>Feature sequence0001 1346 42 gene locus_tag LOCUS_00010 1346 42 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063709.1 protein_id gnl|my_center|LOCUS_00010 1871 1359 gene locus_tag LOCUS_00020 1871 1359 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172862.1 protein_id gnl|my_center|LOCUS_00020 2949 1945 gene locus_tag LOCUS_00030 gene dctP 2949 1945 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063711.1 protein_id gnl|my_center|LOCUS_00030 4943 3198 gene locus_tag LOCUS_00040 4943 3198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 6345 4930 gene locus_tag LOCUS_00050 6345 4930 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943098.1 protein_id gnl|my_center|LOCUS_00050 8531 6378 gene locus_tag LOCUS_00060 8531 6378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00060 9433 8591 gene locus_tag LOCUS_00070 9433 8591 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_00070 9919 9554 gene locus_tag LOCUS_00080 9919 9554 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939487.1 protein_id gnl|my_center|LOCUS_00080 11375 10110 gene locus_tag LOCUS_00090 11375 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 11688 12179 gene locus_tag LOCUS_00100 11688 12179 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037309.1 protein_id gnl|my_center|LOCUS_00100 12293 12610 gene locus_tag LOCUS_00110 12293 12610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 12635 12919 gene locus_tag LOCUS_00120 12635 12919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 >Feature sequence0002 <1 789 gene locus_tag LOCUS_00130 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941616.1:ABC transporter permease 791 1480 gene locus_tag LOCUS_00140 791 1480 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_00140 1804 2979 gene locus_tag LOCUS_00150 1804 2979 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967833.1 protein_id gnl|my_center|LOCUS_00150 2987 3403 gene locus_tag LOCUS_00160 2987 3403 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_00160 3807 4655 gene locus_tag LOCUS_00170 3807 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 4652 5020 gene locus_tag LOCUS_00180 4652 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 5648 4983 gene locus_tag LOCUS_00190 5648 4983 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_00190 6084 7712 gene locus_tag LOCUS_00200 gene hcp 6084 7712 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791786.1 protein_id gnl|my_center|LOCUS_00200 7857 8438 gene locus_tag LOCUS_00210 7857 8438 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938888.1 protein_id gnl|my_center|LOCUS_00210 >Feature sequence0003 732 187 gene locus_tag LOCUS_00220 732 187 CDS product RsbRD N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393113.1 protein_id gnl|my_center|LOCUS_00220 2946 817 gene locus_tag LOCUS_00230 2946 817 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_00230 3622 2996 gene locus_tag LOCUS_00240 gene yedF 3622 2996 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391672.1 protein_id gnl|my_center|LOCUS_00240 4593 3670 gene locus_tag LOCUS_00250 4593 3670 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_00250 5640 4696 gene locus_tag LOCUS_00260 5640 4696 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_00260 6269 6093 gene locus_tag LOCUS_00270 6269 6093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 7047 6262 gene locus_tag LOCUS_00280 7047 6262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 7822 7121 gene locus_tag LOCUS_00290 7822 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 <8776 7966 gene locus_tag LOCUS_00300 <8776 7966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002557127.1:elongation factor G >Feature sequence0004 3759 2452 gene locus_tag LOCUS_00310 gene nhaA 3759 2452 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_00310 4809 3868 gene locus_tag LOCUS_00320 4809 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 4831 5010 gene locus_tag LOCUS_00330 4831 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 5384 5097 gene locus_tag LOCUS_00340 5384 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 5516 5613 gene locus_tag LOCUS_t00010 5516 5613 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 6516 5638 gene locus_tag LOCUS_00350 gene glyQ 6516 5638 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941241.1 protein_id gnl|my_center|LOCUS_00350 6756 7163 gene locus_tag LOCUS_00360 6756 7163 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence0005 4483 1112 gene locus_tag LOCUS_00370 4483 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 5457 4516 gene locus_tag LOCUS_00380 5457 4516 CDS product sensor domain-containing diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104500.1 protein_id gnl|my_center|LOCUS_00380 5717 7918 gene locus_tag LOCUS_00390 