>Feature sequence001 97 738 gene locus_tag LOCUS_00010 97 738 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_00010 801 1664 gene locus_tag LOCUS_00020 801 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 1746 1670 gene locus_tag LOCUS_t00010 1746 1670 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3684 1813 gene locus_tag LOCUS_00030 gene rpoD 3684 1813 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_00030 5780 4023 gene locus_tag LOCUS_00040 gene dnaG 5780 4023 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038900.1 protein_id gnl|my_center|LOCUS_00040 6377 5922 gene locus_tag LOCUS_00050 6377 5922 CDS product CBU_1594 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772128.1 protein_id gnl|my_center|LOCUS_00050 6673 6458 gene locus_tag LOCUS_00060 gene rpsU 6673 6458 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808376.1 protein_id gnl|my_center|LOCUS_00060 6857 7894 gene locus_tag LOCUS_00070 gene tsaD 6857 7894 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369630.1 protein_id gnl|my_center|LOCUS_00070 8352 7960 gene locus_tag LOCUS_00080 8352 7960 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957599.1 protein_id gnl|my_center|LOCUS_00080 8665 9246 gene locus_tag LOCUS_00090 gene nudE 8665 9246 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070586.1 protein_id gnl|my_center|LOCUS_00090 9284 10072 gene locus_tag LOCUS_00100 gene cysQ 9284 10072 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143634.1 protein_id gnl|my_center|LOCUS_00100 10195 10869 gene locus_tag LOCUS_00110 10195 10869 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208038.1 protein_id gnl|my_center|LOCUS_00110 10885 11484 gene locus_tag LOCUS_00120 10885 11484 CDS product DNA-J related domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112460.1 protein_id gnl|my_center|LOCUS_00120 12602 11574 gene locus_tag LOCUS_00130 12602 11574 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 protein_id gnl|my_center|LOCUS_00130 13819 12731 gene locus_tag LOCUS_00140 gene galT 13819 12731 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080684.1 protein_id gnl|my_center|LOCUS_00140 14349 13918 gene locus_tag LOCUS_00150 14349 13918 CDS product YcgN family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383735.1 protein_id gnl|my_center|LOCUS_00150 16493 14346 gene locus_tag LOCUS_00160 16493 14346 CDS product bifunctional TVP38/TMEM64 family protein/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705444.1 protein_id gnl|my_center|LOCUS_00160 16689 16979 gene locus_tag LOCUS_00170 16689 16979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17123 20002 gene locus_tag LOCUS_00180 17123 20002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20529 20454 gene locus_tag LOCUS_t00020 20529 20454 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 21093 20659 gene locus_tag LOCUS_00190 21093 20659 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391535.1 protein_id gnl|my_center|LOCUS_00190 22242 21145 gene locus_tag LOCUS_00200 gene thiO 22242 21145 CDS product glycine oxidase ThiO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895678.1 protein_id gnl|my_center|LOCUS_00200 23206 22316 gene locus_tag LOCUS_00210 23206 22316 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966070.1 protein_id gnl|my_center|LOCUS_00210 23572 23216 gene locus_tag LOCUS_00220 23572 23216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23463 23687 gene locus_tag LOCUS_00230 23463 23687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 23684 24247 gene locus_tag LOCUS_00240 23684 24247 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206373.1 protein_id gnl|my_center|LOCUS_00240 24291 24950 gene locus_tag LOCUS_00250 24291 24950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 24966 25706 gene locus_tag LOCUS_00260 24966 25706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 26507 25749 gene locus_tag LOCUS_00270 26507 25749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27798 26542 gene locus_tag LOCUS_00280 gene rho 27798 26542 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096334.1 protein_id gnl|my_center|LOCUS_00280 28651 28325 gene locus_tag LOCUS_00290 gene trxA 28651 28325 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_00290 28813 30114 gene locus_tag LOCUS_00300 gene rhlB 28813 30114 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368886.1 protein_id gnl|my_center|LOCUS_00300 31218 30115 gene locus_tag LOCUS_00310 31218 30115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32721 31291 gene locus_tag LOCUS_00320 32721 31291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 36090 32977 gene locus_tag LOCUS_00330 36090 32977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 36747 36100 gene locus_tag LOCUS_00340 36747 36100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 37835 36798 gene locus_tag LOCUS_00350 37835 36798 CDS product NADP(H)-dependent aldo-keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094166.1 protein_id gnl|my_center|LOCUS_00350 38070 38897 gene locus_tag LOCUS_00360 38070 38897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 39716 38901 gene locus_tag LOCUS_00370 gene mutM 39716 38901 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_00370 40402 39719 gene locus_tag LOCUS_00380 40402 39719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 42007 40634 gene locus_tag LOCUS_00390 42007 40634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 43254 42181 gene locus_tag LOCUS_00400 43254 42181 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037036.1 protein_id gnl|my_center|LOCUS_00400 43929 43288 gene locus_tag LOCUS_00410 gene cheD 43929 43288 CDS product chemoreceptor glutamine deamidase CheD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072188.1 protein_id gnl|my_center|LOCUS_00410 44803 43934 gene locus_tag LOCUS_00420 44803 43934 CDS product chemotaxis protein methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011832274.1 protein_id gnl|my_center|LOCUS_00420 47780 44901 gene locus_tag LOCUS_00430 47780 44901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 48743 47994 gene locus_tag LOCUS_00440 48743 47994 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_00440 49294 48767 gene locus_tag LOCUS_00450 49294 48767 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037040.1 protein_id gnl|my_center|LOCUS_00450 51366 49354 gene locus_tag LOCUS_00460 51366 49354 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001162435.1 protein_id gnl|my_center|LOCUS_00460 51733 51371 gene locus_tag LOCUS_00470 51733 51371 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_00470 52030 51737 gene locus_tag LOCUS_00480 52030 51737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 53670 52132 gene locus_tag LOCUS_00490 53670 52132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 53843 54022 gene locus_tag LOCUS_00500 53843 54022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 54239 54970 gene locus_tag LOCUS_00510 54239 54970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 55498 55854 gene locus_tag LOCUS_00520 55498 55854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943213.1 protein_id gnl|my_center|LOCUS_00520 55838 56692 gene locus_tag LOCUS_00530 55838 56692 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943212.1 protein_id gnl|my_center|LOCUS_00530 56689 58773 gene locus_tag LOCUS_00540 56689 58773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 59258 58881 gene locus_tag LOCUS_00550 59258 58881 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806565.1 protein_id gnl|my_center|LOCUS_00550 59740 64545 gene locus_tag LOCUS_00560 59740 64545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 64696 66801 gene locus_tag LOCUS_00570 64696 66801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 66809 67918 gene locus_tag LOCUS_00580 66809 67918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 67973 69109 gene locus_tag LOCUS_00590 67973 69109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 69474 69103 gene locus_tag LOCUS_00600 69474 69103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 70291 69536 gene locus_tag LOCUS_00610 70291 69536 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524099.1 protein_id gnl|my_center|LOCUS_00610 71301 70288 gene locus_tag LOCUS_00620 71301 70288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 71414 72451 gene locus_tag LOCUS_00630 71414 72451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 72462 74492 gene locus_tag LOCUS_00640 72462 74492 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421608.1 protein_id gnl|my_center|LOCUS_00640 75828 74617 gene locus_tag LOCUS_00650 75828 74617 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_00650 76345 75887 gene locus_tag LOCUS_00660 76345 75887 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_00660 77714 76353 gene locus_tag LOCUS_00670 gene mgtE 77714 76353 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000840452.1 protein_id gnl|my_center|LOCUS_00670 78311 77910 gene locus_tag LOCUS_00680 78311 77910 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152611757.1 protein_id gnl|my_center|LOCUS_00680 80098 78311 gene locus_tag LOCUS_00690 80098 78311 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051000241.1 protein_id gnl|my_center|LOCUS_00690 82213 80141 gene locus_tag LOCUS_00700 82213 80141 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957672.1 protein_id gnl|my_center|LOCUS_00700 83532 82216 gene locus_tag LOCUS_00710 83532 82216 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957671.1 protein_id gnl|my_center|LOCUS_00710 86262 83842 gene locus_tag LOCUS_00720 86262 83842 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810115.1 protein_id gnl|my_center|LOCUS_00720 87252 86266 gene locus_tag LOCUS_00730 87252 86266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 87596 88549 gene locus_tag LOCUS_00740 87596 88549 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073496.1 protein_id gnl|my_center|LOCUS_00740 89591 88563 gene locus_tag LOCUS_00750 89591 88563 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074212.1 protein_id gnl|my_center|LOCUS_00750 89744 90583 gene locus_tag LOCUS_00760 89744 90583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 90596 91027 gene locus_tag LOCUS_00770 90596 91027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 91049 91903 gene locus_tag LOCUS_00780 91049 91903 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941571.1 protein_id gnl|my_center|LOCUS_00780 92802 91975 gene locus_tag LOCUS_00790 92802 91975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 93085 94044 gene locus_tag LOCUS_00800 gene cysB 93085 94044 CDS product HTH-type transcriptional regulator CysB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087775.1 protein_id gnl|my_center|LOCUS_00800 94621 94034 gene locus_tag LOCUS_00810 94621 94034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 94755 94973 gene locus_tag LOCUS_00820 94755 94973 CDS product SlyX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694169.1 protein_id gnl|my_center|LOCUS_00820 95028 95342 gene locus_tag LOCUS_00830 95028 95342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 96796 95345 gene locus_tag LOCUS_00840 96796 95345 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001160591.1 protein_id gnl|my_center|LOCUS_00840 >Feature sequence002 498 127 gene locus_tag LOCUS_00850 498 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 2030 831 gene locus_tag LOCUS_00860 2030 831 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003393654.1 protein_id gnl|my_center|LOCUS_00860 2429 2109 gene locus_tag LOCUS_00870 2429 2109 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931769.1 protein_id gnl|my_center|LOCUS_00870 2617 4656 gene locus_tag LOCUS_00880 2617 4656 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023630.1 protein_id gnl|my_center|LOCUS_00880 5533 4763 gene locus_tag LOCUS_00890 5533 4763 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093967.1 protein_id gnl|my_center|LOCUS_00890 6673 5789 gene locus_tag LOCUS_00900 6673 5789 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920210.1 protein_id gnl|my_center|LOCUS_00900 6778 7749 gene locus_tag LOCUS_00910 6778 7749 CDS product NAD(P)-dependent alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000643877.1 protein_id gnl|my_center|LOCUS_00910 9537 7816 gene locus_tag LOCUS_00920 9537 7816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 11700 9748 gene locus_tag LOCUS_00930 11700 9748 CDS product LTA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074224.1 protein_id gnl|my_center|LOCUS_00930 12705 11773 gene locus_tag LOCUS_00940 12705 11773 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038567.1 protein_id gnl|my_center|LOCUS_00940 13118 12750 gene locus_tag LOCUS_00950 13118 12750 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261207.1 protein_id gnl|my_center|LOCUS_00950 14623 13124 gene locus_tag LOCUS_00960 gene gcvPB 14623 13124 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958389.1 protein_id gnl|my_center|LOCUS_00960 16143 14785 gene locus_tag LOCUS_00970 gene gcvPA 16143 14785 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770511.1 protein_id gnl|my_center|LOCUS_00970 16578 16183 gene locus_tag LOCUS_00980 gene gcvH 16578 16183 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071083.1 protein_id gnl|my_center|LOCUS_00980 17800 16619 gene locus_tag LOCUS_00990 gene gcvT 17800 16619 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114049.1 protein_id gnl|my_center|LOCUS_00990 17700 18068 gene locus_tag LOCUS_01000 17700 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 18205 21156 gene locus_tag LOCUS_01010 18205 21156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 21497 22231 gene locus_tag LOCUS_01020 21497 22231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 22201 22860 gene locus_tag LOCUS_01030 22201 22860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 22919 23440 gene locus_tag LOCUS_01040 22919 23440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 23479 23667 gene locus_tag LOCUS_01050 23479 23667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 23723 24829 gene locus_tag LOCUS_01060 23723 24829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 24875 25474 gene locus_tag LOCUS_01070 24875 25474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 25557 27380 gene locus_tag LOCUS_01080 25557 27380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 27377 30286 gene locus_tag LOCUS_01090 27377 30286 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_01090 30273 30596 gene locus_tag LOCUS_01100 30273 30596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 30700 31734 gene locus_tag LOCUS_01110 30700 31734 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136620024.1 protein_id gnl|my_center|LOCUS_01110 32228 31731 gene locus_tag LOCUS_01120 32228 31731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 33797 32565 gene locus_tag LOCUS_01130 33797 32565 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405216.1 protein_id gnl|my_center|LOCUS_01130 33979 34929 gene locus_tag LOCUS_01140 33979 34929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 35674 35051 gene locus_tag LOCUS_01150 35674 35051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 37064 35880 gene locus_tag LOCUS_01160 37064 35880 CDS product UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957362.1 protein_id gnl|my_center|LOCUS_01160 38290 37061 gene locus_tag LOCUS_01170 gene ubiH 38290 37061 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_01170 39769 38390 gene locus_tag LOCUS_01180 gene pepP 39769 38390 CDS product Xaa-Pro aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114045.1 protein_id gnl|my_center|LOCUS_01180 40470 39886 gene locus_tag LOCUS_01190 40470 39886 CDS product UPF0149 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945837.1 protein_id gnl|my_center|LOCUS_01190 40606 40815 gene locus_tag LOCUS_01200 40606 40815 CDS product TIGR02449 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038363.1 protein_id gnl|my_center|LOCUS_01200 40812 41147 gene locus_tag LOCUS_01210 40812 41147 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380079.1 protein_id gnl|my_center|LOCUS_01210 41385 41975 gene locus_tag LOCUS_01220 41385 41975 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266316.1 protein_id gnl|my_center|LOCUS_01220 44133 42484 gene locus_tag LOCUS_01230 44133 42484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 46956 44182 gene locus_tag LOCUS_01240 46956 44182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 48241 47009 gene locus_tag LOCUS_01250 48241 47009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 49994 48837 gene locus_tag LOCUS_01260 49994 48837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 50926 50147 gene locus_tag LOCUS_01270 50926 50147 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819152.1 protein_id gnl|my_center|LOCUS_01270 51212 51859 gene locus_tag LOCUS_01280 51212 51859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 51856 52539 gene locus_tag LOCUS_01290 gene mshJ 51856 52539 CDS product MSHA fimbrial biogenesis protein MshJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704364.1 protein_id gnl|my_center|LOCUS_01290 52592 52915 gene locus_tag LOCUS_01300 52592 52915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 52918 54693 gene locus_tag LOCUS_01310 gene mshL 52918 54693 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261161.1 protein_id gnl|my_center|LOCUS_01310 54711 55616 gene locus_tag LOCUS_01320 54711 55616 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073813.1 protein_id gnl|my_center|LOCUS_01320 55620 56861 gene locus_tag LOCUS_01330 55620 56861 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819183.1 protein_id gnl|my_center|LOCUS_01330 56864 58570 gene locus_tag LOCUS_01340 56864 58570 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073811.1 protein_id gnl|my_center|LOCUS_01340 58588 59808 gene locus_tag LOCUS_01350 58588 59808 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261163.1 protein_id gnl|my_center|LOCUS_01350 59973 60404 gene locus_tag LOCUS_01360 59973 60404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 60586 64149 gene locus_tag LOCUS_01370 60586 64149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 64194 64589 gene locus_tag LOCUS_01380 64194 64589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 64598 65113 gene locus_tag LOCUS_01390 64598 65113 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 protein_id gnl|my_center|LOCUS_01390 65191 66066 gene locus_tag LOCUS_01400 65191 66066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 66063 66485 gene locus_tag LOCUS_01410 66063 66485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 66516 67472 gene locus_tag LOCUS_01420 66516 67472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 67662 68003 gene locus_tag LOCUS_01430 67662 68003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 69562 68147 gene locus_tag LOCUS_01440 gene ntrC 69562 68147 CDS product two-component system response regulator NtrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104661.1 protein_id gnl|my_center|LOCUS_01440 70695 69559 gene locus_tag LOCUS_01450 gene ntrB 70695 69559 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_01450 71482 70964 gene locus_tag LOCUS_01460 71482 70964 CDS product DUF4124 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074099.1 protein_id gnl|my_center|LOCUS_01460 73091 71682 gene locus_tag LOCUS_01470 gene glnA 73091 71682 CDS product glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000110151.1 protein_id gnl|my_center|LOCUS_01470 74570 73389 gene locus_tag LOCUS_01480 74570 73389 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444330.1 protein_id gnl|my_center|LOCUS_01480 74800 74570 gene locus_tag LOCUS_01490 74800 74570 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337257.1 protein_id gnl|my_center|LOCUS_01490 76055 75012 gene locus_tag LOCUS_01500 76055 75012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_01500 76216 76566 gene locus_tag LOCUS_01510 76216 76566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 77147 76563 gene locus_tag LOCUS_01520 77147 76563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 77811 77227 gene locus_tag LOCUS_01530 gene plsY 77811 77227 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770791.1 protein_id gnl|my_center|LOCUS_01530 77922 78278 gene locus_tag LOCUS_01540 gene folB 77922 78278 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038896.1 protein_id gnl|my_center|LOCUS_01540 78280 78768 gene locus_tag LOCUS_01550 gene folK 78280 78768 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707548.1 protein_id gnl|my_center|LOCUS_01550 78826 79986 gene locus_tag LOCUS_01560 78826 79986 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258910.1 protein_id gnl|my_center|LOCUS_01560 80734 80135 gene locus_tag LOCUS_01570 80734 80135 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035344.1 protein_id gnl|my_center|LOCUS_01570 81030 80731 gene locus_tag LOCUS_01580 81030 80731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 81895 81119 gene locus_tag LOCUS_01590 81895 81119 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038530.1 protein_id gnl|my_center|LOCUS_01590 81968 83167 gene locus_tag LOCUS_01600 81968 83167 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_01600 83353 84045 gene locus_tag LOCUS_01610 83353 84045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 84119 84994 gene locus_tag LOCUS_01620 84119 84994 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262664.1 protein_id gnl|my_center|LOCUS_01620 85578 84979 gene locus_tag LOCUS_01630 85578 84979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 85650 86483 gene locus_tag LOCUS_01640 85650 86483 CDS product symmetrical bis(5'-nucleosyl)-tetraphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113213.1 protein_id gnl|my_center|LOCUS_01640 86483 86881 gene locus_tag LOCUS_01650 86483 86881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 86913 87422 gene locus_tag LOCUS_01660 86913 87422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 87425 87799 gene locus_tag LOCUS_01670 87425 87799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 >Feature sequence003 2995 914 gene locus_tag LOCUS_01680 gene flhA 2995 914 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083059.1 protein_id gnl|my_center|LOCUS_01680 4134 2998 gene locus_tag LOCUS_01690 gene flhB 4134 2998 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083056.1 protein_id gnl|my_center|LOCUS_01690 4926 4147 gene locus_tag LOCUS_01700 gene fliR 4926 4147 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114278.1 protein_id gnl|my_center|LOCUS_01700 5212 4943 gene locus_tag LOCUS_01710 gene fliQ 5212 4943 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083053.1 protein_id gnl|my_center|LOCUS_01710 6008 5238 gene locus_tag LOCUS_01720 gene fliP 6008 5238 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073102.1 protein_id gnl|my_center|LOCUS_01720 6370 6005 gene locus_tag LOCUS_01730 6370 6005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 7016 6534 gene locus_tag LOCUS_01740 7016 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 8026 7013 gene locus_tag LOCUS_01750 gene fliM 8026 7013 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083045.1 protein_id gnl|my_center|LOCUS_01750 8663 8085 gene locus_tag LOCUS_01760 8663 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 8946 9968 gene locus_tag LOCUS_01770 8946 9968 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389542.1 protein_id gnl|my_center|LOCUS_01770 10365 10063 gene locus_tag LOCUS_01780 gene hsbA 10365 10063 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_01780 12167 10689 gene locus_tag LOCUS_01790 12167 10689 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037087.1 protein_id gnl|my_center|LOCUS_01790 12811 12362 gene locus_tag LOCUS_01800 gene fliJ 12811 12362 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082220.1 protein_id gnl|my_center|LOCUS_01800 15843 12907 gene locus_tag LOCUS_01810 15843 12907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 15970 16527 gene locus_tag LOCUS_01820 15970 16527 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114324.1 protein_id gnl|my_center|LOCUS_01820 16561 17670 gene locus_tag LOCUS_01830 gene mnmA 16561 17670 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004540.1 protein_id gnl|my_center|LOCUS_01830 17687 18313 gene locus_tag LOCUS_01840 gene hflD 17687 18313 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072581.1 protein_id gnl|my_center|LOCUS_01840 19102 18302 gene locus_tag LOCUS_01850 19102 18302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 19631 19263 gene locus_tag LOCUS_01860 19631 19263 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_01860 20491 19628 gene locus_tag LOCUS_01870 20491 19628 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004556463.1 protein_id gnl|my_center|LOCUS_01870 20645 21847 gene locus_tag LOCUS_01880 gene dapC 20645 21847 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406264.1 protein_id gnl|my_center|LOCUS_01880 22048 22869 gene locus_tag LOCUS_01890 gene dapD 22048 22869 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368172.1 protein_id gnl|my_center|LOCUS_01890 22956 23297 gene locus_tag LOCUS_01900 22956 23297 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012533673.1 protein_id gnl|my_center|LOCUS_01900 23416 24558 gene locus_tag LOCUS_01910 gene dapE 23416 24558 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705377.1 protein_id gnl|my_center|LOCUS_01910 24562 25215 gene locus_tag LOCUS_01920 24562 25215 CDS product DsbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895526.1 protein_id gnl|my_center|LOCUS_01920 25212 26015 gene locus_tag LOCUS_01930 25212 26015 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234194.1 protein_id gnl|my_center|LOCUS_01930 26019 26972 gene locus_tag LOCUS_01940 26019 26972 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020668.1 protein_id gnl|my_center|LOCUS_01940 27323 27811 gene locus_tag LOCUS_01950 27323 27811 CDS product glycoside hydrolase family 108 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225286.1 protein_id gnl|my_center|LOCUS_01950 27865 28248 gene locus_tag LOCUS_01960 gene mapZ 27865 28248 CDS product cyclic di-GMP-binding protein MapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094864.1 protein_id gnl|my_center|LOCUS_01960 29715 28342 gene locus_tag LOCUS_01970 gene radA 29715 28342 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001414703.1 protein_id gnl|my_center|LOCUS_01970 30904 29798 gene locus_tag LOCUS_01980 gene alr 30904 29798 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817869.1 protein_id gnl|my_center|LOCUS_01980 32319 30901 gene locus_tag LOCUS_01990 32319 30901 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192724.1 protein_id gnl|my_center|LOCUS_01990 33005 32556 gene locus_tag LOCUS_02000 gene rplI 33005 32556 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005421134.1 protein_id gnl|my_center|LOCUS_02000 33947 33039 gene locus_tag LOCUS_02010 33947 33039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095630.1 protein_id gnl|my_center|LOCUS_02010 34242 34015 gene locus_tag LOCUS_02020 gene rpsR 34242 34015 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_02020 34811 34308 gene locus_tag LOCUS_02030 34811 34308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 36482 35073 gene locus_tag LOCUS_02040 36482 35073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 37766 37239 gene locus_tag LOCUS_02050 37766 37239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 37741 37863 gene locus_tag LOCUS_02060 37741 37863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 44496 38014 gene locus_tag LOCUS_02070 44496 38014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 45383 47125 gene locus_tag LOCUS_02080 45383 47125 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_02080 47754 47122 gene locus_tag LOCUS_02090 47754 47122 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024503826.1 protein_id gnl|my_center|LOCUS_02090 48597 47860 gene locus_tag LOCUS_02100 gene rlmB 48597 47860 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095638.1 protein_id gnl|my_center|LOCUS_02100 51143 48597 gene locus_tag LOCUS_02110 gene rnr 51143 48597 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004407829.1 protein_id gnl|my_center|LOCUS_02110 52243 51845 gene locus_tag LOCUS_02120 52243 51845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 53299 52301 gene locus_tag LOCUS_02130 53299 52301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 54171 54257 gene locus_tag LOCUS_t00030 54171 54257 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 55771 54458 gene locus_tag LOCUS_02140 55771 54458 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_02140 57173 55995 gene locus_tag LOCUS_02150 57173 55995 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402926.1 protein_id gnl|my_center|LOCUS_02150 57420 57232 gene locus_tag LOCUS_02160 57420 57232 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095647.1 protein_id gnl|my_center|LOCUS_02160 58319 57465 gene locus_tag LOCUS_02170 gene hflC 58319 57465 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763025.1 protein_id gnl|my_center|LOCUS_02170 59497 58319 gene locus_tag LOCUS_02180 gene hflK 59497 58319 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262723.1 protein_id gnl|my_center|LOCUS_02180 61009 59663 gene locus_tag LOCUS_02190 gene hflX 61009 59663 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_02190 61284 61033 gene locus_tag LOCUS_02200 gene hfq 61284 61033 CDS product RNA chaperone Hfq inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036893.1 protein_id gnl|my_center|LOCUS_02200 62412 61462 gene locus_tag LOCUS_02210 gene miaA 62412 61462 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704863.1 protein_id gnl|my_center|LOCUS_02210 63095 62625 gene locus_tag LOCUS_02220 gene rimI 63095 62625 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012439259.1 protein_id gnl|my_center|LOCUS_02220 63915 63109 gene locus_tag LOCUS_02230 63915 63109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 65688 64150 gene locus_tag LOCUS_02240 65688 64150 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_02240 66823 66005 gene locus_tag LOCUS_02250 gene pssA 66823 66005 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095061.1 protein_id gnl|my_center|LOCUS_02250 67551 66820 gene locus_tag LOCUS_02260 67551 66820 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196436.1 protein_id gnl|my_center|LOCUS_02260 68652 67636 gene locus_tag LOCUS_02270 gene ilvC 68652 67636 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095066.1 protein_id gnl|my_center|LOCUS_02270 69185 68715 gene locus_tag LOCUS_02280 gene ilvN 69185 68715 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_02280 71011 69227 gene locus_tag LOCUS_02290 71011 69227 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 protein_id gnl|my_center|LOCUS_02290 71445 71789 gene locus_tag LOCUS_02300 71445 71789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 71808 72152 gene locus_tag LOCUS_02310 71808 72152 CDS product phenylpyruvate tautomerase MIF-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101886618.1 protein_id gnl|my_center|LOCUS_02310 72196 72672 gene locus_tag LOCUS_02320 72196 72672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 75180 72676 gene locus_tag LOCUS_02330 75180 72676 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_02330 75965 75234 gene locus_tag LOCUS_02340 75965 75234 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010928863.1 protein_id gnl|my_center|LOCUS_02340 76081 76635 gene locus_tag LOCUS_02350 76081 76635 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010440639.1 protein_id gnl|my_center|LOCUS_02350 78182 76725 gene locus_tag LOCUS_02360 gene pyk 78182 76725 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125075.1 protein_id gnl|my_center|LOCUS_02360 79105 78254 gene locus_tag LOCUS_02370 79105 78254 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037440.1 protein_id gnl|my_center|LOCUS_02370 79885 79433 gene locus_tag LOCUS_02380 79885 79433 CDS product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169047187.1 protein_id gnl|my_center|LOCUS_02380 80765 80037 gene locus_tag LOCUS_02390 gene ispD 80765 80037 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092359.1 protein_id gnl|my_center|LOCUS_02390 81064 80795 gene locus_tag LOCUS_02400 gene ftsB 81064 80795 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 protein_id gnl|my_center|LOCUS_02400 82377 81094 gene locus_tag LOCUS_02410 gene eno 82377 81094 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_02410 >Feature sequence004 1369 1584 gene locus_tag LOCUS_02420 1369 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 3059 2001 gene locus_tag LOCUS_02430 3059 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211410235.1 protein_id gnl|my_center|LOCUS_02430 3669 4802 gene locus_tag LOCUS_02440 3669 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 5597 5259 gene locus_tag LOCUS_02450 5597 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 6112 5591 gene locus_tag LOCUS_02460 6112 5591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 6005 6259 gene locus_tag LOCUS_02470 6005 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 6737 6294 gene locus_tag LOCUS_02480 6737 6294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 7073 6771 gene locus_tag LOCUS_02490 7073 6771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 7219 7833 gene locus_tag LOCUS_02500 7219 7833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 8115 8498 gene locus_tag LOCUS_02510 8115 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 9202 11535 gene locus_tag LOCUS_02520 9202 11535 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763462.1 protein_id gnl|my_center|LOCUS_02520 13526 11577 gene locus_tag LOCUS_02530 13526 11577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073516.1 protein_id gnl|my_center|LOCUS_02530 14933 13749 gene locus_tag LOCUS_02540 gene mltC 14933 13749 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 protein_id gnl|my_center|LOCUS_02540 15669 15127 gene locus_tag LOCUS_02550 15669 15127 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106283.1 protein_id gnl|my_center|LOCUS_02550 16967 15666 gene locus_tag LOCUS_02560 16967 15666 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094421.1 protein_id gnl|my_center|LOCUS_02560 17256 18314 gene locus_tag LOCUS_02570 17256 18314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 18330 18653 gene locus_tag LOCUS_02580 18330 18653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 18676 19341 gene locus_tag LOCUS_02590 18676 19341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 20365 19352 gene locus_tag LOCUS_02600 20365 19352 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169775301.1 protein_id gnl|my_center|LOCUS_02600 20764 20390 gene locus_tag LOCUS_02610 20764 20390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 21439 21182 gene locus_tag LOCUS_02620 21439 21182 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_02620 22434 21568 gene locus_tag LOCUS_02630 22434 21568 CDS product sterol desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453865.1 protein_id gnl|my_center|LOCUS_02630 22678 23394 gene locus_tag LOCUS_02640 22678 23394 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092844068.1 protein_id gnl|my_center|LOCUS_02640 23405 24589 gene locus_tag LOCUS_02650 23405 24589 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071226.1 protein_id gnl|my_center|LOCUS_02650 24758 27880 gene locus_tag LOCUS_02660 24758 27880 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071225.1 protein_id gnl|my_center|LOCUS_02660 27997 28437 gene locus_tag LOCUS_02670 27997 28437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 30669 28492 gene locus_tag LOCUS_02680 30669 28492 CDS product amylo-alpha-1,6-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969651.1 protein_id gnl|my_center|LOCUS_02680 31793 30681 gene locus_tag LOCUS_02690 31793 30681 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087973.1 protein_id gnl|my_center|LOCUS_02690 32956 31994 gene locus_tag LOCUS_02700 32956 31994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 33879 32953 gene locus_tag LOCUS_02710 33879 32953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 35634 34321 gene locus_tag LOCUS_02720 gene bioA 35634 34321 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931741.1 protein_id gnl|my_center|LOCUS_02720 36226 35732 gene locus_tag LOCUS_02730 36226 35732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 39614 36273 gene locus_tag LOCUS_02740 39614 36273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 41749 39671 gene locus_tag LOCUS_02750 41749 39671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258039.1 protein_id gnl|my_center|LOCUS_02750 44547 41746 gene locus_tag LOCUS_02760 44547 41746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 47074 44549 gene locus_tag LOCUS_02770 47074 44549 CDS product putative baseplate assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258037.1 protein_id gnl|my_center|LOCUS_02770 47445 47071 gene locus_tag LOCUS_02780 47445 47071 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258036.1 protein_id gnl|my_center|LOCUS_02780 47852 47532 gene locus_tag LOCUS_02790 47852 47532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258035.1 protein_id gnl|my_center|LOCUS_02790 48362 47853 gene locus_tag LOCUS_02800 48362 47853 CDS product phage baseplate assembly protein V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258034.1 protein_id gnl|my_center|LOCUS_02800 49501 48359 gene locus_tag LOCUS_02810 49501 48359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258033.1 protein_id gnl|my_center|LOCUS_02810 49863 49498 gene locus_tag LOCUS_02820 49863 49498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258032.1 protein_id gnl|my_center|LOCUS_02820 50584 49928 gene locus_tag LOCUS_02830 50584 49928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258031.1 protein_id gnl|my_center|LOCUS_02830 52092 50599 gene locus_tag LOCUS_02840 52092 50599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 52526 52272 gene locus_tag LOCUS_02850 52526 52272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 54526 52523 gene locus_tag LOCUS_02860 54526 52523 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258027.1 protein_id gnl|my_center|LOCUS_02860 55743 54523 gene locus_tag LOCUS_02870 55743 54523 CDS product DUF4255 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258026.1 protein_id gnl|my_center|LOCUS_02870 56723 55740 gene locus_tag LOCUS_02880 56723 55740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 57454 56720 gene locus_tag LOCUS_02890 57454 56720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258024.1 protein_id gnl|my_center|LOCUS_02890 57988 57461 gene locus_tag LOCUS_02900 57988 57461 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258023.1 protein_id gnl|my_center|LOCUS_02900 59531 57999 gene locus_tag LOCUS_02910 59531 57999 CDS product phage tail sheath subtilisin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258022.1 protein_id gnl|my_center|LOCUS_02910 60117 59722 gene locus_tag LOCUS_02920 60117 59722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 61590 61500 gene locus_tag LOCUS_t00040 61590 61500 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 61724 62653 gene locus_tag LOCUS_02930 gene motA 61724 62653 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038736.1 protein_id gnl|my_center|LOCUS_02930 62692 63831 gene locus_tag LOCUS_02940 62692 63831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 63879 65000 gene locus_tag LOCUS_02950 gene aroC 63879 65000 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405788.1 protein_id gnl|my_center|LOCUS_02950 65155 66297 gene locus_tag LOCUS_02960 65155 66297 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114618.1 protein_id gnl|my_center|LOCUS_02960 66316 69072 gene locus_tag LOCUS_02970 66316 69072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 69738 69319 gene locus_tag LOCUS_02980 69738 69319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 71057 69735 gene locus_tag LOCUS_02990 71057 69735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 71218 72120 gene locus_tag LOCUS_03000 71218 72120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 72198 73745 gene locus_tag LOCUS_03010 72198 73745 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_03010 73801 75810 gene locus_tag LOCUS_03020 73801 75810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 75841 77931 gene locus_tag LOCUS_03030 75841 77931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence005 1503 229 gene locus_tag LOCUS_03040 gene serS 1503 229 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097631.1 protein_id gnl|my_center|LOCUS_03040 1875 1558 gene locus_tag LOCUS_03050 1875 1558 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957951.1 protein_id gnl|my_center|LOCUS_03050 2243 1872 gene locus_tag LOCUS_03060 gene crcB 2243 1872 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_03060 3608 2271 gene locus_tag LOCUS_03070 3608 2271 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097632.1 protein_id gnl|my_center|LOCUS_03070 4391 3747 gene locus_tag LOCUS_03080 gene lolA 4391 3747 CDS product outer membrane lipoprotein chaperone LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930946.1 protein_id gnl|my_center|LOCUS_03080 5799 4414 gene locus_tag LOCUS_03090 gene nhaA 5799 4414 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_03090 6251 7087 gene locus_tag LOCUS_03100 6251 7087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 9573 7246 gene locus_tag LOCUS_03110 gene ftsK 9573 7246 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895627.1 protein_id gnl|my_center|LOCUS_03110 10670 9606 gene locus_tag LOCUS_03120 gene ald 10670 9606 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338437.1 protein_id gnl|my_center|LOCUS_03120 10884 12080 gene locus_tag LOCUS_03130 10884 12080 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114098.1 protein_id gnl|my_center|LOCUS_03130 12094 12384 gene locus_tag LOCUS_03140 12094 12384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 12371 13033 gene locus_tag LOCUS_03150 12371 13033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 13092 14069 gene locus_tag LOCUS_03160 13092 14069 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970702.1 protein_id gnl|my_center|LOCUS_03160 14195 15145 gene locus_tag LOCUS_03170 gene trxB 14195 15145 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483581.1 protein_id gnl|my_center|LOCUS_03170 16013 15336 gene locus_tag LOCUS_03180 16013 15336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 16054 17202 gene locus_tag LOCUS_03190 16054 17202 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192390.1 protein_id gnl|my_center|LOCUS_03190 17373 18479 gene locus_tag LOCUS_03200 17373 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 18568 19287 gene locus_tag LOCUS_03210 gene aat 18568 19287 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113368.1 protein_id gnl|my_center|LOCUS_03210 19284 20087 gene locus_tag LOCUS_03220 19284 20087 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_03220 20227 20463 gene locus_tag LOCUS_03230 20227 20463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 20673 20891 gene locus_tag LOCUS_03240 gene infA 20673 20891 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_03240 23266 20999 gene locus_tag LOCUS_03250 gene clpA 23266 20999 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317954.1 protein_id gnl|my_center|LOCUS_03250 23680 23360 gene locus_tag LOCUS_03260 gene clpS 23680 23360 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037130.1 protein_id gnl|my_center|LOCUS_03260 25028 23772 gene locus_tag LOCUS_03270 gene icd 25028 23772 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090436.1 protein_id gnl|my_center|LOCUS_03270 25503 26303 gene locus_tag LOCUS_03280 25503 26303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 27486 26692 gene locus_tag LOCUS_03290 27486 26692 CDS product type II secretion system protein N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070573.1 protein_id gnl|my_center|LOCUS_03290 27485 27634 gene locus_tag LOCUS_03300 27485 27634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 28357 27869 gene locus_tag LOCUS_03310 gene gspM 28357 27869 CDS product type II secretion system protein GspM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661339.1 protein_id gnl|my_center|LOCUS_03310 29655 28354 gene locus_tag LOCUS_03320 29655 28354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 30752 29781 gene locus_tag LOCUS_03330 gene xcpX 30752 29781 CDS product GspK family T2SS minor pseudopilin variant XcpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103524.1 protein_id gnl|my_center|LOCUS_03330 31375 30749 gene locus_tag LOCUS_03340 gene xcpW 31375 30749 CDS product GspJ family T2SS minor pseudopilin variant XcpW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110067.1 protein_id gnl|my_center|LOCUS_03340 31767 31375 gene locus_tag LOCUS_03350 31767 31375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 32479 31910 gene locus_tag LOCUS_03360 gene xcpU 32479 31910 CDS product GspH family T2SS minor pseudopilin variant XcpU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103530.1 protein_id gnl|my_center|LOCUS_03360 32946 32494 gene locus_tag LOCUS_03370 gene lspG 32946 32494 CDS product GspG family T2SS major pseudopilin variant LspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947092.1 protein_id gnl|my_center|LOCUS_03370 33037 33618 gene locus_tag LOCUS_03380 gene rrtA 33037 33618 CDS product rhombosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072468.1 protein_id gnl|my_center|LOCUS_03380 34067 33693 gene locus_tag LOCUS_03390 34067 33693 CDS product ClpXP protease specificity-enhancing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958412.1 protein_id gnl|my_center|LOCUS_03390 34717 34094 gene locus_tag LOCUS_03400 gene sspA 34717 34094 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_03400 35637 34894 gene locus_tag LOCUS_03410 35637 34894 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262642.1 protein_id gnl|my_center|LOCUS_03410 36872 35634 gene locus_tag LOCUS_03420 36872 35634 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094159.1 protein_id gnl|my_center|LOCUS_03420 37432 36872 gene locus_tag LOCUS_03430 gene petA 37432 36872 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_03430 39189 38155 gene locus_tag LOCUS_03440 39189 38155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 39701 39252 gene locus_tag LOCUS_03450 39701 39252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 40327 39803 gene locus_tag LOCUS_03460 40327 39803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 41728 40328 gene locus_tag LOCUS_03470 gene nrfD 41728 40328 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063680.1 protein_id gnl|my_center|LOCUS_03470 42666 41824 gene locus_tag LOCUS_03480 42666 41824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 44861 42669 gene locus_tag LOCUS_03490 44861 42669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 45552 44941 gene locus_tag LOCUS_03500 45552 44941 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_03500 46639 46205 gene locus_tag LOCUS_03510 46639 46205 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091210.1 protein_id gnl|my_center|LOCUS_03510 49864 46784 gene locus_tag LOCUS_03520 49864 46784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 50469 50627 gene locus_tag LOCUS_03530 50469 50627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 52207 51707 gene locus_tag LOCUS_03540 52207 51707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 53676 52222 gene locus_tag LOCUS_03550 53676 52222 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_03550 54009 55094 gene locus_tag LOCUS_03560 54009 55094 CDS product alkene reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388234.1 protein_id gnl|my_center|LOCUS_03560 55139 55705 gene locus_tag LOCUS_03570 55139 55705 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975385.1 protein_id gnl|my_center|LOCUS_03570 57632 55836 gene locus_tag LOCUS_03580 57632 55836 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405539.1 protein_id gnl|my_center|LOCUS_03580 59426 57774 gene locus_tag LOCUS_03590 gene groL 59426 57774 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035771.1 protein_id gnl|my_center|LOCUS_03590 59775 59485 gene locus_tag LOCUS_03600 gene groES 59775 59485 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946424.1 protein_id gnl|my_center|LOCUS_03600 60066 60530 gene locus_tag LOCUS_03610 60066 60530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 60612 60851 gene locus_tag LOCUS_03620 60612 60851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 61226 60909 gene locus_tag LOCUS_03630 61226 60909 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_03630 62327 61392 gene locus_tag LOCUS_03640 62327 61392 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 protein_id gnl|my_center|LOCUS_03640 63868 62327 gene locus_tag LOCUS_03650 63868 62327 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_03650 64307 63855 gene locus_tag LOCUS_03660 64307 63855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 64560 64895 gene locus_tag LOCUS_03670 64560 64895 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_03670 64917 67256 gene locus_tag LOCUS_03680 64917 67256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 67281 67844 gene locus_tag LOCUS_03690 67281 67844 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194069.1 