center|LOCUS_13180 >Feature sequence357 186 1409 gene locus_tag LOCUS_13190 gene gdhA 186 1409 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080520.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence358 >Feature sequence359 >Feature sequence360 >Feature sequence361 1321 368 gene locus_tag LOCUS_13200 1321 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 >Feature sequence362 673 840 gene locus_tag LOCUS_13210 673 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence363 >Feature sequence364 296 1533 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatcccttcttcatcaggtctaggtttggaac >Feature sequence365 >Feature sequence366 <1637 1050 gene locus_tag LOCUS_13220 <1637 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251027.1:4Fe-4S dicluster domain-containing protein >Feature sequence367 >Feature sequence368 >Feature sequence369 386 862 gene locus_tag LOCUS_13230 386 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 840 1409 gene locus_tag LOCUS_13240 gene ruvA 840 1409 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082791.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence370 1001 33 gene locus_tag LOCUS_13250 1001 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1401 1039 gene locus_tag LOCUS_13260 1401 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 >Feature sequence371 >Feature sequence372 683 1553 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcggagaactacccataggggaatggcgac >Feature sequence373 257 691 gene locus_tag LOCUS_13270 257 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 1086 688 gene locus_tag LOCUS_13280 1086 688 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_13280 >Feature sequence374 <1 1564 gene locus_tag LOCUS_13290 <1 1564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011125969.1:SpoIID/LytB domain-containing protein >Feature sequence375 <1 643 gene locus_tag LOCUS_13300 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081897.1:1,4-dihydroxy-2-naphthoate octaprenyltransferase >Feature sequence376 1235 504 gene locus_tag LOCUS_13310 gene cas6 1235 504 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence377 >Feature sequence378 >Feature sequence379 79 855 gene locus_tag LOCUS_13320 79 855 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence380 >Feature sequence381 >Feature sequence382 21 1217 gene locus_tag LOCUS_13330 21 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence383 368 1486 gene locus_tag LOCUS_13340 368 1486 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228946.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence384 <1 1281 gene locus_tag LOCUS_13350 <1 1281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249703.1:S9 family peptidase >Feature sequence385 >Feature sequence386 <1529 682 gene locus_tag LOCUS_13360 <1529 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002320953.1:FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO >Feature sequence387 >Feature sequence388 245 1453 gene locus_tag LOCUS_13370 245 1453 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139084167.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence389 1123 1398 gene locus_tag LOCUS_13380 1123 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 >Feature sequence390 16 438 gene locus_tag LOCUS_13390 16 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 <1515 932 gene locus_tag LOCUS_13400 <1515 932 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477390.1:sodium/proline symporter PutP >Feature sequence391