gene rlmKL 5717 7918 CDS product bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113961.1 protein_id gnl|my_center|LOCUS_00390 >Feature sequence0006 1752 247 gene locus_tag LOCUS_00400 gene fliC 1752 247 CDS product B-type flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112503.1 protein_id gnl|my_center|LOCUS_00400 3998 2517 gene locus_tag LOCUS_00410 3998 2517 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947070.1 protein_id gnl|my_center|LOCUS_00410 4255 4052 gene locus_tag LOCUS_00420 4255 4052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 4867 4433 gene locus_tag LOCUS_00430 4867 4433 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198267.1 protein_id gnl|my_center|LOCUS_00430 5154 4864 gene locus_tag LOCUS_00440 5154 4864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 6317 5343 gene locus_tag LOCUS_00450 gene flgL 6317 5343 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943668.1 protein_id gnl|my_center|LOCUS_00450 7733 6321 gene locus_tag LOCUS_00460 gene flgK 7733 6321 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_00460 >Feature sequence0007 2139 2669 gene locus_tag LOCUS_00470 gene pal 2139 2669 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_00470 2848 3381 gene locus_tag LOCUS_00480 2848 3381 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939643.1 protein_id gnl|my_center|LOCUS_00480 3609 4436 gene locus_tag LOCUS_00490 3609 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 4426 5427 gene locus_tag LOCUS_00500 gene rfaE1 4426 5427 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546729.1 protein_id gnl|my_center|LOCUS_00500 5506 6387 gene locus_tag LOCUS_00510 5506 6387 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811868.1 protein_id gnl|my_center|LOCUS_00510 6460 6915 gene locus_tag LOCUS_00520 6460 6915 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_00520 6926 7225 gene locus_tag LOCUS_00530 6926 7225 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545639.1 protein_id gnl|my_center|LOCUS_00530 >Feature sequence0008 196 1755 gene locus_tag LOCUS_00540 gene eam 196 1755 CDS product glutamate 2,3-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817444.1 protein_id gnl|my_center|LOCUS_00540 1777 2958 gene locus_tag LOCUS_00550 1777 2958 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267549.1 protein_id gnl|my_center|LOCUS_00550 3690 3196 gene locus_tag LOCUS_00560 3690 3196 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_00560 5781 3700 gene locus_tag LOCUS_00570 5781 3700 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_00570 6994 6017 gene locus_tag LOCUS_00580 6994 6017 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_00580 >Feature sequence0009 <1 766 gene locus_tag LOCUS_00590 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943483.1:50S ribosomal protein L2 881 1153 gene locus_tag LOCUS_00600 gene rpsS 881 1153 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943482.1 protein_id gnl|my_center|LOCUS_00600 1189 1524 gene locus_tag LOCUS_00610 gene rplV 1189 1524 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003486710.1 protein_id gnl|my_center|LOCUS_00610 1589 2236 gene locus_tag LOCUS_00620 gene rpsC 1589 2236 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545204.1 protein_id gnl|my_center|LOCUS_00620 2357 2725 gene locus_tag LOCUS_00630 gene rplP 2357 2725 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000950835.1 protein_id gnl|my_center|LOCUS_00630 2722 2913 gene locus_tag LOCUS_00640 gene rpmC 2722 2913 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_00640 3268 3636 gene locus_tag LOCUS_00650 gene rplN 3268 3636 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_00650 3684 4022 gene locus_tag LOCUS_00660 gene rplX 3684 4022 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_00660 4050 4592 gene locus_tag LOCUS_00670 gene rplE 4050 4592 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225809.1 protein_id gnl|my_center|LOCUS_00670 4638 4823 gene locus_tag LOCUS_00680 4638 4823 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943473.1 protein_id gnl|my_center|LOCUS_00680 4908 5306 gene locus_tag LOCUS_00690 gene rpsH 4908 5306 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_00690 5337 5885 gene locus_tag LOCUS_00700 gene rplF 5337 5885 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723683.1 protein_id gnl|my_center|LOCUS_00700 5910 6275 gene locus_tag LOCUS_00710 gene rplR 5910 6275 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000623881.1 protein_id gnl|my_center|LOCUS_00710 6341 6853 gene locus_tag LOCUS_00720 gene rpsE 6341 6853 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_00720 6885 7064 gene locus_tag LOCUS_00730 gene rpmD 6885 7064 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943468.