protein_id gnl|my_center|LOCUS_03690 68051 68512 gene locus_tag LOCUS_03700 gene aroQ 68051 68512 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095385.1 protein_id gnl|my_center|LOCUS_03700 68561 69013 gene locus_tag LOCUS_03710 gene accB 68561 69013 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478605.1 protein_id gnl|my_center|LOCUS_03710 69091 70431 gene locus_tag LOCUS_03720 gene accC 69091 70431 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884639.1 protein_id gnl|my_center|LOCUS_03720 70589 71473 gene locus_tag LOCUS_03730 gene prmA 70589 71473 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112237.1 protein_id gnl|my_center|LOCUS_03730 71593 72303 gene locus_tag LOCUS_03740 71593 72303 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389000.1 protein_id gnl|my_center|LOCUS_03740 72885 74630 gene locus_tag LOCUS_03750 72885 74630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 <76308 75051 gene locus_tag LOCUS_03760 <76308 75051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_133503194.1:PAS domain-containing methyl-accepting chemotaxis protein >Feature sequence006 1785 904 gene locus_tag LOCUS_03770 gene htpX 1785 904 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090915.1 protein_id gnl|my_center|LOCUS_03770 2198 1830 gene locus_tag LOCUS_03780 2198 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 4548 2203 gene locus_tag LOCUS_03790 4548 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 5404 4589 gene locus_tag LOCUS_03800 5404 4589 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_03800 5747 5436 gene locus_tag LOCUS_03810 5747 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 6154 5807 gene locus_tag LOCUS_03820 6154 5807 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124705.1 protein_id gnl|my_center|LOCUS_03820 7722 6244 gene locus_tag LOCUS_03830 7722 6244 CDS product form I ribulose bisphosphate carboxylase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124704.1 protein_id gnl|my_center|LOCUS_03830 7786 8751 gene locus_tag LOCUS_03840 7786 8751 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_03840 10738 9005 gene locus_tag LOCUS_03850 gene polX 10738 9005 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551361.1 protein_id gnl|my_center|LOCUS_03850 19536 11329 gene locus_tag LOCUS_03860 19536 11329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 21590 19728 gene locus_tag LOCUS_03870 21590 19728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 21914 24823 gene locus_tag LOCUS_03880 gene rapA 21914 24823 CDS product RNA polymerase-associated protein RapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117001.1 protein_id gnl|my_center|LOCUS_03880 25571 25233 gene locus_tag LOCUS_03890 25571 25233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 25641 27191 gene locus_tag LOCUS_03900 25641 27191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 29653 27569 gene locus_tag LOCUS_03910 gene fusA 29653 27569 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774533.1 protein_id gnl|my_center|LOCUS_03910 29830 29754 gene locus_tag LOCUS_t00050 29830 29754 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 30310 29954 gene locus_tag LOCUS_03920 30310 29954 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090655.1 protein_id gnl|my_center|LOCUS_03920 30590 30288 gene locus_tag LOCUS_03930 gene ihfA 30590 30288 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553164.1 protein_id gnl|my_center|LOCUS_03930 32995 30614 gene locus_tag LOCUS_03940 gene pheT 32995 30614 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103972.1 protein_id gnl|my_center|LOCUS_03940 34060 33029 gene locus_tag LOCUS_03950 gene pheS 34060 33029 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114409.1 protein_id gnl|my_center|LOCUS_03950 34551 34192 gene locus_tag LOCUS_03960 gene rplT 34551 34192 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214103.1 protein_id gnl|my_center|LOCUS_03960 34775 34578 gene locus_tag LOCUS_03970 gene rpmI 34775 34578 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005596065.1 protein_id gnl|my_center|LOCUS_03970 35360 34923 gene locus_tag LOCUS_03980 gene infC 35360 34923 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023546.1 protein_id gnl|my_center|LOCUS_03980 37376 35451 gene locus_tag LOCUS_03990 gene thrS 37376 35451 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005738829.1 protein_id gnl|my_center|LOCUS_03990 40033 37532 gene locus_tag LOCUS_04000 gene glgP 40033 37532 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939622.1 protein_id gnl|my_center|LOCUS_04000 42040 40340 gene locus_tag LOCUS_04010 42040 40340 CDS product alpha-D-glucose phosphate-specific phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143971.1 protein_id gnl|my_center|LOCUS_04010 42354 42073 gene locus_tag LOCUS_04020 42354 42073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 42739 42326 gene locus_tag LOCUS_04030 42739 42326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 44581 43112 gene locus_tag LOCUS_04040 gene glgA 44581 43112 CDS product glycogen synthase GlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817363.1 protein_id gnl|my_center|LOCUS_04040 46779 44587 gene locus_tag LOCUS_04050 gene glgB 46779 44587 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390326.1 protein_id gnl|my_center|LOCUS_04050 46963 48225 gene locus_tag LOCUS_04060 gene glgC 46963 48225 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071681.1 protein_id gnl|my_center|LOCUS_04060 48258 49970 gene locus_tag LOCUS_04070 48258 49970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 50429 51937 gene locus_tag LOCUS_04080 gene malQ 50429 51937 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056555.1 protein_id gnl|my_center|LOCUS_04080 54533 51975 gene locus_tag LOCUS_04090 gene glgP 54533 51975 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256629.1 protein_id gnl|my_center|LOCUS_04090 55025 54687 gene locus_tag LOCUS_04100 55025 54687 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398993.1 protein_id gnl|my_center|LOCUS_04100 55695 55117 gene locus_tag LOCUS_04110 55695 55117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 55878 55802 gene locus_tag LOCUS_t00060 55878 55802 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 57603 56023 gene locus_tag LOCUS_04120 57603 56023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 60066 58036 gene locus_tag LOCUS_04130 gene uvrB 60066 58036 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957630.1 protein_id gnl|my_center|LOCUS_04130 60146 61345 gene locus_tag LOCUS_04140 60146 61345 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945831.1 protein_id gnl|my_center|LOCUS_04140 61425 61500 gene locus_tag LOCUS_t00070 61425 61500 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 62426 63397 gene locus_tag LOCUS_04150 62426 63397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 63501 63710 gene locus_tag LOCUS_04160 63501 63710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 64112 63750 gene locus_tag LOCUS_04170 64112 63750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 65848 64112 gene locus_tag LOCUS_04180 gene hsbR 65848 64112 CDS product two-component system response regulator HsbR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098751.1 protein_id gnl|my_center|LOCUS_04180 66259 65951 gene locus_tag LOCUS_04190 gene hsbA 66259 65951 CDS product anti-anti sigma factor HsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091727.1 protein_id gnl|my_center|LOCUS_04190 67140 66583 gene locus_tag LOCUS_04200 67140 66583 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391428.1 protein_id gnl|my_center|LOCUS_04200 68080 67229 gene locus_tag LOCUS_04210 68080 67229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 68328 68092 gene locus_tag LOCUS_04220 68328 68092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 68661 70619 gene locus_tag LOCUS_04230 gene slt 68661 70619 CDS product lytic transglycosylase Slt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113975.1 protein_id gnl|my_center|LOCUS_04230 71915 72934 gene locus_tag LOCUS_04240 71915 72934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 >Feature sequence007 619 1539 gene locus_tag LOCUS_04250 619 1539 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014537907.1 protein_id gnl|my_center|LOCUS_04250 2044 1514 gene locus_tag LOCUS_04260 2044 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2339 4522 gene locus_tag LOCUS_04270 2339 4522 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396305.1 protein_id gnl|my_center|LOCUS_04270 4530 5681 gene locus_tag LOCUS_04280 4530 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 5704 6618 gene locus_tag LOCUS_04290 5704 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6611 7822 gene locus_tag LOCUS_04300 6611 7822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 8122 8913 gene locus_tag LOCUS_04310 8122 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 9387 9743 gene locus_tag LOCUS_04320 9387 9743 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920612.1 protein_id gnl|my_center|LOCUS_04320 9740 11047 gene locus_tag LOCUS_04330 9740 11047 CDS product type II toxin-antitoxin system HipA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920611.1 protein_id gnl|my_center|LOCUS_04330 11439 14345 gene locus_tag LOCUS_04340 11439 14345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 14566 15057 gene locus_tag LOCUS_04350 14566 15057 CDS product NlpC/P60 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169395.1 protein_id gnl|my_center|LOCUS_04350 15202 15450 gene locus_tag LOCUS_04360 15202 15450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 15529 15984 gene locus_tag LOCUS_04370 15529 15984 CDS product host attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000792515.1 protein_id gnl|my_center|LOCUS_04370 16486 16001 gene locus_tag LOCUS_04380 16486 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 16958 16597 gene locus_tag LOCUS_tm00010 16958 16597 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 17544 17071 gene locus_tag LOCUS_04390 gene smpB 17544 17071 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262462.1 protein_id gnl|my_center|LOCUS_04390 17595 19022 gene locus_tag LOCUS_04400 17595 19022 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007243715.1 protein_id gnl|my_center|LOCUS_04400 19037 19471 gene locus_tag LOCUS_04410 19037 19471 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_04410 19461 19808 gene locus_tag LOCUS_04420 19461 19808 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262461.1 protein_id gnl|my_center|LOCUS_04420 20191 19805 gene locus_tag LOCUS_04430 20191 19805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 20277 20708 gene locus_tag LOCUS_04440 gene fur 20277 20708 CDS product ferric iron uptake transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958136.1 protein_id gnl|my_center|LOCUS_04440 22756 21065 gene locus_tag LOCUS_04450 gene recN 22756 21065 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706784.1 protein_id gnl|my_center|LOCUS_04450 23659 22784 gene locus_tag LOCUS_04460 gene nadK 23659 22784 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005303013.1 protein_id gnl|my_center|LOCUS_04460 23857 24972 gene locus_tag LOCUS_04470 gene hrcA 23857 24972 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_04470 25044 25640 gene locus_tag LOCUS_04480 gene grpE 25044 25640 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313642.1 protein_id gnl|my_center|LOCUS_04480 25747 27681 gene locus_tag LOCUS_04490 gene dnaK 25747 27681 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770882.1 protein_id gnl|my_center|LOCUS_04490 27839 28966 gene locus_tag LOCUS_04500 gene dnaJ 27839 28966 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209249.1 protein_id gnl|my_center|LOCUS_04500 29029 29496 gene locus_tag LOCUS_04510 29029 29496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 29647 30444 gene locus_tag LOCUS_04520 gene dapB 29647 30444 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766439.1 protein_id gnl|my_center|LOCUS_04520 30450 31898 gene locus_tag LOCUS_04530 30450 31898 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963606.1 protein_id gnl|my_center|LOCUS_04530 31891 32289 gene locus_tag LOCUS_04540 31891 32289 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_04540 32626 33546 gene locus_tag LOCUS_04550 gene gldA 32626 33546 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209146359.1 protein_id gnl|my_center|LOCUS_04550 33539 36391 gene locus_tag LOCUS_04560 33539 36391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 36396 37379 gene locus_tag LOCUS_04570 36396 37379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 37534 38655 gene locus_tag LOCUS_04580 gene carA 37534 38655 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105665.1 protein_id gnl|my_center|LOCUS_04580 38671 38910 gene locus_tag LOCUS_04590 38671 38910 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963300.1 protein_id gnl|my_center|LOCUS_04590 38936 42157 gene locus_tag LOCUS_04600 gene carB 38936 42157 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095207.1 protein_id gnl|my_center|LOCUS_04600 42154 42633 gene locus_tag LOCUS_04610 gene greA 42154 42633 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688476.1 protein_id gnl|my_center|LOCUS_04610 42633 43112 gene locus_tag LOCUS_04620 42633 43112 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521823.1 protein_id gnl|my_center|LOCUS_04620 43405 43109 gene locus_tag LOCUS_04630 gene yhbY 43405 43109 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298134.1 protein_id gnl|my_center|LOCUS_04630 43637 43930 gene locus_tag LOCUS_04640 43637 43930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 43927 44565 gene locus_tag LOCUS_04650 gene rlmE 43927 44565 CDS product 23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095202.1 protein_id gnl|my_center|LOCUS_04650 44715 46646 gene locus_tag LOCUS_04660 gene ftsH 44715 46646 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707080.1 protein_id gnl|my_center|LOCUS_04660 46679 47530 gene locus_tag LOCUS_04670 gene folP 46679 47530 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113907.1 protein_id gnl|my_center|LOCUS_04670 47523 48863 gene locus_tag LOCUS_04680 gene glmM 47523 48863 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707078.1 protein_id gnl|my_center|LOCUS_04680 48997 49746 gene locus_tag LOCUS_04690 gene tpiA 48997 49746 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071430.1 protein_id gnl|my_center|LOCUS_04690 49802 50194 gene locus_tag LOCUS_04700 gene secG 49802 50194 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185627.1 protein_id gnl|my_center|LOCUS_04700 50246 50330 gene locus_tag LOCUS_t00080 50246 50330 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 51410 51766 gene locus_tag LOCUS_04710 51410 51766 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_04710 51757 52233 gene locus_tag LOCUS_04720 51757 52233 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_04720 52296 52991 gene locus_tag LOCUS_04730 52296 52991 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958234.1 protein_id gnl|my_center|LOCUS_04730 52984 54237 gene locus_tag LOCUS_04740 52984 54237 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185833.1 protein_id gnl|my_center|LOCUS_04740 54237 54737 gene locus_tag LOCUS_04750 gene nuoE 54237 54737 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_04750 54755 56032 gene locus_tag LOCUS_04760 gene nuoF 54755 56032 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443944.1 protein_id gnl|my_center|LOCUS_04760 56086 58434 gene locus_tag LOCUS_04770 gene nuoG 56086 58434 CDS product NADH-quinone oxidoreductase subunit NuoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948472.1 protein_id gnl|my_center|LOCUS_04770 58487 59572 gene locus_tag LOCUS_04780 gene nuoH 58487 59572 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948471.1 protein_id gnl|my_center|LOCUS_04780 59646 60134 gene locus_tag LOCUS_04790 gene nuoI 59646 60134 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_04790 60168 60776 gene locus_tag LOCUS_04800 60168 60776 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185672.1 protein_id gnl|my_center|LOCUS_04800 60835 61140 gene locus_tag LOCUS_04810 gene nuoK 60835 61140 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_04810 61158 63110 gene locus_tag LOCUS_04820 gene nuoL 61158 63110 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526462.1 protein_id gnl|my_center|LOCUS_04820 63171 64688 gene locus_tag LOCUS_04830 63171 64688 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186137.1 protein_id gnl|my_center|LOCUS_04830 64710 66155 gene locus_tag LOCUS_04840 gene nuoN 64710 66155 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958226.1 protein_id gnl|my_center|LOCUS_04840 66458 66625 gene locus_tag LOCUS_04850 66458 66625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 67847 66576 gene locus_tag LOCUS_04860 67847 66576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04860 68423 67872 gene locus_tag LOCUS_04870 gene mobB 68423 67872 CDS product molybdopterin-guanine dinucleotide biosynthesis protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000907622.1 protein_id gnl|my_center|LOCUS_04870 >Feature sequence008 1938 478 gene locus_tag LOCUS_04880 gene guaB 1938 478 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003314194.1 protein_id gnl|my_center|LOCUS_04880 2177 2509 gene locus_tag LOCUS_04890 2177 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 2636 3997 gene locus_tag LOCUS_04900 gene xseA 2636 3997 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000953156.1 protein_id gnl|my_center|LOCUS_04900 3997 4872 gene locus_tag LOCUS_04910 3997 4872 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092745.1 protein_id gnl|my_center|LOCUS_04910 5081 5878 gene locus_tag LOCUS_04920 5081 5878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 5932 6444 gene locus_tag LOCUS_04930 5932 6444 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175145.1 protein_id gnl|my_center|LOCUS_04930 6441 7160 gene locus_tag LOCUS_04940 6441 7160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 7157 7579 gene locus_tag LOCUS_04950 7157 7579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 8701 7595 gene locus_tag LOCUS_04960 gene hemH 8701 7595 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073218.1 protein_id gnl|my_center|LOCUS_04960 8837 9472 gene locus_tag LOCUS_04970 8837 9472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 9494 9970 gene locus_tag LOCUS_04980 9494 9970 CDS product copper chaperone PCu(A)C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483350.1 protein_id gnl|my_center|LOCUS_04980 10009 10896 gene locus_tag LOCUS_04990 10009 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 10922 11167 gene locus_tag LOCUS_05000 10922 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 11619 11260 gene locus_tag LOCUS_05010 11619 11260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 12881 11907 gene locus_tag LOCUS_05020 gene epmA 12881 11907 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004789.1 protein_id gnl|my_center|LOCUS_05020 13489 12920 gene locus_tag LOCUS_05030 gene efp 13489 12920 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_05030 13563 14651 gene locus_tag LOCUS_05040 gene epmB 13563 14651 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_05040 15072 16943 gene locus_tag LOCUS_05050 15072 16943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 16974 19052 gene locus_tag LOCUS_05060 gene fimX 16974 19052 CDS product cyclic di-GMP-binding protein FimX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095680.1 protein_id gnl|my_center|LOCUS_05060 20953 19073 gene locus_tag LOCUS_05070 20953 19073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 23229 20956 gene locus_tag LOCUS_05080 gene parC 23229 20956 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095687.1 protein_id gnl|my_center|LOCUS_05080 23760 23419 gene locus_tag LOCUS_05090 23760 23419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 26615 24717 gene locus_tag LOCUS_05100 gene parE 26615 24717 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102062.1 protein_id gnl|my_center|LOCUS_05100 26885 29356 gene locus_tag LOCUS_05110 26885 29356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 29383 30531 gene locus_tag LOCUS_05120 29383 30531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 31921 30572 gene locus_tag LOCUS_05130 gene carS 31921 30572 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_05130 32598 31918 gene locus_tag LOCUS_05140 32598 31918 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_05140 33194 32901 gene locus_tag LOCUS_05150 33194 32901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 33758 33195 gene locus_tag LOCUS_05160 33758 33195 CDS product diheme cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074113.1 protein_id gnl|my_center|LOCUS_05160 34184 33783 gene locus_tag LOCUS_05170 34184 33783 CDS product DUF1924 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074112.1 protein_id gnl|my_center|LOCUS_05170 34810 34181 gene locus_tag LOCUS_05180 34810 34181 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074111.1 protein_id gnl|my_center|LOCUS_05180 35093 35329 gene locus_tag LOCUS_05190 35093 35329 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093283.1 protein_id gnl|my_center|LOCUS_05190 35379 36269 gene locus_tag LOCUS_05200 35379 36269 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245492.1 protein_id gnl|my_center|LOCUS_05200 36417 38471 gene locus_tag LOCUS_05210 gene dxs 36417 38471 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102816.1 protein_id gnl|my_center|LOCUS_05210 38657 39040 gene locus_tag LOCUS_05220 gene queD 38657 39040 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_05220 39108 39932 gene locus_tag LOCUS_05230 gene folE2 39108 39932 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195713.1 protein_id gnl|my_center|LOCUS_05230 40453 40166 gene locus_tag LOCUS_05240 40453 40166 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141822.1 protein_id gnl|my_center|LOCUS_05240 40716 40450 gene locus_tag LOCUS_05250 40716 40450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 41160 40867 gene locus_tag LOCUS_05260 41160 40867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 42035 41457 gene locus_tag LOCUS_05270 42035 41457 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093301.1 protein_id gnl|my_center|LOCUS_05270 42166 42882 gene locus_tag LOCUS_05280 42166 42882 CDS product GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113559.1 protein_id gnl|my_center|LOCUS_05280 43084 42884 gene locus_tag LOCUS_05290 43084 42884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 44233 43262 gene locus_tag LOCUS_05300 44233 43262 CDS product DUF1853 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267174.1 protein_id gnl|my_center|LOCUS_05300 44324 47554 gene locus_tag LOCUS_05310 44324 47554 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975826.1 protein_id gnl|my_center|LOCUS_05310 47920 49212 gene locus_tag LOCUS_05320 47920 49212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 49274 49624 gene locus_tag LOCUS_05330 49274 49624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 50815 49631 gene locus_tag LOCUS_05340 50815 49631 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113933.1 protein_id gnl|my_center|LOCUS_05340 52543 51029 gene locus_tag LOCUS_05350 gene purF 52543 51029 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091383.1 protein_id gnl|my_center|LOCUS_05350 53096 52620 gene locus_tag LOCUS_05360 53096 52620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 53730 53113 gene locus_tag LOCUS_05370 53730 53113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 55037 53760 gene locus_tag LOCUS_05380 gene folC 55037 53760 CDS product bifunctional tetrahydrofolate synthase/dihydrofolate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043123896.1 protein_id gnl|my_center|LOCUS_05380 55989 55129 gene locus_tag LOCUS_05390 gene accD 55989 55129 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000118593.1 protein_id gnl|my_center|LOCUS_05390 56455 56066 gene locus_tag LOCUS_05400 56455 56066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 57349 56546 gene locus_tag LOCUS_05410 gene trpA 57349 56546 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528976.1 protein_id gnl|my_center|LOCUS_05410 58719 57484 gene locus_tag LOCUS_05420 gene trpB 58719 57484 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188704.1 protein_id gnl|my_center|LOCUS_05420 59571 58939 gene locus_tag LOCUS_05430 59571 58939 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104200.1 protein_id gnl|my_center|LOCUS_05430 60387 59605 gene locus_tag LOCUS_05440 gene truA 60387 59605 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091390.1 protein_id gnl|my_center|LOCUS_05440 61106 60387 gene locus_tag LOCUS_05450 61106 60387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 63850 61226 gene locus_tag LOCUS_05460 gene fimV 63850 61226 CDS product motility hub landmark protein FimV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003163304.1 protein_id gnl|my_center|LOCUS_05460 65010 63988 gene locus_tag LOCUS_05470 65010 63988 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957862.1 protein_id gnl|my_center|LOCUS_05470 66158 65046 gene locus_tag LOCUS_05480 gene asd 66158 65046 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001263690.1 protein_id gnl|my_center|LOCUS_05480 67358 66288 gene locus_tag LOCUS_05490 gene leuB 67358 66288 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213431.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence009 1576 995 gene locus_tag LOCUS_05500 gene sodB 1576 995 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096926.1 protein_id gnl|my_center|LOCUS_05500 1774 3312 gene locus_tag LOCUS_05510 1774 3312 CDS product hydantoinase B/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881258.1 protein_id gnl|my_center|LOCUS_05510 4583 3495 gene locus_tag LOCUS_05520 4583 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5376 4723 gene locus_tag LOCUS_05530 5376 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 6369 5410 gene locus_tag LOCUS_05540 6369 5410 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090361384.1 protein_id gnl|my_center|LOCUS_05540 8222 6441 gene locus_tag LOCUS_05550 8222 6441 CDS product copper resistance system multicopper oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815301.1 protein_id gnl|my_center|LOCUS_05550 8481 9164 gene locus_tag LOCUS_05560 gene silR 8481 9164 CDS product copper/silver response regulator transcription factor SilR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000697968.1 protein_id gnl|my_center|LOCUS_05560 9161 10606 gene locus_tag LOCUS_05570 gene cusS 9161 10606 CDS product Cu(+)/Ag(+) sensor histidine kinase CusS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000253844.1 protein_id gnl|my_center|LOCUS_05570 11396 10629 gene locus_tag LOCUS_05580 11396 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 11865 11410 gene locus_tag LOCUS_05590 11865 11410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 12182 13990 gene locus_tag LOCUS_05600 12182 13990 CDS product N-acetylglutaminylglutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969278.1 protein_id gnl|my_center|LOCUS_05600 14097 14435 gene locus_tag LOCUS_05610 gene grxD 14097 14435 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_05610 15392 14712 gene locus_tag LOCUS_05620 gene rnt 15392 14712 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_05620 16420 15377 gene locus_tag LOCUS_05630 gene pyrC 16420 15377 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112889.1 protein_id gnl|my_center|LOCUS_05630 16502 17278 gene locus_tag LOCUS_05640 16502 17278 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 protein_id gnl|my_center|LOCUS_05640 17275 17787 gene locus_tag LOCUS_05650 17275 17787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 18139 18768 gene locus_tag LOCUS_05660 18139 18768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 18985 21645 gene locus_tag LOCUS_05670 gene aceE 18985 21645 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222352.1 protein_id gnl|my_center|LOCUS_05670 21886 23187 gene locus_tag LOCUS_05680 gene aceF 21886 23187 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_05680 23191 24978 gene locus_tag LOCUS_05690 gene lpdA 23191 24978 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930129.1 protein_id gnl|my_center|LOCUS_05690 25024 26241 gene locus_tag LOCUS_05700 25024 26241 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_05700 26424 28859 gene locus_tag LOCUS_05710 26424 28859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 28987 29256 gene locus_tag LOCUS_05720 28987 29256 CDS product DUF2282 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706878.1 protein_id gnl|my_center|LOCUS_05720 29268 30155 gene locus_tag LOCUS_05730 29268 30155 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458570.1 protein_id gnl|my_center|LOCUS_05730 30106 30972 gene locus_tag LOCUS_05740 30106 30972 CDS product putative DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508790.1 protein_id gnl|my_center|LOCUS_05740 30969 31442 gene locus_tag LOCUS_05750 30969 31442 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458568.1 protein_id gnl|my_center|LOCUS_05750 31881 31447 gene locus_tag LOCUS_05760 31881 31447 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553866.1 protein_id gnl|my_center|LOCUS_05760 32516 31881 gene locus_tag LOCUS_05770 gene nth 32516 31881 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210602.1 protein_id gnl|my_center|LOCUS_05770 32978 35206 gene locus_tag LOCUS_05780 gene priA 32978 35206 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170066715.1 protein_id gnl|my_center|LOCUS_05780 35976 35281 gene locus_tag LOCUS_05790 35976 35281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 36409 36182 gene locus_tag LOCUS_05800 36409 36182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 36359 38119 gene locus_tag LOCUS_05810 gene argS 36359 38119 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947747.1 protein_id gnl|my_center|LOCUS_05810 38133 38699 gene locus_tag LOCUS_05820 38133 38699 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095850.1 protein_id gnl|my_center|LOCUS_05820 38974 43560 gene locus_tag LOCUS_05830 38974 43560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 43921 43601 gene locus_tag LOCUS_05840 43921 43601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 45062 44604 gene locus_tag LOCUS_05850 45062 44604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 45406 46338 gene locus_tag LOCUS_05860 45406 46338 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057673536.1 protein_id gnl|my_center|LOCUS_05860 46631 47398 gene locus_tag LOCUS_05870 46631 47398 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206134.1 protein_id gnl|my_center|LOCUS_05870 47475 48641 gene locus_tag LOCUS_05880 47475 48641 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867639.1 protein_id gnl|my_center|LOCUS_05880 48768 50369 gene locus_tag LOCUS_05890 48768 50369 CDS product GMC oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142818.1 protein_id gnl|my_center|LOCUS_05890 50369 51490 gene locus_tag LOCUS_05900 50369 51490 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003315709.1 protein_id gnl|my_center|LOCUS_05900 52873 51599 gene locus_tag LOCUS_05910 52873 51599 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262597.1 protein_id gnl|my_center|LOCUS_05910 53228 52890 gene locus_tag LOCUS_05920 gene glnK 53228 52890 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096476.1 protein_id gnl|my_center|LOCUS_05920 54004 53333 gene locus_tag LOCUS_05930 54004 53333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 54114 54329 gene locus_tag LOCUS_05940 54114 54329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 54351 54608 gene locus_tag LOCUS_05950 54351 54608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 54642 56153 gene locus_tag LOCUS_05960 54642 56153 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038949.1 protein_id gnl|my_center|LOCUS_05960 56252 56704 gene locus_tag LOCUS_05970 56252 56704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 56708 57838 gene locus_tag LOCUS_05980 56708 57838 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705255.1 protein_id gnl|my_center|LOCUS_05980 58013 61066 gene locus_tag LOCUS_05990 58013 61066 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705254.1 protein_id gnl|my_center|LOCUS_05990 61580 61089 gene locus_tag LOCUS_06000 61580 61089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 61710 62174 gene locus_tag LOCUS_06010 61710 62174 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534145.1 protein_id gnl|my_center|LOCUS_06010 62335 63762 gene locus_tag LOCUS_06020 gene glcD 62335 63762 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765139.1 protein_id gnl|my_center|LOCUS_06020 63762 65027 gene locus_tag LOCUS_06030 gene glcE 63762 65027 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194396.1 protein_id gnl|my_center|LOCUS_06030 65480 66715 gene locus_tag LOCUS_06040 gene glcF 65480 66715 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268367.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence010 723 2048 gene locus_tag LOCUS_06050 723 2048 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732326.1 protein_id gnl|my_center|LOCUS_06050 3000 2302 gene locus_tag LOCUS_06060 3000 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3205 5574 gene locus_tag LOCUS_06070 3205 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 5587 6366 gene locus_tag LOCUS_06080 5587 6366 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058076.1 protein_id gnl|my_center|LOCUS_06080 6429 6779 gene locus_tag LOCUS_06090 6429 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6929 7396 gene locus_tag LOCUS_06100 6929 7396 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036473.1 protein_id gnl|my_center|LOCUS_06100 7428 8909 gene locus_tag LOCUS_06110 7428 8909 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014538266.1 protein_id gnl|my_center|LOCUS_06110 9801 9139 gene locus_tag LOCUS_06120 9801 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 11661 9907 gene locus_tag LOCUS_06130 11661 9907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 12534 11671 gene locus_tag LOCUS_06140 12534 11671 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176666.1 protein_id gnl|my_center|LOCUS_06140 13578 12727 gene locus_tag LOCUS_06150 13578 12727 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038034.1 protein_id gnl|my_center|LOCUS_06150 13733 14260 gene locus_tag LOCUS_06160 13733 14260 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_06160 14510 16714 gene locus_tag LOCUS_06170 14510 16714 CDS product HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056430.1 protein_id gnl|my_center|LOCUS_06170 16711 17568 gene locus_tag LOCUS_06180 16711 17568 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120323.1 protein_id gnl|my_center|LOCUS_06180 18170 17595 gene locus_tag LOCUS_06190 18170 17595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 19255 18428 gene locus_tag LOCUS_06200 19255 18428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 19595 20200 gene locus_tag LOCUS_06210 gene lexA 19595 20200 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646078.1 protein_id gnl|my_center|LOCUS_06210 20200 20367 gene locus_tag LOCUS_06220 20200 20367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 20770 21342 gene locus_tag LOCUS_06230 20770 21342 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_06230 21609 22529 gene locus_tag LOCUS_06240 21609 22529 CDS product GIDE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112766.1 protein_id gnl|my_center|LOCUS_06240 23404 22751 gene locus_tag LOCUS_06250 23404 22751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 23501 24349 gene locus_tag LOCUS_06260 23501 24349 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080622.1 protein_id gnl|my_center|LOCUS_06260 24816 24460 gene locus_tag LOCUS_06270 24816 24460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 27708 24868 gene locus_tag LOCUS_06280 27708 24868 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113794.1 protein_id gnl|my_center|LOCUS_06280 28074 28994 gene locus_tag LOCUS_06290 28074 28994 CDS product D-hexose-6-phosphate mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895705.1 protein_id gnl|my_center|LOCUS_06290 28991 29605 gene locus_tag LOCUS_06300 28991 29605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 30479 29616 gene locus_tag LOCUS_06310 30479 29616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 31912 30941 gene locus_tag LOCUS_06320 31912 30941 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_06320 32073 33911 gene locus_tag LOCUS_06330 gene recQ 32073 33911 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198363.1 protein_id gnl|my_center|LOCUS_06330 36415 33893 gene locus_tag LOCUS_06340 36415 33893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 36859 36431 gene locus_tag LOCUS_06350 gene holC 36859 36431 CDS product DNA polymerase III subunit chi inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100593.1 protein_id gnl|my_center|LOCUS_06350 38376 36856 gene locus_tag LOCUS_06360 gene pepA 38376 36856 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_06360 38566 39681 gene locus_tag LOCUS_06370 gene lptF 38566 39681 CDS product LPS export ABC transporter permease LptF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443992.1 protein_id gnl|my_center|LOCUS_06370 39681 40745 gene locus_tag LOCUS_06380 gene lptG 39681 40745 CDS product LPS export ABC transporter permease LptG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071579.1 protein_id gnl|my_center|LOCUS_06380 42819 41095 gene locus_tag LOCUS_06390 gene soxB 42819 41095 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_06390 44008 43175 gene locus_tag LOCUS_06400 gene soxA 44008 43175 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 protein_id gnl|my_center|LOCUS_06400 44390 44073 gene locus_tag LOCUS_06410 gene soxZ 44390 44073 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_06410 44895 44434 gene locus_tag LOCUS_06420 gene soxY 44895 44434 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932696.1 protein_id gnl|my_center|LOCUS_06420 45331 44957 gene locus_tag LOCUS_06430 gene soxX 45331 44957 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 protein_id gnl|my_center|LOCUS_06430 47009 45528 gene locus_tag LOCUS_06440 47009 45528 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112546.1 protein_id gnl|my_center|LOCUS_06440 47392 47622 gene locus_tag LOCUS_06450 47392 47622 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193727.1 protein_id gnl|my_center|LOCUS_06450 47655 48125 gene locus_tag LOCUS_06460 47655 48125 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_06460 49502 48234 gene locus_tag LOCUS_06470 49502 48234 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_06470 50003 51145 gene locus_tag LOCUS_06480 50003 51145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 51250 52167 gene locus_tag LOCUS_06490 51250 52167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 53423 52272 gene locus_tag LOCUS_06500 53423 52272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 53700 55064 gene locus_tag LOCUS_06510 53700 55064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 56452 55085 gene locus_tag LOCUS_06520 56452 55085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 56774 57532 gene locus_tag LOCUS_06530 56774 57532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 57717 58754 gene locus_tag LOCUS_06540 57717 58754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 58891 60360 gene locus_tag LOCUS_06550 58891 60360 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044893.1 protein_id gnl|my_center|LOCUS_06550 >Feature sequence011 <1 1594 gene locus_tag LOCUS_06560 <1 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927084.1:bifunctional aldolase/short-chain dehydrogenase 1773 2804 gene locus_tag LOCUS_06570 1773 2804 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087119.1 protein_id gnl|my_center|LOCUS_06570 3705 2818 gene locus_tag LOCUS_06580 gene hpnC 3705 2818 CDS product squalene synthase HpnC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020997346.1 protein_id gnl|my_center|LOCUS_06580 3746 3952 gene locus_tag LOCUS_06590 3746 3952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5302 3965 gene locus_tag LOCUS_06600 5302 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5504 7468 gene locus_tag LOCUS_06610 5504 7468 CDS product cytochrome c/FTR1 family iron permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115264.1 protein_id gnl|my_center|LOCUS_06610 8156 7488 gene locus_tag LOCUS_06620 gene gph 8156 7488 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957521.1 protein_id gnl|my_center|LOCUS_06620 9139 8375 gene locus_tag LOCUS_06630 9139 8375 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113434.1 protein_id gnl|my_center|LOCUS_06630 9573 9136 gene locus_tag LOCUS_06640 9573 9136 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957854.1 protein_id gnl|my_center|LOCUS_06640 9731 10918 gene locus_tag LOCUS_06650 gene alaC 9731 10918 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005739631.1 protein_id gnl|my_center|LOCUS_06650 11210 12523 gene locus_tag LOCUS_06660 11210 12523 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109642.1 protein_id gnl|my_center|LOCUS_06660 12636 14141 gene locus_tag LOCUS_06670 gene thrC 12636 14141 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001117321.1 protein_id gnl|my_center|LOCUS_06670 14246 15367 gene locus_tag LOCUS_06680 gene tgt 14246 15367 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073009.1 protein_id gnl|my_center|LOCUS_06680 15548 15889 gene locus_tag LOCUS_06690 gene yajC 15548 15889 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809416.1 protein_id gnl|my_center|LOCUS_06690 15941 17812 gene locus_tag LOCUS_06700 gene secD 15941 17812 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482962.1 protein_id gnl|my_center|LOCUS_06700 17858 18796 gene locus_tag LOCUS_06710 gene secF 17858 18796 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460198.1 protein_id gnl|my_center|LOCUS_06710 19703 18867 gene locus_tag LOCUS_06720 19703 18867 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103285.1 protein_id gnl|my_center|LOCUS_06720 21075 19708 gene locus_tag LOCUS_06730 21075 19708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 21306 22562 gene locus_tag LOCUS_06740 gene glyA 21306 22562 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000919159.1 protein_id gnl|my_center|LOCUS_06740 22628 23134 gene locus_tag LOCUS_06750 gene nrdR 22628 23134 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010675395.1 protein_id gnl|my_center|LOCUS_06750 23127 24236 gene locus_tag LOCUS_06760 gene ribD 23127 24236 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150434.1 protein_id gnl|my_center|LOCUS_06760 24738 25829 gene locus_tag LOCUS_06770 24738 25829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 25892 26419 gene locus_tag LOCUS_06780 25892 26419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 26521 27132 gene locus_tag LOCUS_06790 26521 27132 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977456.1 protein_id gnl|my_center|LOCUS_06790 27135 28910 gene locus_tag LOCUS_06800 27135 28910 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_06800 28954 30342 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccgctcccgtctttttgagacgggagaac 30810 30520 gene locus_tag LOCUS_06810 gene cas2 30810 30520 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_06810 31861 30830 gene locus_tag LOCUS_06820 gene cas1c 31861 30830 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_06820 32499 31858 gene locus_tag LOCUS_06830 gene cas4 32499 31858 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_06830 33397 32504 gene locus_tag LOCUS_06840 gene cas7c 33397 32504 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176709.1 protein_id gnl|my_center|LOCUS_06840 35166 33394 gene locus_tag LOCUS_06850 gene cas8c 35166 33394 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926986.1 protein_id gnl|my_center|LOCUS_06850 35825 35163 gene locus_tag LOCUS_06860 gene cas5c 35825 35163 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932806.1 protein_id gnl|my_center|LOCUS_06860 36265 35822 gene locus_tag LOCUS_06870 36265 35822 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_075890604.1 protein_id gnl|my_center|LOCUS_06870 36552 36262 gene locus_tag LOCUS_06880 36552 36262 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143788.1 protein_id gnl|my_center|LOCUS_06880 38835 36607 gene locus_tag LOCUS_06890 gene cas3 38835 36607 CDS product CRISPR-associated helicase Cas3' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932807.1 protein_id gnl|my_center|LOCUS_06890 38964 39614 gene locus_tag LOCUS_06900 38964 39614 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_06900 39621 40748 gene locus_tag LOCUS_06910 gene ribBA 39621 40748 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_06910 40781 41254 gene locus_tag LOCUS_06920 gene ribE 40781 41254 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093311.1 protein_id gnl|my_center|LOCUS_06920 41259 41699 gene locus_tag LOCUS_06930 gene nusB 41259 41699 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093308.1 protein_id gnl|my_center|LOCUS_06930 41706 42695 gene locus_tag LOCUS_06940 gene thiL 41706 42695 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707094.1 protein_id gnl|my_center|LOCUS_06940 42743 43222 gene locus_tag LOCUS_06950 42743 43222 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113053.1 protein_id gnl|my_center|LOCUS_06950 43275 43691 gene locus_tag LOCUS_06960 43275 43691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 43935 44543 gene locus_tag LOCUS_06970 43935 44543 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072497.1 protein_id gnl|my_center|LOCUS_06970 45396 44560 gene locus_tag LOCUS_06980 45396 44560 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113853.1 protein_id gnl|my_center|LOCUS_06980 46268 45399 gene locus_tag LOCUS_06990 46268 45399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 46433 47617 gene locus_tag LOCUS_07000 46433 47617 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257106.1 protein_id gnl|my_center|LOCUS_07000 49219 47645 gene locus_tag LOCUS_07010 49219 47645 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268952.1 protein_id gnl|my_center|LOCUS_07010 49291 51669 gene locus_tag LOCUS_07020 gene mrcB 49291 51669 CDS product penicillin-binding protein 1B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100154.1 protein_id gnl|my_center|LOCUS_07020 51666 52097 gene locus_tag LOCUS_07030 51666 52097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 54199 52190 gene locus_tag LOCUS_07040 gene feoB 54199 52190 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964349.1 protein_id gnl|my_center|LOCUS_07040 54665 54192 gene locus_tag LOCUS_07050 54665 54192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 55595 55143 gene locus_tag LOCUS_07060 55595 55143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 55954 55694 gene locus_tag LOCUS_07070 55954 55694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 56581 55964 gene locus_tag LOCUS_07080 56581 55964 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389979.1 protein_id gnl|my_center|LOCUS_07080 57156 56617 gene locus_tag LOCUS_07090 57156 56617 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532473.1 protein_id gnl|my_center|LOCUS_07090 <58012 57153 gene locus_tag LOCUS_07100 <58012 57153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393743.1:branched-chain-amino-acid transaminase >Feature sequence012 875 195 gene locus_tag LOCUS_07110 875 195 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_07110 1028 1525 gene locus_tag LOCUS_07120 gene rppH 1028 1525 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098553.1 protein_id gnl|my_center|LOCUS_07120 1600 3873 gene locus_tag LOCUS_07130 gene ptsP 1600 3873 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084404.1 protein_id gnl|my_center|LOCUS_07130 4517 3870 gene locus_tag LOCUS_07140 4517 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4960 4547 gene locus_tag LOCUS_07150 4960 4547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 8133 5263 gene locus_tag LOCUS_07160 8133 5263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 8987 8130 gene locus_tag LOCUS_07170 8987 8130 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103721.1 protein_id gnl|my_center|LOCUS_07170 10951 8987 gene locus_tag LOCUS_07180 10951 8987 CDS product DUF4105 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268924.1 protein_id gnl|my_center|LOCUS_07180 11496 11014 gene locus_tag LOCUS_07190 11496 11014 CDS product DUF3015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650547.1 protein_id gnl|my_center|LOCUS_07190 14750 11652 gene locus_tag LOCUS_07200 14750 11652 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000838383.1 protein_id gnl|my_center|LOCUS_07200 14859 15092 gene locus_tag LOCUS_07210 14859 15092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 16210 15113 gene locus_tag LOCUS_07220 16210 15113 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527920.1 protein_id gnl|my_center|LOCUS_07220 17523 16243 gene locus_tag LOCUS_07230 gene hemL 17523 16243 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399812.1 protein_id gnl|my_center|LOCUS_07230 18658 17645 gene locus_tag LOCUS_07240 18658 17645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 19112 