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence0010 1252 749 gene locus_tag LOCUS_00740 1252 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 2330 1338 gene locus_tag LOCUS_00750 2330 1338 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811594.1 protein_id gnl|my_center|LOCUS_00750 2744 3454 gene locus_tag LOCUS_00760 2744 3454 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938322.1 protein_id gnl|my_center|LOCUS_00760 3898 3470 gene locus_tag LOCUS_00770 3898 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 4347 4204 gene locus_tag LOCUS_00780 4347 4204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 4964 5452 gene locus_tag LOCUS_00790 4964 5452 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938329.1 protein_id gnl|my_center|LOCUS_00790 5498 6766 gene locus_tag LOCUS_00800 5498 6766 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880567.1 protein_id gnl|my_center|LOCUS_00800 >Feature sequence0011 3189 496 gene locus_tag LOCUS_00810 3189 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 3607 3759 gene locus_tag LOCUS_00820 3607 3759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 5298 3772 gene locus_tag LOCUS_00830 5298 3772 CDS product mercuric reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140567.1 protein_id gnl|my_center|LOCUS_00830 6046 5288 gene locus_tag LOCUS_00840 6046 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 6392 6619 gene locus_tag LOCUS_00850 6392 6619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 6982 6695 gene locus_tag LOCUS_00860 6982 6695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 >Feature sequence0012 <1 1624 gene locus_tag LOCUS_00870 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038389.1:bifunctional DedA family/phosphatase PAP2 family protein 2164 2445 gene locus_tag LOCUS_00880 2164 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 2553 3791 gene locus_tag LOCUS_00890 2553 3791 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_00890 3788 4918 gene locus_tag LOCUS_00900 3788 4918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 5449 4910 gene locus_tag LOCUS_00910 gene aroK 5449 4910 CDS product shikimate kinase AroK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095833.1 protein_id gnl|my_center|LOCUS_00910 5742 6860 gene locus_tag LOCUS_00920 5742 6860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 >Feature sequence0013 1588 2178 gene locus_tag LOCUS_00930 1588 2178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 2521 3027 gene locus_tag LOCUS_00940 2521 3027 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_00940 3027 3353 gene locus_tag LOCUS_00950 3027 3353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 3375 3632 gene locus_tag LOCUS_00960 3375 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 3632 4003 gene locus_tag LOCUS_00970 3632 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 4508 5314 gene locus_tag LOCUS_00980 4508 5314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 6959 5334 gene locus_tag LOCUS_00990 6959 5334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 >Feature sequence0014 <1 1308 gene locus_tag LOCUS_01000 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038053.1:ATP-dependent DNA helicase 1295 2305 gene locus_tag LOCUS_01010 1295 2305 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941971.1 protein_id gnl|my_center|LOCUS_01010 2306 3214 gene locus_tag LOCUS_01020 2306 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 3325 3960 gene locus_tag LOCUS_01030 gene cobC 3325 3960 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812873.1 protein_id gnl|my_center|LOCUS_01030 4440 4054 gene locus_tag LOCUS_01040 4440 4054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 6022 4463 gene locus_tag LOCUS_01050 gene cobA 6022 4463 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938035.1 protein_id gnl|my_center|LOCUS_01050 <6928 6019 gene locus_tag LOCUS_01060 <6928 6019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016349245.1:hydroxymethylbilane synthase >Feature sequence0015 2867 966 gene locus_tag LOCUS_01070 2867 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 4541 3339 gene locus_tag LOCUS_01080 4541 3339 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682387.1 protein_id gnl|my_center|LOCUS_01080 5085 4645 gene locus_tag LOCUS_01090 5085 4645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 <6685 5082 gene locus_tag LOCUS_01100 <6685 5082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100154.1:penicillin-binding protein 1B >Feature sequence0016 1712 852 gene locus_tag LOCUS_01110 1712 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 2759 1725 gene locus_tag LOCUS_01120 2759 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 3646 3071 gene locus_tag LOCUS_01130 3646 3071 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_01130 