18675 gene locus_tag LOCUS_07250 19112 18675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 19916 19272 gene locus_tag LOCUS_07260 gene thiE 19916 19272 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_07260 20748 19918 gene locus_tag LOCUS_07270 20748 19918 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010427216.1 protein_id gnl|my_center|LOCUS_07270 20933 21478 gene locus_tag LOCUS_07280 20933 21478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 21890 21465 gene locus_tag LOCUS_07290 21890 21465 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958512.1 protein_id gnl|my_center|LOCUS_07290 23657 21921 gene locus_tag LOCUS_07300 23657 21921 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071515.1 protein_id gnl|my_center|LOCUS_07300 25305 23938 gene locus_tag LOCUS_07310 gene argA 25305 23938 CDS product amino-acid N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403912.1 protein_id gnl|my_center|LOCUS_07310 25961 26755 gene locus_tag LOCUS_07320 gene djlA 25961 26755 CDS product co-chaperone DjlA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704885.1 protein_id gnl|my_center|LOCUS_07320 26794 27732 gene locus_tag LOCUS_07330 26794 27732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 28554 27688 gene locus_tag LOCUS_07340 28554 27688 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099546.1 protein_id gnl|my_center|LOCUS_07340 28963 29655 gene locus_tag LOCUS_07350 gene rpe 28963 29655 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174695.1 protein_id gnl|my_center|LOCUS_07350 29747 30412 gene locus_tag LOCUS_07360 29747 30412 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815386.1 protein_id gnl|my_center|LOCUS_07360 30606 32117 gene locus_tag LOCUS_07370 gene trpE 30606 32117 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402019.1 protein_id gnl|my_center|LOCUS_07370 32166 32543 gene locus_tag LOCUS_07380 32166 32543 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_07380 32603 33187 gene locus_tag LOCUS_07390 32603 33187 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113175.1 protein_id gnl|my_center|LOCUS_07390 33385 34416 gene locus_tag LOCUS_07400 gene trpD 33385 34416 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103215.1 protein_id gnl|my_center|LOCUS_07400 34435 35973 gene locus_tag LOCUS_07410 34435 35973 CDS product tetratricopeptide repeat-containing sulfotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172931.1 protein_id gnl|my_center|LOCUS_07410 36450 37262 gene locus_tag LOCUS_07420 gene trpC 36450 37262 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113174.1 protein_id gnl|my_center|LOCUS_07420 37467 37982 gene locus_tag LOCUS_07430 37467 37982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 38815 38177 gene locus_tag LOCUS_07440 gene crp 38815 38177 CDS product cAMP-activated global transcriptional regulator CRP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085214.1 protein_id gnl|my_center|LOCUS_07440 38974 39390 gene locus_tag LOCUS_07450 38974 39390 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085219.1 protein_id gnl|my_center|LOCUS_07450 39942 40334 gene locus_tag LOCUS_07460 39942 40334 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098688.1 protein_id gnl|my_center|LOCUS_07460 40661 41491 gene locus_tag LOCUS_07470 40661 41491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 42405 41755 gene locus_tag LOCUS_07480 gene coq7 42405 41755 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 protein_id gnl|my_center|LOCUS_07480 43773 42517 gene locus_tag LOCUS_07490 43773 42517 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258001.1 protein_id gnl|my_center|LOCUS_07490 43890 44204 gene locus_tag LOCUS_07500 43890 44204 CDS product NAD(P)H-dependent oxidoreductase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530970.1 protein_id gnl|my_center|LOCUS_07500 44201 44887 gene locus_tag LOCUS_07510 44201 44887 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035515.1 protein_id gnl|my_center|LOCUS_07510 45358 45786 gene locus_tag LOCUS_07520 gene rplM 45358 45786 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000847559.1 protein_id gnl|my_center|LOCUS_07520 45836 46228 gene locus_tag LOCUS_07530 gene rpsI 45836 46228 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829824.1 protein_id gnl|my_center|LOCUS_07530 46268 46624 gene locus_tag LOCUS_07540 46268 46624 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123903.1 protein_id gnl|my_center|LOCUS_07540 46671 46744 gene locus_tag LOCUS_t00090 46671 46744 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 47402 48370 gene locus_tag LOCUS_07550 47402 48370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 48547 49638 gene locus_tag LOCUS_07560 48547 49638 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_07560 50140 51132 gene locus_tag LOCUS_07570 50140 51132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 51341 52372 gene locus_tag LOCUS_07580 51341 52372 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943066.1 protein_id gnl|my_center|LOCUS_07580 52611 54365 gene locus_tag LOCUS_07590 52611 54365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 54365 54871 gene locus_tag LOCUS_07600 54365 54871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 54892 55554 gene locus_tag LOCUS_07610 54892 55554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 55728 57458 gene locus_tag LOCUS_07620 55728 57458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence013 1867 197 gene locus_tag LOCUS_07630 1867 197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 2427 1996 gene locus_tag LOCUS_07640 2427 1996 CDS product S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068915.1 protein_id gnl|my_center|LOCUS_07640 4138 2516 gene locus_tag LOCUS_07650 4138 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 4959 4156 gene locus_tag LOCUS_07660 4959 4156 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613805.1 protein_id gnl|my_center|LOCUS_07660 6640 5009 gene locus_tag LOCUS_07670 6640 5009 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_07670 7315 6692 gene locus_tag LOCUS_07680 7315 6692 CDS product thiol:disulfide interchange protein DsbA/DsbL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403888.1 protein_id gnl|my_center|LOCUS_07680 7507 7992 gene locus_tag LOCUS_07690 7507 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 8632 8021 gene locus_tag LOCUS_07700 8632 8021 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_07700 9105 8746 gene locus_tag LOCUS_07710 9105 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 9275 9916 gene locus_tag LOCUS_07720 gene yihA 9275 9916 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945886.1 protein_id gnl|my_center|LOCUS_07720 12853 10127 gene locus_tag LOCUS_07730 gene polA 12853 10127 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074260.1 protein_id gnl|my_center|LOCUS_07730 13003 13308 gene locus_tag LOCUS_07740 13003 13308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 13651 13977 gene locus_tag LOCUS_07750 gene nirM 13651 13977 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_07750 14496 15386 gene locus_tag LOCUS_07760 14496 15386 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_07760 15444 16289 gene locus_tag LOCUS_07770 gene serB 15444 16289 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193217.1 protein_id gnl|my_center|LOCUS_07770 16303 17451 gene locus_tag LOCUS_07780 16303 17451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 18879 17533 gene locus_tag LOCUS_07790 18879 17533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 19024 19647 gene locus_tag LOCUS_07800 19024 19647 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403750.1 protein_id gnl|my_center|LOCUS_07800 19647 20957 gene locus_tag LOCUS_07810 19647 20957 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579489.1 protein_id gnl|my_center|LOCUS_07810 21028 22224 gene locus_tag LOCUS_07820 21028 22224 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880477.1 protein_id gnl|my_center|LOCUS_07820 22407 23021 gene locus_tag LOCUS_07830 22407 23021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 23076 24134 gene locus_tag LOCUS_07840 23076 24134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 24692 24210 gene locus_tag LOCUS_07850 24692 24210 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736521.1 protein_id gnl|my_center|LOCUS_07850 26076 24973 gene locus_tag LOCUS_07860 gene dctP 26076 24973 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_07860 28542 26368 gene locus_tag LOCUS_07870 gene uvrD 28542 26368 CDS product DNA helicase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383400.1 protein_id gnl|my_center|LOCUS_07870 29213 28704 gene locus_tag LOCUS_07880 29213 28704 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974701.1 protein_id gnl|my_center|LOCUS_07880 30954 29290 gene locus_tag LOCUS_07890 30954 29290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 34189 31256 gene locus_tag LOCUS_07900 34189 31256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 34453 35316 gene locus_tag LOCUS_07910 34453 35316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 35819 35418 gene locus_tag LOCUS_07920 35819 35418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 37386 36064 gene locus_tag LOCUS_07930 gene yegQ 37386 36064 CDS product tRNA 5-hydroxyuridine modification protein YegQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222142.1 protein_id gnl|my_center|LOCUS_07930 37531 38091 gene locus_tag LOCUS_07940 37531 38091 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969560.1 protein_id gnl|my_center|LOCUS_07940 38480 40456 gene locus_tag LOCUS_07950 gene tkt 38480 40456 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000098688.1 protein_id gnl|my_center|LOCUS_07950 40567 41562 gene locus_tag LOCUS_07960 gene gap 40567 41562 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038299.1 protein_id gnl|my_center|LOCUS_07960 41727 42911 gene locus_tag LOCUS_07970 41727 42911 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071212.1 protein_id gnl|my_center|LOCUS_07970 42953 44401 gene locus_tag LOCUS_07980 gene pyk 42953 44401 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958436.1 protein_id gnl|my_center|LOCUS_07980 44520 45557 gene locus_tag LOCUS_07990 gene fba 44520 45557 CDS product fructose-bisphosphate aldolase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225784.1 protein_id gnl|my_center|LOCUS_07990 46258 48411 gene locus_tag LOCUS_08000 46258 48411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 48556 50091 gene locus_tag LOCUS_08010 48556 50091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 51809 50088 gene locus_tag LOCUS_08020 51809 50088 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_08020 53286 51919 gene locus_tag LOCUS_08030 gene nhaD 53286 51919 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071215.1 protein_id gnl|my_center|LOCUS_08030 55353 53380 gene locus_tag LOCUS_08040 55353 53380 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038259.1 protein_id gnl|my_center|LOCUS_08040 56222 55494 gene locus_tag LOCUS_08050 gene trmB 56222 55494 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927735.1 protein_id gnl|my_center|LOCUS_08050 57187 56387 gene locus_tag LOCUS_08060 57187 56387 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038257.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence014 <1 630 gene locus_tag LOCUS_08070 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222832.1:ferritin-like domain-containing protein 687 1463 gene locus_tag LOCUS_08080 687 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2190 1468 gene locus_tag LOCUS_08090 gene lpxH 2190 1468 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704629.1 protein_id gnl|my_center|LOCUS_08090 2744 2244 gene locus_tag LOCUS_08100 2744 2244 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087890.1 protein_id gnl|my_center|LOCUS_08100 3394 2786 gene locus_tag LOCUS_08110 3394 2786 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_08110 3543 4997 gene locus_tag LOCUS_08120 gene cysS 3543 4997 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113587.1 protein_id gnl|my_center|LOCUS_08120 5300 5052 gene locus_tag LOCUS_08130 5300 5052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 5606 5304 gene locus_tag LOCUS_08140 5606 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 5744 6223 gene locus_tag LOCUS_08150 5744 6223 CDS product lpg2434 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948137.1 protein_id gnl|my_center|LOCUS_08150 7078 6224 gene locus_tag LOCUS_08160 gene folD 7078 6224 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087898.1 protein_id gnl|my_center|LOCUS_08160 7271 7347 gene locus_tag LOCUS_t00100 7271 7347 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 8635 8710 gene locus_tag LOCUS_t00110 8635 8710 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 8769 8844 gene locus_tag LOCUS_t00120 8769 8844 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9019 9103 gene locus_tag LOCUS_t00130 9019 9103 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9149 10450 gene locus_tag LOCUS_08170 gene tig 9149 10450 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_08170 10532 11206 gene locus_tag LOCUS_08180 gene clpP 10532 11206 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098129.1 protein_id gnl|my_center|LOCUS_08180 11316 12596 gene locus_tag LOCUS_08190 gene clpX 11316 12596 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087924.1 protein_id gnl|my_center|LOCUS_08190 12627 12809 gene locus_tag LOCUS_08200 12627 12809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 12903 15326 gene locus_tag LOCUS_08210 gene lon 12903 15326 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087926.1 protein_id gnl|my_center|LOCUS_08210 15636 15908 gene locus_tag LOCUS_08220 15636 15908 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806049.1 protein_id gnl|my_center|LOCUS_08220 15921 15996 gene locus_tag LOCUS_t00140 15921 15996 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 16074 16150 gene locus_tag LOCUS_t00150 16074 16150 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 16423 18333 gene locus_tag LOCUS_08230 gene ppiD 16423 18333 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071919.1 protein_id gnl|my_center|LOCUS_08230 18614 19888 gene locus_tag LOCUS_08240 18614 19888 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_08240 20885 20103 gene locus_tag LOCUS_08250 gene fabI 20885 20103 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368564.1 protein_id gnl|my_center|LOCUS_08250 21136 23352 gene locus_tag LOCUS_08260 21136 23352 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032828680.1 protein_id gnl|my_center|LOCUS_08260 23352 24329 gene locus_tag LOCUS_08270 23352 24329 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958495.1 protein_id gnl|my_center|LOCUS_08270 24326 25813 gene locus_tag LOCUS_08280 24326 25813 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958494.1 protein_id gnl|my_center|LOCUS_08280 26043 28064 gene locus_tag LOCUS_08290 26043 28064 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862444.1 protein_id gnl|my_center|LOCUS_08290 30625 28835 gene locus_tag LOCUS_08300 30625 28835 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262417.1 protein_id gnl|my_center|LOCUS_08300 31542 30769 gene locus_tag LOCUS_08310 gene gloB 31542 30769 CDS product hydroxyacylglutathione hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705462.1 protein_id gnl|my_center|LOCUS_08310 31772 32539 gene locus_tag LOCUS_08320 31772 32539 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192921.1 protein_id gnl|my_center|LOCUS_08320 32536 32979 gene locus_tag LOCUS_08330 gene rnhA 32536 32979 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003368579.1 protein_id gnl|my_center|LOCUS_08330 33558 34271 gene locus_tag LOCUS_08340 gene dnaQ 33558 34271 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 protein_id gnl|my_center|LOCUS_08340 34384 34929 gene locus_tag LOCUS_08350 34384 34929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 37337 35016 gene locus_tag LOCUS_08360 37337 35016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 37934 37401 gene locus_tag LOCUS_08370 37934 37401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 39429 38419 gene locus_tag LOCUS_08380 39429 38419 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_08380 40747 39470 gene locus_tag LOCUS_08390 gene tviB 40747 39470 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_08390 42174 40852 gene locus_tag LOCUS_08400 42174 40852 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932849.1 protein_id gnl|my_center|LOCUS_08400 42570 43976 gene locus_tag LOCUS_08410 42570 43976 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_08410 44115 46142 gene locus_tag LOCUS_08420 gene prsK 44115 46142 CDS product PEP-CTERM system histidine kinase PrsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390851.1 protein_id gnl|my_center|LOCUS_08420 46157 47521 gene locus_tag LOCUS_08430 gene prsR 46157 47521 CDS product PEP-CTERM-box response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390852.1 protein_id gnl|my_center|LOCUS_08430 47585 50680 gene locus_tag LOCUS_08440 47585 50680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 51565 50837 gene locus_tag LOCUS_08450 51565 50837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 52283 52915 gene locus_tag LOCUS_08460 52283 52915 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_08460 52951 54546 gene locus_tag LOCUS_08470 52951 54546 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390866.1 protein_id gnl|my_center|LOCUS_08470 54543 55412 gene locus_tag LOCUS_08480 54543 55412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence015 826 1251 gene locus_tag LOCUS_08490 826 1251 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035736.1 protein_id gnl|my_center|LOCUS_08490 1375 1752 gene locus_tag LOCUS_08500 gene erpA 1375 1752 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 protein_id gnl|my_center|LOCUS_08500 1923 3080 gene locus_tag LOCUS_08510 1923 3080 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143005.1 protein_id gnl|my_center|LOCUS_08510 4456 3344 gene locus_tag LOCUS_08520 4456 3344 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_08520 5986 4526 gene locus_tag LOCUS_08530 5986 4526 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003129241.1 protein_id gnl|my_center|LOCUS_08530 6488 8455 gene locus_tag LOCUS_08540 6488 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 9490 8543 gene locus_tag LOCUS_08550 9490 8543 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190237.1 protein_id gnl|my_center|LOCUS_08550 10180 9515 gene locus_tag LOCUS_08560 10180 9515 CDS product chemotaxis protein CheC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200722.1 protein_id gnl|my_center|LOCUS_08560 10517 10152 gene locus_tag LOCUS_08570 10517 10152 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190980.1 protein_id gnl|my_center|LOCUS_08570 10752 11951 gene locus_tag LOCUS_08580 gene tyrS 10752 11951 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071526.1 protein_id gnl|my_center|LOCUS_08580 12227 13765 gene locus_tag LOCUS_08590 12227 13765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 14428 13841 gene locus_tag LOCUS_08600 14428 13841 CDS product LON peptidase substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103257.1 protein_id gnl|my_center|LOCUS_08600 15048 14425 gene locus_tag LOCUS_08610 gene ubiX 15048 14425 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379089.1 protein_id gnl|my_center|LOCUS_08610 16525 15143 gene locus_tag LOCUS_08620 gene mpl 16525 15143 CDS product UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707291.1 protein_id gnl|my_center|LOCUS_08620 17055 16537 gene locus_tag LOCUS_08630 17055 16537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 17203 18375 gene locus_tag LOCUS_08640 gene rnd 17203 18375 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919573.1 protein_id gnl|my_center|LOCUS_08640 18478 19578 gene locus_tag LOCUS_08650 18478 19578 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268810.1 protein_id gnl|my_center|LOCUS_08650 20319 19927 gene locus_tag LOCUS_08660 gene apaG 20319 19927 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085085.1 protein_id gnl|my_center|LOCUS_08660 21916 20399 gene locus_tag LOCUS_08670 21916 20399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 23854 22130 gene locus_tag LOCUS_08680 23854 22130 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_08680 24074 24487 gene locus_tag LOCUS_08690 24074 24487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 25364 24582 gene locus_tag LOCUS_08700 25364 24582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 26351 25374 gene locus_tag LOCUS_08710 26351 25374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 27015 27749 gene locus_tag LOCUS_08720 27015 27749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 27959 28609 gene locus_tag LOCUS_08730 27959 28609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 28613 29149 gene locus_tag LOCUS_08740 28613 29149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 29159 29656 gene locus_tag LOCUS_08750 29159 29656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 29663 30115 gene locus_tag LOCUS_08760 29663 30115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 30409 30215 gene locus_tag LOCUS_08770 30409 30215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 30787 31044 gene locus_tag LOCUS_08780 30787 31044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 31337 32641 gene locus_tag LOCUS_08790 31337 32641 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403101.1 protein_id gnl|my_center|LOCUS_08790 32668 33618 gene locus_tag LOCUS_08800 32668 33618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 33630 34268 gene locus_tag LOCUS_08810 33630 34268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 34297 34428 gene locus_tag LOCUS_08820 34297 34428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 34592 35053 gene locus_tag LOCUS_08830 34592 35053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 35065 35343 gene locus_tag LOCUS_08840 35065 35343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 35343 35831 gene locus_tag LOCUS_08850 35343 35831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 35828 36331 gene locus_tag LOCUS_08860 35828 36331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 36335 37417 gene locus_tag LOCUS_08870 36335 37417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 37644 38018 gene locus_tag LOCUS_08880 37644 38018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 38073 40694 gene locus_tag LOCUS_08890 38073 40694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 40770 42095 gene locus_tag LOCUS_08900 40770 42095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 42114 42590 gene locus_tag LOCUS_08910 42114 42590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 42559 42876 gene locus_tag LOCUS_08920 42559 42876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 42918 43292 gene locus_tag LOCUS_08930 42918 43292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 43795 43289 gene locus_tag LOCUS_08940 43795 43289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 44363 43797 gene locus_tag LOCUS_08950 44363 43797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 44999 44745 gene locus_tag LOCUS_08960 44999 44745 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215364.1 protein_id gnl|my_center|LOCUS_08960 45540 45049 gene locus_tag LOCUS_08970 gene coaD 45540 45049 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_08970 46058 45561 gene locus_tag LOCUS_08980 gene rsmD 46058 45561 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189766.1 protein_id gnl|my_center|LOCUS_08980 47083 46160 gene locus_tag LOCUS_08990 gene hemF 47083 46160 CDS product oxygen-dependent coproporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070454.1 protein_id gnl|my_center|LOCUS_08990 47624 47211 gene locus_tag LOCUS_09000 47624 47211 CDS product MAPEG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087131.1 protein_id gnl|my_center|LOCUS_09000 48183 47617 gene locus_tag LOCUS_09010 48183 47617 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921658.1 protein_id gnl|my_center|LOCUS_09010 48499 48281 gene locus_tag LOCUS_09020 48499 48281 CDS product 4-oxalocrotonate tautomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104925.1 protein_id gnl|my_center|LOCUS_09020 49214 48627 gene locus_tag LOCUS_09030 49214 48627 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976315.1 protein_id gnl|my_center|LOCUS_09030 49786 49337 gene locus_tag LOCUS_09040 49786 49337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 50459 49896 gene locus_tag LOCUS_09050 50459 49896 CDS product Sua5/YciO/YrdC/YwlC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097300.1 protein_id gnl|my_center|LOCUS_09050 50999 50493 gene locus_tag LOCUS_09060 gene purE 50999 50493 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704271.1 protein_id gnl|my_center|LOCUS_09060 52610 51318 gene locus_tag LOCUS_09070 gene purD 52610 51318 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001197681.1 protein_id gnl|my_center|LOCUS_09070 53011 52811 gene locus_tag LOCUS_09080 53011 52811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 53153 54571 gene locus_tag LOCUS_09090 53153 54571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 55031 55762 gene locus_tag LOCUS_09100 55031 55762 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920731.1 protein_id gnl|my_center|LOCUS_09100 55768 56148 gene locus_tag LOCUS_09110 55768 56148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence016 170 580 gene locus_tag LOCUS_09120 170 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 757 1524 gene locus_tag LOCUS_09130 757 1524 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003365615.1 protein_id gnl|my_center|LOCUS_09130 1767 2642 gene locus_tag LOCUS_09140 1767 2642 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_09140 2702 4279 gene locus_tag LOCUS_09150 2702 4279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5737 4301 gene locus_tag LOCUS_09160 gene gatB 5737 4301 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105016.1 protein_id gnl|my_center|LOCUS_09160 7245 5911 gene locus_tag LOCUS_09170 gene gatA 7245 5911 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091960758.1 protein_id gnl|my_center|LOCUS_09170 7141 7341 gene locus_tag LOCUS_09180 7141 7341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 7743 7456 gene locus_tag LOCUS_09190 gene gatC 7743 7456 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_09190 7705 7968 gene locus_tag LOCUS_09200 7705 7968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 8011 9063 gene locus_tag LOCUS_09210 gene mreB 8011 9063 CDS product rod shape-determining protein MreB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002918653.1 protein_id gnl|my_center|LOCUS_09210 9213 10049 gene locus_tag LOCUS_09220 gene mreC 9213 10049 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123307.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09220 10046 10537 gene locus_tag LOCUS_09230 gene mreD 10046 10537 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377527.1 protein_id gnl|my_center|LOCUS_09230 10569 12452 gene locus_tag LOCUS_09240 gene mrdA 10569 12452 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093191.1 protein_id gnl|my_center|LOCUS_09240 12449 13576 gene locus_tag LOCUS_09250 gene rodA 12449 13576 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071398.1 protein_id gnl|my_center|LOCUS_09250 13598 14632 gene locus_tag LOCUS_09260 gene mltB 13598 14632 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005736753.1 protein_id gnl|my_center|LOCUS_09260 14650 15537 gene locus_tag LOCUS_09270 14650 15537 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957937.1 protein_id gnl|my_center|LOCUS_09270 15654 16793 gene locus_tag LOCUS_09280 15654 16793 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093182.1 protein_id gnl|my_center|LOCUS_09280 16973 17827 gene locus_tag LOCUS_09290 16973 17827 CDS product D-amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929622.1 protein_id gnl|my_center|LOCUS_09290 17835 18110 gene locus_tag LOCUS_09300 gene ybeD 17835 18110 CDS product DUF493 family protein YbeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932180.1 protein_id gnl|my_center|LOCUS_09300 18107 18733 gene locus_tag LOCUS_09310 gene lipB 18107 18733 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244676.1 protein_id gnl|my_center|LOCUS_09310 18730 19764 gene locus_tag LOCUS_09320 gene lipA 18730 19764 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119196.1 protein_id gnl|my_center|LOCUS_09320 21613 19892 gene locus_tag LOCUS_09330 21613 19892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 21809 21943 gene locus_tag LOCUS_09340 21809 21943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 22490 24043 gene locus_tag LOCUS_09350 22490 24043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 24365 25555 gene locus_tag LOCUS_09360 gene sat 24365 25555 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_09360 25934 27031 gene locus_tag LOCUS_09370 25934 27031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 27931 27113 gene locus_tag LOCUS_09380 27931 27113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 28136 28555 gene locus_tag LOCUS_09390 28136 28555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 28857 28690 gene locus_tag LOCUS_09400 28857 28690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 29349 28927 gene locus_tag LOCUS_09410 29349 28927 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674794.1 protein_id gnl|my_center|LOCUS_09410 30411 29386 gene locus_tag LOCUS_09420 30411 29386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 30917 30408 gene locus_tag LOCUS_09430 30917 30408 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015890.1 protein_id gnl|my_center|LOCUS_09430 31341 30991 gene locus_tag LOCUS_09440 31341 30991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 33471 31564 gene locus_tag LOCUS_09450 gene aprA 33471 31564 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879166.1 protein_id gnl|my_center|LOCUS_09450 33833 33471 gene locus_tag LOCUS_09460 33833 33471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 34828 33992 gene locus_tag LOCUS_09470 34828 33992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 35376 38294 gene locus_tag LOCUS_09480 35376 38294 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187995.1 protein_id gnl|my_center|LOCUS_09480 38428 39207 gene locus_tag LOCUS_09490 38428 39207 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_09490 39354 40328 gene locus_tag LOCUS_09500 39354 40328 CDS product dimethyl sulfoxide reductase anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188558.1 protein_id gnl|my_center|LOCUS_09500 40623 41597 gene locus_tag LOCUS_09510 gene moaA 40623 41597 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092949.1 protein_id gnl|my_center|LOCUS_09510 41957 41712 gene locus_tag LOCUS_09520 41957 41712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 42267 41989 gene locus_tag LOCUS_09530 42267 41989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 45065 44142 gene locus_tag LOCUS_09540 45065 44142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 45772 45173 gene locus_tag LOCUS_09550 45772 45173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 46409 46026 gene locus_tag LOCUS_09560 46409 46026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 47641 46844 gene locus_tag LOCUS_09570 47641 46844 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110587.1 protein_id gnl|my_center|LOCUS_09570 50865 47722 gene locus_tag LOCUS_09580 50865 47722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 52240 50876 gene locus_tag LOCUS_09590 52240 50876 CDS product NAD-dependent succinate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037479.1 protein_id gnl|my_center|LOCUS_09590 52398 53351 gene locus_tag LOCUS_09600 52398 53351 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927008.1 protein_id gnl|my_center|LOCUS_09600 54390 53317 gene locus_tag LOCUS_09610 54390 53317 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528524.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence017 1660 350 gene locus_tag LOCUS_09620 gene murA 1660 350 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_09620 1989 1729 gene locus_tag LOCUS_09630 gene ibaG 1989 1729 CDS product BolA family iron metabolism protein IbaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005306001.1 protein_id gnl|my_center|LOCUS_09630 2834 2052 gene locus_tag LOCUS_09640 2834 2052 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199919.1 protein_id gnl|my_center|LOCUS_09640 3763 2831 gene locus_tag LOCUS_09650 3763 2831 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_09650 4063 3764 gene locus_tag LOCUS_09660 4063 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 4707 4060 gene locus_tag LOCUS_09670 4707 4060 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946580.1 protein_id gnl|my_center|LOCUS_09670 6077 4704 gene locus_tag LOCUS_09680 6077 4704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 6782 6294 gene locus_tag LOCUS_09690 6782 6294 CDS product SRPBCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086162.1 protein_id gnl|my_center|LOCUS_09690 7637 6975 gene locus_tag LOCUS_09700 7637 6975 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940744.1 protein_id gnl|my_center|LOCUS_09700 7857 8093 gene locus_tag LOCUS_09710 7857 8093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 8736 8272 gene locus_tag LOCUS_09720 gene mlaD 8736 8272 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815777.1 protein_id gnl|my_center|LOCUS_09720 9771 8992 gene locus_tag LOCUS_09730 gene mlaE 9771 8992 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001887761.1 protein_id gnl|my_center|LOCUS_09730 10607 9771 gene locus_tag LOCUS_09740 10607 9771 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094343.1 protein_id gnl|my_center|LOCUS_09740 11399 10695 gene locus_tag LOCUS_09750 11399 10695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 11520 11717 gene locus_tag LOCUS_09760 11520 11717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 12503 11730 gene locus_tag LOCUS_09770 12503 11730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208302.1 protein_id gnl|my_center|LOCUS_09770 12700 12500 gene locus_tag LOCUS_09780 12700 12500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 13366 12710 gene locus_tag LOCUS_09790 gene rpiA 13366 12710 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084386.1 protein_id gnl|my_center|LOCUS_09790 13556 15073 gene locus_tag LOCUS_09800 gene ilvA 13556 15073 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110582.1 protein_id gnl|my_center|LOCUS_09800 15833 17665 gene locus_tag LOCUS_09810 15833 17665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 19859 18915 gene locus_tag LOCUS_09820 19859 18915 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765720.1 protein_id gnl|my_center|LOCUS_09820 19945 20409 gene locus_tag LOCUS_09830 gene trmL 19945 20409 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932331.1 protein_id gnl|my_center|LOCUS_09830 20990 20406 gene locus_tag LOCUS_09840 20990 20406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 22092 21082 gene locus_tag LOCUS_09850 gene gpsA 22092 21082 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076194.1 protein_id gnl|my_center|LOCUS_09850 22630 22139 gene locus_tag LOCUS_09860 gene secB 22630 22139 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070466.1 protein_id gnl|my_center|LOCUS_09860 23121 22687 gene locus_tag LOCUS_09870 gene trxC 23121 22687 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088519.1 protein_id gnl|my_center|LOCUS_09870 23463 23185 gene locus_tag LOCUS_09880 gene grxC 23463 23185 CDS product glutaredoxin 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369179.1 protein_id gnl|my_center|LOCUS_09880 24239 23460 gene locus_tag LOCUS_09890 24239 23460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 24821 24510 gene locus_tag LOCUS_09900 24821 24510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 25079 26656 gene locus_tag LOCUS_09910 gene gpmI 25079 26656 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114478.1 protein_id gnl|my_center|LOCUS_09910 26685 27887 gene locus_tag LOCUS_09920 26685 27887 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123645.1 protein_id gnl|my_center|LOCUS_09920 28016 29341 gene locus_tag LOCUS_09930 gene cptA 28016 29341 CDS product proteolytic complex protein CptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096067.1 protein_id gnl|my_center|LOCUS_09930 29356 30168 gene locus_tag LOCUS_09940 29356 30168 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246844.1 protein_id gnl|my_center|LOCUS_09940 30144 30695 gene locus_tag LOCUS_09950 30144 30695 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143742.1 protein_id gnl|my_center|LOCUS_09950 31172 34063 gene locus_tag LOCUS_09960 31172 34063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 34598 34245 gene locus_tag LOCUS_09970 34598 34245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 35447 35058 gene locus_tag LOCUS_09980 35447 35058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 35934 35530 gene locus_tag LOCUS_09990 35934 35530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 37344 35977 gene locus_tag LOCUS_10000 37344 35977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 37898 37341 gene locus_tag LOCUS_10010 37898 37341 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212573.1 protein_id gnl|my_center|LOCUS_10010 39115 37931 gene locus_tag LOCUS_10020 39115 37931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 40262 39891 gene locus_tag LOCUS_10030 40262 39891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 41971 40298 gene locus_tag LOCUS_10040 gene ubiB 41971 40298 CDS product ubiquinone biosynthesis regulatory protein kinase UbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948590.1 protein_id gnl|my_center|LOCUS_10040 42618 41968 gene locus_tag LOCUS_10050 42618 41968 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_10050 43082 42615 gene locus_tag LOCUS_10060 43082 42615 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068725.1 protein_id gnl|my_center|LOCUS_10060 43852 43079 gene locus_tag LOCUS_10070 gene ubiE 43852 43079 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103462.1 protein_id gnl|my_center|LOCUS_10070 44438 44070 gene locus_tag LOCUS_10080 44438 44070 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190130.1 protein_id gnl|my_center|LOCUS_10080 45915 44542 gene locus_tag LOCUS_10090 gene hslU 45915 44542 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175854.1 protein_id gnl|my_center|LOCUS_10090 46466 45915 gene locus_tag LOCUS_10100 gene hslV 46466 45915 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_10100 46717 47499 gene locus_tag LOCUS_10110 46717 47499 CDS product dienelactone hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943172.1 protein_id gnl|my_center|LOCUS_10110 48753 47848 gene locus_tag LOCUS_10120 gene xerC 48753 47848 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266244.1 protein_id gnl|my_center|LOCUS_10120 49492 48770 gene locus_tag LOCUS_10130 49492 48770 CDS product DUF484 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096433.1 protein_id gnl|my_center|LOCUS_10130 50657 49827 gene locus_tag LOCUS_10140 gene dapF 50657 49827 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114344.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence018 145 1548 gene locus_tag LOCUS_10150 gene cysG 145 1548 CDS product siroheme synthase CysG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113366.1 protein_id gnl|my_center|LOCUS_10150 4276 1886 gene locus_tag LOCUS_10160 4276 1886 CDS product DUF1631 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112843.1 protein_id gnl|my_center|LOCUS_10160 4705 4920 gene locus_tag LOCUS_10170 4705 4920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 4978 5613 gene locus_tag LOCUS_10180 4978 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 5649 6350 gene locus_tag LOCUS_10190 5649 6350 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002220370.1 protein_id gnl|my_center|LOCUS_10190 6565 9294 gene locus_tag LOCUS_10200 6565 9294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 9318 10061 gene locus_tag LOCUS_10210 gene pgl 9318 10061 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143172.1 protein_id gnl|my_center|LOCUS_10210 10065 11093 gene locus_tag LOCUS_10220 10065 11093 CDS product glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920885.1 protein_id gnl|my_center|LOCUS_10220 12002 11118 gene locus_tag LOCUS_10230 12002 11118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 12278 13210 gene locus_tag LOCUS_10240 12278 13210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 14081 13422 gene locus_tag LOCUS_10250 14081 13422 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_10250 15846 14344 gene locus_tag LOCUS_10260 15846 14344 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839831.1 protein_id gnl|my_center|LOCUS_10260 16555 15851 gene locus_tag LOCUS_10270 16555 15851 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_10270 17101 16634 gene locus_tag LOCUS_10280 17101 16634 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_10280 17778 17122 gene locus_tag LOCUS_10290 17778 17122 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688682.1 protein_id gnl|my_center|LOCUS_10290 19373 17823 gene locus_tag LOCUS_10300 19373 17823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 19842 19510 gene locus_tag LOCUS_10310 19842 19510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 21261 19882 gene locus_tag LOCUS_10320 gene cobB 21261 19882 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393130.1 protein_id gnl|my_center|LOCUS_10320 22298 21297 gene locus_tag LOCUS_10330 22298 21297 CDS product glycosyl transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207217.1 protein_id gnl|my_center|LOCUS_10330 23621 22404 gene locus_tag LOCUS_10340 gene hmeB 23621 22404 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_10340 24479 23706 gene locus_tag LOCUS_10350 24479 23706 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933894.1 protein_id gnl|my_center|LOCUS_10350 24805 24476 gene locus_tag LOCUS_10360 24805 24476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 26894 24918 gene locus_tag LOCUS_10370 26894 24918 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932535.1 protein_id gnl|my_center|LOCUS_10370 28509 27004 gene locus_tag LOCUS_10380 28509 27004 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_10380 29293 28577 gene locus_tag LOCUS_10390 gene dsrM 29293 28577 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810497.1 protein_id gnl|my_center|LOCUS_10390 29830 29498 gene locus_tag LOCUS_10400 29830 29498 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_10400 30194 29886 gene locus_tag LOCUS_10410 gene tusB 30194 29886 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_10410 30614 30207 gene locus_tag LOCUS_10420 gene tusC 30614 30207 CDS product sulfurtransferase complex subunit TusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099034.1 protein_id gnl|my_center|LOCUS_10420 31021 30629 gene locus_tag LOCUS_10430 gene tusD 31021 30629 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932536.1 protein_id gnl|my_center|LOCUS_10430 32108 31035 gene locus_tag LOCUS_10440 gene dsrB 32108 31035 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_10440 33478 32165 gene locus_tag LOCUS_10450 gene dsrA 33478 32165 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_10450 34275 34991 gene locus_tag LOCUS_10460 34275 34991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 35022 35249 gene locus_tag LOCUS_10470 35022 35249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 35280 35987 gene locus_tag LOCUS_10480 35280 35987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 36004 36690 gene locus_tag LOCUS_10490 gene cas6 36004 36690 CDS product type I-MYXAN CRISPR-associated protein Cas6/Cmx6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000026911.1 protein_id gnl|my_center|LOCUS_10490 36733 37071 gene locus_tag LOCUS_10500 36733 37071 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_10500 39500 37320 gene locus_tag LOCUS_10510 39500 37320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 40330 39656 gene locus_tag LOCUS_10520 40330 39656 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150092553.1 protein_id gnl|my_center|LOCUS_10520 40959 40351 gene locus_tag LOCUS_10530 40959 40351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 41184 41381 gene locus_tag LOCUS_10540 41184 41381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 42166 41738 gene locus_tag LOCUS_10550 42166 41738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 43257 42184 gene locus_tag LOCUS_10560 43257 42184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 43347 44033 gene locus_tag LOCUS_10570 43347 44033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 44217 44038 gene locus_tag LOCUS_10580 44217 44038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 45213 44542 gene locus_tag LOCUS_10590 45213 44542 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005494926.1 protein_id gnl|my_center|LOCUS_10590 45780 45867 gene locus_tag LOCUS_t00160 45780 45867 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 46592 46407 gene locus_tag LOCUS_10600 46592 46407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 46831 47253 gene locus_tag LOCUS_10610 46831 47253 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210018.1 protein_id gnl|my_center|LOCUS_10610 47268 47447 gene locus_tag LOCUS_10620 47268 47447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 47441 47689 gene locus_tag LOCUS_10630 47441 47689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 48022 47792 gene locus_tag LOCUS_10640 48022 47792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 48221 48027 gene locus_tag LOCUS_10650 48221 48027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence019 1555 866 gene locus_tag LOCUS_10660 1555 866 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337653.1 protein_id gnl|my_center|LOCUS_10660 2612 1578 gene locus_tag LOCUS_10670 2612 1578 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113451.1 protein_id gnl|my_center|LOCUS_10670 3045 2593 gene locus_tag LOCUS_10680 3045 2593 CDS product YtoQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229263.1 protein_id gnl|my_center|LOCUS_10680 4945 3050 gene locus_tag LOCUS_10690 gene thiC 4945 3050 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_10690 5715 5251 gene locus_tag LOCUS_10700 5715 5251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 6045 6740 gene locus_tag LOCUS_10710 6045 6740 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522277.1 protein_id gnl|my_center|LOCUS_10710 6792 8114 gene locus_tag LOCUS_10720 gene tolC 6792 8114 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024944694.1 protein_id gnl|my_center|LOCUS_10720 8274 9125 gene locus_tag LOCUS_10730 8274 9125 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267129.1 protein_id gnl|my_center|LOCUS_10730 10311 9268 gene locus_tag LOCUS_10740 10311 9268 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_10740 11783 10497 gene locus_tag LOCUS_10750 gene waaA 11783 10497 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114538.1 protein_id gnl|my_center|LOCUS_10750 12354 11755 gene locus_tag LOCUS_10760 12354 11755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 13800 12376 gene locus_tag LOCUS_10770 gene hldE 13800 12376 CDS product bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095747.1 protein_id gnl|my_center|LOCUS_10770 15039 13930 gene locus_tag LOCUS_10780 15039 13930 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004565946.1 protein_id gnl|my_center|LOCUS_10780 16061 15036 gene locus_tag LOCUS_10790 gene waaC 16061 15036 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546021.1 protein_id gnl|my_center|LOCUS_10790 17417 16113 gene locus_tag LOCUS_10800 17417 16113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 18636 17398 gene locus_tag LOCUS_10810 18636 17398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 20116 18932 gene locus_tag LOCUS_10820 20116 18932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 21037 20138 gene locus_tag LOCUS_10830 gene wecB 21037 20138 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211986.1 protein_id gnl|my_center|LOCUS_10830 21664 22806 gene locus_tag LOCUS_10840 21664 22806 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_10840 22813 24633 gene locus_tag LOCUS_10850 gene asnB 22813 24633 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390687.1 protein_id gnl|my_center|LOCUS_10850 24621 25772 gene locus_tag LOCUS_10860 24621 25772 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197524118.1 protein_id gnl|my_center|LOCUS_10860 26119 26781 gene locus_tag LOCUS_10870 26119 26781 CDS product sulfotransferase family 2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339247.1 protein_id gnl|my_center|LOCUS_10870 27389 26829 gene locus_tag LOCUS_10880 gene gmhA 27389 26829 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942729.1 protein_id gnl|my_center|LOCUS_10880 27602 27390 gene locus_tag LOCUS_10890 27602 27390 CDS product zinc-finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038440.1 protein_id gnl|my_center|LOCUS_10890 28573 27653 gene locus_tag LOCUS_10900 gene ilvE 28573 27653 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_10900 31639 28613 gene locus_tag LOCUS_10910 gene glnE 31639 28613 CDS product bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114555.1 protein_id gnl|my_center|LOCUS_10910 31744 32904 gene locus_tag LOCUS_10920 gene tapW 31744 32904 CDS product type IVa pilus ATPase TapW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_10920 35334 32923 gene locus_tag LOCUS_10930 35334 32923 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958515.1 protein_id gnl|my_center|LOCUS_10930 35595 36665 gene locus_tag LOCUS_10940 35595 36665 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105329.1 protein_id gnl|my_center|LOCUS_10940 36665 37225 gene locus_tag LOCUS_10950 36665 37225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 37222 37866 gene locus_tag LOCUS_10960 gene pilO 37222 37866 CDS product type 4a pilus biogenesis protein PilO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103268.1 protein_id gnl|my_center|LOCUS_10960 37866 38393 gene locus_tag LOCUS_10970 gene pilP 37866 38393 CDS product type 4a pilus biogenesis lipoprotein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095836.1 protein_id gnl|my_center|LOCUS_10970 38413 41046 gene locus_tag LOCUS_10980 38413 41046 CDS product type IV pilus secretin PilQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765499.1 protein_id gnl|my_center|LOCUS_10980 41202 41720 gene locus_tag LOCUS_10990 gene aroK 41202 41720 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245596.1 protein_id gnl|my_center|LOCUS_10990 41731 42819 gene locus_tag LOCUS_11000 gene aroB 41731 42819 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_11000 42794 43978 gene locus_tag LOCUS_11010 42794 43978 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 protein_id gnl|my_center|LOCUS_11010 43983 44237 gene locus_tag LOCUS_11020 43983 44237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 44234 45829 gene locus_tag LOCUS_11030 44234 45829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence020 1209 838 gene locus_tag LOCUS_11040 1209 838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1332 2234 gene locus_tag LOCUS_11050 1332 2234 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529395.1 protein_id gnl|my_center|LOCUS_11050 3664 2432 gene locus_tag LOCUS_11060 3664 2432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4649 5146 gene locus_tag LOCUS_11070 4649 5146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5183 7141 gene locus_tag LOCUS_11080 5183 7141 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038053.1 protein_id gnl|my_center|LOCUS_11080 7138 7809 gene locus_tag LOCUS_11090 gene tsaB 7138 7809 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038052.1 protein_id gnl|my_center|LOCUS_11090 7903 9078 gene locus_tag LOCUS_11100 7903 9078 CDS product pentapeptide repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056556.1 protein_id gnl|my_center|LOCUS_11100 9672 9166 gene locus_tag LOCUS_11110 9672 9166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 10264 9788 gene locus_tag LOCUS_11120 10264 9788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 11298 10282 gene locus_tag LOCUS_11130 11298 10282 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085800.1 protein_id gnl|my_center|LOCUS_11130 11683 12009 gene locus_tag LOCUS_11140 11683 12009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 12767 12018 gene locus_tag LOCUS_11150 12767 12018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 13960 12950 gene locus_tag LOCUS_11160 gene rsgA 13960 12950 CDS product small ribosomal subunit biogenesis GTPase RsgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113927.1 protein_id gnl|my_center|LOCUS_11160 14286 13993 gene locus_tag LOCUS_11170 14286 13993 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037236.1 protein_id gnl|my_center|LOCUS_11170 14597 14340 gene locus_tag LOCUS_11180 14597 14340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 14841 15398 gene locus_tag LOCUS_11190 gene orn 14841 15398 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_11190 15447 15773 gene locus_tag LOCUS_11200 15447 15773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 16354 17250 gene locus_tag LOCUS_11210 16354 17250 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207404.1 protein_id gnl|my_center|LOCUS_11210 18378 17281 gene locus_tag LOCUS_11220 gene queG 18378 17281 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266491.1 protein_id gnl|my_center|LOCUS_11220 18442 18627 gene locus_tag LOCUS_11230 18442 18627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 18760 18927 gene locus_tag LOCUS_11240 18760 18927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 18948 20450 gene locus_tag LOCUS_11250 18948 20450 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958000.1 protein_id gnl|my_center|LOCUS_11250 20456 20941 gene locus_tag LOCUS_11260 gene tsaE 20456 20941 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000981984.1 protein_id gnl|my_center|LOCUS_11260 21112 22434 gene locus_tag LOCUS_11270 gene amiB 21112 22434 CDS product N-acetylmuramoyl-L-alanine amidase AmiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003123571.1 protein_id gnl|my_center|LOCUS_11270 22597 24429 gene locus_tag LOCUS_11280 gene mutL 22597 24429 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106411.1 protein_id gnl|my_center|LOCUS_11280 24595 26448 gene locus_tag LOCUS_11290 24595 26448 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085865.1 protein_id gnl|my_center|LOCUS_11290 26829 27395 gene locus_tag LOCUS_11300 gene yeiP 26829 27395 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 protein_id gnl|my_center|LOCUS_11300 27624 28970 gene locus_tag LOCUS_11310 27624 28970 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994037.1 protein_id gnl|my_center|LOCUS_11310 29467 28979 gene locus_tag LOCUS_11320 29467 28979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 29970 29629 gene locus_tag LOCUS_11330 29970 29629 CDS product methylamine utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000908409.1 protein_id gnl|my_center|LOCUS_11330 31040 30000 gene locus_tag LOCUS_11340 31040 30000 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_11340 32705 31074 gene locus_tag LOCUS_11350 32705 31074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 33274 32756 gene locus_tag LOCUS_11360 33274 32756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 33534 35333 gene locus_tag LOCUS_11370 33534 35333 CDS product ABC transporter ATP-binding protein/permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189741.1 protein_id gnl|my_center|LOCUS_11370 35714 35436 gene locus_tag LOCUS_11380 35714 35436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 36699 35716 gene locus_tag LOCUS_11390 36699 35716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 37831 36683 gene locus_tag LOCUS_11400 37831 36683 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403536.1 protein_id gnl|my_center|LOCUS_11400 38104 38355 gene locus_tag LOCUS_11410 38104 38355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 38352 38669 gene locus_tag LOCUS_11420 38352 38669 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_11420 40450 39083 gene locus_tag LOCUS_11430 gene purB 40450 39083 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113371.1 protein_id gnl|my_center|LOCUS_11430 40825 42039 gene locus_tag LOCUS_11440 40825 42039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 42506 45064 gene locus_tag LOCUS_11450 gene acnB 42506 45064 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818886.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence021 1027 1857 gene locus_tag LOCUS_11460 1027 1857 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921712.1 protein_id gnl|my_center|LOCUS_11460 2378 2623 gene locus_tag LOCUS_11470 2378 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2919 2668 gene locus_tag LOCUS_11480 2919 2668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 2983 3216 gene locus_tag LOCUS_11490 2983 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 3227 3457 gene locus_tag LOCUS_11500 3227 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 4209 3694 gene locus_tag LOCUS_11510 4209 3694 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891887.1 protein_id gnl|my_center|LOCUS_11510 6947 4206 gene locus_tag LOCUS_11520 gene napA 6947 4206 CDS product periplasmic nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852404.1 protein_id gnl|my_center|LOCUS_11520 7222 6938 gene locus_tag LOCUS_11530 7222 6938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 9066 8047 gene locus_tag LOCUS_11540 9066 8047 CDS product CDP-6-deoxy-delta-3,4-glucoseen reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185343.1 protein_id gnl|my_center|LOCUS_11540 9139 10005 gene locus_tag LOCUS_11550 9139 10005 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_11550 10038 10937 gene locus_tag LOCUS_11560 gene argB 10038 10937 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096572.1 protein_id gnl|my_center|LOCUS_11560 11309 11902 gene locus_tag LOCUS_11570 gene slmA 11309 11902 CDS product nucleoid occlusion factor SlmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073926.1 protein_id gnl|my_center|LOCUS_11570 11918 12673 gene locus_tag LOCUS_11580 11918 12673 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124872.1 protein_id gnl|my_center|LOCUS_11580 13634 12900 gene locus_tag LOCUS_11590 13634 12900 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_11590 15059 14415 gene locus_tag LOCUS_11600 gene pyrE 15059 14415 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094889.1 protein_id gnl|my_center|LOCUS_11600 15170 15955 gene locus_tag LOCUS_11610 15170 15955 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957486.1 protein_id gnl|my_center|LOCUS_11610 18350 15966 gene locus_tag LOCUS_11620 18350 15966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 18970 18521 gene locus_tag LOCUS_11630 18970 18521 CDS product DUF4426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001233674.1 protein_id gnl|my_center|LOCUS_11630 21120 19153 gene locus_tag LOCUS_11640 21120 19153 CDS product dynamin-like GTPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114887.1 protein_id gnl|my_center|LOCUS_11640 21626 21318 gene locus_tag LOCUS_11650 gene yggU 21626 21318 CDS product DUF167 family protein YggU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005173614.1 protein_id gnl|my_center|LOCUS_11650 22204 21623 gene locus_tag LOCUS_11660 22204 21623 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084544.1 protein_id gnl|my_center|LOCUS_11660 23063 22221 gene locus_tag LOCUS_11670 gene proC 23063 22221 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114890.1 protein_id gnl|my_center|LOCUS_11670 23858 23112 gene locus_tag LOCUS_11680 23858 23112 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084549.1 protein_id gnl|my_center|LOCUS_11680 24014 25051 gene locus_tag LOCUS_11690 24014 25051 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003489919.1 protein_id gnl|my_center|LOCUS_11690 25167 26321 gene locus_tag LOCUS_11700 gene pilU 25167 26321 CDS product type IV pilus ATPase PilU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100959.1 protein_id gnl|my_center|LOCUS_11700 26689 28449 gene locus_tag LOCUS_11710 26689 28449 CDS product multicopper oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204917.1 protein_id gnl|my_center|LOCUS_11710 28980 29306 gene locus_tag LOCUS_11720 28980 29306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 30248 29379 gene locus_tag LOCUS_11730 30248 29379 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_11730 31743 30466 gene locus_tag LOCUS_11740 31743 30466 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011381770.1 protein_id gnl|my_center|LOCUS_11740 32726 31740 gene locus_tag LOCUS_11750 32726 31740 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004534003.1 protein_id gnl|my_center|LOCUS_11750 33226 32723 gene locus_tag LOCUS_11760 gene pyrR 33226 32723 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084574.1 protein_id gnl|my_center|LOCUS_11760 33673 33239 gene locus_tag LOCUS_11770 gene ruvX 33673 33239 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706917.1 protein_id gnl|my_center|LOCUS_11770 34233 33670 gene locus_tag LOCUS_11780 34233 33670 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037878.1 protein_id gnl|my_center|LOCUS_11780 35551 34679 gene locus_tag LOCUS_11790 35551 34679 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895505.1 protein_id gnl|my_center|LOCUS_11790 36201 35662 gene locus_tag LOCUS_11800 36201 35662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 36790 36416 gene locus_tag LOCUS_11810 36790 36416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 37848 36787 gene locus_tag LOCUS_11820 37848 36787 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017140332.1 protein_id gnl|my_center|LOCUS_11820 38792 37845 gene locus_tag LOCUS_11830 gene gshB 38792 37845 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100943.1 protein_id gnl|my_center|LOCUS_11830 39291 39704 gene locus_tag LOCUS_11840 gene pilG 39291 39704 CDS product twitching motility response regulator PilG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084583.1 protein_id gnl|my_center|LOCUS_11840 39746 40111 gene locus_tag LOCUS_11850 gene pilH 39746 40111 CDS product twitching motility response regulator PilH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084587.1 protein_id gnl|my_center|LOCUS_11850 40141 40680 gene locus_tag LOCUS_11860 40141 40680 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084590.1 protein_id gnl|my_center|LOCUS_11860 40749 42770 gene locus_tag LOCUS_11870 gene pilJ 40749 42770 CDS product chemotaxis chemoreceptor PilJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100940.1 protein_id gnl|my_center|LOCUS_11870 42829 43740 gene locus_tag LOCUS_11880 gene pilK 42829 43740 CDS product type 4 fimbrial methyltransferase PilK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100938.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence022 91 1281 gene locus_tag LOCUS_11890 91 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490227.1 protein_id gnl|my_center|LOCUS_11890 1540 2445 gene locus_tag LOCUS_11900 1540 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3296 2679 gene locus_tag LOCUS_11910 3296 2679 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765411.1 protein_id gnl|my_center|LOCUS_11910 3963 3352 gene locus_tag LOCUS_11920 3963 3352 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198059.1 protein_id gnl|my_center|LOCUS_11920 4673 3981 gene locus_tag LOCUS_11930 4673 3981 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174799.1 protein_id gnl|my_center|LOCUS_11930 4892 5833 gene locus_tag LOCUS_11940 4892 5833 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036906.1 protein_id gnl|my_center|LOCUS_11940 5841 6461 gene locus_tag LOCUS_11950 5841 6461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 6987 8186 gene locus_tag LOCUS_11960 6987 8186 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_11960 8196 8732 gene locus_tag LOCUS_11970 8196 8732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 8742 9545 gene locus_tag LOCUS_11980 8742 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 10089 9580 gene locus_tag LOCUS_11990 gene resA 10089 9580 CDS product thiol-disulfide oxidoreductase ResA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230513.1 protein_id gnl|my_center|LOCUS_11990 10714 10094 gene locus_tag LOCUS_12000 10714 10094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 10816 11964 gene locus_tag LOCUS_12010 10816 11964 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933016.1 protein_id gnl|my_center|LOCUS_12010 12554 13249 gene locus_tag LOCUS_12020 12554 13249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809408.1 protein_id gnl|my_center|LOCUS_12020 13246 14454 gene locus_tag LOCUS_12030 13246 14454 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_12030 14461 15660 gene locus_tag LOCUS_12040 14461 15660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057223.1 protein_id gnl|my_center|LOCUS_12040 16694 17503 gene locus_tag LOCUS_12050 16694 17503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 17631 19079 gene locus_tag LOCUS_12060 17631 19079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 19466 20980 gene locus_tag LOCUS_12070 19466 20980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 21670 21080 gene locus_tag LOCUS_12080 21670 21080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 21753 22169 gene locus_tag LOCUS_12090 gene arfB 21753 22169 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105972.1 protein_id gnl|my_center|LOCUS_12090 23370 22507 gene locus_tag LOCUS_12100 gene panC 23370 22507 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109313.1 protein_id gnl|my_center|LOCUS_12100 24383 23589 gene locus_tag LOCUS_12110 gene panB 24383 23589 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_12110 25069 24416 gene locus_tag LOCUS_12120 25069 24416 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004532195.1 protein_id gnl|my_center|LOCUS_12120 25771 25259 gene locus_tag LOCUS_12130 gene folK 25771 25259 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771454.1 protein_id gnl|my_center|LOCUS_12130 27099 25768 gene locus_tag LOCUS_12140 27099 25768 CDS product polynucleotide adenylyltransferase PcnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095142.1 protein_id gnl|my_center|LOCUS_12140 27193 27267 gene locus_tag LOCUS_t00170 27193 27267 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 30165 27361 gene locus_tag LOCUS_12150 30165 27361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 31231 30167 gene locus_tag LOCUS_12160 31231 30167 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258942.1 protein_id gnl|my_center|LOCUS_12160 32824 31235 gene locus_tag LOCUS_12170 32824 31235 CDS product PAS domain-containing methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_133503194.1 protein_id gnl|my_center|LOCUS_12170 33454 32849 gene locus_tag LOCUS_12180 33454 32849 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328727.1 protein_id gnl|my_center|LOCUS_12180 33694 33891 gene locus_tag LOCUS_12190 33694 33891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 33952 34251 gene locus_tag LOCUS_12200 33952 34251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 35547 34285 gene locus_tag LOCUS_12210 35547 34285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 35757 36668 gene locus_tag LOCUS_12220 35757 36668 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001045946.1 protein_id gnl|my_center|LOCUS_12220 36709 36903 gene locus_tag LOCUS_12230 36709 36903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 37874 37419 gene locus_tag LOCUS_12240 gene ssb 37874 37419 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_12240 39456 37987 gene locus_tag LOCUS_12250 39456 37987 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103910.1 protein_id gnl|my_center|LOCUS_12250 39614 42469 gene locus_tag LOCUS_12260 gene uvrA 39614 42469 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093663.1 protein_id gnl|my_center|LOCUS_12260 42654 44282 gene locus_tag LOCUS_12270 42654 44282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence023 996 88 gene locus_tag LOCUS_12280 996 88 CDS product hydrogen peroxide-inducible genes activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921524.1 protein_id gnl|my_center|LOCUS_12280 1166 1927 gene locus_tag LOCUS_12290 1166 1927 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815312.1 protein_id gnl|my_center|LOCUS_12290 1976 2254 gene locus_tag LOCUS_12300 1976 2254 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771921.1 protein_id gnl|my_center|LOCUS_12300 2454 3089 gene locus_tag LOCUS_12310 2454 3089 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121256.1 protein_id gnl|my_center|LOCUS_12310 3752 3180 gene locus_tag LOCUS_12320 3752 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 3903 4721 gene locus_tag LOCUS_12330 gene lgt 3903 4721 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126322954.1 protein_id gnl|my_center|LOCUS_12330 4718 5512 gene locus_tag LOCUS_12340 4718 5512 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691712.1 protein_id gnl|my_center|LOCUS_12340 5669 6142 gene locus_tag LOCUS_12350 gene folA 5669 6142 CDS product type 3 dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000973535.1 protein_id gnl|my_center|LOCUS_12350 6147 6689 gene locus_tag LOCUS_12360 6147 6689 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_12360 7409 6993 gene locus_tag LOCUS_12370 7409 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 7449 7976 gene locus_tag LOCUS_12380 7449 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 8839 8405 gene locus_tag LOCUS_12390 8839 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 10516 11475 gene locus_tag LOCUS_12400 10516 11475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 11671 11979 gene locus_tag LOCUS_12410 11671 11979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 12120 12959 gene locus_tag LOCUS_12420 12120 12959 CDS product DUF4396 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945812.1 protein_id gnl|my_center|LOCUS_12420 13088 13522 gene locus_tag LOCUS_12430 13088 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 14052 13543 gene locus_tag LOCUS_12440 14052 13543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 15828 14239 gene locus_tag LOCUS_12450 gene gshA 15828 14239 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109990.1 protein_id gnl|my_center|LOCUS_12450 16280 15873 gene locus_tag LOCUS_12460 16280 15873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 16926 16648 gene locus_tag LOCUS_12470 16926 16648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 17057 17446 gene locus_tag LOCUS_12480 gene msrB 17057 17446 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106032.1 protein_id gnl|my_center|LOCUS_12480 17739 18128 gene locus_tag LOCUS_12490 17739 18128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12490 18161 18649 gene locus_tag LOCUS_12500 18161 18649 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_12500 19478 18912 gene locus_tag LOCUS_12510 19478 18912 CDS product TIGR02281 family clan AA aspartic protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105246.1 protein_id gnl|my_center|LOCUS_12510 19860 19471 gene locus_tag LOCUS_12520 19860 19471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 19922 20311 gene locus_tag LOCUS_12530 19922 20311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 23169 20491 gene locus_tag LOCUS_12540 gene pepN 23169 20491 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113940.1 protein_id gnl|my_center|LOCUS_12540 23299 23691 gene locus_tag LOCUS_12550 23299 23691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 23710 24210 gene locus_tag LOCUS_12560 23710 24210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 24459 24229 gene locus_tag LOCUS_12570 24459 24229 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_12570 24905 24528 gene locus_tag LOCUS_12580 24905 24528 CDS product SirB2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704321.1 protein_id gnl|my_center|LOCUS_12580 25153 24902 gene locus_tag LOCUS_12590 25153 24902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 25476 25156 gene locus_tag LOCUS_12600 25476 25156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 25743 26183 gene locus_tag LOCUS_12610 25743 26183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 26356 27663 gene locus_tag LOCUS_12620 26356 27663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 27660 29105 gene locus_tag LOCUS_12630 27660 29105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 29099 32269 gene locus_tag LOCUS_12640 29099 32269 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946755.1 protein_id gnl|my_center|LOCUS_12640 32890 32435 gene locus_tag LOCUS_12650 32890 32435 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082024.1 protein_id gnl|my_center|LOCUS_12650 33441 33758 gene locus_tag LOCUS_12660 33441 33758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 33849 34280 gene locus_tag LOCUS_12670 33849 34280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 34705 35928 gene locus_tag LOCUS_12680 gene selD 34705 35928 CDS product selenide, water dikinase SelD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201158.1 protein_id gnl|my_center|LOCUS_12680 36002 37093 gene locus_tag LOCUS_12690 36002 37093 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_12690 37093 37833 gene locus_tag LOCUS_12700 37093 37833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 38258 39814 gene locus_tag LOCUS_12710 38258 39814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 40698 39988 gene locus_tag LOCUS_12720 40698 39988 CDS product ribonucleotide reductase system inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704811.1 protein_id gnl|my_center|LOCUS_12720 <43360 40751 gene locus_tag LOCUS_12730 <43360 40751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704810.1:adenosylcobalamin-dependent ribonucleoside-diphosphate reductase >Feature sequence024 501 1523 gene locus_tag LOCUS_12740 501 1523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 1526 2656 gene locus_tag LOCUS_12750 1526 2656 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943842.1 protein_id gnl|my_center|LOCUS_12750 2721 5414 gene locus_tag LOCUS_12760 2721 5414 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943843.1 protein_id gnl|my_center|LOCUS_12760 5495 7681 gene locus_tag LOCUS_12770 5495 7681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 8280 10736 gene locus_tag LOCUS_12780 8280 10736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 10828 12996 gene locus_tag LOCUS_12790 10828 12996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 13711 12986 gene locus_tag LOCUS_12800 13711 12986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 14997 13717 gene locus_tag LOCUS_12810 14997 13717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 15212 16207 gene locus_tag LOCUS_12820 15212 16207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 16204 17049 gene locus_tag LOCUS_12830 gene ccsA 16204 17049 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941366.1 protein_id gnl|my_center|LOCUS_12830 17049 17750 gene locus_tag LOCUS_12840 17049 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 17811 18356 gene locus_tag LOCUS_12850 17811 18356 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941975.1 protein_id gnl|my_center|LOCUS_12850 18568 19185 gene locus_tag LOCUS_12860 gene ccmA 18568 19185 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705297.1 protein_id gnl|my_center|LOCUS_12860 19182 19892 gene locus_tag LOCUS_12870 gene ccmB 19182 19892 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_12870 19954 20718 gene locus_tag LOCUS_12880 gene ccmC 19954 20718 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_12880 20715 20876 gene locus_tag LOCUS_12890 20715 20876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 20922 21374 gene locus_tag LOCUS_12900 gene ccmE 20922 21374 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811414.1 protein_id gnl|my_center|LOCUS_12900 21408 23423 gene locus_tag LOCUS_12910 21408 23423 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926646.1 protein_id gnl|my_center|LOCUS_12910 23426 23998 gene locus_tag LOCUS_12920 23426 23998 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039916.1 protein_id gnl|my_center|LOCUS_12920 23995 24483 gene locus_tag LOCUS_12930 23995 24483 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268400.1 protein_id gnl|my_center|LOCUS_12930 24480 25733 gene locus_tag LOCUS_12940 gene ccmI 24480 25733 CDS product c-type cytochrome biogenesis protein CcmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063825.1 protein_id gnl|my_center|LOCUS_12940 25763 26080 gene locus_tag LOCUS_12950 25763 26080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 26080 27261 gene locus_tag LOCUS_12960 26080 27261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 27312 28550 gene locus_tag LOCUS_12970 27312 28550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 28778 29995 gene locus_tag LOCUS_12980 28778 29995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 30670 30275 gene locus_tag LOCUS_12990 30670 30275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 31316 30990 gene locus_tag LOCUS_13000 31316 30990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 32599 31616 gene locus_tag LOCUS_13010 32599 31616 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039646584.1 protein_id gnl|my_center|LOCUS_13010 33946 32825 gene locus_tag LOCUS_13020 33946 32825 CDS product 6-bladed beta-propeller inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942432.1 protein_id gnl|my_center|LOCUS_13020 34704 33922 gene locus_tag LOCUS_13030 34704 33922 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941282.1 protein_id gnl|my_center|LOCUS_13030 35132 36376 gene locus_tag LOCUS_13040 35132 36376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 36550 37338 gene locus_tag LOCUS_13050 36550 37338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 37462 37914 gene locus_tag LOCUS_13060 37462 37914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_13060 37986 39341 gene locus_tag LOCUS_13070 37986 39341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 39808 40845 gene locus_tag LOCUS_13080 gene argC 39808 40845 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113169.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence025 1336 233 gene locus_tag LOCUS_13090 gene zapE 1336 233 CDS product cell division protein ZapE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766543.1 protein_id gnl|my_center|LOCUS_13090 1421 1834 gene locus_tag LOCUS_13100 1421 1834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1912 2184 gene locus_tag LOCUS_13110 1912 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 2870 5050 gene locus_tag LOCUS_13120 gene rlmKL 2870 5050 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_13120 5204 5809 gene locus_tag LOCUS_13130 5204 5809 CDS product peroxiredoxin C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705411.1 protein_id gnl|my_center|LOCUS_13130 5955 7115 gene locus_tag LOCUS_13140 5955 7115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 7931 7665 gene locus_tag LOCUS_13150 7931 7665 CDS product YcgL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295992.1 protein_id gnl|my_center|LOCUS_13150 8097 8567 gene locus_tag LOCUS_13160 8097 8567 CDS product aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014327119.1 protein_id gnl|my_center|LOCUS_13160 9742 8669 gene locus_tag LOCUS_13170 gene aroG 9742 8669 CDS product 3-deoxy-7-phosphoheptulonate synthase AroG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550019.1 protein_id gnl|my_center|LOCUS_13170 9940 10821 gene locus_tag LOCUS_13180 9940 10821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 11238 10783 gene locus_tag LOCUS_13190 11238 10783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 11678 11253 gene locus_tag LOCUS_13200 11678 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 11843 13102 gene locus_tag LOCUS_13210 11843 13102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 13308 15185 gene locus_tag LOCUS_13220 13308 15185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 16988 15186 gene locus_tag LOCUS_13230 16988 15186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 17425 17036 gene locus_tag LOCUS_13240 17425 17036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 18436 17627 gene locus_tag LOCUS_13250 18436 17627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 20664 18739 gene locus_tag LOCUS_13260 20664 18739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 24388 20774 gene locus_tag LOCUS_13270 gene metH 24388 20774 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005453805.1 protein_id gnl|my_center|LOCUS_13270 25011 24583 gene locus_tag LOCUS_13280 25011 24583 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 protein_id gnl|my_center|LOCUS_13280 25304 25023 gene locus_tag LOCUS_13290 25304 25023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 25718 26563 gene locus_tag LOCUS_13300 gene ttcA 25718 26563 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_13300 26564 27430 gene locus_tag LOCUS_13310 26564 27430 CDS product lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038820.1 protein_id gnl|my_center|LOCUS_13310 28521 27709 gene locus_tag LOCUS_13320 28521 27709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 29295 28963 gene locus_tag LOCUS_13330 gene tusE 29295 28963 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904446.1 protein_id gnl|my_center|LOCUS_13330 30028 29390 gene locus_tag LOCUS_13340 30028 29390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 31337 30123 gene locus_tag LOCUS_13350 gene purT 31337 30123 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896675.1 protein_id gnl|my_center|LOCUS_13350 32547 31447 gene locus_tag LOCUS_13360 32547 31447 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479038.1 protein_id gnl|my_center|LOCUS_13360 32983 32594 gene locus_tag LOCUS_13370 32983 32594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 33128 35089 gene locus_tag LOCUS_13380 33128 35089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 35673 35194 gene locus_tag LOCUS_13390 35673 35194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 37061 35874 gene locus_tag LOCUS_13400 37061 35874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 37632 38603 gene locus_tag LOCUS_13410 37632 38603 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_13410 >Feature sequence026 <1 595 gene locus_tag LOCUS_13420 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015039570.1:aspartate aminotransferase family protein 697 1599 gene locus_tag LOCUS_13430 gene argF 697 1599 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003412919.1 protein_id gnl|my_center|LOCUS_13430 8703 2038 gene locus_tag LOCUS_13440 8703 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 9945 8842 gene locus_tag LOCUS_13450 9945 8842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 10814 10149 gene locus_tag LOCUS_13460 10814 10149 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945885.1 protein_id gnl|my_center|LOCUS_13460 11277 11966 gene locus_tag LOCUS_13470 11277 11966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 13848 11998 gene locus_tag LOCUS_13480 gene ilvD 13848 11998 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127404.1 protein_id gnl|my_center|LOCUS_13480 14054 15622 gene locus_tag LOCUS_13490 14054 15622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 15624 16058 gene locus_tag LOCUS_13500 15624 16058 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_13500 17090 16065 gene locus_tag LOCUS_13510 17090 16065 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257679.1 protein_id gnl|my_center|LOCUS_13510 17516 17124 gene locus_tag LOCUS_13520 17516 17124 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_13520 17909 17688 gene locus_tag LOCUS_13530 17909 17688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 18431 18841 gene locus_tag LOCUS_13540 18431 18841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 19483 18854 gene locus_tag LOCUS_13550 19483 18854 CDS product alpha-ribazole phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404266.1 protein_id gnl|my_center|LOCUS_13550 21765 19501 gene locus_tag LOCUS_13560 21765 19501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 22662 21862 gene locus_tag LOCUS_13570 22662 21862 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970966.1 protein_id gnl|my_center|LOCUS_13570 23099 22725 gene locus_tag LOCUS_13580 23099 22725 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_13580 24604 23225 gene locus_tag LOCUS_13590 24604 23225 CDS product ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011339170.1 protein_id gnl|my_center|LOCUS_13590 24803 25723 gene locus_tag LOCUS_13600 24803 25723 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141003.1 protein_id gnl|my_center|LOCUS_13600 25979 25749 gene locus_tag LOCUS_13610 25979 25749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 26274 26564 gene locus_tag LOCUS_13620 26274 26564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 26732 27907 gene locus_tag LOCUS_13630 26732 27907 CDS product HPP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004528269.1 protein_id gnl|my_center|LOCUS_13630 28834 28097 gene locus_tag LOCUS_13640 28834 28097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 29006 29317 gene locus_tag LOCUS_13650 29006 29317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 29757 29371 gene locus_tag LOCUS_13660 29757 29371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 29833 30042 gene locus_tag LOCUS_13670 29833 30042 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809966.1 protein_id gnl|my_center|LOCUS_13670 30300 33047 gene locus_tag LOCUS_13680 gene topA 30300 33047 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001297122.1 protein_id gnl|my_center|LOCUS_13680 33664 33122 gene locus_tag LOCUS_13690 33664 33122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 34236 33661 gene locus_tag LOCUS_13700 34236 33661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 34677 36599 gene locus_tag LOCUS_13710 34677 36599 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192719.1 protein_id gnl|my_center|LOCUS_13710 36678 37937 gene locus_tag LOCUS_13720 36678 37937 CDS product YeaH/YhbH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443933.1 protein_id gnl|my_center|LOCUS_13720 37934 39451 gene locus_tag LOCUS_13730 37934 39451 CDS product SpoVR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402050.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence027 887 195 gene locus_tag LOCUS_13740 887 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1468 974 gene locus_tag LOCUS_13750 1468 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 4592 3921 gene locus_tag LOCUS_13760 4592 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 6037 4694 gene locus_tag LOCUS_13770 6037 4694 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975609.1 protein_id gnl|my_center|LOCUS_13770 6961 6083 gene locus_tag LOCUS_13780 6961 6083 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259484.1 protein_id gnl|my_center|LOCUS_13780 7729 7037 gene locus_tag LOCUS_13790 7729 7037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 9559 9113 gene locus_tag LOCUS_13800 9559 9113 CDS product pilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223804324.1 protein_id gnl|my_center|LOCUS_13800 11370 10018 gene locus_tag LOCUS_13810 11370 10018 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183947609.1 protein_id gnl|my_center|LOCUS_13810 13052 11367 gene locus_tag LOCUS_13820 13052 11367 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_13820 13423 14589 gene locus_tag LOCUS_13830 13423 14589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 15616 17019 gene locus_tag LOCUS_13840 15616 17019 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_13840 17275 18099 gene locus_tag LOCUS_13850 17275 18099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 18146 18484 gene locus_tag LOCUS_13860 18146 18484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 18560 19396 gene locus_tag LOCUS_13870 18560 19396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 19429 19851 gene locus_tag LOCUS_13880 19429 19851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 19851 20135 gene locus_tag LOCUS_13890 19851 20135 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080561.1 protein_id gnl|my_center|LOCUS_13890 20132 21445 gene locus_tag LOCUS_13900 20132 21445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 21561 21905 gene locus_tag LOCUS_13910 21561 21905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 22104 23072 gene locus_tag LOCUS_13920 22104 23072 CDS product SBBP repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990858.1 protein_id gnl|my_center|LOCUS_13920 23072 23356 gene locus_tag LOCUS_13930 23072 23356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 23349 23759 gene locus_tag LOCUS_13940 gene zntR 23349 23759 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099019.1 protein_id gnl|my_center|LOCUS_13940 24407 23793 gene locus_tag LOCUS_13950 24407 23793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 25255 24407 gene locus_tag LOCUS_13960 25255 24407 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122027.1 protein_id gnl|my_center|LOCUS_13960 28845 25645 gene locus_tag LOCUS_13970 28845 25645 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070862.1 protein_id gnl|my_center|LOCUS_13970 29855 28860 gene locus_tag LOCUS_13980 29855 28860 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070861.1 protein_id gnl|my_center|LOCUS_13980 30076 29858 gene locus_tag LOCUS_13990 30076 29858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 31444 30149 gene locus_tag LOCUS_14000 31444 30149 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070860.1 protein_id gnl|my_center|LOCUS_14000 31904 31515 gene locus_tag LOCUS_14010 31904 31515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 32337 32002 gene locus_tag LOCUS_14020 32337 32002 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384997.1 protein_id gnl|my_center|LOCUS_14020 35541 32365 gene locus_tag LOCUS_14030 35541 32365 CDS product CusA/CzcA family heavy metal efflux RND transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482627.1 protein_id gnl|my_center|LOCUS_14030 37018 35534 gene locus_tag LOCUS_14040 37018 35534 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_190973259.1 protein_id gnl|my_center|LOCUS_14040 38355 37018 gene locus_tag LOCUS_14050 38355 37018 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941984.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence028 <1 553 gene locus_tag LOCUS_14060 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766526.1:ATP phosphoribosyltransferase 675 1973 gene locus_tag LOCUS_14070 gene hisD 675 1973 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094326.1 protein_id gnl|my_center|LOCUS_14070 2051 3154 gene locus_tag LOCUS_14080 gene hisC 2051 3154 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199913.1 protein_id gnl|my_center|LOCUS_14080 3296 3889 gene locus_tag LOCUS_14090 gene hisB 3296 3889 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_14090 3905 4555 gene locus_tag LOCUS_14100 gene hisH 3905 4555 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121251.1 protein_id gnl|my_center|LOCUS_14100 4682 5425 gene locus_tag LOCUS_14110 gene hisA 4682 5425 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010927224.1 protein_id gnl|my_center|LOCUS_14110 5516 6289 gene locus_tag LOCUS_14120 gene hisF 5516 6289 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767116.1 protein_id gnl|my_center|LOCUS_14120 6513 6896 gene locus_tag LOCUS_14130 gene hisI 6513 6896 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095888.1 protein_id gnl|my_center|LOCUS_14130 6889 7224 gene locus_tag LOCUS_14140 6889 7224 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103458.1 protein_id gnl|my_center|LOCUS_14140 7221 7559 gene locus_tag LOCUS_14150 7221 7559 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687490.1 protein_id gnl|my_center|LOCUS_14150 7575 7802 gene locus_tag LOCUS_14160 gene tatA 7575 7802 CDS product Sec-independent protein translocase subunit TatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815808.1 protein_id gnl|my_center|LOCUS_14160 7877 8302 gene locus_tag LOCUS_14170 gene tatB 7877 8302 CDS product Sec-independent protein translocase protein TatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014906112.1 protein_id gnl|my_center|LOCUS_14170 8299 9378 gene locus_tag LOCUS_14180 8299 9378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 9443 9748 gene locus_tag LOCUS_14190 9443 9748 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214948.1 protein_id gnl|my_center|LOCUS_14190 9982 10365 gene locus_tag LOCUS_14200 9982 10365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 10596 11405 gene locus_tag LOCUS_14210 10596 11405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 11686 13452 gene locus_tag LOCUS_14220 11686 13452 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926891.1 protein_id gnl|my_center|LOCUS_14220 14126 13662 gene locus_tag LOCUS_14230 14126 13662 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815835.1 protein_id gnl|my_center|LOCUS_14230 15397 14138 gene locus_tag LOCUS_14240 15397 14138 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_14240 15932 15552 gene locus_tag LOCUS_14250 15932 15552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 16154 17944 gene locus_tag LOCUS_14260 16154 17944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 19149 17941 gene locus_tag LOCUS_14270 gene algW 19149 17941 CDS product Do family serine endopeptidase AlgW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377590.1 protein_id gnl|my_center|LOCUS_14270 19184 19933 gene locus_tag LOCUS_14280 19184 19933 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072570.1 protein_id gnl|my_center|LOCUS_14280 20059 20265 gene locus_tag LOCUS_14290 gene rpmE 20059 20265 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095846.1 protein_id gnl|my_center|LOCUS_14290 20390 21133 gene locus_tag LOCUS_14300 20390 21133 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103280.1 protein_id gnl|my_center|LOCUS_14300 21171 22445 gene locus_tag LOCUS_14310 21171 22445 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_14310 22459 23115 gene locus_tag LOCUS_14320 22459 23115 CDS product DUF3047 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941830.1 protein_id gnl|my_center|LOCUS_14320 23525 23160 gene locus_tag LOCUS_14330 23525 23160 CDS product DUF6164 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037243.1 protein_id gnl|my_center|LOCUS_14330 23890 23528 gene locus_tag LOCUS_14340 23890 23528 CDS product YajD family HNH nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071871.1 protein_id gnl|my_center|LOCUS_14340 24182 23880 gene locus_tag LOCUS_14350 24182 23880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 26165 24243 gene locus_tag LOCUS_14360 26165 24243 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168667914.1 protein_id gnl|my_center|LOCUS_14360 26774 26193 gene locus_tag LOCUS_14370 26774 26193 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962319.1 protein_id gnl|my_center|LOCUS_14370 27611 26838 gene locus_tag LOCUS_14380 gene yaaA 27611 26838 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266801.1 protein_id gnl|my_center|LOCUS_14380 28609 27758 gene locus_tag LOCUS_14390 28609 27758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 29154 28660 gene locus_tag LOCUS_14400 29154 28660 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207496.1 protein_id gnl|my_center|LOCUS_14400 29472 29158 gene locus_tag LOCUS_14410 29472 29158 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_14410 29947 31326 gene locus_tag LOCUS_14420 29947 31326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 32223 32669 gene locus_tag LOCUS_14430 32223 32669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 33844 32780 gene locus_tag LOCUS_14440 gene hemE 33844 32780 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095015.1 protein_id gnl|my_center|LOCUS_14440 35363 33957 gene locus_tag LOCUS_14450 35363 33957 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095829.1 protein_id gnl|my_center|LOCUS_14450 <36593 35450 gene locus_tag LOCUS_14460 <36593 35450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103700.1:glutamate synthase large subunit >Feature sequence029 2499 1981 gene locus_tag LOCUS_14470 2499 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 4023 2710 gene locus_tag LOCUS_14480 4023 2710 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546494.1 protein_id gnl|my_center|LOCUS_14480 4525 4941 gene locus_tag LOCUS_14490 4525 4941 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_14490 5064 6389 gene locus_tag LOCUS_14500 5064 6389 CDS product heterodisulfide reductase-related iron-sulfur binding cluster inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190664.1 protein_id gnl|my_center|LOCUS_14500 6708 7289 gene locus_tag LOCUS_14510 6708 7289 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_14510 7911 7827 gene locus_tag LOCUS_t00180 7911 7827 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7997 9022 gene locus_tag LOCUS_14520 gene queA 7997 9022 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113798.1 protein_id gnl|my_center|LOCUS_14520 9015 10100 gene locus_tag LOCUS_14530 9015 10100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037015.1 protein_id gnl|my_center|LOCUS_14530 10721 10104 gene locus_tag LOCUS_14540 10721 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 11262 10732 gene locus_tag LOCUS_14550 gene moaB 11262 10732 CDS product molybdenum cofactor biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388021.1 protein_id gnl|my_center|LOCUS_14550 11598 12686 gene locus_tag LOCUS_14560 11598 12686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 12725 13414 gene locus_tag LOCUS_14570 12725 13414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 13404 13754 gene locus_tag LOCUS_14580 13404 13754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 13871 14827 gene locus_tag LOCUS_14590 13871 14827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 14985 15134 gene locus_tag LOCUS_14600 14985 15134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 15189 15470 gene locus_tag LOCUS_14610 15189 15470 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553340.1 protein_id gnl|my_center|LOCUS_14610 15471 17207 gene locus_tag LOCUS_14620 gene recJ 15471 17207 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100681.1 protein_id gnl|my_center|LOCUS_14620 17682 18524 gene locus_tag LOCUS_14630 17682 18524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14630 18921 20450 gene locus_tag LOCUS_14640 gene lysS 18921 20450 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817018.1 protein_id gnl|my_center|LOCUS_14640 21304 20471 gene locus_tag LOCUS_14650 21304 20471 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_14650 22493 21426 gene locus_tag LOCUS_14660 22493 21426 CDS product folate-binding protein YgfZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114180.1 protein_id gnl|my_center|LOCUS_14660 22630 23022 gene locus_tag LOCUS_14670 gene sdhC 22630 23022 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688393.1 protein_id gnl|my_center|LOCUS_14670 23019 23360 gene locus_tag LOCUS_14680 gene sdhD 23019 23360 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946276.1 protein_id gnl|my_center|LOCUS_14680 23357 25126 gene locus_tag LOCUS_14690 gene sdhA 23357 25126 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946277.1 protein_id gnl|my_center|LOCUS_14690 25152 25847 gene locus_tag LOCUS_14700 25152 25847 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187935.1 protein_id gnl|my_center|LOCUS_14700 25847 26107 gene locus_tag LOCUS_14710 25847 26107 CDS product succinate dehydrogenase assembly factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768810.1 protein_id gnl|my_center|LOCUS_14710 26154 26537 gene locus_tag LOCUS_14720 26154 26537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 26810 28360 gene locus_tag LOCUS_14730 26810 28360 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071057.1 protein_id gnl|my_center|LOCUS_14730 28357 30018 gene locus_tag LOCUS_14740 28357 30018 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101357.1 protein_id gnl|my_center|LOCUS_14740 30398 30652 gene locus_tag LOCUS_14750 30398 30652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 30649 31341 gene locus_tag LOCUS_14760 30649 31341 CDS product HTTM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015923256.1 protein_id gnl|my_center|LOCUS_14760 32996 31353 gene locus_tag LOCUS_14770 gene nadB 32996 31353 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114182.1 protein_id gnl|my_center|LOCUS_14770 33292 33873 gene locus_tag LOCUS_14780 gene rpoE 33292 33873 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309371.1 protein_id gnl|my_center|LOCUS_14780 33906 34574 gene locus_tag LOCUS_14790 33906 34574 CDS product RseA family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704744.1 protein_id gnl|my_center|LOCUS_14790 34577 35569 gene locus_tag LOCUS_14800 34577 35569 CDS product MucB/RseB C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930931.1 protein_id gnl|my_center|LOCUS_14800 35566 36021 gene locus_tag LOCUS_14810 35566 36021 CDS product SoxR reducing system RseC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005670174.