4256 3651 gene locus_tag LOCUS_01140 4256 3651 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942116.1 protein_id gnl|my_center|LOCUS_01140 5095 4253 gene locus_tag LOCUS_01150 5095 4253 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939232.1 protein_id gnl|my_center|LOCUS_01150 6268 5129 gene locus_tag LOCUS_01160 6268 5129 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939231.1 protein_id gnl|my_center|LOCUS_01160 >Feature sequence0017 1132 98 gene locus_tag LOCUS_01170 1132 98 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583756.1 protein_id gnl|my_center|LOCUS_01170 2210 1101 gene locus_tag LOCUS_01180 2210 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 2959 2441 gene locus_tag LOCUS_01190 2959 2441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 3527 2982 gene locus_tag LOCUS_01200 gene orn 3527 2982 CDS product oligoribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095671.1 protein_id gnl|my_center|LOCUS_01200 4336 3593 gene locus_tag LOCUS_01210 4336 3593 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932563.1 protein_id gnl|my_center|LOCUS_01210 6151 4616 gene locus_tag LOCUS_01220 6151 4616 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932564.1 protein_id gnl|my_center|LOCUS_01220 >Feature sequence0018 1284 1369 gene locus_tag LOCUS_t00020 1284 1369 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1526 2866 gene locus_tag LOCUS_01230 gene tig 1526 2866 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942437.1 protein_id gnl|my_center|LOCUS_01230 3137 3745 gene locus_tag LOCUS_01240 gene clpP 3137 3745 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_01240 3742 5004 gene locus_tag LOCUS_01250 gene clpX 3742 5004 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942435.1 protein_id gnl|my_center|LOCUS_01250 >Feature sequence0019 2272 695 gene locus_tag LOCUS_01260 2272 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 2354 3025 gene locus_tag LOCUS_01270 2354 3025 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080979.1 protein_id gnl|my_center|LOCUS_01270 4251 3331 gene locus_tag LOCUS_01280 gene epmA 4251 3331 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_01280 4873 4310 gene locus_tag LOCUS_01290 gene efp 4873 4310 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_01290 5081 5578 gene locus_tag LOCUS_01300 5081 5578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 5602 6084 gene locus_tag LOCUS_01310 5602 6084 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942345.1 protein_id gnl|my_center|LOCUS_01310 >Feature sequence0020 1780 761 gene locus_tag LOCUS_01320 1780 761 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_01320 2220 2906 gene locus_tag LOCUS_01330 gene bioD 2220 2906 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795149.1 protein_id gnl|my_center|LOCUS_01330 3137 3997 gene locus_tag LOCUS_01340 3137 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 4218 5432 gene locus_tag LOCUS_01350 4218 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 >Feature sequence0021 2738 1827 gene locus_tag LOCUS_01360 gene trxB 2738 1827 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_01360 4850 3162 gene locus_tag LOCUS_01370 4850 3162 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943977.1 protein_id gnl|my_center|LOCUS_01370 <5888 4865 gene locus_tag LOCUS_01380 <5888 4865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545418.1:glutamate--tRNA ligase >Feature sequence0022 2502 1093 gene locus_tag LOCUS_01390 gene dnaB 2502 1093 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_01390 3183 2698 gene locus_tag LOCUS_01400 gene rplI 3183 2698 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_01400 4304 3336 gene locus_tag LOCUS_01410 4304 3336 CDS product YybS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941328.1 protein_id gnl|my_center|LOCUS_01410 4562 4323 gene locus_tag LOCUS_01420 4562 4323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 5146 4676 gene locus_tag LOCUS_01430 5146 4676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 >Feature sequence0023 1912 3423 gene locus_tag LOCUS_01440 gene lysS 1912 3423 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_01440 3513 3803 gene locus_tag LOCUS_01450 3513 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 3909 5132 gene locus_tag LOCUS_01460 3909 5132 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_01460 5125 5841 gene locus_tag LOCUS_01470 5125 5841 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence0024 3027 3215 gene locus_tag LOCUS_01480 3027 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3145 3993 gene locus_tag LOCUS_01490 gene galU 3145 3993 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009890959.1 protein_id gnl|my_center|LOCUS_01490 4142 4612 gene locus_tag LOCUS_01500 4142 4612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 4605 4793 gene locus_tag LOCUS_01510 4605 4793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 >Feature sequence0025 1050 601 gene locus_tag LOCUS_01520 gene dtd 1050 601 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426448.1 protein_id gnl|my_center|LOCUS_01520 1310 1152 gene locus_tag LOCUS_01530 1310 1152 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_01530 2165 1428 gene locus_tag LOCUS_01540 2165 1428 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105300.1 protein_id gnl|my_center|LOCUS_01540 3718 2168 gene locus_tag LOCUS_01550 gene sbtM 3718 2168 CDS product thio(seleno)oxazole modification radical SAM maturase SbtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045007.1 protein_id gnl|my_center|LOCUS_01550 4068 3853 gene locus_tag LOCUS_01560 4068 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 4878 4369 gene locus_tag LOCUS_01570 gene dfrA 4878 4369 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637205.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence0026 1249 17 gene locus_tag LOCUS_01580 1249 17 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403144.1 protein_id gnl|my_center|LOCUS_01580 2882 1386 gene locus_tag LOCUS_01590 2882 1386 CDS product lytic transglycosylase F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704053.1 protein_id gnl|my_center|LOCUS_01590 4255 2927 gene locus_tag LOCUS_01600 4255 2927 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_01600 4758 4252 gene locus_tag LOCUS_01610 4758 4252 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_01610 <5551 4969 gene locus_tag LOCUS_01620 <5551 4969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001123234.1:TRAP transporter substrate-binding protein >Feature sequence0027 760 1641 gene locus_tag LOCUS_01630 760 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 2253 1720 gene locus_tag LOCUS_01640 2253 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 2816 4000 gene locus_tag LOCUS_01650 gene mutY 2816 4000 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043629788.1 protein_id gnl|my_center|LOCUS_01650 >Feature sequence0028 582 370 gene locus_tag LOCUS_01660 582 370 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071954.1 protein_id gnl|my_center|LOCUS_01660 1126 605 gene locus_tag LOCUS_01670 1126 605 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_01670 1952 1113 gene locus_tag LOCUS_01680 1952 1113 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144685205.1 protein_id gnl|my_center|LOCUS_01680 3242 2283 gene locus_tag LOCUS_01690 gene ilvA 3242 2283 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272642.1 protein_id gnl|my_center|LOCUS_01690 4069 3239 gene locus_tag LOCUS_01700 4069 3239 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119749.1 protein_id gnl|my_center|LOCUS_01700 4347 4069 gene locus_tag LOCUS_01710 4347 4069 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943394.1 protein_id gnl|my_center|LOCUS_01710 4866 4510 gene locus_tag LOCUS_01720 4866 4510 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393074.1 protein_id gnl|my_center|LOCUS_01720 5258 4857 gene locus_tag LOCUS_01730 5258 4857 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080552.1 protein_id gnl|my_center|LOCUS_01730 >Feature sequence0029 <1 563 gene locus_tag LOCUS_01740 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941738.1:Holliday junction branch migration DNA helicase RuvB 641 1084 gene locus_tag LOCUS_01750 641 1084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1298 2134 gene locus_tag LOCUS_01760 gene panB 1298 2134 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391669.1 protein_id gnl|my_center|LOCUS_01760 2507 2878 gene locus_tag LOCUS_01770 2507 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2966 3145 gene locus_tag LOCUS_01780 2966 3145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 3423 4148 gene locus_tag LOCUS_01790 3423 4148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 4208 5089 gene locus_tag LOCUS_01800 4208 5089 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_01800 >Feature sequence0030 329 1621 gene locus_tag LOCUS_01810 329 1621 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_01810 1881 2996 gene locus_tag LOCUS_01820 gene carA 1881 2996 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_01820 >Feature sequence0031 513 4775 gene locus_tag LOCUS_01830 513 4775 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545209.1 protein_id gnl|my_center|LOCUS_01830 >Feature sequence0032 353 778 gene locus_tag LOCUS_01840 gene rplK 353 778 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003156430.1 protein_id gnl|my_center|LOCUS_01840 886 1596 gene locus_tag LOCUS_01850 gene rplA 886 1596 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_01850 2021 2539 gene locus_tag LOCUS_01860 gene rplJ 2021 2539 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940186.1 protein_id gnl|my_center|LOCUS_01860 2570 2956 gene locus_tag LOCUS_01870 gene rplL 2570 2956 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002294588.