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence030 388 2895 gene locus_tag LOCUS_14820 gene infB 388 2895 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268881.1 protein_id gnl|my_center|LOCUS_14820 2949 3377 gene locus_tag LOCUS_14830 gene rbfA 2949 3377 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268880.1 protein_id gnl|my_center|LOCUS_14830 3402 4322 gene locus_tag LOCUS_14840 gene truB 3402 4322 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400189.1 protein_id gnl|my_center|LOCUS_14840 4793 5062 gene locus_tag LOCUS_14850 gene rpsO 4793 5062 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185828.1 protein_id gnl|my_center|LOCUS_14850 5148 7235 gene locus_tag LOCUS_14860 gene pnp 5148 7235 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957848.1 protein_id gnl|my_center|LOCUS_14860 7346 8233 gene locus_tag LOCUS_14870 gene galU 7346 8233 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192544.1 protein_id gnl|my_center|LOCUS_14870 10967 8241 gene locus_tag LOCUS_14880 gene gacS 10967 8241 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_14880 11881 10964 gene locus_tag LOCUS_14890 11881 10964 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895578.1 protein_id gnl|my_center|LOCUS_14890 13955 11982 gene locus_tag LOCUS_14900 13955 11982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 14276 15166 gene locus_tag LOCUS_14910 gene cysM 14276 15166 CDS product cysteine synthase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102419.1 protein_id gnl|my_center|LOCUS_14910 15326 16678 gene locus_tag LOCUS_14920 gene rlmD 15326 16678 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036471.1 protein_id gnl|my_center|LOCUS_14920 16809 17108 gene locus_tag LOCUS_14930 16809 17108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 17519 17157 gene locus_tag LOCUS_14940 17519 17157 CDS product HopJ type III effector protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263557.1 protein_id gnl|my_center|LOCUS_14940 18371 17547 gene locus_tag LOCUS_14950 18371 17547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 18677 22324 gene locus_tag LOCUS_14960 18677 22324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 24102 22435 gene locus_tag LOCUS_14970 gene ettA 24102 22435 CDS product energy-dependent translational throttle protein EttA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704886.1 protein_id gnl|my_center|LOCUS_14970 24246 25163 gene locus_tag LOCUS_14980 gene prmB 24246 25163 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405794.1 protein_id gnl|my_center|LOCUS_14980 25275 26699 gene locus_tag LOCUS_14990 gene hemN 25275 26699 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087267.1 protein_id gnl|my_center|LOCUS_14990 27470 27030 gene locus_tag LOCUS_15000 27470 27030 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195485.1 protein_id gnl|my_center|LOCUS_15000 27707 28393 gene locus_tag LOCUS_15010 27707 28393 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020659.1 protein_id gnl|my_center|LOCUS_15010 29694 28855 gene locus_tag LOCUS_15020 29694 28855 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114179.1 protein_id gnl|my_center|LOCUS_15020 31514 29787 gene locus_tag LOCUS_15030 31514 29787 CDS product bifunctional protein-serine/threonine kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965821.1 protein_id gnl|my_center|LOCUS_15030 31872 31531 gene locus_tag LOCUS_15040 31872 31531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 33389 31920 gene locus_tag LOCUS_15050 33389 31920 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207247.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence031 <1 1063 gene locus_tag LOCUS_15060 <1 1063 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963904.1:glycosyltransferase family 4 protein 2258 1149 gene locus_tag LOCUS_15070 2258 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 3484 2348 gene locus_tag LOCUS_15080 3484 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 4405 5397 gene locus_tag LOCUS_15090 4405 5397 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941286.1 protein_id gnl|my_center|LOCUS_15090 5390 6325 gene locus_tag LOCUS_15100 5390 6325 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125825.1 protein_id gnl|my_center|LOCUS_15100 7571 6318 gene locus_tag LOCUS_15110 7571 6318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 7682 8497 gene locus_tag LOCUS_15120 7682 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 8625 8876 gene locus_tag LOCUS_15130 8625 8876 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390870.1 protein_id gnl|my_center|LOCUS_15130 10126 8891 gene locus_tag LOCUS_15140 10126 8891 CDS product pyridoxal-dependent decarboxylase, exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390883.1 protein_id gnl|my_center|LOCUS_15140 11783 10155 gene locus_tag LOCUS_15150 11783 10155 CDS product acyl-CoA ligase (AMP-forming), exosortase A system-associated inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187764.1 protein_id gnl|my_center|LOCUS_15150 12396 12728 gene locus_tag LOCUS_15160 12396 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 12752 13042 gene locus_tag LOCUS_15170 12752 13042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 13039 13968 gene locus_tag LOCUS_15180 13039 13968 CDS product HprK-related kinase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390848.1 protein_id gnl|my_center|LOCUS_15180 14045 15070 gene locus_tag LOCUS_15190 14045 15070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 16147 15164 gene locus_tag LOCUS_15200 gene galE 16147 15164 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942880.1 protein_id gnl|my_center|LOCUS_15200 17231 16767 gene locus_tag LOCUS_15210 17231 16767 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_15210 17726 21097 gene locus_tag LOCUS_15220 17726 21097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 21190 21486 gene locus_tag LOCUS_15230 21190 21486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 21556 23682 gene locus_tag LOCUS_15240 21556 23682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 24293 27115 gene locus_tag LOCUS_15250 24293 27115 CDS product SLBB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925895.1 protein_id gnl|my_center|LOCUS_15250 27169 28143 gene locus_tag LOCUS_15260 27169 28143 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073078.1 protein_id gnl|my_center|LOCUS_15260 28227 28874 gene locus_tag LOCUS_15270 gene cysC 28227 28874 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046849124.1 protein_id gnl|my_center|LOCUS_15270 32191 29249 gene locus_tag LOCUS_15280 32191 29249 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206955.1 protein_id gnl|my_center|LOCUS_15280 33229 32321 gene locus_tag LOCUS_15290 33229 32321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 33498 33698 gene locus_tag LOCUS_15300 33498 33698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 35143 34106 gene locus_tag LOCUS_15310 35143 34106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence032 1874 1008 gene locus_tag LOCUS_15320 1874 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 2438 1884 gene locus_tag LOCUS_15330 2438 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 2670 2419 gene locus_tag LOCUS_15340 2670 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 3013 2660 gene locus_tag LOCUS_15350 3013 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 3573 3013 gene locus_tag LOCUS_15360 3573 3013 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_15360 3790 4239 gene locus_tag LOCUS_15370 3790 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 5708 4653 gene locus_tag LOCUS_15380 5708 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 7361 5859 gene locus_tag LOCUS_15390 gene gpmI 7361 5859 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943825.1 protein_id gnl|my_center|LOCUS_15390 7266 7460 gene locus_tag LOCUS_15400 7266 7460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 9039 7453 gene locus_tag LOCUS_15410 9039 7453 CDS product fused MFS/spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258554.1 protein_id gnl|my_center|LOCUS_15410 9862 9101 gene locus_tag LOCUS_15420 9862 9101 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162470656.1 protein_id gnl|my_center|LOCUS_15420 10554 9859 gene locus_tag LOCUS_15430 gene queC 10554 9859 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111415.1 protein_id gnl|my_center|LOCUS_15430 11237 10551 gene locus_tag LOCUS_15440 gene queE 11237 10551 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_15440 12186 11335 gene locus_tag LOCUS_15450 gene ybgF 12186 11335 CDS product tol-pal system protein YbgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038132.1 protein_id gnl|my_center|LOCUS_15450 12858 12277 gene locus_tag LOCUS_15460 12858 12277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 14331 12994 gene locus_tag LOCUS_15470 gene tolB 14331 12994 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038134.1 protein_id gnl|my_center|LOCUS_15470 15278 14388 gene locus_tag LOCUS_15480 15278 14388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 15731 15294 gene locus_tag LOCUS_15490 gene tolR 15731 15294 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_126827401.1 protein_id gnl|my_center|LOCUS_15490 16406 15732 gene locus_tag LOCUS_15500 gene tolQ 16406 15732 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554655.1 protein_id gnl|my_center|LOCUS_15500 16836 16396 gene locus_tag LOCUS_15510 16836 16396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 18014 16956 gene locus_tag LOCUS_15520 gene ruvB 18014 16956 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409396.1 protein_id gnl|my_center|LOCUS_15520 18104 19816 gene locus_tag LOCUS_15530 18104 19816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 20443 19847 gene locus_tag LOCUS_15540 20443 19847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 21445 20843 gene locus_tag LOCUS_15550 gene ruvA 21445 20843 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086122.1 protein_id gnl|my_center|LOCUS_15550 21951 21442 gene locus_tag LOCUS_15560 gene ruvC 21951 21442 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072406.1 protein_id gnl|my_center|LOCUS_15560 22822 22073 gene locus_tag LOCUS_15570 22822 22073 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020411.1 protein_id gnl|my_center|LOCUS_15570 23287 22940 gene locus_tag LOCUS_15580 23287 22940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 23553 23275 gene locus_tag LOCUS_15590 23553 23275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 23909 23562 gene locus_tag LOCUS_15600 23909 23562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 25629 24751 gene locus_tag LOCUS_15610 25629 24751 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942022.1 protein_id gnl|my_center|LOCUS_15610 25722 27365 gene locus_tag LOCUS_15620 25722 27365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 31011 27349 gene locus_tag LOCUS_15630 31011 27349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 31245 31448 gene locus_tag LOCUS_15640 31245 31448 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932662.1 protein_id gnl|my_center|LOCUS_15640 31758 31552 gene locus_tag LOCUS_15650 31758 31552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 32138 31755 gene locus_tag LOCUS_15660 32138 31755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15660 33292 32192 gene locus_tag LOCUS_15670 gene nadA 33292 32192 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051156418.1 protein_id gnl|my_center|LOCUS_15670 <35212 33529 gene locus_tag LOCUS_15680 <35212 33529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003123218.1:aspartate--tRNA ligase >Feature sequence033 1509 631 gene locus_tag LOCUS_15690 1509 631 CDS product formyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403379.1 protein_id gnl|my_center|LOCUS_15690 2696 1506 gene locus_tag LOCUS_15700 gene neuC 2696 1506 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403378.1 protein_id gnl|my_center|LOCUS_15700 3856 2693 gene locus_tag LOCUS_15710 3856 2693 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403377.1 protein_id gnl|my_center|LOCUS_15710 4866 3856 gene locus_tag LOCUS_15720 4866 3856 CDS product NAD-dependent 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600889.1 protein_id gnl|my_center|LOCUS_15720 7358 4866 gene locus_tag LOCUS_15730 7358 4866 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073156.1 protein_id gnl|my_center|LOCUS_15730 7644 8345 gene locus_tag LOCUS_15740 7644 8345 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073121.1 protein_id gnl|my_center|LOCUS_15740 8426 8854 gene locus_tag LOCUS_15750 8426 8854 CDS product flagellar protein FlaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943643.1 protein_id gnl|my_center|LOCUS_15750 8928 10364 gene locus_tag LOCUS_15760 gene fliD 8928 10364 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000146784.1 protein_id gnl|my_center|LOCUS_15760 10455 10841 gene locus_tag LOCUS_15770 gene fliS 10455 10841 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082192.1 protein_id gnl|my_center|LOCUS_15770 10852 11166 gene locus_tag LOCUS_15780 10852 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 11242 11823 gene locus_tag LOCUS_15790 11242 11823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 12004 13440 gene locus_tag LOCUS_15800 gene fleQ 12004 13440 CDS product transcriptional regulator FleQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316803.1 protein_id gnl|my_center|LOCUS_15800 13601 14812 gene locus_tag LOCUS_15810 gene fleS 13601 14812 CDS product sensor histidine kinase FleS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086450.1 protein_id gnl|my_center|LOCUS_15810 14809 16164 gene locus_tag LOCUS_15820 14809 16164 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706626.1 protein_id gnl|my_center|LOCUS_15820 16194 16514 gene locus_tag LOCUS_15830 gene fliE 16194 16514 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457685.1 protein_id gnl|my_center|LOCUS_15830 16616 18280 gene locus_tag LOCUS_15840 gene fliF 16616 18280 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244370.1 protein_id gnl|my_center|LOCUS_15840 18273 19280 gene locus_tag LOCUS_15850 gene fliG 18273 19280 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082212.1 protein_id gnl|my_center|LOCUS_15850 19283 19960 gene locus_tag LOCUS_15860 19283 19960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 20019 21410 gene locus_tag LOCUS_15870 gene fliI 20019 21410 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705275.1 protein_id gnl|my_center|LOCUS_15870 22165 21488 gene locus_tag LOCUS_15880 22165 21488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 23041 22238 gene locus_tag LOCUS_15890 23041 22238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 24098 23001 gene locus_tag LOCUS_15900 24098 23001 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_15900 25211 24117 gene locus_tag LOCUS_15910 25211 24117 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941105.1 protein_id gnl|my_center|LOCUS_15910 27721 25211 gene locus_tag LOCUS_15920 27721 25211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15920 28273 27782 gene locus_tag LOCUS_15930 28273 27782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 28433 30514 gene locus_tag LOCUS_15940 28433 30514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 30560 31276 gene locus_tag LOCUS_15950 30560 31276 CDS product protein phosphatase 2C domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036194.1 protein_id gnl|my_center|LOCUS_15950 31328 32848 gene locus_tag LOCUS_15960 gene sbcB 31328 32848 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_15960 33006 33527 gene locus_tag LOCUS_15970 33006 33527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence034 900 2936 gene locus_tag LOCUS_15980 900 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 3932 2991 gene locus_tag LOCUS_15990 3932 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 8048 4137 gene locus_tag LOCUS_16000 gene purL 8048 4137 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_16000 10240 8219 gene locus_tag LOCUS_16010 10240 8219 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105343.1 protein_id gnl|my_center|LOCUS_16010 11128 10418 gene locus_tag LOCUS_16020 11128 10418 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108622.1 protein_id gnl|my_center|LOCUS_16020 11988 11230 gene locus_tag LOCUS_16030 11988 11230 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193059.1 protein_id gnl|my_center|LOCUS_16030 13067 11997 gene locus_tag LOCUS_16040 gene bamC 13067 11997 CDS product outer membrane protein assembly factor BamC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225338.1 protein_id gnl|my_center|LOCUS_16040 14006 13125 gene locus_tag LOCUS_16050 gene dapA 14006 13125 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086270.1 protein_id gnl|my_center|LOCUS_16050 14203 14733 gene locus_tag LOCUS_16060 14203 14733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 14767 15234 gene locus_tag LOCUS_16070 14767 15234 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317382.1 protein_id gnl|my_center|LOCUS_16070 15268 15540 gene locus_tag LOCUS_16080 15268 15540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 16608 15544 gene locus_tag LOCUS_16090 16608 15544 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108615.1 protein_id gnl|my_center|LOCUS_16090 16985 16605 gene locus_tag LOCUS_16100 16985 16605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 17941 17027 gene locus_tag LOCUS_16110 17941 17027 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393377.1 protein_id gnl|my_center|LOCUS_16110 21323 18093 gene locus_tag LOCUS_16120 21323 18093 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072999.1 protein_id gnl|my_center|LOCUS_16120 22354 21335 gene locus_tag LOCUS_16130 22354 21335 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706768.1 protein_id gnl|my_center|LOCUS_16130 22817 23533 gene locus_tag LOCUS_16140 22817 23533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 24718 23537 gene locus_tag LOCUS_16150 24718 23537 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071253.1 protein_id gnl|my_center|LOCUS_16150 25482 24715 gene locus_tag LOCUS_16160 25482 24715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 26963 25485 gene locus_tag LOCUS_16170 gene glpK 26963 25485 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919105.1 protein_id gnl|my_center|LOCUS_16170 27960 27283 gene locus_tag LOCUS_16180 gene rluA 27960 27283 CDS product bifunctional tRNA pseudouridine(32) synthase/23S rRNA pseudouridine(746) synthase RluA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000525162.1 protein_id gnl|my_center|LOCUS_16180 28333 29760 gene locus_tag LOCUS_16190 gene ccoN 28333 29760 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087322.1 protein_id gnl|my_center|LOCUS_16190 29774 30487 gene locus_tag LOCUS_16200 gene ccoO 29774 30487 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967401.1 protein_id gnl|my_center|LOCUS_16200 30480 30716 gene locus_tag LOCUS_16210 30480 30716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 30713 31564 gene locus_tag LOCUS_16220 gene ccoP 30713 31564 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338422.1 protein_id gnl|my_center|LOCUS_16220 31536 31763 gene locus_tag LOCUS_16230 31536 31763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 32133 33569 gene locus_tag LOCUS_16240 gene ccoG 32133 33569 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087288.1 protein_id gnl|my_center|LOCUS_16240 >Feature sequence035 2018 195 gene locus_tag LOCUS_16250 gene oadA 2018 195 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105555.1 protein_id gnl|my_center|LOCUS_16250 3635 2217 gene locus_tag LOCUS_16260 3635 2217 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096848.1 protein_id gnl|my_center|LOCUS_16260 3989 4558 gene locus_tag LOCUS_16270 3989 4558 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104745.1 protein_id gnl|my_center|LOCUS_16270 4657 4839 gene locus_tag LOCUS_16280 gene rpmF 4657 4839 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771287.1 protein_id gnl|my_center|LOCUS_16280 4950 5996 gene locus_tag LOCUS_16290 gene plsX 4950 5996 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947122.1 protein_id gnl|my_center|LOCUS_16290 5993 6976 gene locus_tag LOCUS_16300 5993 6976 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_16300 7046 7987 gene locus_tag LOCUS_16310 gene fabD 7046 7987 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 protein_id gnl|my_center|LOCUS_16310 7990 8745 gene locus_tag LOCUS_16320 gene fabG 7990 8745 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106013.1 protein_id gnl|my_center|LOCUS_16320 8947 9183 gene locus_tag LOCUS_16330 gene acpP 8947 9183 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_16330 9386 10609 gene locus_tag LOCUS_16340 gene fabF 9386 10609 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193086.1 protein_id gnl|my_center|LOCUS_16340 10668 11987 gene locus_tag LOCUS_16350 10668 11987 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036222.1 protein_id gnl|my_center|LOCUS_16350 12044 12874 gene locus_tag LOCUS_16360 gene pabC 12044 12874 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113994.1 protein_id gnl|my_center|LOCUS_16360 12867 13925 gene locus_tag LOCUS_16370 gene mltG 12867 13925 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957616.1 protein_id gnl|my_center|LOCUS_16370 14265 14912 gene locus_tag LOCUS_16380 gene tmk 14265 14912 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267153.1 protein_id gnl|my_center|LOCUS_16380 14909 15889 gene locus_tag LOCUS_16390 14909 15889 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 protein_id gnl|my_center|LOCUS_16390 15991 16341 gene locus_tag LOCUS_16400 15991 16341 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091119.1 protein_id gnl|my_center|LOCUS_16400 16639 17451 gene locus_tag LOCUS_16410 16639 17451 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444530.1 protein_id gnl|my_center|LOCUS_16410 18581 17442 gene locus_tag LOCUS_16420 18581 17442 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113995.1 protein_id gnl|my_center|LOCUS_16420 21037 18644 gene locus_tag LOCUS_16430 21037 18644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 22054 21356 gene locus_tag LOCUS_16440 22054 21356 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771596.1 protein_id gnl|my_center|LOCUS_16440 23699 22062 gene locus_tag LOCUS_16450 23699 22062 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103766.1 protein_id gnl|my_center|LOCUS_16450 23968 26658 gene locus_tag LOCUS_16460 23968 26658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 26996 27451 gene locus_tag LOCUS_16470 26996 27451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 27854 28627 gene locus_tag LOCUS_16480 27854 28627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 29458 29048 gene locus_tag LOCUS_16490 29458 29048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 30799 29462 gene locus_tag LOCUS_16500 gene dinB 30799 29462 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_16500 31400 30792 gene locus_tag LOCUS_16510 gene lexA 31400 30792 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087594.1 protein_id gnl|my_center|LOCUS_16510 31683 32096 gene locus_tag LOCUS_16520 31683 32096 CDS product DUF2384 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720621.1 protein_id gnl|my_center|LOCUS_16520 32096 32809 gene locus_tag LOCUS_16530 32096 32809 CDS product RES family NAD+ phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338238.1 protein_id gnl|my_center|LOCUS_16530 >Feature sequence036 405 43 gene locus_tag LOCUS_16540 405 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 813 493 gene locus_tag LOCUS_16550 813 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1202 849 gene locus_tag LOCUS_16560 1202 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 1496 1281 gene locus_tag LOCUS_16570 1496 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 4366 2534 gene locus_tag LOCUS_16580 gene glmS 4366 2534 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114654.1 protein_id gnl|my_center|LOCUS_16580 5906 4524 gene locus_tag LOCUS_16590 gene glmU 5906 4524 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215550.1 protein_id gnl|my_center|LOCUS_16590 6444 6016 gene locus_tag LOCUS_16600 6444 6016 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_16600 7847 6471 gene locus_tag LOCUS_16610 gene atpD 7847 6471 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948666.1 protein_id gnl|my_center|LOCUS_16610 8863 8003 gene locus_tag LOCUS_16620 gene atpG 8863 8003 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097132.1 protein_id gnl|my_center|LOCUS_16620 10442 8901 gene locus_tag LOCUS_16630 gene atpA 10442 8901 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948668.1 protein_id gnl|my_center|LOCUS_16630 11028 10492 gene locus_tag LOCUS_16640 11028 10492 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097135.1 protein_id gnl|my_center|LOCUS_16640 11503 11033 gene locus_tag LOCUS_16650 gene atpF 11503 11033 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458451.1 protein_id gnl|my_center|LOCUS_16650 11881 11594 gene locus_tag LOCUS_16660 gene atpE 11881 11594 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005372317.1 protein_id gnl|my_center|LOCUS_16660 12781 11960 gene locus_tag LOCUS_16670 gene atpB 12781 11960 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074335.1 protein_id gnl|my_center|LOCUS_16670 13226 12786 gene locus_tag LOCUS_16680 13226 12786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 13448 13236 gene locus_tag LOCUS_16690 13448 13236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 14484 13612 gene locus_tag LOCUS_16700 14484 13612 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_16700 15313 14525 gene locus_tag LOCUS_16710 15313 14525 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074338.1 protein_id gnl|my_center|LOCUS_16710 16105 15431 gene locus_tag LOCUS_16720 gene rsmG 16105 15431 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039110.1 protein_id gnl|my_center|LOCUS_16720 16617 16111 gene locus_tag LOCUS_16730 16617 16111 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_16730 18595 16700 gene locus_tag LOCUS_16740 gene mnmG 18595 16700 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000965608.1 protein_id gnl|my_center|LOCUS_16740 19034 18765 gene locus_tag LOCUS_16750 19034 18765 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003686964.1 protein_id gnl|my_center|LOCUS_16750 19457 19056 gene locus_tag LOCUS_16760 19457 19056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037933.1 protein_id gnl|my_center|LOCUS_16760 20327 19470 gene locus_tag LOCUS_16770 gene rapZ 20327 19470 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 protein_id gnl|my_center|LOCUS_16770 21139 20348 gene locus_tag LOCUS_16780 gene hprK 21139 20348 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005993219.1 protein_id gnl|my_center|LOCUS_16780 21026 21325 gene locus_tag LOCUS_16790 21026 21325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 21879 21340 gene locus_tag LOCUS_16800 gene ptsN 21879 21340 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098853.1 protein_id gnl|my_center|LOCUS_16800 22230 21886 gene locus_tag LOCUS_16810 gene hpf 22230 21886 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001166643.1 protein_id gnl|my_center|LOCUS_16810 23794 22292 gene locus_tag LOCUS_16820 23794 22292 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094357.1 protein_id gnl|my_center|LOCUS_16820 24702 23977 gene locus_tag LOCUS_16830 gene lptB 24702 23977 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206203.1 protein_id gnl|my_center|LOCUS_16830 25256 24699 gene locus_tag LOCUS_16840 gene lptA 25256 24699 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369494.1 protein_id gnl|my_center|LOCUS_16840 25782 25246 gene locus_tag LOCUS_16850 25782 25246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 26365 25841 gene locus_tag LOCUS_16860 26365 25841 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112742.1 protein_id gnl|my_center|LOCUS_16860 27437 26463 gene locus_tag LOCUS_16870 27437 26463 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707617.1 protein_id gnl|my_center|LOCUS_16870 28441 27452 gene locus_tag LOCUS_16880 28441 27452 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_16880 29378 28446 gene locus_tag LOCUS_16890 gene ubiA 29378 28446 CDS product 4-hydroxybenzoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704199.1 protein_id gnl|my_center|LOCUS_16890 29972 29397 gene locus_tag LOCUS_16900 29972 29397 CDS product chorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114374.1 protein_id gnl|my_center|LOCUS_16900 30543 31559 gene locus_tag LOCUS_16910 30543 31559 CDS product IS110-like element ISYen1 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815821.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence037 1088 462 gene locus_tag LOCUS_16920 gene gmk 1088 462 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098317.1 protein_id gnl|my_center|LOCUS_16920 2014 1148 gene locus_tag LOCUS_16930 2014 1148 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459003.1 protein_id gnl|my_center|LOCUS_16930 2144 3073 gene locus_tag LOCUS_16940 2144 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 3075 3914 gene locus_tag LOCUS_16950 3075 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 4600 3926 gene locus_tag LOCUS_16960 gene radC 4600 3926 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_16960 4693 5904 gene locus_tag LOCUS_16970 gene coaBC 4693 5904 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_16970 6500 6030 gene locus_tag LOCUS_16980 6500 6030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 6923 6522 gene locus_tag LOCUS_16990 6923 6522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 8376 6991 gene locus_tag LOCUS_17000 8376 6991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 9447 8521 gene locus_tag LOCUS_17010 9447 8521 CDS product CysB family HTH-type transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193435.1 protein_id gnl|my_center|LOCUS_17010 9587 10360 gene locus_tag LOCUS_17020 9587 10360 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194827.1 protein_id gnl|my_center|LOCUS_17020 10390 12510 gene locus_tag LOCUS_17030 10390 12510 CDS product nitrite/sulfite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228113.1 protein_id gnl|my_center|LOCUS_17030 12553 13269 gene locus_tag LOCUS_17040 12553 13269 CDS product phosphoadenylyl-sulfate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192841.1 protein_id gnl|my_center|LOCUS_17040 13859 13332 gene locus_tag LOCUS_17050 13859 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 14333 13878 gene locus_tag LOCUS_17060 gene dut 14333 13878 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976070.1 protein_id gnl|my_center|LOCUS_17060 15680 14346 gene locus_tag LOCUS_17070 15680 14346 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958524.1 protein_id gnl|my_center|LOCUS_17070 17124 15670 gene locus_tag LOCUS_17080 17124 15670 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948371.1 protein_id gnl|my_center|LOCUS_17080 17347 18375 gene locus_tag LOCUS_17090 17347 18375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 18553 19245 gene locus_tag LOCUS_17100 gene ftsE 18553 19245 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704349.1 protein_id gnl|my_center|LOCUS_17100 19407 20357 gene locus_tag LOCUS_17110 gene ftsX 19407 20357 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086480063.1 protein_id gnl|my_center|LOCUS_17110 20524 21375 gene locus_tag LOCUS_17120 gene rpoH 20524 21375 CDS product RNA polymerase sigma factor RpoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704351.1 protein_id gnl|my_center|LOCUS_17120 22346 21864 gene locus_tag LOCUS_17130 22346 21864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 23211 22474 gene locus_tag LOCUS_17140 23211 22474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 24292 23261 gene locus_tag LOCUS_17150 24292 23261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 25244 24324 gene locus_tag LOCUS_17160 25244 24324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 26246 25323 gene locus_tag LOCUS_17170 26246 25323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 28341 26377 gene locus_tag LOCUS_17180 28341 26377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 28560 29951 gene locus_tag LOCUS_17190 28560 29951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 30692 30000 gene locus_tag LOCUS_17200 gene bioD 30692 30000 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763772.1 protein_id gnl|my_center|LOCUS_17200 >Feature sequence038 1920 478 gene locus_tag LOCUS_17210 1920 478 CDS product TRZ/ATZ family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014507955.1 protein_id gnl|my_center|LOCUS_17210 2759 1932 gene locus_tag LOCUS_17220 2759 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2907 4157 gene locus_tag LOCUS_17230 2907 4157 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546769.1 protein_id gnl|my_center|LOCUS_17230 4284 5330 gene locus_tag LOCUS_17240 gene mtnA 4284 5330 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091449.1 protein_id gnl|my_center|LOCUS_17240 5515 8094 gene locus_tag LOCUS_17250 gene gyrA 5515 8094 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444523.1 protein_id gnl|my_center|LOCUS_17250 8368 9453 gene locus_tag LOCUS_17260 gene serC 8368 9453 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106701.1 protein_id gnl|my_center|LOCUS_17260 9544 10707 gene locus_tag LOCUS_17270 9544 10707 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958401.1 protein_id gnl|my_center|LOCUS_17270 10931 12010 gene locus_tag LOCUS_17280 gene pheA 10931 12010 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005616461.1 protein_id gnl|my_center|LOCUS_17280 12192 13304 gene locus_tag LOCUS_17290 gene hisC 12192 13304 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115433.1 protein_id gnl|my_center|LOCUS_17290 13447 14310 gene locus_tag LOCUS_17300 13447 14310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 14434 15756 gene locus_tag LOCUS_17310 14434 15756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 15908 16603 gene locus_tag LOCUS_17320 gene cmk 15908 16603 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106707.1 protein_id gnl|my_center|LOCUS_17320 16890 18575 gene locus_tag LOCUS_17330 gene rpsA 16890 18575 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091442.1 protein_id gnl|my_center|LOCUS_17330 18689 18976 gene locus_tag LOCUS_17340 18689 18976 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037339.1 protein_id gnl|my_center|LOCUS_17340 19097 19390 gene locus_tag LOCUS_17350 19097 19390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 19423 20601 gene locus_tag LOCUS_17360 gene lapB 19423 20601 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957639.1 protein_id gnl|my_center|LOCUS_17360 20944 21666 gene locus_tag LOCUS_17370 gene pyrF 20944 21666 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705735.1 protein_id gnl|my_center|LOCUS_17370 21798 22094 gene locus_tag LOCUS_17380 21798 22094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 22321 23391 gene locus_tag LOCUS_17390 22321 23391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 23659 25152 gene locus_tag LOCUS_17400 23659 25152 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529087.1 protein_id gnl|my_center|LOCUS_17400 25343 26503 gene locus_tag LOCUS_17410 gene metK 25343 26503 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817040.1 protein_id gnl|my_center|LOCUS_17410 26561 26944 gene locus_tag LOCUS_17420 26561 26944 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_17420 27118 28539 gene locus_tag LOCUS_17430 gene ahcY 27118 28539 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931278.1 protein_id gnl|my_center|LOCUS_17430 28871 29251 gene locus_tag LOCUS_17440 28871 29251 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174492.1 protein_id gnl|my_center|LOCUS_17440 29241 29672 gene locus_tag LOCUS_17450 29241 29672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 29721 30569 gene locus_tag LOCUS_17460 gene metF 29721 30569 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198631.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence039 176 412 gene locus_tag LOCUS_17470 176 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 651 415 gene locus_tag LOCUS_17480 651 415 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_17480 857 675 gene locus_tag LOCUS_17490 857 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 1352 894 gene locus_tag LOCUS_17500 1352 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 2330 1371 gene locus_tag LOCUS_17510 2330 1371 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 protein_id gnl|my_center|LOCUS_17510 3528 2422 gene locus_tag LOCUS_17520 gene arsB 3528 2422 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_17520 3968 3525 gene locus_tag LOCUS_17530 3968 3525 CDS product thioredoxin-dependent arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398596.1 protein_id gnl|my_center|LOCUS_17530 4374 4003 gene locus_tag LOCUS_17540 4374 4003 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017131138.1 protein_id gnl|my_center|LOCUS_17540 5158 4463 gene locus_tag LOCUS_17550 5158 4463 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103253.1 protein_id gnl|my_center|LOCUS_17550 5048 5305 gene locus_tag LOCUS_17560 5048 5305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 5561 6532 gene locus_tag LOCUS_17570 5561 6532 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978086.1 protein_id gnl|my_center|LOCUS_17570 6682 7701 gene locus_tag LOCUS_17580 6682 7701 CDS product fructose-bisphosphate aldolase class I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946219.1 protein_id gnl|my_center|LOCUS_17580 7815 8000 gene locus_tag LOCUS_17590 7815 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 8025 10070 gene locus_tag LOCUS_17600 8025 10070 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_17600 10255 11442 gene locus_tag LOCUS_17610 10255 11442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 11450 12238 gene locus_tag LOCUS_17620 11450 12238 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122962.1 protein_id gnl|my_center|LOCUS_17620 13098 12277 gene locus_tag LOCUS_17630 13098 12277 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016507544.1 protein_id gnl|my_center|LOCUS_17630 13812 13111 gene locus_tag LOCUS_17640 13812 13111 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872098.1 protein_id gnl|my_center|LOCUS_17640 14420 13809 gene locus_tag LOCUS_17650 14420 13809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 14744 14463 gene locus_tag LOCUS_17660 14744 14463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 15593 14967 gene locus_tag LOCUS_17670 15593 14967 CDS product DUF1003 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208084.1 protein_id gnl|my_center|LOCUS_17670 16911 15709 gene locus_tag LOCUS_17680 16911 15709 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142563.1 protein_id gnl|my_center|LOCUS_17680 17926 16946 gene locus_tag LOCUS_17690 17926 16946 CDS product alpha-ketoacid dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943073.1 protein_id gnl|my_center|LOCUS_17690 18426 17923 gene locus_tag LOCUS_17700 18426 17923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17700 18919 18494 gene locus_tag LOCUS_17710 18919 18494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 19971 18916 gene locus_tag LOCUS_17720 gene pdhA 19971 18916 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943082.1 protein_id gnl|my_center|LOCUS_17720 21336 20344 gene locus_tag LOCUS_17730 gene pfkB 21336 20344 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_17730 21487 21891 gene locus_tag LOCUS_17740 21487 21891 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198632.1 protein_id gnl|my_center|LOCUS_17740 23349 22048 gene locus_tag LOCUS_17750 23349 22048 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_17750 25291 23378 gene locus_tag LOCUS_17760 gene ftsH 25291 23378 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869596.1 protein_id gnl|my_center|LOCUS_17760 25594 25917 gene locus_tag LOCUS_17770 25594 25917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17770 26130 27545 gene locus_tag LOCUS_17780 26130 27545 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933618.1 protein_id gnl|my_center|LOCUS_17780 27568 29964 gene locus_tag LOCUS_17790 gene ppsA 27568 29964 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941469.1 protein_id gnl|my_center|LOCUS_17790 30192 30539 gene locus_tag LOCUS_17800 30192 30539 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence040 535 645 gene locus_tag LOCUS_r00010 535 645 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 1030 2100 gene locus_tag LOCUS_17810 1030 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 2134 3132 gene locus_tag LOCUS_17820 gene birA 2134 3132 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262797.1 protein_id gnl|my_center|LOCUS_17820 3129 3893 gene locus_tag LOCUS_17830 3129 3893 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196311.1 protein_id gnl|my_center|LOCUS_17830 3959 4732 gene locus_tag LOCUS_17840 3959 4732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 4814 4889 gene locus_tag LOCUS_t00190 4814 4889 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4987 5481 gene locus_tag LOCUS_17850 4987 5481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 5625 6026 gene locus_tag LOCUS_17860 5625 6026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 6209 8113 gene locus_tag LOCUS_17870 gene htpG 6209 8113 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087446.1 protein_id gnl|my_center|LOCUS_17870 8129 8848 gene locus_tag LOCUS_17880 gene sfsA 8129 8848 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368194.1 protein_id gnl|my_center|LOCUS_17880 10775 8859 gene locus_tag LOCUS_17890 10775 8859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 11006 10788 gene locus_tag LOCUS_17900 11006 10788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 12595 11192 gene locus_tag LOCUS_17910 12595 11192 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035947.1 protein_id gnl|my_center|LOCUS_17910 13197 12610 gene locus_tag LOCUS_17920 gene dolP 13197 12610 CDS product division/outer membrane stress-associated lipid-binding lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070669.1 protein_id gnl|my_center|LOCUS_17920 13594 13223 gene locus_tag LOCUS_17930 13594 13223 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024665649.1 protein_id gnl|my_center|LOCUS_17930 15562 13607 gene locus_tag LOCUS_17940 15562 13607 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103096.1 protein_id gnl|my_center|LOCUS_17940 15601 16461 gene locus_tag LOCUS_17950 gene rsmI 15601 16461 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003120901.1 protein_id gnl|my_center|LOCUS_17950 16516 17556 gene locus_tag LOCUS_17960 16516 17556 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973390.1 protein_id gnl|my_center|LOCUS_17960 17611 17898 gene locus_tag LOCUS_17970 17611 17898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 17943 20591 gene locus_tag LOCUS_17980 17943 20591 CDS product cation-transporting P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112435.1 protein_id gnl|my_center|LOCUS_17980 21365 20652 gene locus_tag LOCUS_17990 21365 20652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 21506 21691 gene locus_tag LOCUS_18000 21506 21691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 22722 22594 gene locus_tag LOCUS_18010 22722 22594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 23217 22858 gene locus_tag LOCUS_18020 23217 22858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 24080 23313 gene locus_tag LOCUS_18030 24080 23313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 24220 24408 gene locus_tag LOCUS_18040 24220 24408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 25392 25847 gene locus_tag LOCUS_18050 gene mraZ 25392 25847 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103101.1 protein_id gnl|my_center|LOCUS_18050 25853 26794 gene locus_tag LOCUS_18060 gene rsmH 25853 26794 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769446.1 protein_id gnl|my_center|LOCUS_18060 26795 27067 gene locus_tag LOCUS_18070 gene ftsL 26795 27067 CDS product cell division protein FtsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029684613.1 protein_id gnl|my_center|LOCUS_18070 27171 28904 gene locus_tag LOCUS_18080 gene ftsI 27171 28904 CDS product peptidoglycan D,D-transpeptidase FtsI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094139.1 protein_id gnl|my_center|LOCUS_18080 >Feature sequence041 <1 554 gene locus_tag LOCUS_18090 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000198892.1:acetoin:2,6-dichlorophenolindophenol oxidoreductase subunit beta 585 1961 gene locus_tag LOCUS_18100 585 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18100 3435 2188 gene locus_tag LOCUS_18110 3435 2188 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_18110 4118 3435 gene locus_tag LOCUS_18120 4118 3435 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404917.1 protein_id gnl|my_center|LOCUS_18120 6408 4150 gene locus_tag LOCUS_18130 6408 4150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18130 6734 7798 gene locus_tag LOCUS_18140 6734 7798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 7854 8036 gene locus_tag LOCUS_18150 7854 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18150 9566 8169 gene locus_tag LOCUS_18160 9566 8169 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170873898.1 protein_id gnl|my_center|LOCUS_18160 10284 9577 gene locus_tag LOCUS_18170 10284 9577 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002808458.1 protein_id gnl|my_center|LOCUS_18170 10928 10617 gene locus_tag LOCUS_18180 gene nirM 10928 10617 CDS product cytochrome C-551 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084872.1 protein_id gnl|my_center|LOCUS_18180 12250 11045 gene locus_tag LOCUS_18190 12250 11045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 12677 12264 gene locus_tag LOCUS_18200 12677 12264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18200 13930 12695 gene locus_tag LOCUS_18210 gene fabB 13930 12695 CDS product beta-ketoacyl-ACP synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114255.1 protein_id gnl|my_center|LOCUS_18210 14489 13974 gene locus_tag LOCUS_18220 gene fabA 14489 13974 CDS product 3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316569.1 protein_id gnl|my_center|LOCUS_18220 15226 14678 gene locus_tag LOCUS_18230 15226 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 17404 15242 gene