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence0033 209 898 gene locus_tag LOCUS_01880 209 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 1037 2473 gene locus_tag LOCUS_01890 1037 2473 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435615.1 protein_id gnl|my_center|LOCUS_01890 4262 2478 gene locus_tag LOCUS_01900 4262 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 4495 4923 gene locus_tag LOCUS_01910 4495 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence0034 <1 525 gene locus_tag LOCUS_01920 <1 525 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583959.1:epoxyqueuosine reductase QueH 574 1257 gene locus_tag LOCUS_01930 574 1257 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942438.1 protein_id gnl|my_center|LOCUS_01930 2444 1506 gene locus_tag LOCUS_01940 gene ppk2 2444 1506 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_01940 3632 2529 gene locus_tag LOCUS_01950 3632 2529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 >Feature sequence0035 2134 1118 gene locus_tag LOCUS_01960 gene pheS 2134 1118 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393252.1 protein_id gnl|my_center|LOCUS_01960 2498 2142 gene locus_tag LOCUS_01970 gene rplT 2498 2142 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942165.1 protein_id gnl|my_center|LOCUS_01970 2785 2588 gene locus_tag LOCUS_01980 gene rpmI 2785 2588 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965657.1 protein_id gnl|my_center|LOCUS_01980 3433 3029 gene locus_tag LOCUS_01990 3433 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 5181 3634 gene locus_tag LOCUS_02000 gene thrS 5181 3634 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence0036 1290 2282 gene locus_tag LOCUS_02010 1290 2282 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535304.1 protein_id gnl|my_center|LOCUS_02010 2285 4936 gene locus_tag LOCUS_02020 2285 4936 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387818.1 protein_id gnl|my_center|LOCUS_02020 >Feature sequence0037 54 2303 gene locus_tag LOCUS_02030 gene pilB 54 2303 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_02030 2300 3097 gene locus_tag LOCUS_02040 2300 3097 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770612.1 protein_id gnl|my_center|LOCUS_02040 4156 3311 gene locus_tag LOCUS_02050 4156 3311 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459679.1 protein_id gnl|my_center|LOCUS_02050 <5143 4168 gene locus_tag LOCUS_02060 <5143 4168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546021.1:lipopolysaccharide heptosyltransferase I >Feature sequence0038 3936 1258 gene locus_tag LOCUS_02070 gene bamA 3936 1258 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791908.1 protein_id gnl|my_center|LOCUS_02070 4808 4047 gene locus_tag LOCUS_02080 4808 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 >Feature sequence0039 <1 681 gene locus_tag LOCUS_02090 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546488.1:NADH-quinone oxidoreductase subunit NuoH 695 1315 gene locus_tag LOCUS_02100 gene nuoI 695 1315 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546584.1 protein_id gnl|my_center|LOCUS_02100 1349 1876 gene locus_tag LOCUS_02110 1349 1876 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546215.1 protein_id gnl|my_center|LOCUS_02110 1969 2271 gene locus_tag LOCUS_02120 gene nuoK 1969 2271 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_02120 2274 4460 gene locus_tag LOCUS_02130 gene nuoL 2274 4460 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence0040 758 363 gene locus_tag LOCUS_02140 758 363 CDS product bacteriohemerythrin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963397.1 protein_id gnl|my_center|LOCUS_02140 4025 777 gene locus_tag LOCUS_02150 4025 777 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941062.1 protein_id gnl|my_center|LOCUS_02150 <5096 4258 gene locus_tag LOCUS_02160 <5096 4258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337795.