locus_tag LOCUS_18240 gene relA 17404 15242 CDS product GTP diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086042.1 protein_id gnl|my_center|LOCUS_18240 18104 17457 gene locus_tag LOCUS_18250 18104 17457 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942636.1 protein_id gnl|my_center|LOCUS_18250 18342 19052 gene locus_tag LOCUS_18260 18342 19052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 20075 19086 gene locus_tag LOCUS_18270 20075 19086 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004406328.1 protein_id gnl|my_center|LOCUS_18270 21158 20136 gene locus_tag LOCUS_18280 gene wspF 21158 20136 CDS product Wsp signal transduction system protein-glutamate methylesterase WspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092534.1 protein_id gnl|my_center|LOCUS_18280 23401 21155 gene locus_tag LOCUS_18290 23401 21155 CDS product hybrid sensor histidine kinase/response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525365.1 protein_id gnl|my_center|LOCUS_18290 23724 23398 gene locus_tag LOCUS_18300 23724 23398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18300 25478 24090 gene locus_tag LOCUS_18310 25478 24090 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113845.1 protein_id gnl|my_center|LOCUS_18310 25942 25484 gene locus_tag LOCUS_18320 25942 25484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 27942 25957 gene locus_tag LOCUS_18330 27942 25957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 <30110 28307 gene locus_tag LOCUS_18340 <30110 28307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815824.1:dimethylsulfoxide reductase subunit B >Feature sequence042 177 899 gene locus_tag LOCUS_18350 gene lpxH 177 899 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000212291.1 protein_id gnl|my_center|LOCUS_18350 1680 904 gene locus_tag LOCUS_18360 1680 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18360 2567 1737 gene locus_tag LOCUS_18370 2567 1737 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043921634.1 protein_id gnl|my_center|LOCUS_18370 3776 2676 gene locus_tag LOCUS_18380 gene amrS 3776 2676 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444592.1 protein_id gnl|my_center|LOCUS_18380 3839 4630 gene locus_tag LOCUS_18390 gene amrB 3839 4630 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_18390 4617 5207 gene locus_tag LOCUS_18400 4617 5207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18400 5655 5852 gene locus_tag LOCUS_18410 5655 5852 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405863.1 protein_id gnl|my_center|LOCUS_18410 5849 6211 gene locus_tag LOCUS_18420 5849 6211 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405865.1 protein_id gnl|my_center|LOCUS_18420 6761 6291 gene locus_tag LOCUS_18430 6761 6291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18430 6858 7187 gene locus_tag LOCUS_18440 6858 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18440 7783 7190 gene locus_tag LOCUS_18450 7783 7190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 13103 7821 gene locus_tag LOCUS_18460 13103 7821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18460 13981 14217 gene locus_tag LOCUS_18470 13981 14217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18470 16207 15239 gene locus_tag LOCUS_18480 16207 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18480 16349 17878 gene locus_tag LOCUS_18490 16349 17878 CDS product flagellar hook-length control protein FliK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895570.1 protein_id gnl|my_center|LOCUS_18490 17875 18162 gene locus_tag LOCUS_18500 17875 18162 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083121.1 protein_id gnl|my_center|LOCUS_18500 18774 18382 gene locus_tag LOCUS_18510 18774 18382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 19506 19021 gene locus_tag LOCUS_18520 19506 19021 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005298836.1 protein_id gnl|my_center|LOCUS_18520 20342 19632 gene locus_tag LOCUS_18530 20342 19632 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244357.1 protein_id gnl|my_center|LOCUS_18530 21166 20360 gene locus_tag LOCUS_18540 21166 20360 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705294.1 protein_id gnl|my_center|LOCUS_18540 22085 21186 gene locus_tag LOCUS_18550 gene motD 22085 21186 CDS product flagellar motor protein MotD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103791.1 protein_id gnl|my_center|LOCUS_18550 22859 22119 gene locus_tag LOCUS_18560 22859 22119 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436124.1 protein_id gnl|my_center|LOCUS_18560 23950 22862 gene locus_tag LOCUS_18570 23950 22862 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895569.1 protein_id gnl|my_center|LOCUS_18570 26199 24007 gene locus_tag LOCUS_18580 26199 24007 CDS product chemotaxis protein CheA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073093.1 protein_id gnl|my_center|LOCUS_18580 27009 26239 gene locus_tag LOCUS_18590 27009 26239 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705289.1 protein_id gnl|my_center|LOCUS_18590 27404 27012 gene locus_tag LOCUS_18600 gene cheY 27404 27012 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211091957.1 protein_id gnl|my_center|LOCUS_18600 28213 27458 gene locus_tag LOCUS_18610 gene fliA 28213 27458 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083070.1 protein_id gnl|my_center|LOCUS_18610 29094 28210 gene locus_tag LOCUS_18620 gene fleN 29094 28210 CDS product flagellar synthesis regulator FleN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083064.1 protein_id gnl|my_center|LOCUS_18620 <29755 29081 gene locus_tag LOCUS_18630 <29755 29081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705286.1:flagellar biosynthesis protein FlhF >Feature sequence043 612 274 gene locus_tag LOCUS_18640 612 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18640 897 625 gene locus_tag LOCUS_18650 897 625 CDS product YheU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012532745.1 protein_id gnl|my_center|LOCUS_18650 1095 2087 gene locus_tag LOCUS_18660 1095 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18660 2416 2144 gene locus_tag LOCUS_18670 2416 2144 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080314.1 protein_id gnl|my_center|LOCUS_18670 2586 2900 gene locus_tag LOCUS_18680 2586 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 3126 3407 gene locus_tag LOCUS_18690 3126 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18690 3504 3428 gene locus_tag LOCUS_t00200 3504 3428 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3608 3533 gene locus_tag LOCUS_t00210 3608 3533 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 3950 3681 gene locus_tag LOCUS_18700 3950 3681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 4558 3947 gene locus_tag LOCUS_18710 4558 3947 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091628.1 protein_id gnl|my_center|LOCUS_18710 4876 5838 gene locus_tag LOCUS_18720 gene arsS 4876 5838 CDS product arsenosugar biosynthesis radical SAM protein ArsS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140889.1 protein_id gnl|my_center|LOCUS_18720 5849 6523 gene locus_tag LOCUS_18730 5849 6523 CDS product TIGR04283 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460533.1 protein_id gnl|my_center|LOCUS_18730 6818 7204 gene locus_tag LOCUS_18740 6818 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 7962 7207 gene locus_tag LOCUS_18750 7962 7207 CDS product flagellar brake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404320.1 protein_id gnl|my_center|LOCUS_18750 8512 8000 gene locus_tag LOCUS_18760 8512 8000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 8948 8610 gene locus_tag LOCUS_18770 8948 8610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 9728 9039 gene locus_tag LOCUS_18780 gene flgA 9728 9039 CDS product flagellar basal body P-ring formation chaperone FlgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946643.1 protein_id gnl|my_center|LOCUS_18780 10156 11088 gene locus_tag LOCUS_18790 10156 11088 CDS product chemotaxis protein CheV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420408.1 protein_id gnl|my_center|LOCUS_18790 11176 12003 gene locus_tag LOCUS_18800 gene cheR 11176 12003 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003382687.1 protein_id gnl|my_center|LOCUS_18800 12206 12625 gene locus_tag LOCUS_18810 gene flgB 12206 12625 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082144.1 protein_id gnl|my_center|LOCUS_18810 12707 13081 gene locus_tag LOCUS_18820 gene flgC 12707 13081 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706643.1 protein_id gnl|my_center|LOCUS_18820 13101 13784 gene locus_tag LOCUS_18830 gene flgD 13101 13784 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082153.1 protein_id gnl|my_center|LOCUS_18830 13860 15080 gene locus_tag LOCUS_18840 gene flgE 13860 15080 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037113.1 protein_id gnl|my_center|LOCUS_18840 15115 15858 gene locus_tag LOCUS_18850 15115 15858 CDS product flagellar basal body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003316785.1 protein_id gnl|my_center|LOCUS_18850 15907 16692 gene locus_tag LOCUS_18860 gene flgG 15907 16692 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005994332.1 protein_id gnl|my_center|LOCUS_18860 16724 17407 gene locus_tag LOCUS_18870 gene flgH 16724 17407 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082166.1 protein_id gnl|my_center|LOCUS_18870 17482 18576 gene locus_tag LOCUS_18880 17482 18576 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082169.1 protein_id gnl|my_center|LOCUS_18880 18583 19494 gene locus_tag LOCUS_18890 gene flgJ 18583 19494 CDS product flagellar assembly peptidoglycan hydrolase FlgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454015.1 protein_id gnl|my_center|LOCUS_18890 19575 21245 gene locus_tag LOCUS_18900 gene flgK 19575 21245 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704937.1 protein_id gnl|my_center|LOCUS_18900 21473 22393 gene locus_tag LOCUS_18910 gene flgL 21473 22393 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010981404.1 protein_id gnl|my_center|LOCUS_18910 23320 22442 gene locus_tag LOCUS_18920 23320 22442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18920 23533 24177 gene locus_tag LOCUS_18930 23533 24177 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_18930 24296 26170 gene locus_tag LOCUS_18940 gene uvrC 24296 26170 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113354.1 protein_id gnl|my_center|LOCUS_18940 26319 26894 gene locus_tag LOCUS_18950 gene pgsA 26319 26894 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090349.1 protein_id gnl|my_center|LOCUS_18950 26967 27042 gene locus_tag LOCUS_t00220 26967 27042 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 27177 27250 gene locus_tag LOCUS_t00230 27177 27250 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 27319 27405 gene locus_tag LOCUS_t00240 27319 27405 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 768 1694 gene locus_tag LOCUS_18960 gene ribF 768 1694 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477935.1 protein_id gnl|my_center|LOCUS_18960 2113 1679 gene locus_tag LOCUS_18970 2113 1679 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072739.1 protein_id gnl|my_center|LOCUS_18970 2261 5104 gene locus_tag LOCUS_18980 gene ileS 2261 5104 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704643.1 protein_id gnl|my_center|LOCUS_18980 5407 5889 gene locus_tag LOCUS_18990 gene lspA 5407 5889 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009387467.1 protein_id gnl|my_center|LOCUS_18990 5891 6355 gene locus_tag LOCUS_19000 gene fkpB 5891 6355 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261245.1 protein_id gnl|my_center|LOCUS_19000 6575 7528 gene locus_tag LOCUS_19010 gene ispH 6575 7528 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003318785.1 protein_id gnl|my_center|LOCUS_19010 10465 7595 gene locus_tag LOCUS_19020 10465 7595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 10923 10519 gene locus_tag LOCUS_19030 10923 10519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 11808 11029 gene locus_tag LOCUS_19040 11808 11029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 12392 11808 gene locus_tag LOCUS_19050 12392 11808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 12967 12383 gene locus_tag LOCUS_19060 12967 12383 CDS product GspH/FimT family pseudopilin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073355.1 protein_id gnl|my_center|LOCUS_19060 13594 13094 gene locus_tag LOCUS_19070 13594 13094 CDS product type IV pilin protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266587.1 protein_id gnl|my_center|LOCUS_19070 14020 13658 gene locus_tag LOCUS_19080 14020 13658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 17806 14045 gene locus_tag LOCUS_19090 17806 14045 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704651.1 protein_id gnl|my_center|LOCUS_19090 18483 17866 gene locus_tag LOCUS_19100 18483 17866 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 protein_id gnl|my_center|LOCUS_19100 19547 18483 gene locus_tag LOCUS_19110 19547 18483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 20068 19544 gene locus_tag LOCUS_19120 gene pilV 20068 19544 CDS product type IV pilus modification protein PilV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946368.1 protein_id gnl|my_center|LOCUS_19120 20669 20097 gene locus_tag LOCUS_19130 gene tppE 20669 20097 CDS product type IVa pilus pseudopilin TppE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704647.1 protein_id gnl|my_center|LOCUS_19130 21681 20992 gene locus_tag LOCUS_19140 21681 20992 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480817.1 protein_id gnl|my_center|LOCUS_19140 22337 21678 gene locus_tag LOCUS_19150 gene rsxG 22337 21678 CDS product electron transport complex subunit RsxG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092047.1 protein_id gnl|my_center|LOCUS_19150 23395 22337 gene locus_tag LOCUS_19160 gene rsxD 23395 22337 CDS product electron transport complex subunit RsxD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061001934.1 protein_id gnl|my_center|LOCUS_19160 25035 23392 gene locus_tag LOCUS_19170 25035 23392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 25601 25035 gene locus_tag LOCUS_19180 gene rsxB 25601 25035 CDS product electron transport complex subunit RsxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480813.1 protein_id gnl|my_center|LOCUS_19180 26205 25624 gene locus_tag LOCUS_19190 gene rsxA 26205 25624 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005380762.1 protein_id gnl|my_center|LOCUS_19190 <27914 26578 gene locus_tag LOCUS_19200 <27914 26578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211829411.1:methionine--tRNA ligase >Feature sequence045 <1 1175 gene locus_tag LOCUS_19210 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263049.1:DEAD/DEAH box helicase 1737 1189 gene locus_tag LOCUS_19220 1737 1189 CDS product DUF4188 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141249.1 protein_id gnl|my_center|LOCUS_19220 2325 1762 gene locus_tag LOCUS_19230 2325 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 3230 2904 gene locus_tag LOCUS_19240 3230 2904 CDS product DUF3175 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243572.1 protein_id gnl|my_center|LOCUS_19240 4151 3240 gene locus_tag LOCUS_19250 4151 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19250 4762 4208 gene locus_tag LOCUS_19260 gene ampD 4762 4208 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707565.1 protein_id gnl|my_center|LOCUS_19260 5123 5347 gene locus_tag LOCUS_19270 5123 5347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19270 5347 6255 gene locus_tag LOCUS_19280 5347 6255 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_19280 6586 6302 gene locus_tag LOCUS_19290 6586 6302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 8169 6583 gene locus_tag LOCUS_19300 8169 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 8856 9344 gene locus_tag LOCUS_19310 8856 9344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 9345 10814 gene locus_tag LOCUS_19320 9345 10814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 10826 13669 gene locus_tag LOCUS_19330 10826 13669 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_104232144.1 protein_id gnl|my_center|LOCUS_19330 13688 14311 gene locus_tag LOCUS_19340 13688 14311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19340 14308 14598 gene locus_tag LOCUS_19350 14308 14598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 14876 15532 gene locus_tag LOCUS_19360 14876 15532 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537045.1 protein_id gnl|my_center|LOCUS_19360 15548 16042 gene locus_tag LOCUS_19370 15548 16042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19370 16039 16545 gene locus_tag LOCUS_19380 16039 16545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 16549 17511 gene locus_tag LOCUS_19390 16549 17511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 18216 17524 gene locus_tag LOCUS_19400 18216 17524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19400 18513 18265 gene locus_tag LOCUS_19410 18513 18265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19410 19244 18687 gene locus_tag LOCUS_19420 19244 18687 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201622.1 protein_id gnl|my_center|LOCUS_19420 19415 20230 gene locus_tag LOCUS_19430 19415 20230 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192829.1 protein_id gnl|my_center|LOCUS_19430 21086 20316 gene locus_tag LOCUS_19440 21086 20316 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_195765897.1 protein_id gnl|my_center|LOCUS_19440 23051 21096 gene locus_tag LOCUS_19450 23051 21096 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087534.1 protein_id gnl|my_center|LOCUS_19450 23305 23496 gene locus_tag LOCUS_19460 23305 23496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19460 23569 24294 gene locus_tag LOCUS_19470 23569 24294 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390884.1 protein_id gnl|my_center|LOCUS_19470 24481 25242 gene locus_tag LOCUS_19480 24481 25242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887787.1 protein_id gnl|my_center|LOCUS_19480 26082 25303 gene locus_tag LOCUS_19490 gene fhuC 26082 25303 CDS product Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704433.1 protein_id gnl|my_center|LOCUS_19490 <26723 26079 gene locus_tag LOCUS_19500 <26723 26079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192857.1:iron ABC transporter permease >Feature sequence046 768 4 gene locus_tag LOCUS_19510 768 4 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_19510 1094 1915 gene locus_tag LOCUS_19520 1094 1915 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_19520 2030 3337 gene locus_tag LOCUS_19530 2030 3337 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462557.1 protein_id gnl|my_center|LOCUS_19530 3754 3527 gene locus_tag LOCUS_19540 gene cspD 3754 3527 CDS product cold shock domain-containing protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072576.1 protein_id gnl|my_center|LOCUS_19540 4497 4802 gene locus_tag LOCUS_19550 4497 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 5303 8122 gene locus_tag LOCUS_19560 gene ppc 5303 8122 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207161458.1 protein_id gnl|my_center|LOCUS_19560 8272 9453 gene locus_tag LOCUS_19570 8272 9453 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947236.1 protein_id gnl|my_center|LOCUS_19570 10766 9450 gene locus_tag LOCUS_19580 10766 9450 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_19580 12074 11292 gene locus_tag LOCUS_19590 12074 11292 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947962.1 protein_id gnl|my_center|LOCUS_19590 12943 12062 gene locus_tag LOCUS_19600 12943 12062 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444160.1 protein_id gnl|my_center|LOCUS_19600 13283 13023 gene locus_tag LOCUS_19610 13283 13023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947964.1 protein_id gnl|my_center|LOCUS_19610 14553 13507 gene locus_tag LOCUS_19620 gene nagZ 14553 13507 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529291.1 protein_id gnl|my_center|LOCUS_19620 15604 14750 gene locus_tag LOCUS_19630 15604 14750 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583498.1 protein_id gnl|my_center|LOCUS_19630 16701 15775 gene locus_tag LOCUS_19640 16701 15775 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228608.1 protein_id gnl|my_center|LOCUS_19640 16844 17080 gene locus_tag LOCUS_19650 16844 17080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 17077 17274 gene locus_tag LOCUS_19660 17077 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 17397 17957 gene locus_tag LOCUS_19670 17397 17957 CDS product heme-binding beta-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084100.1 protein_id gnl|my_center|LOCUS_19670 17970 18503 gene locus_tag LOCUS_19680 17970 18503 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000251279.1 protein_id gnl|my_center|LOCUS_19680 19743 18511 gene locus_tag LOCUS_19690 19743 18511 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945874.1 protein_id gnl|my_center|LOCUS_19690 19700 19891 gene locus_tag LOCUS_19700 19700 19891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 22064 20154 gene locus_tag LOCUS_19710 22064 20154 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113976.1 protein_id gnl|my_center|LOCUS_19710 22928 22104 gene locus_tag LOCUS_19720 22928 22104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19720 24317 22941 gene locus_tag LOCUS_19730 24317 22941 CDS product glycoside hydrolase 100 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124524.1 protein_id gnl|my_center|LOCUS_19730 25096 25560 gene locus_tag LOCUS_19740 25096 25560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence047 102 470 gene locus_tag LOCUS_19750 102 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19750 486 905 gene locus_tag LOCUS_19760 486 905 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_19760 988 1230 gene locus_tag LOCUS_19770 988 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1294 3117 gene locus_tag LOCUS_19780 1294 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19780 4016 3150 gene locus_tag LOCUS_19790 4016 3150 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704980.1 protein_id gnl|my_center|LOCUS_19790 5153 4026 gene locus_tag LOCUS_19800 5153 4026 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162517810.1 protein_id gnl|my_center|LOCUS_19800 5325 5882 gene locus_tag LOCUS_19810 5325 5882 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_19810 5955 6710 gene locus_tag LOCUS_19820 5955 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 6751 7200 gene locus_tag LOCUS_19830 6751 7200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 7540 8805 gene locus_tag LOCUS_19840 7540 8805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 8896 9921 gene locus_tag LOCUS_19850 gene amgK 8896 9921 CDS product N-acetylmuramate/N-acetylglucosamine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113208.1 protein_id gnl|my_center|LOCUS_19850 9967 10638 gene locus_tag LOCUS_19860 9967 10638 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237801.1 protein_id gnl|my_center|LOCUS_19860 10861 11505 gene locus_tag LOCUS_19870 gene uvrY 10861 11505 CDS product UvrY/SirA/GacA family response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553344.1 protein_id gnl|my_center|LOCUS_19870 11710 12198 gene locus_tag LOCUS_19880 11710 12198 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945773.1 protein_id gnl|my_center|LOCUS_19880 12223 12777 gene locus_tag LOCUS_19890 12223 12777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19890 12789 14108 gene locus_tag LOCUS_19900 12789 14108 CDS product TolC family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000533850.1 protein_id gnl|my_center|LOCUS_19900 14105 14896 gene locus_tag LOCUS_19910 14105 14896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19910 14898 15164 gene locus_tag LOCUS_19920 14898 15164 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947603.1 protein_id gnl|my_center|LOCUS_19920 15178 15543 gene locus_tag LOCUS_19930 15178 15543 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023525.1 protein_id gnl|my_center|LOCUS_19930 15581 16000 gene locus_tag LOCUS_19940 15581 16000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 16110 16322 gene locus_tag LOCUS_19950 16110 16322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19950 17186 16332 gene locus_tag LOCUS_19960 17186 16332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19960 17898 17284 gene locus_tag LOCUS_19970 17898 17284 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688215.1 protein_id gnl|my_center|LOCUS_19970 19649 17904 gene locus_tag LOCUS_19980 19649 17904 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707374.1 protein_id gnl|my_center|LOCUS_19980 19855 22563 gene locus_tag LOCUS_19990 19855 22563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19990 22625 22915 gene locus_tag LOCUS_20000 22625 22915 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040056.1 protein_id gnl|my_center|LOCUS_20000 22936 24159 gene locus_tag LOCUS_20010 22936 24159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20010 >Feature sequence048 608 1579 gene locus_tag LOCUS_20020 gene hpnD 608 1579 CDS product presqualene diphosphate synthase HpnD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818612.1 protein_id gnl|my_center|LOCUS_20020 1579 2922 gene locus_tag LOCUS_20030 gene hpnE 1579 2922 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930255.1 protein_id gnl|my_center|LOCUS_20030 2937 3698 gene locus_tag LOCUS_20040 2937 3698 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113436.1 protein_id gnl|my_center|LOCUS_20040 3945 4877 gene locus_tag LOCUS_20050 3945 4877 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105929.1 protein_id gnl|my_center|LOCUS_20050 6343 4943 gene locus_tag LOCUS_20060 6343 4943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 7240 6581 gene locus_tag LOCUS_20070 7240 6581 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360272.1 protein_id gnl|my_center|LOCUS_20070 8170 7244 gene locus_tag LOCUS_20080 gene rluB 8170 7244 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072841.1 protein_id gnl|my_center|LOCUS_20080 9096 8167 gene locus_tag LOCUS_20090 9096 8167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 9941 9129 gene locus_tag LOCUS_20100 9941 9129 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004396554.1 protein_id gnl|my_center|LOCUS_20100 11337 10120 gene locus_tag LOCUS_20110 11337 10120 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_20110 12168 11512 gene locus_tag LOCUS_20120 12168 11512 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958411.1 protein_id gnl|my_center|LOCUS_20120 12366 13013 gene locus_tag LOCUS_20130 12366 13013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20130 14483 13380 gene locus_tag LOCUS_20140 14483 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20140 17162 14847 gene locus_tag LOCUS_20150 17162 14847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 18059 17439 gene locus_tag LOCUS_20160 18059 17439 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005465083.1 protein_id gnl|my_center|LOCUS_20160 18916 18056 gene locus_tag LOCUS_20170 18916 18056 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816844.1 protein_id gnl|my_center|LOCUS_20170 19010 19447 gene locus_tag LOCUS_20180 19010 19447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_20180 19447 19602 gene locus_tag LOCUS_20190 19447 19602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20190 19602 19901 gene locus_tag LOCUS_20200 19602 19901 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404138.1 protein_id gnl|my_center|LOCUS_20200 19931 20206 gene locus_tag LOCUS_20210 19931 20206 CDS product BolA family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037355.1 protein_id gnl|my_center|LOCUS_20210 20229 21032 gene locus_tag LOCUS_20220 20229 21032 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003821314.1 protein_id gnl|my_center|LOCUS_20220 21801 21319 gene locus_tag LOCUS_20230 21801 21319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 21980 21798 gene locus_tag LOCUS_20240 21980 21798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 24066 22027 gene locus_tag LOCUS_20250 gene ligA 24066 22027 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013878165.1 protein_id gnl|my_center|LOCUS_20250 24905 24366 gene locus_tag LOCUS_20260 gene def 24905 24366 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814412.1 protein_id gnl|my_center|LOCUS_20260 >Feature sequence049 203 1315 gene locus_tag LOCUS_20270 203 1315 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247213.1 protein_id gnl|my_center|LOCUS_20270 1321 2064 gene locus_tag LOCUS_20280 1321 2064 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208188.1 protein_id gnl|my_center|LOCUS_20280 2560 2141 gene locus_tag LOCUS_20290 2560 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 3149 2625 gene locus_tag LOCUS_20300 3149 2625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20300 5493 3475 gene locus_tag LOCUS_20310 gene rep 5493 3475 CDS product DNA helicase Rep inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000773964.1 protein_id gnl|my_center|LOCUS_20310 6859 5591 gene locus_tag LOCUS_20320 6859 5591 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724487.1 protein_id gnl|my_center|LOCUS_20320 7050 6922 gene locus_tag LOCUS_20330 gene cydX 7050 6922 CDS product cytochrome bd-I oxidase subunit CydX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073165.1 protein_id gnl|my_center|LOCUS_20330 8197 7055 gene locus_tag LOCUS_20340 gene cydB 8197 7055 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195344.1 protein_id gnl|my_center|LOCUS_20340 9780 8197 gene locus_tag LOCUS_20350 gene cydA 9780 8197 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884372.1 protein_id gnl|my_center|LOCUS_20350 9953 9774 gene locus_tag LOCUS_20360 9953 9774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 10669 10839 gene locus_tag LOCUS_20370 10669 10839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 11056 10820 gene locus_tag LOCUS_20380 11056 10820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20380 11281 11099 gene locus_tag LOCUS_20390 11281 11099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 12231 13037 gene locus_tag LOCUS_20400 12231 13037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20400 14300 13134 gene locus_tag LOCUS_20410 14300 13134 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814929.1 protein_id gnl|my_center|LOCUS_20410 17447 14556 gene locus_tag LOCUS_20420 17447 14556 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082358.1 protein_id gnl|my_center|LOCUS_20420 18985 18080 gene locus_tag LOCUS_20430 gene metR 18985 18080 CDS product transcriptional regulator MetR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092181.1 protein_id gnl|my_center|LOCUS_20430 19207 19016 gene locus_tag LOCUS_20440 19207 19016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 19173 21518 gene locus_tag LOCUS_20450 gene metE 19173 21518 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_20450 22236 21589 gene locus_tag LOCUS_20460 22236 21589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20460 22658 23482 gene locus_tag LOCUS_20470 22658 23482 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289730.1 protein_id gnl|my_center|LOCUS_20470 >Feature sequence050 1665 16 gene locus_tag LOCUS_20480 gene pstA 1665 16 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114377.1 protein_id gnl|my_center|LOCUS_20480 3883 1676 gene locus_tag LOCUS_20490 3883 1676 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201418856.1 protein_id gnl|my_center|LOCUS_20490 5146 4163 gene locus_tag LOCUS_20500 gene pstS 5146 4163 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_20500 6613 5300 gene locus_tag LOCUS_20510 gene phoR 6613 5300 CDS product phosphate regulon sensor histidine kinase PhoR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121316.1 protein_id gnl|my_center|LOCUS_20510 7337 6642 gene locus_tag LOCUS_20520 gene phoB 7337 6642 CDS product phosphate regulon transcriptional regulator PhoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096653.1 protein_id gnl|my_center|LOCUS_20520 7497 8357 gene locus_tag LOCUS_20530 gene aroE 7497 8357 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704274.1 protein_id gnl|my_center|LOCUS_20530 8777 8379 gene locus_tag LOCUS_20540 8777 8379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 10259 9108 gene locus_tag LOCUS_20550 10259 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 10843 10307 gene locus_tag LOCUS_20560 10843 10307 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083618.1 protein_id gnl|my_center|LOCUS_20560 12325 10976 gene locus_tag LOCUS_20570 gene gorA 12325 10976 CDS product glutathione-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099198.1 protein_id gnl|my_center|LOCUS_20570 13553 12513 gene locus_tag LOCUS_20580 13553 12513 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113256.1 protein_id gnl|my_center|LOCUS_20580 13862 15889 gene locus_tag LOCUS_20590 gene prlC 13862 15889 CDS product oligopeptidase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478727.1 protein_id gnl|my_center|LOCUS_20590 16039 16854 gene locus_tag LOCUS_20600 16039 16854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20600 16926 17705 gene locus_tag LOCUS_20610 gene xth 16926 17705 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025862491.1 protein_id gnl|my_center|LOCUS_20610 17761 19512 gene locus_tag LOCUS_20620 17761 19512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 19699 19490 gene locus_tag LOCUS_20630 19699 19490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20630 19905 21386 gene locus_tag LOCUS_20640 gene ubiD 19905 21386 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096332.1 protein_id gnl|my_center|LOCUS_20640 22309 21392 gene locus_tag LOCUS_20650 22309 21392 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968832.1 protein_id gnl|my_center|LOCUS_20650 >Feature sequence051 3102 766 gene locus_tag LOCUS_20660 3102 766 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480716.1 protein_id gnl|my_center|LOCUS_20660 3781 3173 gene locus_tag LOCUS_20670 3781 3173 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974635.1 protein_id gnl|my_center|LOCUS_20670 3984 4907 gene locus_tag LOCUS_20680 3984 4907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 4907 6790 gene locus_tag LOCUS_20690 4907 6790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 7041 7811 gene locus_tag LOCUS_20700 7041 7811 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120080.1 protein_id gnl|my_center|LOCUS_20700 10426 7838 gene locus_tag LOCUS_20710 10426 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 10671 13562 gene locus_tag LOCUS_20720 gene sucA 10671 13562 CDS product 2-oxoglutarate dehydrogenase E1 component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210726.1 protein_id gnl|my_center|LOCUS_20720 13658 14878 gene locus_tag LOCUS_20730 gene odhB 13658 14878 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192735.1 protein_id gnl|my_center|LOCUS_20730 15246 16658 gene locus_tag LOCUS_20740 gene lpdA 15246 16658 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087422.1 protein_id gnl|my_center|LOCUS_20740 18320 16800 gene locus_tag LOCUS_20750 18320 16800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20750 19296 18427 gene locus_tag LOCUS_20760 19296 18427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20760 21017 19326 gene locus_tag LOCUS_20770 21017 19326 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082593.1 protein_id gnl|my_center|LOCUS_20770 21974 21096 gene locus_tag LOCUS_20780 21974 21096 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529052.1 protein_id gnl|my_center|LOCUS_20780 >Feature sequence052 81 962 gene locus_tag LOCUS_20790 81 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20790 2711 1317 gene locus_tag LOCUS_20800 gene der 2711 1317 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208345.1 protein_id gnl|my_center|LOCUS_20800 3963 2737 gene locus_tag LOCUS_20810 gene bamB 3963 2737 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092789.1 protein_id gnl|my_center|LOCUS_20810 4646 3966 gene locus_tag LOCUS_20820 4646 3966 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261367.1 protein_id gnl|my_center|LOCUS_20820 6120 4843 gene locus_tag LOCUS_20830 gene hisS 6120 4843 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705646.1 protein_id gnl|my_center|LOCUS_20830 7281 6145 gene locus_tag LOCUS_20840 gene ispG 7281 6145 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092800.1 protein_id gnl|my_center|LOCUS_20840 8444 7500 gene locus_tag LOCUS_20850 8444 7500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20850 9267 8521 gene locus_tag LOCUS_20860 gene pilF 9267 8521 CDS product type 4a pilus biogenesis protein PilF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113801.1 protein_id gnl|my_center|LOCUS_20860 10439 9342 gene locus_tag LOCUS_20870 10439 9342 CDS product bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444483.1 protein_id gnl|my_center|LOCUS_20870 10901 10470 gene locus_tag LOCUS_20880 gene ndk 10901 10470 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172605.1 protein_id gnl|my_center|LOCUS_20880 11088 12353 gene locus_tag LOCUS_20890 11088 12353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20890 12670 12470 gene locus_tag LOCUS_20900 gene iscX 12670 12470 CDS product Fe-S cluster assembly protein IscX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092814.1 protein_id gnl|my_center|LOCUS_20900 13031 12693 gene locus_tag LOCUS_20910 gene fdx 13031 12693 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_20910 15173 13302 gene locus_tag LOCUS_20920 gene hscA 15173 13302 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100622.1 protein_id gnl|my_center|LOCUS_20920 15971 15429 gene locus_tag LOCUS_20930 gene hscB 15971 15429 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072279.1 protein_id gnl|my_center|LOCUS_20930 16321 15998 gene locus_tag LOCUS_20940 gene iscA 16321 15998 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693788.1 protein_id gnl|my_center|LOCUS_20940 16768 16355 gene locus_tag LOCUS_20950 gene iscU 16768 16355 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213175.1 protein_id gnl|my_center|LOCUS_20950 18055 16829 gene locus_tag LOCUS_20960 gene iscS 18055 16829 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295373.1 protein_id gnl|my_center|LOCUS_20960 19258 18095 gene locus_tag LOCUS_20970 19258 18095 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943206.1 protein_id gnl|my_center|LOCUS_20970 19783 19280 gene locus_tag LOCUS_20980 gene iscR 19783 19280 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380601.1 protein_id gnl|my_center|LOCUS_20980 20975 20160 gene locus_tag LOCUS_20990 gene cysE 20975 20160 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072274.1 protein_id gnl|my_center|LOCUS_20990 21766 20993 gene locus_tag LOCUS_21000 gene trmJ 21766 20993 CDS product tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771034.1 protein_id gnl|my_center|LOCUS_21000 22077 21895 gene locus_tag LOCUS_21010 22077 21895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21010 >Feature sequence053 514 747 gene locus_tag LOCUS_21020 514 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21020 3880 1448 gene locus_tag LOCUS_21030 3880 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21030 4098 3883 gene locus_tag LOCUS_21040 4098 3883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21040 4449 7760 gene locus_tag LOCUS_21050 4449 7760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 10386 7843 gene locus_tag LOCUS_21060 10386 7843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21060 11438 10449 gene locus_tag LOCUS_21070 11438 10449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 12821 11778 gene locus_tag LOCUS_21080 12821 11778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 13015 12863 gene locus_tag LOCUS_21090 13015 12863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21090 14998 13151 gene locus_tag LOCUS_21100 14998 13151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 15231 15049 gene locus_tag LOCUS_21110 15231 15049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21110 18546 15316 gene locus_tag LOCUS_21120 18546 15316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence054 309 713 gene locus_tag LOCUS_21130 309 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 738 2000 gene locus_tag LOCUS_21140 738 2000 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986806.1 protein_id gnl|my_center|LOCUS_21140 1997 3160 gene locus_tag LOCUS_21150 1997 3160 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038277.1 protein_id gnl|my_center|LOCUS_21150 3157 4344 gene locus_tag LOCUS_21160 3157 4344 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_21160 4349 5095 gene locus_tag LOCUS_21170 4349 5095 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_21170 5197 5436 gene locus_tag LOCUS_21180 5197 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21180 5860 6735 gene locus_tag LOCUS_21190 5860 6735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21190 7279 6929 gene locus_tag LOCUS_21200 gene tusE 7279 6929 CDS product sulfurtransferase TusE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019079836.1 protein_id gnl|my_center|LOCUS_21200 7462 8754 gene locus_tag LOCUS_21210 7462 8754 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_21210 8921 9331 gene locus_tag LOCUS_21220 8921 9331 CDS product mercuric transport protein MerT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001294660.1 protein_id gnl|my_center|LOCUS_21220 9408 9719 gene locus_tag LOCUS_21230 9408 9719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 9751 11388 gene locus_tag LOCUS_21240 gene merA 9751 11388 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105636.1 protein_id gnl|my_center|LOCUS_21240 11373 11909 gene locus_tag LOCUS_21250 11373 11909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21250 11906 12415 gene locus_tag LOCUS_21260 11906 12415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21260 12461 13165 gene locus_tag LOCUS_21270 12461 13165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21270 13354 13689 gene locus_tag LOCUS_21280 13354 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947964.1 protein_id gnl|my_center|LOCUS_21280 13692 14519 gene locus_tag LOCUS_21290 13692 14519 CDS product DUF692 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265874.1 protein_id gnl|my_center|LOCUS_21290 14516 15307 gene locus_tag LOCUS_21300 14516 15307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21300 15315 15710 gene locus_tag LOCUS_21310 gene merR 15315 15710 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_21310 16926 16081 gene locus_tag LOCUS_21320 16926 16081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21320 18187 16919 gene locus_tag LOCUS_21330 18187 16919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21330 21014 18396 gene locus_tag LOCUS_21340 21014 18396 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942986.1 protein_id gnl|my_center|LOCUS_21340 >Feature sequence055 1519 398 gene locus_tag LOCUS_21350 1519 398 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771829.1 protein_id gnl|my_center|LOCUS_21350 2474 1497 gene locus_tag LOCUS_21360 2474 1497 CDS product thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957741.1 protein_id gnl|my_center|LOCUS_21360 4102 2528 gene locus_tag LOCUS_21370 4102 2528 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088170.1 protein_id gnl|my_center|LOCUS_21370 4691 4086 gene locus_tag LOCUS_21380 4691 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21380 5682 4693 gene locus_tag LOCUS_21390 5682 4693 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088169.1 protein_id gnl|my_center|LOCUS_21390 6827 5697 gene locus_tag LOCUS_21400 6827 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21400 7460 8665 gene locus_tag LOCUS_21410 7460 8665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21410 9136 10491 gene locus_tag LOCUS_21420 9136 10491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 10505 11674 gene locus_tag LOCUS_21430 10505 11674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 11687 13678 gene locus_tag LOCUS_21440 11687 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 14111 14965 gene locus_tag LOCUS_21450 14111 14965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 16144 15005 gene locus_tag LOCUS_21460 16144 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21460 16990 16154 gene locus_tag LOCUS_21470 16990 16154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21470 17783 16965 gene locus_tag LOCUS_21480 17783 16965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21480 18579 17773 gene locus_tag LOCUS_21490 18579 17773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 20872 19805 gene locus_tag LOCUS_21500 20872 19805 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403383.1 protein_id gnl|my_center|LOCUS_21500 <21418 20875 gene locus_tag LOCUS_21510 <21418 20875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000132016.1:acylneuraminate cytidylyltransferase family protein >Feature sequence056 182 745 gene locus_tag LOCUS_21520 182 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21520 870 1193 gene locus_tag LOCUS_21530 870 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21530 1499 1423 gene locus_tag LOCUS_t00250 1499 1423 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1919 1829 gene locus_tag LOCUS_t00260 1919 1829 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2390 2202 gene locus_tag LOCUS_21540 gene csrA 2390 2202 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305164.1 protein_id gnl|my_center|LOCUS_21540 3799 2555 gene locus_tag LOCUS_21550 3799 2555 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005731386.1 protein_id gnl|my_center|LOCUS_21550 6645 3991 gene locus_tag LOCUS_21560 gene alaS 6645 3991 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112602.1 protein_id gnl|my_center|LOCUS_21560 7204 6698 gene locus_tag LOCUS_21570 gene recX 7204 6698 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000006855.1 protein_id gnl|my_center|LOCUS_21570 8259 7210 gene locus_tag LOCUS_21580 gene recA 8259 7210 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_21580 8577 9470 gene locus_tag LOCUS_21590 8577 9470 CDS product WYL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008000.1 protein_id gnl|my_center|LOCUS_21590 10088 9540 gene locus_tag LOCUS_21600 gene thpR 10088 9540 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209356.1 protein_id gnl|my_center|LOCUS_21600 10560 10069 gene locus_tag LOCUS_21610 gene pncC 10560 10069 CDS product nicotinamide-nucleotide amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478554.1 protein_id gnl|my_center|LOCUS_21610 12017 10629 gene locus_tag LOCUS_21620 12017 10629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21620 12367 12780 gene locus_tag LOCUS_21630 12367 12780 CDS product PA2779 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090843.1 protein_id gnl|my_center|LOCUS_21630 12824 13756 gene locus_tag LOCUS_21640 12824 13756 CDS product PA2778 family cysteine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895637.1 protein_id gnl|my_center|LOCUS_21640 14984 13773 gene locus_tag LOCUS_21650 gene gspF 14984 13773 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_21650 16681 15134 gene locus_tag LOCUS_21660 gene xcpR 16681 15134 CDS product GspE family T2SS ATPase variant XcpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091377.1 protein_id gnl|my_center|LOCUS_21660 18807 16699 gene locus_tag LOCUS_21670 gene gspD 18807 16699 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000498830.1 protein_id gnl|my_center|LOCUS_21670 19803 18880 gene locus_tag LOCUS_21680 gene gspC 19803 18880 CDS product type II secretion system protein GspC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262834.1 protein_id gnl|my_center|LOCUS_21680 20111 20788 gene locus_tag LOCUS_21690 20111 20788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 >Feature sequence057 403 170 gene locus_tag LOCUS_21700 403 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 677 1429 gene locus_tag LOCUS_21710 677 1429 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_21710 1556 2176 gene locus_tag LOCUS_21720 1556 2176 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478024.1 protein_id gnl|my_center|LOCUS_21720 4212 2287 gene locus_tag LOCUS_21730 4212 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21730 4480 4259 gene locus_tag LOCUS_21740 4480 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21740 5282 4557 gene locus_tag LOCUS_21750 gene tsaA 5282 4557 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706829.1 protein_id gnl|my_center|LOCUS_21750 5373 5846 gene locus_tag LOCUS_21760 5373 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 6597 5968 gene locus_tag LOCUS_21770 6597 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 6743 8086 gene locus_tag LOCUS_21780 6743 8086 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113324.1 protein_id gnl|my_center|LOCUS_21780 8282 8593 gene locus_tag LOCUS_21790 8282 8593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 9151 8708 gene locus_tag LOCUS_21800 9151 8708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 9630 9304 gene locus_tag LOCUS_21810 9630 9304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21810 10285 9734 gene locus_tag LOCUS_21820 10285 9734 CDS product DUF924 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084136.1 protein_id gnl|my_center|LOCUS_21820 10899 10300 gene locus_tag LOCUS_21830 gene msrA 10899 10300 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_096571812.1 protein_id gnl|my_center|LOCUS_21830 12013 10922 gene locus_tag LOCUS_21840 12013 10922 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686815.1 protein_id gnl|my_center|LOCUS_21840 14184 12205 gene locus_tag LOCUS_21850 14184 12205 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_21850 15977 14448 gene locus_tag LOCUS_21860 15977 14448 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_21860 16056 16241 gene locus_tag LOCUS_21870 16056 16241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21870 17149 16268 gene locus_tag LOCUS_21880 17149 16268 CDS product pirin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037847.1 protein_id gnl|my_center|LOCUS_21880 18537 17305 gene locus_tag LOCUS_21890 18537 17305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 20752 18830 gene locus_tag LOCUS_21900 20752 18830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21900 >Feature sequence058 440 895 gene locus_tag LOCUS_21910 440 895 CDS product Rsd/AlgQ family anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707403.1 protein_id gnl|my_center|LOCUS_21910 1614 910 gene locus_tag LOCUS_21920 1614 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 1746 2990 gene locus_tag LOCUS_21930 1746 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 3291 4487 gene locus_tag LOCUS_21940 3291 4487 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119782.1 protein_id gnl|my_center|LOCUS_21940 4875 6248 gene locus_tag LOCUS_21950 gene miaB 4875 6248 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649877.1 protein_id gnl|my_center|LOCUS_21950 6284 7288 gene locus_tag LOCUS_21960 6284 7288 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763270.1 protein_id gnl|my_center|LOCUS_21960 7290 7754 gene locus_tag LOCUS_21970 gene ybeY 7290 7754 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071410.1 protein_id gnl|my_center|LOCUS_21970 7825 8772 gene locus_tag LOCUS_21980 7825 8772 CDS product HlyC/CorC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093161.1 protein_id gnl|my_center|LOCUS_21980 8750 10303 gene locus_tag LOCUS_21990 gene lnt 8750 10303 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483491.1 protein_id gnl|my_center|LOCUS_21990 10382 11809 gene locus_tag LOCUS_22000 10382 11809 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338202.1 protein_id gnl|my_center|LOCUS_22000 12574 12077 gene locus_tag LOCUS_22010 12574 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 12524 12718 gene locus_tag LOCUS_22020 12524 12718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22020 13476 12715 gene locus_tag LOCUS_22030 13476 12715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 13904 13569 gene locus_tag LOCUS_22040 13904 13569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 14491 14655 gene locus_tag LOCUS_22050 14491 14655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22050 15221 15535 gene locus_tag LOCUS_22060 15221 15535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22060 18305 15519 gene locus_tag LOCUS_22070 18305 15519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22070 >Feature sequence059 979 137 gene locus_tag LOCUS_22080 979 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384461.1 protein_id gnl|my_center|LOCUS_22080 1908 1087 gene locus_tag LOCUS_22090 gene tcdA 1908 1087 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482313.1 protein_id gnl|my_center|LOCUS_22090 2681 1905 gene locus_tag LOCUS_22100 2681 1905 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046463568.1 protein_id gnl|my_center|LOCUS_22100 2909 3574 gene locus_tag LOCUS_22110 2909 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22110 4729 3641 gene locus_tag LOCUS_22120 4729 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22120 5659 7011 gene locus_tag LOCUS_22130 5659 7011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 7573 9132 gene locus_tag LOCUS_22140 7573 9132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22140 9309 10295 gene locus_tag LOCUS_22150 9309 10295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 10303 10725 gene locus_tag LOCUS_22160 gene zntR 10303 10725 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099019.1 protein_id gnl|my_center|LOCUS_22160 10873 11229 gene locus_tag LOCUS_22170 10873 11229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22170 11333 13993 gene locus_tag LOCUS_22180 11333 13993 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162006391.1 protein_id gnl|my_center|LOCUS_22180 14096 15154 gene locus_tag LOCUS_22190 14096 15154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22190 15193 15345 gene locus_tag LOCUS_22200 15193 15345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22200 15326 16075 gene locus_tag LOCUS_22210 15326 16075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 16106 17287 gene locus_tag LOCUS_22220 16106 17287 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020792.1 protein_id gnl|my_center|LOCUS_22220 17309 17692 gene locus_tag LOCUS_22230 17309 17692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22230 17704 18102 gene locus_tag LOCUS_22240 17704 18102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 18799 18311 gene locus_tag LOCUS_22250 18799 18311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22250 19456 18998 gene locus_tag LOCUS_22260 19456 18998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22260 >Feature sequence060 1422 49 gene locus_tag LOCUS_22270 gene trkA 1422 49 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_22270 2866 1508 gene locus_tag LOCUS_22280 gene ntrX 2866 1508 CDS product two-component system response regulator NtrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003535439.1 protein_id gnl|my_center|LOCUS_22280 5089 2924 gene locus_tag LOCUS_22290 5089 2924 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929884.1 protein_id gnl|my_center|LOCUS_22290 5770 5186 gene locus_tag LOCUS_22300 5770 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 7044 5749 gene locus_tag LOCUS_22310 gene rsmB 7044 5749 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_149560556.1 protein_id gnl|my_center|LOCUS_22310 7986 7060 gene locus_tag LOCUS_22320 gene fmt 7986 7060 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174602.1 protein_id gnl|my_center|LOCUS_22320 8534 8031 gene locus_tag LOCUS_22330 gene def 8534 8031 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038831.1 protein_id gnl|my_center|LOCUS_22330 8788 9870 gene locus_tag LOCUS_22340 8788 9870 CDS product LysM peptidoglycan-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003097294.1 protein_id gnl|my_center|LOCUS_22340 10052 11080 gene locus_tag LOCUS_22350 gene dprA 10052 11080 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958587.1 protein_id gnl|my_center|LOCUS_22350 11162 11641 gene locus_tag LOCUS_22360 11162 11641 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_22360 12681 11686 gene locus_tag LOCUS_22370 12681 11686 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948238.1 protein_id gnl|my_center|LOCUS_22370 13083 12715 gene locus_tag LOCUS_22380 13083 12715 CDS product group 1 truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947457.1 protein_id gnl|my_center|LOCUS_22380 13359 13829 gene locus_tag LOCUS_22390 13359 13829 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948236.1 protein_id gnl|my_center|LOCUS_22390 14043 14930 gene locus_tag LOCUS_22400 14043 14930 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_22400 15383 14949 gene locus_tag LOCUS_22410 15383 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22410 15806 15731 gene locus_tag LOCUS_t00270 15806 15731 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15935 16996 gene locus_tag LOCUS_22420 gene amrS 15935 16996 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023404.1 protein_id gnl|my_center|LOCUS_22420 17004 17546 gene locus_tag LOCUS_22430 17004 17546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22430 18757 17621 gene locus_tag LOCUS_22440 18757 17621 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100079.1 protein_id gnl|my_center|LOCUS_22440 19654 18878 gene locus_tag LOCUS_22450 19654 18878 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852748.1 protein_id gnl|my_center|LOCUS_22450 19920 19651 gene locus_tag LOCUS_22460 19920 19651 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768500.1 protein_id gnl|my_center|LOCUS_22460 >Feature sequence061 291 25 gene locus_tag LOCUS_22470 291 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 1373 2338 gene locus_tag LOCUS_22480 1373 2338 CDS product kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920748.1 protein_id gnl|my_center|LOCUS_22480 3392 2475 gene locus_tag LOCUS_22490 3392 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 3557 4810 gene locus_tag LOCUS_22500 3557 4810 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244213.1 protein_id gnl|my_center|LOCUS_22500 4803 5513 gene locus_tag LOCUS_22510 gene lolD 4803 5513 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091168.1 protein_id gnl|my_center|LOCUS_22510 6095 5550 gene locus_tag LOCUS_22520 6095 5550 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_22520 6214 8589 gene locus_tag LOCUS_22530 6214 8589 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037274.1 protein_id gnl|my_center|LOCUS_22530 8727 9374 gene locus_tag LOCUS_22540 8727 9374 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_22540 9381 9803 gene locus_tag LOCUS_22550 9381 9803 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091161.1 protein_id gnl|my_center|LOCUS_22550 9843 11576 gene locus_tag LOCUS_22560 gene msbA 9843 11576 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957851.1 protein_id gnl|my_center|LOCUS_22560 11611 12579 gene locus_tag LOCUS_22570 gene lpxK 11611 12579 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957852.1 protein_id gnl|my_center|LOCUS_22570 12620 12802 gene locus_tag LOCUS_22580 gene ycaR 12620 12802 CDS product protein YcaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367465.1 protein_id gnl|my_center|LOCUS_22580 12799 13557 gene locus_tag LOCUS_22590 gene kdsB 12799 13557 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000011329.1 protein_id gnl|my_center|LOCUS_22590 14297 16474 gene locus_tag LOCUS_22600 14297 16474 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082901051.1 protein_id gnl|my_center|LOCUS_22600 16889 18238 gene locus_tag LOCUS_22610 16889 18238 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966765.1 protein_id gnl|my_center|LOCUS_22610 18334 19044 gene locus_tag LOCUS_22620 18334 19044 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387744.1 protein_id gnl|my_center|LOCUS_22620 19267 19506 gene locus_tag LOCUS_22630 19267 19506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22630 19570 19698 gene locus_tag LOCUS_22640 19570 19698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 >Feature sequence062 103 1209 gene locus_tag LOCUS_22650 103 1209 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_22650 1230 2288 gene locus_tag LOCUS_22660 1230 2288 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_22660 2340 4046 gene locus_tag LOCUS_22670 gene dauA 2340 4046 CDS product C4-dicarboxylic acid transporter DauA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925752.1 protein_id gnl|my_center|LOCUS_22670 4196 5095 gene locus_tag LOCUS_22680 gene glyQ 4196 5095 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070431.1 protein_id gnl|my_center|LOCUS_22680 5228 5593 gene locus_tag LOCUS_22690 5228 5593 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_22690 5590 7695 gene locus_tag LOCUS_22700 gene glyS 5590 7695 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114646.1 protein_id gnl|my_center|LOCUS_22700 7884 8216 gene locus_tag LOCUS_22710 7884 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 8553 9149 gene locus_tag LOCUS_22720 gene gmhB 8553 9149 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522791.1 protein_id gnl|my_center|LOCUS_22720 9149 9901 gene locus_tag LOCUS_22730 9149 9901 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814405.1 protein_id gnl|my_center|LOCUS_22730 9955 10031 gene locus_tag LOCUS_t00280 9955 10031 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10141 10647 gene locus_tag LOCUS_22740 10141 10647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 11238 10822 gene locus_tag LOCUS_22750 11238 10822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22750 11119 12702 gene locus_tag LOCUS_22760 gene asnB 11119 12702 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124141.1 protein_id gnl|my_center|LOCUS_22760 13492 12956 gene locus_tag LOCUS_22770 13492 12956 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423707.1 protein_id gnl|my_center|LOCUS_22770 14054 13521 gene locus_tag LOCUS_22780 14054 13521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 14118 15038 gene locus_tag LOCUS_22790 14118 15038 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114741.1 protein_id gnl|my_center|LOCUS_22790 15104 16075 gene locus_tag LOCUS_22800 15104 16075 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765784.1 protein_id gnl|my_center|LOCUS_22800 16062 18074 gene locus_tag LOCUS_22810 gene tgpA 16062 18074 CDS product protein-glutamine gamma-glutamyltransferase TgpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114743.1 protein_id gnl|my_center|LOCUS_22810 18228 18629 gene locus_tag LOCUS_22820 18228 18629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 19264 18686 gene locus_tag LOCUS_22830 19264 18686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 <19903 19374 gene locus_tag LOCUS_22840 <19903 19374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038356.1:radical SAM family heme chaperone HemW >Feature sequence063 7990 6722 gene locus_tag LOCUS_22850 gene opmH 7990 6722 CDS product efflux transporter outer membrane subunit OpmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095699.1 protein_id gnl|my_center|LOCUS_22850 8795 9406 gene locus_tag LOCUS_22860 8795 9406 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142655.1 protein_id gnl|my_center|LOCUS_22860 9403 9894 gene locus_tag LOCUS_22870 9403 9894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22870 9891 10319 gene locus_tag LOCUS_22880 9891 10319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_22880 10316 10786 gene locus_tag LOCUS_22890 10316 10786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 11115 11444 gene locus_tag LOCUS_22900 11115 11444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 12923 11565 gene locus_tag LOCUS_22910 12923 11565 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268198.1 protein_id gnl|my_center|LOCUS_22910 <19551 12930 gene locus_tag LOCUS_22920 <19551 12930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268209.1:calcium-binding protein >Feature sequence064 268 1515 gene locus_tag LOCUS_22930 268 1515 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946042.1 protein_id gnl|my_center|LOCUS_22930 1856 2224 gene locus_tag LOCUS_22940 1856 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22940 5334 2734 gene locus_tag LOCUS_22950 gene clpB 5334 2734 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947476.1 protein_id gnl|my_center|LOCUS_22950 5779 5558 gene locus_tag LOCUS_22960 5779 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22960 6619 5885 gene locus_tag LOCUS_22970 6619 5885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 7203 6694 gene locus_tag LOCUS_22980 7203 6694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22980 7711 7307 gene locus_tag LOCUS_22990 7711 7307 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454537.1 protein_id gnl|my_center|LOCUS_22990 8058 7708 gene locus_tag LOCUS_23000 8058 7708 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005382084.1 protein_id gnl|my_center|LOCUS_23000 8888 8091 gene locus_tag LOCUS_23010 8888 8091 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454529.1 protein_id gnl|my_center|LOCUS_23010 9622 8888 gene locus_tag LOCUS_23020 9622 8888 CDS product DUF1538 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478515.1 protein_id gnl|my_center|LOCUS_23020 11673 9757 gene locus_tag LOCUS_23030 11673 9757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23030 11918 13447 gene locus_tag LOCUS_23040 11918 13447 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420148.1 protein_id gnl|my_center|LOCUS_23040 13480 14352 gene locus_tag LOCUS_23050 gene nadC 13480 14352 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957378.1 protein_id gnl|my_center|LOCUS_23050 14426 14839 gene locus_tag LOCUS_23060 14426 14839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 15929 14955 gene locus_tag LOCUS_23070 15929 14955 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941847.1 protein_id gnl|my_center|LOCUS_23070 16268 15951 gene locus_tag LOCUS_23080 16268 15951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23080 17218 16271 gene locus_tag LOCUS_23090 17218 16271 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930139.1 protein_id gnl|my_center|LOCUS_23090 <19251 17311 gene locus_tag LOCUS_23100 <19251 17311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010883982.1:helicase-related protein >Feature sequence065 910 3183 gene locus_tag LOCUS_23110 910 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 4497 3214 gene locus_tag LOCUS_23120 4497 3214 CDS product cyclic di-GMP phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113015.1 protein_id gnl|my_center|LOCUS_23120 5182 4550 gene locus_tag LOCUS_23130 gene can 5182 4550 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308055.1 protein_id gnl|my_center|LOCUS_23130 5847 5245 gene locus_tag LOCUS_23140 gene rnhB 5847 5245 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569430.1 protein_id gnl|my_center|LOCUS_23140 7192 6008 gene locus_tag LOCUS_23150 gene lpxB 7192 6008 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705104.1 protein_id gnl|my_center|LOCUS_23150 7963 7193 gene locus_tag LOCUS_23160 gene lpxA 7963 7193 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811774.1 protein_id gnl|my_center|LOCUS_23160 8462 7995 gene locus_tag LOCUS_23170 gene fabZ 8462 7995 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554719.1 protein_id gnl|my_center|LOCUS_23170 9522 8455 gene locus_tag LOCUS_23180 gene lpxD 9522 8455 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098585.1 protein_id gnl|my_center|LOCUS_23180 10083 9532 gene locus_tag LOCUS_23190 10083 9532 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811782.1 protein_id gnl|my_center|LOCUS_23190 12459 10195 gene locus_tag LOCUS_23200 gene bamA 12459 10195 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268651.1 protein_id gnl|my_center|LOCUS_23200 13908 12538 gene locus_tag LOCUS_23210 gene rseP 13908 12538 CDS product sigma E protease regulator RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005053372.1 protein_id gnl|my_center|LOCUS_23210 15113 13905 gene locus_tag LOCUS_23220 gene ispC 15113 13905 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765988.1 protein_id gnl|my_center|LOCUS_23220 15955 15113 gene locus_tag LOCUS_23230 15955 15113 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103592.1 protein_id gnl|my_center|LOCUS_23230 16748 15969 gene locus_tag LOCUS_23240 gene uppS 16748 15969 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705097.1 protein_id gnl|my_center|LOCUS_23240 17607 17050 gene locus_tag LOCUS_23250 gene frr 17607 17050 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_23250 18416 17694 gene locus_tag LOCUS_23260 gene pyrH 18416 17694 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_23260 >Feature sequence066 2116 536 gene locus_tag LOCUS_23270 2116 536 CDS product peptide chain release factor 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946608.1 protein_id gnl|my_center|LOCUS_23270 2258 2183 gene locus_tag LOCUS_t00290 2258 2183 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 3776 2514 gene locus_tag LOCUS_23280 3776 2514 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086289.1 protein_id gnl|my_center|LOCUS_23280 4456 4049 gene locus_tag LOCUS_23290 gene rplQ 4456 4049 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001216368.1 protein_id gnl|my_center|LOCUS_23290 5528 4533 gene locus_tag LOCUS_23300 gene rpoA 5528 4533 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093675.1 protein_id gnl|my_center|LOCUS_23300 6242 5616 gene locus_tag LOCUS_23310 gene rpsD 6242 5616 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093678.1 protein_id gnl|my_center|LOCUS_23310 6659 6276 gene locus_tag LOCUS_23320 gene rpsK 6659 6276 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005543603.1 protein_id gnl|my_center|LOCUS_23320 7061 6705 gene locus_tag LOCUS_23330 gene rpsM 7061 6705 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197938.1 protein_id gnl|my_center|LOCUS_23330 8650 7325 gene locus_tag LOCUS_23340 gene secY 8650 7325 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101599.1 protein_id gnl|my_center|LOCUS_23340 9112 8678 gene locus_tag LOCUS_23350 gene rplO 9112 8678 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001238917.1 protein_id gnl|my_center|LOCUS_23350 9296 9114 gene locus_tag LOCUS_23360 gene rpmD 9296 9114 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771513.1 protein_id gnl|my_center|LOCUS_23360 9806 9300 gene locus_tag LOCUS_23370 gene rpsE 9806 9300 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093697.1 protein_id gnl|my_center|LOCUS_23370 10156 9824 gene locus_tag LOCUS_23380 gene rplR 10156 9824 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093698.1 protein_id gnl|my_center|LOCUS_23380 10723 10190 gene locus_tag LOCUS_23390 gene rplF 10723 10190 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093699.1 protein_id gnl|my_center|LOCUS_23390 11130 10735 gene locus_tag LOCUS_23400 gene rpsH 11130 10735 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174622.1 protein_id gnl|my_center|LOCUS_23400 11587 11282 gene locus_tag LOCUS_23410 gene rpsN 11587 11282 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002049689.1 protein_id gnl|my_center|LOCUS_23410 12137 11598 gene locus_tag LOCUS_23420 gene rplE 12137 11598 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070624.1 protein_id gnl|my_center|LOCUS_23420 12479 12165 gene locus_tag LOCUS_23430 gene rplX 12479 12165 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771523.1 protein_id gnl|my_center|LOCUS_23430 12918 12550 gene locus_tag LOCUS_23440 gene rplN 12918 12550 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806916.1 protein_id gnl|my_center|LOCUS_23440 13349 13092 gene locus_tag LOCUS_23450 gene rpsQ 13349 13092 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036129.1 protein_id gnl|my_center|LOCUS_23450 13549 13346 gene locus_tag LOCUS_23460 gene rpmC 13549 13346 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044008216.1 protein_id gnl|my_center|LOCUS_23460 13962 13549 gene locus_tag LOCUS_23470 gene rplP 13962 13549 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093723.1 protein_id gnl|my_center|LOCUS_23470 14655 13981 gene locus_tag LOCUS_23480 gene rpsC 14655 13981 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093727.1 protein_id gnl|my_center|LOCUS_23480 15015 14683 gene locus_tag LOCUS_23490 gene rplV 15015 14683 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_23490 15299 15027 gene locus_tag LOCUS_23500 gene rpsS 15299 15027 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307960.1 protein_id gnl|my_center|LOCUS_23500 16152 15322 gene locus_tag LOCUS_23510 gene rplB 16152 15322 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317104.1 protein_id gnl|my_center|LOCUS_23510 16477 16181 gene locus_tag LOCUS_23520 gene rplW 16477 16181 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307955.1 protein_id gnl|my_center|LOCUS_23520 17094 16474 gene locus_tag LOCUS_23530 gene rplD 17094 16474 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005379556.1 protein_id gnl|my_center|LOCUS_23530 17747 17106 gene locus_tag LOCUS_23540 gene rplC 17747 17106 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218932.1 protein_id gnl|my_center|LOCUS_23540 18086 17841 gene locus_tag LOCUS_23550 gene rpsJ 18086 17841 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181007.1 protein_id gnl|my_center|LOCUS_23550 18383 18246 gene locus_tag LOCUS_23560 18383 18246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence067 488 886 gene locus_tag LOCUS_23570 488 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 1304 1576 gene locus_tag LOCUS_23580 1304 1576 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_23580 1580 1912 gene locus_tag LOCUS_23590 1580 1912 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064244108.1 protein_id gnl|my_center|LOCUS_23590 2307 2486 gene locus_tag LOCUS_23600 2307 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23600 2801 3517 gene locus_tag LOCUS_23610 2801 3517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23610 3625 4311 gene locus_tag LOCUS_23620 3625 4311 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704560.1 protein_id gnl|my_center|LOCUS_23620 4376 4675 gene locus_tag LOCUS_23630 4376 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23630 7676 5142 gene locus_tag LOCUS_23640 7676 5142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 10703 8082 gene locus_tag LOCUS_23650 gene mutS 10703 8082 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_23650 10770 12011 gene locus_tag LOCUS_23660 10770 12011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 12357 13625 gene locus_tag LOCUS_23670 12357 13625 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402885.1 protein_id gnl|my_center|LOCUS_23670 14751 13933 gene locus_tag LOCUS_23680 gene rhdA 14751 13933 CDS product thiosulfate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113925.1 protein_id gnl|my_center|LOCUS_23680 15901 14801 gene locus_tag LOCUS_23690 gene tapW 15901 14801 CDS product type IVa pilus ATPase TapW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706550.1 protein_id gnl|my_center|LOCUS_23690 16699 16022 gene locus_tag LOCUS_23700 16699 16022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 16972 16700 gene locus_tag LOCUS_23710 16972 16700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23710 17875 17066 gene locus_tag LOCUS_23720 gene suhB 17875 17066 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003380594.1 protein_id gnl|my_center|LOCUS_23720 >Feature sequence068 1 5757 gene locus_tag LOCUS_23730 1 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23730 5773 6918 gene locus_tag LOCUS_23740 5773 6918 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118811.1 protein_id gnl|my_center|LOCUS_23740 6949 7428 gene locus_tag LOCUS_23750 6949 7428 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769407.1 protein_id gnl|my_center|LOCUS_23750 9862 7757 gene locus_tag LOCUS_23760 gene recG 9862 7757 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819155.1 protein_id gnl|my_center|LOCUS_23760 10290 9973 gene locus_tag LOCUS_23770 10290 9973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 11152 10370 gene locus_tag LOCUS_23780 11152 10370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006788385.1 protein_id gnl|my_center|LOCUS_23780 11409 11801 gene locus_tag LOCUS_23790 11409 11801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 12450 12043 gene locus_tag LOCUS_23800 12450 12043 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116996.1 protein_id gnl|my_center|LOCUS_23800 14664 12496 gene locus_tag LOCUS_23810 gene spoT 14664 12496 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096603.1 protein_id gnl|my_center|LOCUS_23810 15189 14893 gene locus_tag LOCUS_23820 15189 14893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23820 15274 15495 gene locus_tag LOCUS_23830 15274 15495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 16104 15481 gene locus_tag LOCUS_23840 16104 15481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 >Feature sequence069 1949 456 gene locus_tag LOCUS_23850 gene zwf 1949 456 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256405.1 protein_id gnl|my_center|LOCUS_23850 3361 1946 gene locus_tag LOCUS_23860 gene gnd 3361 1946 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477829.1 protein_id gnl|my_center|LOCUS_23860 4428 3529 gene locus_tag LOCUS_23870 4428 3529 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932752.1 protein_id gnl|my_center|LOCUS_23870 5977 4640 gene locus_tag LOCUS_23880 5977 4640 CDS product DUF3570 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072166.1 protein_id gnl|my_center|LOCUS_23880 6183 5968 gene locus_tag LOCUS_23890 6183 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23890 6703 6203 gene locus_tag LOCUS_23900 6703 6203 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072164.1 protein_id gnl|my_center|LOCUS_23900 6972 7934 gene locus_tag LOCUS_23910 gene msrP 6972 7934 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527906.1 protein_id gnl|my_center|LOCUS_23910 8315 8932 gene locus_tag LOCUS_23920 8315 8932 CDS product sulfoxide reductase heme-binding subunit YedZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388352.1 protein_id gnl|my_center|LOCUS_23920 9015 10130 gene locus_tag LOCUS_23930 9015 10130 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462887.1 protein_id gnl|my_center|LOCUS_23930 10218 10586 gene locus_tag LOCUS_23940 10218 10586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23940 10595 11152 gene locus_tag LOCUS_23950 10595 11152 CDS product hypoxanthine-guanine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768820.1 protein_id gnl|my_center|LOCUS_23950 11160 11921 gene locus_tag LOCUS_23960 11160 11921 CDS product S-methyl-5'-thioinosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091193.1 protein_id gnl|my_center|LOCUS_23960 12353 13318 gene locus_tag LOCUS_23970 12353 13318 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941678.1 protein_id gnl|my_center|LOCUS_23970 13649 13395 gene locus_tag LOCUS_23980 13649 13395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 13920 14555 gene locus_tag LOCUS_23990 13920 14555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 14574 14768 gene locus_tag LOCUS_24000 14574 14768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 16397 15309 gene locus_tag LOCUS_24010 16397 15309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24010 >Feature sequence070 3 140 gene locus_tag LOCUS_24020 3 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 250 325 gene locus_tag LOCUS_t00300 250 325 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 409 744 gene locus_tag LOCUS_24030 gene secE 409 744 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108030.1 protein_id gnl|my_center|LOCUS_24030 801 1334 gene locus_tag LOCUS_24040 gene nusG 801 1334 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317113.1 protein_id gnl|my_center|LOCUS_24040 1458 1892 gene locus_tag LOCUS_24050 gene rplK 1458 1892 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074682.1 protein_id gnl|my_center|LOCUS_24050 1895 2590 gene locus_tag LOCUS_24060 gene rplA 1895 2590 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 protein_id gnl|my_center|LOCUS_24060 2958 3485 gene locus_tag LOCUS_24070 gene rplJ 2958 3485 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771616.1 protein_id gnl|my_center|LOCUS_24070 3592 3972 gene locus_tag LOCUS_24080 gene rplL 3592 3972 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_24080 4153 8235 gene locus_tag LOCUS_24090 gene rpoB 4153 8235 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114335.1 protein_id gnl|my_center|LOCUS_24090 8269 12516 gene locus_tag LOCUS_24100 gene rpoC 8269 12516 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_24100 12708 13082 gene locus_tag LOCUS_24110 gene rpsL 12708 13082 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399892.1 protein_id gnl|my_center|LOCUS_24110 13170 13604 gene locus_tag LOCUS_24120 gene rpsG 13170 13604 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806901.1 protein_id gnl|my_center|LOCUS_24120 13771 15870 gene locus_tag LOCUS_24130 gene fusA 13771 15870 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_24130 >Feature sequence071 460 2424 gene locus_tag LOCUS_24140 gene acs 460 2424 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926941.1 protein_id gnl|my_center|LOCUS_24140 3798 2824 gene locus_tag LOCUS_24150 3798 2824 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016328122.1 protein_id gnl|my_center|LOCUS_24150 4848 3817 gene locus_tag LOCUS_24160 4848 3817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24160 6331 5012 gene locus_tag LOCUS_24170 gene tilS 6331 5012 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772040.1 protein_id gnl|my_center|LOCUS_24170 7360 6386 gene locus_tag LOCUS_24180 7360 6386 CDS product DUF2333 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106226.1 protein_id gnl|my_center|LOCUS_24180 8082 7492 gene locus_tag LOCUS_24190 gene msrA 8082 7492 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939270.1 protein_id gnl|my_center|LOCUS_24190 9173 8214 gene locus_tag LOCUS_24200 gene accA 9173 8214 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109333.1 protein_id gnl|my_center|LOCUS_24200 13009 9347 gene locus_tag LOCUS_24210 13009 9347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 13180 13800 gene locus_tag LOCUS_24220 13180 13800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 <15823 13792 gene locus_tag LOCUS_24230 <15823 13792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010888098.1:S8 family serine peptidase >Feature sequence072 <1 907 gene locus_tag LOCUS_24240 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268982.1:DNA polymerase III subunit delta 1205 2461 gene locus_tag LOCUS_24250 1205 2461 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114089.1 protein_id gnl|my_center|LOCUS_24250 2601 3296 gene locus_tag LOCUS_24260 gene nadD 2601 3296 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707025.1 protein_id gnl|my_center|LOCUS_24260 3297 3650 gene locus_tag LOCUS_24270 gene rsfS 3297 3650 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100305.1 protein_id gnl|my_center|LOCUS_24270 4048 4515 gene locus_tag LOCUS_24280 gene rlmH 4048 4515 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261456.1 protein_id gnl|my_center|LOCUS_24280 4544 5185 gene locus_tag LOCUS_24290 4544 5185 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268868.1 protein_id gnl|my_center|LOCUS_24290 5186 6655 gene locus_tag LOCUS_24300 gene rng 5186 6655 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094386.1 protein_id gnl|my_center|LOCUS_24300 6747 10628 gene locus_tag LOCUS_24310 6747 10628 CDS product YhdP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947481.1 protein_id gnl|my_center|LOCUS_24310 10723 11544 gene locus_tag LOCUS_24320 10723 11544 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522140.1 protein_id gnl|my_center|LOCUS_24320 13071 12553 gene locus_tag LOCUS_24330 gene yjgA 13071 12553 CDS product ribosome biogenesis factor YjgA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094378.1 protein_id gnl|my_center|LOCUS_24330 <15725 13068 gene locus_tag LOCUS_24340 <15725 13068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815152.1:FAD/FMN-binding oxidoreductase >Feature sequence073 4032 4472 gene locus_tag LOCUS_24350 4032 4472 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036247.1 protein_id gnl|my_center|LOCUS_24350 5786 4536 gene locus_tag LOCUS_24360 gene lysA 5786 4536 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459130.1 protein_id gnl|my_center|LOCUS_24360 6029 6343 gene locus_tag LOCUS_24370 gene cyaY 6029 6343 CDS product iron donor protein CyaY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003121284.1 protein_id gnl|my_center|LOCUS_24370 6356 7027 gene locus_tag LOCUS_24380 6356 7027 CDS product phospholipase/carboxylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958575.1 protein_id gnl|my_center|LOCUS_24380 10042 7031 gene locus_tag LOCUS_24390 10042 7031 CDS product class I adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114341.1 protein_id gnl|my_center|LOCUS_24390 10173 11042 gene locus_tag LOCUS_24400 10173 11042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 11185 11784 gene locus_tag LOCUS_24410 11185 11784 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958648.1 protein_id gnl|my_center|LOCUS_24410 11808 12137 gene locus_tag LOCUS_24420 11808 12137 CDS product Rieske (2Fe-2S) protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046237140.1 protein_id gnl|my_center|LOCUS_24420 12674 12156 gene locus_tag LOCUS_24430 12674 12156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24430 13565 12762 gene locus_tag LOCUS_24440 13565 12762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 13922 14110 gene locus_tag LOCUS_24450 13922 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 14462 14121 gene locus_tag LOCUS_24460 14462 14121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24460 14876 14520 gene locus_tag LOCUS_24470 14876 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24470 >Feature sequence074 1014 136 gene locus_tag LOCUS_24480 gene tsf 1014 136 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_24480 1910 1146 gene locus_tag LOCUS_24490 gene rpsB 1910 1146 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005615972.1 protein_id gnl|my_center|LOCUS_24490 2206 2973 gene locus_tag LOCUS_24500 gene map 2206 2973 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_24500 3191 5848 gene locus_tag LOCUS_24510 3191 5848 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_24510 6281 6042 gene locus_tag LOCUS_24520 6281 6042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 6450 8198 gene locus_tag LOCUS_24530 6450 8198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 8253 8684 gene locus_tag LOCUS_24540 8253 8684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24540 9903 8986 gene locus_tag LOCUS_24550 9903 8986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24550 11877 12902 gene locus_tag LOCUS_24560 11877 12902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24560 13781 13380 gene locus_tag LOCUS_24570 13781 13380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 14280 13963 gene locus_tag LOCUS_24580 14280 13963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 <15138 14462 gene locus_tag LOCUS_24590 <15138 14462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020521.1:IS1182-like element ISMac1 family transposase >Feature sequence075 1087 779 gene locus_tag LOCUS_24600 1087 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 1968 3350 gene locus_tag LOCUS_24610 gene dnaA 1968 3350 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769932.1 protein_id gnl|my_center|LOCUS_24610 3665 4771 gene locus_tag LOCUS_24620 gene dnaN 3665 4771 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768226.1 protein_id gnl|my_center|LOCUS_24620 4816 5901 gene locus_tag LOCUS_24630 gene recF 4816 5901 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704049.1 protein_id gnl|my_center|LOCUS_24630 6004 8421 gene locus_tag LOCUS_24640 gene gyrB 6004 8421 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000070020.1 protein_id gnl|my_center|LOCUS_24640 9657 8650 gene locus_tag LOCUS_24650 9657 8650 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813068.1 protein_id gnl|my_center|LOCUS_24650 9942 10880 gene locus_tag LOCUS_24660 gene hemC 9942 10880 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260939.1 protein_id gnl|my_center|LOCUS_24660 10881 11657 gene locus_tag LOCUS_24670 gene hemD 10881 11657 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815338.1 protein_id gnl|my_center|LOCUS_24670 11941 13161 gene locus_tag LOCUS_24680 11941 13161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24680 13158 14480 gene locus_tag LOCUS_24690 13158 14480 CDS product heme biosynthesis HemY N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948436.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence076 <1 959 gene locus_tag LOCUS_24700 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_076057335.1:glycosyltransferase family 2 protein 2703 961 gene locus_tag LOCUS_24710 2703 961 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943146.1 protein_id gnl|my_center|LOCUS_24710 4608 2728 gene locus_tag LOCUS_24720 4608 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24720 5458 4601 gene locus_tag LOCUS_24730 5458 4601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24730 5781 6422 gene locus_tag LOCUS_24740 5781 6422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24740 6453 7004 gene locus_tag LOCUS_24750 6453 7004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 8648 7083 gene locus_tag LOCUS_24760 gene purH 8648 7083 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001187540.1 protein_id gnl|my_center|LOCUS_24760 9333 9046 gene locus_tag LOCUS_24770 9333 9046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 10316 9330 gene locus_tag LOCUS_24780 gene dusB 10316 9330 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194278.1 protein_id gnl|my_center|LOCUS_24780 11996 10497 gene locus_tag LOCUS_24790 11996 10497 CDS product DUF3426 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105208.1 protein_id gnl|my_center|LOCUS_24790 13865 12045 gene locus_tag LOCUS_24800 13865 12045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence077 <1 1258 gene locus_tag LOCUS_24810 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528327.1:double-strand break repair helicase AddA 1432 1884 gene locus_tag LOCUS_24820 1432 1884 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_24820 2562 1891 gene locus_tag LOCUS_24830 2562 1891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 4052 2586 gene locus_tag LOCUS_24840 4052 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24840 5262 4498 gene locus_tag LOCUS_24850 gene dsbC 5262 4498 CDS product bifunctional protein-disulfide isomerase/oxidoreductase DsbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071231.1 protein_id gnl|my_center|LOCUS_24850 5795 5313 gene locus_tag LOCUS_24860 5795 5313 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772268.1 protein_id gnl|my_center|LOCUS_24860 6760 5831 gene locus_tag LOCUS_24870 gene xerD 6760 5831 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_24870 7265 6753 gene locus_tag LOCUS_24880 7265 6753 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957577.1 protein_id gnl|my_center|LOCUS_24880 7966 7622 gene locus_tag LOCUS_24890 gene rplS 7966 7622 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092637.1 protein_id gnl|my_center|LOCUS_24890 8929 8156 gene locus_tag LOCUS_24900 gene trmD 8929 8156 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008502493.1 protein_id gnl|my_center|LOCUS_24900 9111 8926 gene locus_tag LOCUS_24910 9111 8926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 9643 9095 gene locus_tag LOCUS_24920 gene rimM 9643 9095 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703198.1 protein_id gnl|my_center|LOCUS_24920 10001 9699 gene locus_tag LOCUS_24930 gene rpsP 10001 9699 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005166006.1 protein_id gnl|my_center|LOCUS_24930 11064 10165 gene locus_tag LOCUS_24940 11064 10165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 11767 11165 gene locus_tag LOCUS_24950 11767 11165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 12317 11757 gene locus_tag LOCUS_24960 12317 11757 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072993.1 protein_id gnl|my_center|LOCUS_24960 <14071 12708 gene locus_tag LOCUS_24970 <14071 12708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209456.1:signal recognition particle protein >Feature sequence078 3524 387 gene locus_tag LOCUS_24980 3524 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24980 3803 4441 gene locus_tag LOCUS_24990 3803 4441 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 protein_id gnl|my_center|LOCUS_24990 7254 4438 gene locus_tag LOCUS_25000 7254 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 7326 7484 gene locus_tag LOCUS_25010 7326 7484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25010 7484 7780 gene locus_tag LOCUS_25020 7484 7780 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103019402.1 protein_id gnl|my_center|LOCUS_25020 8184 8109 gene locus_tag LOCUS_t00310 8184 8109 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 8294 8219 gene locus_tag LOCUS_t00320 8294 8219 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10038 8335 gene locus_tag LOCUS_25030 10038 8335 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_25030 11472 10063 gene locus_tag LOCUS_25040 gene gltX 11472 10063 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222185.1 protein_id gnl|my_center|LOCUS_25040 11655 11729 gene locus_tag LOCUS_t00330 11655 11729 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 11822 13084 gene locus_tag LOCUS_25050 11822 13084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence079 2040 2504 gene locus_tag LOCUS_25060 2040 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25060 3001 3423 gene locus_tag LOCUS_25070 3001 3423 CDS product DUF2846 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035591.1 protein_id gnl|my_center|LOCUS_25070 3776 6586 gene locus_tag LOCUS_25080 3776 6586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 6719 8458 gene locus_tag LOCUS_25090 gene ggt 6719 8458 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946295.1 protein_id gnl|my_center|LOCUS_25090 8461 9246 gene locus_tag LOCUS_25100 8461 9246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25100 9254 10630 gene locus_tag LOCUS_25110 gene ppnN 9254 10630 CDS product nucleotide 5'-monophosphate nucleosidase PpnN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771604.1 protein_id gnl|my_center|LOCUS_25110 10777 11424 gene locus_tag LOCUS_25120 10777 11424 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021125.1 protein_id gnl|my_center|LOCUS_25120 11611 11994 gene locus_tag LOCUS_25130 11611 11994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25130 <12671 12005 gene locus_tag LOCUS_25140 <12671 12005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011083076.1:homoserine O-succinyltransferase >Feature sequence080 503 1069 gene locus_tag LOCUS_25150 503 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25150 1115 2065 gene locus_tag LOCUS_25160 gene pip 1115 2065 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_25160 2076 2528 gene locus_tag LOCUS_25170 gene dtd 2076 2528 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368967.1 protein_id gnl|my_center|LOCUS_25170 3138 8480 gene locus_tag LOCUS_25180 3138 8480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25180 9291 8620 gene locus_tag LOCUS_25190 9291 8620 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063801.1 protein_id gnl|my_center|LOCUS_25190 11489 9309 gene locus_tag LOCUS_25200 11489 9309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25200 <12367 11498 gene locus_tag LOCUS_25210 <12367 11498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002212197.1:multifunctional CCA addition/repair protein >Feature sequence081 641 1411 gene locus_tag LOCUS_25220 641 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25220 3535 1832 gene locus_tag LOCUS_25230 3535 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 3986 3537 gene locus_tag LOCUS_25240 3986 3537 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943873.1 protein_id gnl|my_center|LOCUS_25240 5617 4175 gene locus_tag LOCUS_25250 5617 4175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 7175 5649 gene locus_tag LOCUS_25260 7175 5649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25260 9250 7187 gene locus_tag LOCUS_25270 9250 7187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25270 9520 9864 gene locus_tag LOCUS_25280 9520 9864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25280 10023 9933 gene locus_tag LOCUS_t00340 10023 9933 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11199 10267 gene locus_tag LOCUS_25290 11199 10267 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881170.1 protein_id gnl|my_center|LOCUS_25290 11702 11274 gene locus_tag LOCUS_25300 gene tadA 11702 11274 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098309.1 protein_id gnl|my_center|LOCUS_25300 11910 12116 gene locus_tag LOCUS_25310 11910 12116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25310 >Feature sequence082 191 667 gene locus_tag LOCUS_25320 191 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25320 766 1434 gene locus_tag LOCUS_25330 766 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25330 1457 1732 gene locus_tag LOCUS_25340 1457 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25340 1883 3148 gene locus_tag LOCUS_25350 1883 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25350 6399 3154 gene locus_tag LOCUS_25360 6399 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25360 6812 7024 gene locus_tag LOCUS_25370 6812 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 7030 9585 gene locus_tag LOCUS_25380 7030 9585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941637.1 protein_id gnl|my_center|LOCUS_25380 10104 10907 gene locus_tag LOCUS_25390 10104 10907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 11723 11163 gene locus_tag LOCUS_25400 11723 11163 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071856.1 protein_id gnl|my_center|LOCUS_25400 >Feature sequence083 544 8 gene locus_tag LOCUS_25410 gene def 544 8 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944066.1 protein_id gnl|my_center|LOCUS_25410 1070 546 gene locus_tag LOCUS_25420 1070 546 CDS product amino acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944067.1 protein_id gnl|my_center|LOCUS_25420 1975 1184 gene locus_tag LOCUS_25430 1975 1184 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810564.1 protein_id gnl|my_center|LOCUS_25430 2348 2085 gene locus_tag LOCUS_25440 2348 2085 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_25440 2568 2335 gene locus_tag LOCUS_25450 2568 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 3389 2637 gene locus_tag LOCUS_25460 gene pgeF 3389 2637 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707735.1 protein_id gnl|my_center|LOCUS_25460 4363 3389 gene locus_tag LOCUS_25470 gene rluD 4363 3389 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381266.1 protein_id gnl|my_center|LOCUS_25470 4465 5274 gene locus_tag LOCUS_25480 4465 5274 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015040179.1 protein_id gnl|my_center|LOCUS_25480 5661 5323 gene locus_tag LOCUS_25490 gene glnB 5661 5323 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_25490 7324 5690 gene locus_tag LOCUS_25500 7324 5690 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_25500 8227 7355 gene locus_tag LOCUS_25510 gene sucD 8227 7355 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771707.1 protein_id gnl|my_center|LOCUS_25510 9396 8227 gene locus_tag LOCUS_25520 gene sucC 9396 8227 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958199.1 protein_id gnl|my_center|LOCUS_25520 9634 11313 gene locus_tag LOCUS_25530 9634 11313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 >Feature sequence084 1149 316 gene locus_tag LOCUS_25540 gene mazG 1149 316 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389380.1 protein_id gnl|my_center|LOCUS_25540 1309 1857 gene locus_tag LOCUS_25550 1309 1857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25550 2145 1858 gene locus_tag LOCUS_25560 2145 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 2290 2889 gene locus_tag LOCUS_25570 2290 2889 CDS product nucleoside triphosphate pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001137608.1 protein_id gnl|my_center|LOCUS_25570 3758 2871 gene locus_tag LOCUS_25580 3758 2871 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085368.1 protein_id gnl|my_center|LOCUS_25580 4925 3849 gene locus_tag LOCUS_25590 gene sppA 4925 3849 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091146.1 protein_id gnl|my_center|LOCUS_25590 5651 4980 gene locus_tag LOCUS_25600 5651 4980 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524610.1 protein_id gnl|my_center|LOCUS_25600 6642 5674 gene locus_tag LOCUS_25610 gene rluC 6642 5674 CDS product 23S rRNA pseudouridine(955/2504/2580) synthase RluC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619727.1 protein_id gnl|my_center|LOCUS_25610 7127 9862 gene locus_tag LOCUS_25620 gene rne 7127 9862 CDS product ribonuclease E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895645.1 protein_id gnl|my_center|LOCUS_25620 10466 9981 gene locus_tag LOCUS_25630 10466 9981 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_25630 >Feature sequence085 302 1420 gene locus_tag LOCUS_25640 302 1420 CDS product DUF2066 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042598094.1 protein_id gnl|my_center|LOCUS_25640 1420 1986 gene locus_tag LOCUS_25650 1420 1986 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948488.1 protein_id gnl|my_center|LOCUS_25650 2042 3061 gene locus_tag LOCUS_25660 2042 3061 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404282.1 protein_id gnl|my_center|LOCUS_25660 3155 3844 gene locus_tag LOCUS_25670 gene hda 3155 3844 CDS product DnaA regulatory inactivator Hda inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102398.1 protein_id gnl|my_center|LOCUS_25670 5137 4544 gene locus_tag LOCUS_25680 gene wrbA 5137 4544 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115189.1 protein_id gnl|my_center|LOCUS_25680 5496 5134 gene locus_tag LOCUS_25690 gene arsC 5496 5134 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123113.1 protein_id gnl|my_center|LOCUS_25690 5729 5983 gene locus_tag LOCUS_25700 5729 5983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25700 6122 6673 gene locus_tag LOCUS_25710 6122 6673 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880137.1 protein_id gnl|my_center|LOCUS_25710 6867 7265 gene locus_tag LOCUS_25720 6867 7265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25720 7493 8647 gene locus_tag LOCUS_25730 7493 8647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25730 10191 8671 gene locus_tag LOCUS_25740 10191 8671 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121241671.1 protein_id gnl|my_center|LOCUS_25740 10341 10425 gene locus_tag LOCUS_t00350 10341 10425 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 10555 10628 gene locus_tag LOCUS_t00360 10555 10628 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 10729 10803 gene locus_tag LOCUS_t00370 10729 10803 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence086 <1 744 gene locus_tag LOCUS_25750 <1 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005066802.1:D-alanine--D-alanine ligase 734 1507 gene locus_tag LOCUS_25760 734 1507 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769491.1 protein_id gnl|my_center|LOCUS_25760 1586 2830 gene locus_tag LOCUS_25770 gene ftsA 1586 2830 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_25770 2901 4046 gene locus_tag LOCUS_25780 gene ftsZ 2901 4046 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011997353.1 protein_id gnl|my_center|LOCUS_25780 4216 5139 gene locus_tag LOCUS_25790 gene lpxC 4216 5139 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094111.1 protein_id gnl|my_center|LOCUS_25790 5809 5360 gene locus_tag LOCUS_25800 5809 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 5989 6915 gene locus_tag LOCUS_25810 5989 6915 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094103.1 protein_id gnl|my_center|LOCUS_25810 7118 9841 gene locus_tag LOCUS_25820 gene secA 7118 9841 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707576.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence087 1643 180 gene locus_tag LOCUS_25830 1643 180 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093038.1 protein_id gnl|my_center|LOCUS_25830 1815 2459 gene locus_tag LOCUS_25840 1815 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 3191 2490 gene locus_tag LOCUS_25850 3191 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 4313 3369 gene locus_tag LOCUS_25860 4313 3369 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527322.1 protein_id gnl|my_center|LOCUS_25860 4552 6090 gene locus_tag LOCUS_25870 4552 6090 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_25870 6285 6689 gene locus_tag LOCUS_25880 6285 6689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25880 7949 7266 gene locus_tag LOCUS_25890 7949 7266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 8804 8019 gene locus_tag LOCUS_25900 8804 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 9507 8836 gene locus_tag LOCUS_25910 gene purN 9507 8836 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_25910 10699 9647 gene locus_tag LOCUS_25920 gene purM 10699 9647 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262407.1 protein_id gnl|my_center|LOCUS_25920 >Feature sequence088 720 136 gene locus_tag LOCUS_25930 720 136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25930 982 1239 gene locus_tag LOCUS_25940 982 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25940 1512 1730 gene locus_tag LOCUS_25950 1512 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 4936 1820 gene locus_tag LOCUS_25960 4936 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25960 5561 5295 gene locus_tag LOCUS_25970 5561 5295 CDS product PilZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114645.1 protein_id gnl|my_center|LOCUS_25970 5997 5581 gene locus_tag LOCUS_25980 5997 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25980 6299 6502 gene locus_tag LOCUS_25990 6299 6502 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463371.1 protein_id gnl|my_center|LOCUS_25990 6705 8264 gene locus_tag LOCUS_26000 6705 8264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 8415 8618 gene locus_tag LOCUS_26010 8415 8618 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187926.1 protein_id gnl|my_center|LOCUS_26010 8634 10025 gene locus_tag LOCUS_26020 8634 10025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 >Feature sequence089 1053 1244 gene locus_tag LOCUS_26030 1053 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26030 2174 1395 gene locus_tag LOCUS_26040 2174 1395 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100328.1 protein_id gnl|my_center|LOCUS_26040 2998 2177 gene locus_tag LOCUS_26050 gene rsmA 2998 2177 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113212.1 protein_id gnl|my_center|LOCUS_26050 4014 2995 gene locus_tag LOCUS_26060 gene pdxA 4014 2995 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000241224.1 protein_id gnl|my_center|LOCUS_26060 5343 4024 gene locus_tag LOCUS_26070 5343 4024 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103188.1 protein_id gnl|my_center|LOCUS_26070 7596 5383 gene locus_tag LOCUS_26080 7596 5383 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931411.1 protein_id gnl|my_center|LOCUS_26080 9004 7637 gene locus_tag LOCUS_26090 gene mnmE 9004 7637 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005175133.1 protein_id gnl|my_center|LOCUS_26090 <10501 9037 gene locus_tag LOCUS_26100 <10501 9037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401421.1:membrane protein insertase YidC >Feature sequence090 <1 569 gene locus_tag LOCUS_26110 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679769.1:outer membrane lipoprotein-sorting protein 617 1903 gene locus_tag LOCUS_26120 617 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681562.1 protein_id gnl|my_center|LOCUS_26120 2683 3297 gene locus_tag LOCUS_26130 2683 3297 CDS product glutathione S-transferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071741.1 protein_id gnl|my_center|LOCUS_26130 4083 3343 gene locus_tag LOCUS_26140 4083 3343 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964037.1 protein_id gnl|my_center|LOCUS_26140 5197 4316 gene locus_tag LOCUS_26150 5197 4316 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143748.1 protein_id gnl|my_center|LOCUS_26150 5840 5229 gene locus_tag LOCUS_26160 gene azoR3 5840 5229 CDS product FMN-dependent NADH-azoreductase AzoR3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114814.1 protein_id gnl|my_center|LOCUS_26160 5945 6847 gene locus_tag LOCUS_26170 5945 6847 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143747.1 protein_id gnl|my_center|LOCUS_26170 8607 7417 gene locus_tag LOCUS_26180 8607 7417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 8791 8597 gene locus_tag LOCUS_26190 8791 8597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 9410 8817 gene locus_tag LOCUS_26200 9410 8817 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977736.1 protein_id gnl|my_center|LOCUS_26200 9525 10205 gene locus_tag LOCUS_26210 9525 10205 CDS product peroxiredoxin-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819982.1 protein_id gnl|my_center|LOCUS_26210 >Feature sequence091 80 1495 gene locus_tag LOCUS_26220 gene mucD 80 1495 CDS product serine protease MucD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114183.1 protein_id gnl|my_center|LOCUS_26220 1649 3445 gene locus_tag LOCUS_26230 gene lepA 1649 3445 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649880.1 protein_id gnl|my_center|LOCUS_26230 3474 4307 gene locus_tag LOCUS_26240 gene lepB 3474 4307 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104912.1 protein_id gnl|my_center|LOCUS_26240 4428 4823 gene locus_tag LOCUS_26250 4428 4823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26250 4831 5517 gene locus_tag LOCUS_26260 gene rnc 4831 5517 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460683.1 protein_id gnl|my_center|LOCUS_26260 5527 6441 gene locus_tag LOCUS_26270 gene era 5527 6441 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085566.1 protein_id gnl|my_center|LOCUS_26270 6434 7201 gene locus_tag LOCUS_26280 gene recO 6434 7201 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772032.1 protein_id gnl|my_center|LOCUS_26280 7257 8012 gene locus_tag LOCUS_26290 gene pdxJ 7257 8012 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001296302.1 protein_id gnl|my_center|LOCUS_26290 8009 8398 gene locus_tag LOCUS_26300 gene acpS 8009 8398 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635063.1 protein_id gnl|my_center|LOCUS_26300 8466 8542 gene locus_tag LOCUS_t00380 8466 8542 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8887 9342 gene locus_tag LOCUS_26310 gene rimP 8887 9342 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095193.1 protein_id gnl|my_center|LOCUS_26310 >Feature sequence092 1199 180 gene locus_tag LOCUS_26320 gene mutY 1199 180 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707498.1 protein_id gnl|my_center|LOCUS_26320 3379 1235 gene locus_tag LOCUS_26330 3379 1235 CDS product AsmA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112620.1 protein_id gnl|my_center|LOCUS_26330 3562 3945 gene locus_tag LOCUS_26340 3562 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26340 3888 4049 gene locus_tag LOCUS_26350 3888 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26350 4737 4102 gene locus_tag LOCUS_26360 4737 4102 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000725019.1 protein_id gnl|my_center|LOCUS_26360 5450 4734 gene locus_tag LOCUS_26370 gene rph 5450 4734 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_26370 5681 6871 gene locus_tag LOCUS_26380 gene cfa 5681 6871 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210940.1 protein_id gnl|my_center|LOCUS_26380 6989 7225 gene locus_tag LOCUS_26390 gene rpmB 6989 7225 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091955.1 protein_id gnl|my_center|LOCUS_26390 7262 7417 gene locus_tag LOCUS_26400 gene rpmG 7262 7417 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004410866.1 protein_id gnl|my_center|LOCUS_26400 7581 8162 gene locus_tag LOCUS_26410 7581 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26410 8775 8164 gene locus_tag LOCUS_26420 8775 8164 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944939.1 protein_id gnl|my_center|LOCUS_26420 9007 10047 gene locus_tag LOCUS_26430 gene bioB 9007 10047 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_26430 >Feature sequence093 <1 3060 gene locus_tag LOCUS_26440 <1 3060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114676.1:chromosome segregation protein SMC 3357 4313 gene locus_tag LOCUS_26450 3357 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26450 4505 5515 gene locus_tag LOCUS_26460 4505 5515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 6279 5533 gene locus_tag LOCUS_26470 6279 5533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26470 7203 6376 gene locus_tag LOCUS_26480 7203 6376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 7744 8649 gene locus_tag LOCUS_26490 7744 8649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 8662 9093 gene locus_tag LOCUS_26500 8662 9093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26500 >Feature sequence094 708 133 gene locus_tag LOCUS_26510 gene wlbB 708 133 CDS product O-antigen biosynthesis protein WlbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807114.1 protein_id gnl|my_center|LOCUS_26510 1763 708 gene locus_tag LOCUS_26520 gene wlbA 1763 708 CDS product O-antigen biosynthesis protein WlbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807115.1 protein_id gnl|my_center|LOCUS_26520 2888 1791 gene locus_tag LOCUS_26530 gene wbpE 2888 1791 CDS product UDP-2-acetamido-2-deoxy-3-oxo-D-glucuronate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113425.1 protein_id gnl|my_center|LOCUS_26530 3209 4903 gene locus_tag LOCUS_26540 gene pilB 3209 4903 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112841.1 protein_id gnl|my_center|LOCUS_26540 4946 6163 gene locus_tag LOCUS_26550 4946 6163 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947252.1 protein_id gnl|my_center|LOCUS_26550 6216 7106 gene locus_tag LOCUS_26560 6216 7106 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707571.1 protein_id gnl|my_center|LOCUS_26560 7385 7999 gene locus_tag LOCUS_26570 gene coaE 7385 7999 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070773.1 protein_id gnl|my_center|LOCUS_26570 8010 8831 gene locus_tag LOCUS_26580 gene zapD 8010 8831 CDS product cell division protein ZapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195118.1 protein_id gnl|my_center|LOCUS_26580 >Feature sequence095 666 352 gene locus_tag LOCUS_26590 666 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26590 758 1747 gene locus_tag LOCUS_26600 758 1747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 2942 1878 gene locus_tag LOCUS_26610 gene rpoS 2942 1878 CDS product RNA polymerase sigma factor RpoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113871.1 protein_id gnl|my_center|LOCUS_26610 3802 2984 gene locus_tag LOCUS_26620 3802 2984 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115226.1 protein_id gnl|my_center|LOCUS_26620 4516 3926 gene locus_tag LOCUS_26630 4516 3926 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016349540.1 protein_id gnl|my_center|LOCUS_26630 5358 4690 gene locus_tag LOCUS_26640 5358 4690 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098558.1 protein_id gnl|my_center|LOCUS_26640 6119 5355 gene locus_tag LOCUS_26650 gene surE 6119 5355 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770587.1 protein_id gnl|my_center|LOCUS_26650 6214 6744 gene locus_tag LOCUS_26660 6214 6744 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957861.1 protein_id gnl|my_center|LOCUS_26660 7802 6762 gene locus_tag LOCUS_26670 gene truD 7802 6762 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036881.1 protein_id gnl|my_center|LOCUS_26670 8472 7996 gene locus_tag LOCUS_26680 gene ispF 8472 7996 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098560.1 protein_id gnl|my_center|LOCUS_26680 >Feature sequence096 488 36 gene locus_tag LOCUS_26690 488 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26690 1434 505 gene locus_tag LOCUS_26700 gene gluQRS 1434 505 CDS product tRNA glutamyl-Q(34) synthetase GluQRS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003115557.1 protein_id gnl|my_center|LOCUS_26700 1604 1894 gene locus_tag LOCUS_26710 1604 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2642 1986 gene locus_tag LOCUS_26720 2642 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26720 2938 3702 gene locus_tag LOCUS_26730 2938 3702 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056646.1 protein_id gnl|my_center|LOCUS_26730 3817 5004 gene locus_tag LOCUS_26740 3817 5004 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038595.1 protein_id gnl|my_center|LOCUS_26740 5963 5223 gene locus_tag LOCUS_26750 gene cysZ 5963 5223 CDS product sulfate transporter CysZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213487.1 protein_id gnl|my_center|LOCUS_26750 7489 6173 gene locus_tag LOCUS_26760 7489 6173 CDS product FGGY-family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173812.1 protein_id gnl|my_center|LOCUS_26760 8040 7651 gene locus_tag LOCUS_26770 gene queF 8040 7651 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_26770 >Feature sequence097 2 703 gene locus_tag LOCUS_26780 gene sfsA 2 703 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368194.1 protein_id gnl|my_center|LOCUS_26780 767 2221 gene locus_tag LOCUS_26790 gene sbcB 767 2221 CDS product exodeoxyribonuclease I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072723.1 protein_id gnl|my_center|LOCUS_26790 3433 2273 gene locus_tag LOCUS_26800 3433 2273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26800 6330 3568 gene locus_tag LOCUS_26810 gene gacS 6330 3568 CDS product two-component system sensor histidine kinase GacS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102426.1 protein_id gnl|my_center|LOCUS_26810 7255 6317 gene locus_tag LOCUS_26820 7255 6317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26820 <8705 7279 gene locus_tag LOCUS_26830 <8705 7279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114252.1:TonB-dependent receptor >Feature sequence098 421 1587 gene locus_tag LOCUS_26840 421 1587 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458936.1 protein_id gnl|my_center|LOCUS_26840 1673 2092 gene locus_tag LOCUS_26850 1673 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26850 2089 2589 gene locus_tag LOCUS_26860 2089 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26860 3025 3288 gene locus_tag LOCUS_26870 3025 3288 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_26870 3383 3637 gene locus_tag LOCUS_26880 3383 3637 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_26880 3630 4016 gene locus_tag LOCUS_26890 3630 4016 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212659.1 protein_id gnl|my_center|LOCUS_26890 4140 5765 gene locus_tag LOCUS_26900 4140 5765 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092366.1 protein_id gnl|my_center|LOCUS_26900 5769 6605 gene locus_tag LOCUS_26910 gene kdsA 5769 6605 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946916.1 protein_id gnl|my_center|LOCUS_26910 6752 8035 gene locus_tag LOCUS_26920 gene eno 6752 8035 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192585.1 protein_id gnl|my_center|LOCUS_26920 8065 8334 gene locus_tag LOCUS_26930 gene ftsB 8065 8334 CDS product cell division protein FtsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073295.1 protein_id gnl|my_center|LOCUS_26930 >Feature sequence099 1046 192 gene locus_tag LOCUS_26940 gene prmC 1046 192 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000117270.1 protein_id gnl|my_center|LOCUS_26940 1665 1072 gene locus_tag LOCUS_26950 1665 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 2758 1670 gene locus_tag LOCUS_26960 gene prfA 2758 1670 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003019960.1 protein_id gnl|my_center|LOCUS_26960 4327 3059 gene locus_tag LOCUS_26970 gene hemA 4327 3059 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073598.1 protein_id gnl|my_center|LOCUS_26970 4507 6228 gene locus_tag LOCUS_26980 4507 6228 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103429.1 protein_id gnl|my_center|LOCUS_26980 6225 6872 gene locus_tag LOCUS_26990 gene lolB 6225 6872 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095005.1 protein_id gnl|my_center|LOCUS_26990 6875 7780 gene locus_tag LOCUS_27000 gene ispE 6875 7780 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099284.1 protein_id gnl|my_center|LOCUS_27000 >Feature sequence100 <1 715 gene locus_tag LOCUS_27010 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941057.1:inorganic phosphate transporter 727 1347 gene locus_tag LOCUS_27020 727 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 3425 1350 gene locus_tag LOCUS_27030 3425 1350 CDS product bifunctional DedA family/phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038389.1 protein_id gnl|my_center|LOCUS_27030 3923 3486 gene locus_tag LOCUS_27040 gene moaE 3923 3486 CDS product molybdopterin synthase catalytic subunit MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266803.1 protein_id gnl|my_center|LOCUS_27040 4159 3926 gene locus_tag LOCUS_27050 gene moaD 4159 3926 CDS product molybdopterin synthase sulfur carrier subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005418589.1 protein_id gnl|my_center|LOCUS_27050 4196 4759 gene locus_tag LOCUS_27060 gene moaC 4196 4759 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_27060 5771 5277 gene locus_tag LOCUS_27070 5771 5277 CDS product DUF1810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968595.1 protein_id gnl|my_center|LOCUS_27070 7355 6060 gene locus_tag LOCUS_27080 7355 6060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27080 >Feature sequence101 1567 425 gene locus_tag LOCUS_27090 1567 425 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_27090 3902 1593 gene locus_tag LOCUS_27100 3902 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27100 4461 3895 gene locus_tag LOCUS_27110 4461 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 6583 4475 gene locus_tag LOCUS_27120 6583 4475 CDS product TonB-dependent siderophore receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001034967.1 protein_id gnl|my_center|LOCUS_27120 <7538 6846 gene locus_tag LOCUS_27130 <7538 6846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074000.1:alanine--glyoxylate aminotransferase family protein >Feature sequence102 418 2274 gene locus_tag LOCUS_27140 418 2274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 2271 4424 gene locus_tag LOCUS_27150 2271 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27150 4505 5203 gene locus_tag LOCUS_27160 4505 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 5211 5837 gene locus_tag LOCUS_27170 5211 5837 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071153.1 protein_id gnl|my_center|LOCUS_27170 6780 6127 gene locus_tag LOCUS_27180 6780 6127 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766954.1 protein_id gnl|my_center|LOCUS_27180 6728 6874 gene locus_tag LOCUS_27190 6728 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence103 778 1719 gene locus_tag LOCUS_27200 778 1719 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813145.1 protein_id gnl|my_center|LOCUS_27200 1716 2057 gene locus_tag LOCUS_27210 1716 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 2054 2950 gene locus_tag LOCUS_27220 2054 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27220 3221 3481 gene locus_tag LOCUS_27230 3221 3481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 4035 4202 gene locus_tag LOCUS_27240 4035 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27240 4297 4443 gene locus_tag LOCUS_27250 4297 4443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27250 4454 4714 gene locus_tag LOCUS_27260 4454 4714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_27260 5482 5925 gene locus_tag LOCUS_27270 5482 5925 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532088.1 protein_id gnl|my_center|LOCUS_27270 6144 5944 gene locus_tag LOCUS_27280 6144 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence104 <1 1076 gene locus_tag LOCUS_27290 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005769613.1:beta-ketoacyl-ACP synthase I 1217 3616 gene locus_tag LOCUS_27300 1217 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 3643 4482 gene locus_tag LOCUS_27310 3643 4482 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947156.1 protein_id gnl|my_center|LOCUS_27310 4482 5447 gene locus_tag LOCUS_27320 4482 5447 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_27320 5444 5977 gene locus_tag LOCUS_27330 5444 5977 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142456.1 protein_id gnl|my_center|LOCUS_27330 5998 6798 gene locus_tag LOCUS_27340 5998 6798 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_27340 >Feature sequence105 243 317 gene locus_tag LOCUS_t00390 243 317 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 654 1607 gene locus_tag LOCUS_27350 654 1607 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931310.1 protein_id gnl|my_center|LOCUS_27350 1795 2448 gene locus_tag LOCUS_27360 1795 2448 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948352.1 protein_id gnl|my_center|LOCUS_27360 2491 3072 gene locus_tag LOCUS_27370 gene pth 2491 3072 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099278.1 protein_id gnl|my_center|LOCUS_27370 3200 4291 gene locus_tag LOCUS_27380 gene ychF 3200 4291 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693776.1 protein_id gnl|my_center|LOCUS_27380 4500 4576 gene locus_tag LOCUS_t00400 4500 4576 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5008 6021 gene locus_tag LOCUS_27390 5008 6021 CDS product ISL3-like element ISEc53 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000343765.1 protein_id gnl|my_center|LOCUS_27390 <6655 6070 gene locus_tag LOCUS_27400 <6655 6070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144321.1:nucleotidyl transferase AbiEii/AbiGii toxin family protein >Feature sequence106 2 403 gene locus_tag LOCUS_27410 2 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 400 1695 gene locus_tag LOCUS_27420 400 1695 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_27420 2107 3291 gene locus_tag LOCUS_27430 2107 3291 CDS product IS1380 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064987376.1 protein_id gnl|my_center|LOCUS_27430 4603 3842 gene locus_tag LOCUS_27440 4603 3842 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582486.1 protein_id gnl|my_center|LOCUS_27440 5945 4638 gene locus_tag LOCUS_27450 5945 4638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 >Feature sequence107 88 519 gene locus_tag LOCUS_27460 gene tnpA 88 519 CDS product IS200/IS605-like element ISDra9 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888562.1 protein_id gnl|my_center|LOCUS_27460 695 1525 gene locus_tag LOCUS_27470 gene pstB 695 1525 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096663.1 protein_id gnl|my_center|LOCUS_27470 1559 2272 gene locus_tag LOCUS_27480 gene phoU 1559 2272 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096661.1 protein_id gnl|my_center|LOCUS_27480 3355 2372 gene locus_tag LOCUS_27490 gene hemB 3355 2372 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704123.1 protein_id gnl|my_center|LOCUS_27490 4693 3638 gene locus_tag LOCUS_27500 4693 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27500 >Feature sequence108 1419 784 gene locus_tag LOCUS_27510 gene leuD 1419 784 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222556.1 protein_id gnl|my_center|LOCUS_27510 3063 1639 gene locus_tag LOCUS_27520 gene leuC 3063 1639 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091399.1 protein_id gnl|my_center|LOCUS_27520 3196 4080 gene locus_tag LOCUS_27530 3196 4080 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091401.1 protein_id gnl|my_center|LOCUS_27530 4727 4242 gene locus_tag LOCUS_27540 4727 4242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 5114 5791 gene locus_tag LOCUS_27550 5114 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 6010 5816 gene locus_tag LOCUS_27560 6010 5816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 >Feature sequence109 713 988 gene locus_tag LOCUS_27570 gene cdd1 713 988 CDS product protein Cdd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888450.1 protein_id gnl|my_center|LOCUS_27570 985 1584 gene locus_tag LOCUS_27580 985 1584 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_27580 1581 2381 gene locus_tag LOCUS_27590 gene fetB 1581 2381 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090794.1 protein_id gnl|my_center|LOCUS_27590 2676 4091 gene locus_tag LOCUS_27600 gene hemW 2676 4091 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170072.1 protein_id gnl|my_center|LOCUS_27600 4958 4116 gene locus_tag LOCUS_27610 4958 4116 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143348.1 protein_id gnl|my_center|LOCUS_27610 5283 5957 gene locus_tag LOCUS_27620 5283 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27620 >Feature sequence110 2988 43 gene locus_tag LOCUS_27630 2988 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 3327 3004 gene locus_tag LOCUS_27640 3327 3004 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036917.1 protein_id gnl|my_center|LOCUS_27640 3715 4230 gene locus_tag LOCUS_27650 3715 4230 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393013.1 protein_id gnl|my_center|LOCUS_27650 <5471 4743 gene locus_tag LOCUS_27660 <5471 4743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011035598.1:integron integrase >Feature sequence111 1072 1650 gene locus_tag LOCUS_27670 gene napC 1072 1650 CDS product cytochrome c-type protein NapC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208531.1 protein_id gnl|my_center|LOCUS_27670 1653 2630 gene locus_tag LOCUS_27680 1653 2630 CDS product ankyrin repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016207.1 protein_id gnl|my_center|LOCUS_27680 2795 3304 gene locus_tag LOCUS_27690 2795 3304 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206818147.1 protein_id gnl|my_center|LOCUS_27690 3317 4615 gene locus_tag LOCUS_27700 3317 4615 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069810832.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence112 780 214 gene locus_tag LOCUS_27710 gene dcd 780 214 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381535.1 protein_id gnl|my_center|LOCUS_27710 2096 1005 gene locus_tag LOCUS_27720 gene apbC 2096 1005 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_27720 2417 4504 gene locus_tag LOCUS_27730 gene metG 2417 4504 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211829411.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence113 <1 2728 gene locus_tag LOCUS_27740 <1 2728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258766.1:DNA primase 2728 3810 gene locus_tag LOCUS_27750 gene xerD 2728 3810 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003547075.1 protein_id gnl|my_center|LOCUS_27750 4622 4852 gene locus_tag LOCUS_27760 4622 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27760 >Feature sequence114 737 2368 gene locus_tag LOCUS_27770 737 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2424 4028 gene locus_tag LOCUS_27780 2424 4028 CDS product inactive transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261592.1 protein_id gnl|my_center|LOCUS_27780 4021 4953 gene locus_tag LOCUS_27790 4021 4953 CDS product alpha-L-glutamate ligase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161797774.1 protein_id gnl|my_center|LOCUS_27790 >Feature sequence115 910 296 gene locus_tag LOCUS_27800 910 296 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089752.1 protein_id gnl|my_center|LOCUS_27800 1512 988 gene locus_tag LOCUS_27810 1512 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27810 2968 1724 gene locus_tag LOCUS_27820 2968 1724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 3373 3585 gene locus_tag LOCUS_27830 3373 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 3701 3847 gene locus_tag LOCUS_27840 3701 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 4000 4461 gene locus_tag LOCUS_27850 4000 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27850 4525 4908 gene locus_tag LOCUS_27860 4525 4908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27860 >Feature sequence116 620 99 gene locus_tag LOCUS_27870 620 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27870 2273 828 gene locus_tag LOCUS_27880 2273 828 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947022.1 protein_id gnl|my_center|LOCUS_27880 2941 2300 gene locus_tag LOCUS_27890 gene pmrA 2941 2300 CDS product two-component system response regulator PrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102236.1 protein_id gnl|my_center|LOCUS_27890 3748 3182 gene locus_tag LOCUS_27900 3748 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27900 3871 4530 gene locus_tag LOCUS_27910 gene nfi 3871 4530 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258210.1 protein_id gnl|my_center|LOCUS_27910 >Feature sequence117 <1 519 gene locus_tag LOCUS_27920 <1 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073166.1:cytochrome d ubiquinol oxidase subunit II 668 2407 gene locus_tag LOCUS_27930 gene cydD 668 2407 CDS product thiol reductant ABC exporter subunit CydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461540.1 protein_id gnl|my_center|LOCUS_27930 2404 4146 gene locus_tag LOCUS_27940 gene cydC 2404 4146 CDS product thiol reductant ABC exporter subunit CydC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941873.1 protein_id gnl|my_center|LOCUS_27940 >Feature sequence118 471 1355 gene locus_tag LOCUS_27950 gene htpX 471 1355 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037436.1 protein_id gnl|my_center|LOCUS_27950 2398 1382 gene locus_tag LOCUS_27960 gene epmB 2398 1382 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_27960 2446 3018 gene locus_tag LOCUS_27970 gene efp 2446 3018 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444882.1 protein_id gnl|my_center|LOCUS_27970 3023 3991 gene locus_tag LOCUS_27980 gene epmA 3023 3991 CDS product elongation factor P--(R)-beta-lysine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770152.1 protein_id gnl|my_center|LOCUS_27980 4337 4702 gene locus_tag LOCUS_27990 4337 4702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27990 >Feature sequence119 1226 357 gene locus_tag LOCUS_28000 1226 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28000 2924 1236 gene locus_tag LOCUS_28010 2924 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 3263 4408 gene locus_tag LOCUS_28020 gene bshA 3263 4408 CDS product N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000690025.1 protein_id gnl|my_center|LOCUS_28020 >Feature sequence120 1650 1468 gene locus_tag LOCUS_28030 1650 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1696 4449 gene locus_tag LOCUS_28040 1696 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 >Feature sequence121 725 649 gene locus_tag LOCUS_t00410 725 649 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1797 778 gene locus_tag LOCUS_28050 gene ispB 1797 778 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704869.1 protein_id gnl|my_center|LOCUS_28050 1987 2298 gene locus_tag LOCUS_28060 gene rplU 1987 2298 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417305.1 protein_id gnl|my_center|LOCUS_28060 2322 2579 gene locus_tag LOCUS_28070 gene rpmA 2322 2579 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210179.1 protein_id gnl|my_center|LOCUS_28070 2734 3804 gene locus_tag LOCUS_28080 gene cgtA 2734 3804 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_28080 >Feature sequence122 1294 320 gene locus_tag LOCUS_28090 1294 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28090 1984 1508 gene locus_tag LOCUS_28100 1984 1508 CDS product DUF1249 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102067.1 protein_id gnl|my_center|LOCUS_28100 2705 1989 gene locus_tag LOCUS_28110 2705 1989 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705288.1 protein_id gnl|my_center|LOCUS_28110 3590 2994 gene locus_tag LOCUS_28120 gene recR 3590 2994 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005626527.1 protein_id gnl|my_center|LOCUS_28120 3944 3621 gene locus_tag LOCUS_28130 3944 3621 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087236.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence123 509 180 gene locus_tag LOCUS_28140 509 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1494 589 gene locus_tag LOCUS_28150 1494 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 1911 1510 gene locus_tag LOCUS_28160 1911 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28160 2957 1911 gene locus_tag LOCUS_28170 2957 1911 CDS product phage protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002232421.1 protein_id gnl|my_center|LOCUS_28170 3309 3836 gene locus_tag LOCUS_28180 3309 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 >Feature sequence124 2179 8 gene locus_tag LOCUS_28190 2179 8 CDS product type I secretion system permease/ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836919.1 protein_id gnl|my_center|LOCUS_28190 >Feature sequence125 <1 1198 gene locus_tag LOCUS_28200 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061458.1:nitrite reductase large subunit NirB 1202 1519 gene locus_tag LOCUS_28210 gene nirD 1202 1519 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_28210 1695 3899 gene locus_tag LOCUS_28220 1695 3899 CDS product nitrate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393409.1 protein_id gnl|my_center|LOCUS_28220 >Feature sequence126 <4076 340 gene locus_tag LOCUS_28230 <4076 340 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000139499.1:ATP-dependent RNA helicase HrpA >Feature sequence127 1230 688 gene locus_tag LOCUS_28240 1230 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28240 1468 1316 gene locus_tag LOCUS_28250 1468 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28250 2051 1794 gene locus_tag LOCUS_28260 2051 1794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 2327 2139 gene locus_tag LOCUS_28270 2327 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28270 <3934 2931 gene locus_tag LOCUS_28280 <3934 2931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957661.1:leucine--tRNA ligase >Feature sequence128 <1 1903 gene locus_tag LOCUS_28290 <1 1903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024299434.1:transcription-repair coupling factor 3553 1934 gene locus_tag LOCUS_28300 3553 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 >Feature sequence129 548 330 gene locus_tag LOCUS_28310 gene ccoS 548 330 CDS product cbb3-type cytochrome oxidase assembly protein CcoS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391070.1 protein_id gnl|my_center|LOCUS_28310 3052 539 gene locus_tag LOCUS_28320 3052 539 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_28320 3576 3049 gene locus_tag LOCUS_28330 3576 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 >Feature sequence130 971 2668 gene locus_tag LOCUS_28340 971 2668 CDS product glycerol-3-phosphate dehydrogenase/oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222839.1 protein_id gnl|my_center|LOCUS_28340 >Feature sequence131 >Feature sequence132 223 864 gene locus_tag LOCUS_28350 223 864 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193001.1 protein_id gnl|my_center|LOCUS_28350 939 1160 gene locus_tag LOCUS_28360 939 1160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1195 1977 gene locus_tag LOCUS_28370 1195 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28370 1994 2215 gene locus_tag LOCUS_28380 1994 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28380 2218 2646 gene locus_tag LOCUS_28390 2218 2646 CDS product GFA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068930417.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence133 75 257 gene locus_tag LOCUS_28400 75 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28400 257 1306 gene locus_tag LOCUS_28410 257 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28410 1328 2935 gene locus_tag LOCUS_28420 1328 2935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28420 >Feature sequence134 <1 1834 gene locus_tag LOCUS_28430 <1 1834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530462.1:nitrate reductase 2507 3064 gene locus_tag LOCUS_28440 2507 3064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence135 1287 817 gene locus_tag LOCUS_28450 1287 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28450 1388 1726 gene locus_tag LOCUS_28460 1388 1726 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258292.1 protein_id gnl|my_center|LOCUS_28460 1723 2412 gene locus_tag LOCUS_28470 gene yrfG 1723 2412 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_28470 2915 2487 gene locus_tag LOCUS_28480 2915 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence136 50 799 gene locus_tag LOCUS_28490 50 799 CDS product class III extradiol ring-cleavage dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072011.1 protein_id gnl|my_center|LOCUS_28490 1005 1151 gene locus_tag LOCUS_28500 1005 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 1435 1971 gene locus_tag LOCUS_28510 1435 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28510 2292 2089 gene locus_tag LOCUS_28520 2292 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence137 709 1800 gene locus_tag LOCUS_28530 709 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 2805 1801 gene locus_tag LOCUS_28540 2805 1801 CDS product DUF3187 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943756.1 protein_id gnl|my_center|LOCUS_28540 >Feature sequence138 1160 2596 gene locus_tag LOCUS_28550 1160 2596 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927109.1 protein_id gnl|my_center|LOCUS_28550 >Feature sequence139 1530 85 gene locus_tag LOCUS_28560 1530 85 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940696.1 protein_id gnl|my_center|LOCUS_28560 1893 2690 gene locus_tag LOCUS_28570 1893 2690 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_28570 >Feature sequence140 1475 2089 gene locus_tag LOCUS_28580 1475 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 2099 2467 gene locus_tag LOCUS_28590 2099 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 >Feature sequence141 1536 625 gene locus_tag LOCUS_28600 1536 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28600 2285 1647 gene locus_tag LOCUS_28610 2285 1647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28610 2722 2282 gene locus_tag LOCUS_28620 2722 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 >Feature sequence142 1104 667 gene locus_tag LOCUS_28630 1104 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28630 1820 1362 gene locus_tag LOCUS_28640 1820 1362 CDS product TerB family tellurite resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454910.1 protein_id gnl|my_center|LOCUS_28640 2527 1829 gene locus_tag LOCUS_28650 2527 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 >Feature sequence143 322 471 gene locus_tag LOCUS_28660 322 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28660 594 785 gene locus_tag LOCUS_28670 594 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 1741 908 gene locus_tag LOCUS_28680 1741 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28680 1926 1780 gene locus_tag LOCUS_28690 1926 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28690 2433 2116 gene locus_tag LOCUS_28700 2433 2116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2676 2485 gene locus_tag LOCUS_28710 2676 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28710 >Feature sequence144 <1 1534 gene locus_tag LOCUS_28720 <1 1534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393352.1:glycosyltransferase family 1 protein 2674 1598 gene locus_tag LOCUS_28730 2674 1598 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927125.1 protein_id gnl|my_center|LOCUS_28730 >Feature sequence145 731 273 gene locus_tag LOCUS_28740 731 273 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941646.1 protein_id gnl|my_center|LOCUS_28740 <2617 746 gene locus_tag LOCUS_28750 <2617 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941642.1:phage tail sheath family protein >Feature sequence146 1277 609 gene locus_tag LOCUS_28760 gene bioD 1277 609 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203536601.1 protein_id gnl|my_center|LOCUS_28760 2174 1284 gene locus_tag LOCUS_28770 gene bioC 2174 1284 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence147 875 693 gene locus_tag LOCUS_28780 gene rpmF 875 693 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002214744.1 protein_id gnl|my_center|LOCUS_28780 1430 903 gene locus_tag LOCUS_28790 1430 903 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091144.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence148 <1 1277 gene locus_tag LOCUS_28800 <1 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003121316.1:phosphate regulon sensor histidine kinase PhoR >Feature sequence149 738 346 gene locus_tag LOCUS_28810 gene gloA 738 346 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_28810 1157 786 gene locus_tag LOCUS_28820 1157 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 <2041 1287 gene locus_tag LOCUS_28830 <2041 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093038.1:PhoH family protein >Feature sequence150 >Feature sequence151 >Feature sequence152 519 244 gene locus_tag LOCUS_28840 519 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 1737 685 gene locus_tag LOCUS_28850 1737 685 CDS product glutathione synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973597.1 protein_id gnl|my_center|LOCUS_28850 >Feature sequence153 1509 19 gene locus_tag LOCUS_28860 1509 19 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707724.1 protein_id gnl|my_center|LOCUS_28860 >Feature sequence154 >Feature sequence155 1175 72 gene locus_tag LOCUS_28870 gene recA 1175 72 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092260.1 protein_id gnl|my_center|LOCUS_28870 >Feature sequence156 1467 76 gene locus_tag LOCUS_28880 gene argH 1467 76 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114030.1 protein_id gnl|my_center|LOCUS_28880 >Feature sequence157 338 580 gene locus_tag LOCUS_28890 338 580 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089086.1 protein_id gnl|my_center|LOCUS_28890 >Feature sequence158 1328 735 gene locus_tag LOCUS_28900 gene hisB 1328 735 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_28900 >Feature sequence159 1021 554 gene locus_tag LOCUS_28910 gene trmL 1021 554 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703791.1 protein_id gnl|my_center|LOCUS_28910 <1659 1025 gene locus_tag LOCUS_28920 <1659 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003104661.1:two-component system response regulator NtrC >Feature sequence160 948 193 gene locus_tag LOCUS_28930 948 193 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880615.1 protein_id gnl|my_center|LOCUS_28930 1327 959 gene locus_tag LOCUS_28940 1327 959 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256185.1 protein_id gnl|my_center|LOCUS_28940 >Feature sequence161 876 400 gene locus_tag LOCUS_28950 876 400 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186402.1 protein_id gnl|my_center|LOCUS_28950 1223 867 gene locus_tag LOCUS_28960 1223 867 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958235.1 protein_id gnl|my_center|LOCUS_28960 >Feature sequence162 41 448 gene locus_tag LOCUS_28970 41 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 597 794 gene locus_tag LOCUS_28980 597 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28980 1474 884 gene locus_tag LOCUS_28990 1474 884 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327496.1 protein_id gnl|my_center|LOCUS_28990