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0041 <1 1345 gene locus_tag LOCUS_02170 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056610.1:phosphoenolpyruvate synthase 3875 1473 gene locus_tag LOCUS_02180 3875 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 4911 3865 gene locus_tag LOCUS_02190 4911 3865 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018353.1 protein_id gnl|my_center|LOCUS_02190 >Feature sequence0042 1089 433 gene locus_tag LOCUS_02200 1089 433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 1895 1287 gene locus_tag LOCUS_02210 gene pal 1895 1287 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932322.1 protein_id gnl|my_center|LOCUS_02210 2153 2887 gene locus_tag LOCUS_02220 2153 2887 CDS product basic amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938534.1 protein_id gnl|my_center|LOCUS_02220 3083 3868 gene locus_tag LOCUS_02230 3083 3868 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792490.1 protein_id gnl|my_center|LOCUS_02230 3855 4595 gene locus_tag LOCUS_02240 3855 4595 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938532.1 protein_id gnl|my_center|LOCUS_02240 >Feature sequence0043 <1 1465 gene locus_tag LOCUS_02250 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit 1591 4356 gene locus_tag LOCUS_02260 1591 4356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence0044 2149 1322 gene locus_tag LOCUS_02270 2149 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 3845 2127 gene locus_tag LOCUS_02280 3845 2127 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_02280 4601 3996 gene locus_tag LOCUS_02290 4601 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 >Feature sequence0045 435 797 gene locus_tag LOCUS_02300 435 797 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810206.1 protein_id gnl|my_center|LOCUS_02300 794 1900 gene locus_tag LOCUS_02310 794 1900 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124950.1 protein_id gnl|my_center|LOCUS_02310 1986 2624 gene locus_tag LOCUS_02320 1986 2624 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768796.1 protein_id gnl|my_center|LOCUS_02320 2689 3108 gene locus_tag LOCUS_02330 2689 3108 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_02330 3105 4232 gene locus_tag LOCUS_02340 gene tgt 3105 4232 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943257.1 protein_id gnl|my_center|LOCUS_02340 4281 4622 gene locus_tag LOCUS_02350 gene yajC 4281 4622 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939107.1 protein_id gnl|my_center|LOCUS_02350 >Feature sequence0046 1403 441 gene locus_tag LOCUS_02360 1403 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330175.1 protein_id gnl|my_center|LOCUS_02360 3846 1510 gene locus_tag LOCUS_02370 gene lptD 3846 1510 CDS product LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943003.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence0047 2359 1013 gene locus_tag LOCUS_02380 2359 1013 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931796.1 protein_id gnl|my_center|LOCUS_02380 3569 2640 gene locus_tag LOCUS_02390 3569 2640 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_02390 3836 4480 gene locus_tag LOCUS_02400 gene lexA 3836 4480 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413738.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence0048 <1 565 gene locus_tag LOCUS_02410 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_218938748.1:NAD-dependent epimerase/dehydratase family protein 813 1244 gene locus_tag LOCUS_02420 813 1244 CDS product F0F1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056287.1 protein_id gnl|my_center|LOCUS_02420 1391 2059 gene locus_tag LOCUS_02430 1391 2059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 2056 2598 gene locus_tag LOCUS_02440 gene atpH 2056 2598 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938079.1 protein_id gnl|my_center|LOCUS_02440 2603 4126 gene locus_tag LOCUS_02450 gene atpA 2603 4126 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938078.1 protein_id gnl|my_center|LOCUS_02450 >Feature sequence0049 1031 30 gene locus_tag LOCUS_02460 1031 30 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266321.1 protein_id gnl|my_center|LOCUS_02460 1972 3468 gene locus_tag LOCUS_02470 1972 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 <4877 3470 gene locus_tag LOCUS_02480 <4877 3470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294690.1:sialidase family protein >Feature sequence0050 1932 2891 gene locus_tag LOCUS_02490 1932 2891 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_02490 2891 3928 gene locus_tag LOCUS_02500 2891 3928 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875811.1 protein_id gnl|my_center|LOCUS_02500 3941 4765 gene locus_tag LOCUS_02510 3941 4765 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706051.1 protein_id gnl|my_center|LOCUS_02510 >Feature sequence0051 2 550 gene locus_tag LOCUS_02520 2 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 547 2604 gene locus_tag LOCUS_02530 547 2604 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922174.1 protein_id gnl|my_center|LOCUS_02530 2764 4554 gene locus_tag LOCUS_02540 2764 4554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence0052 <1 818 gene locus_tag LOCUS_02550 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460802.1:flagellar motor protein MotB 829 1632 gene locus_tag LOCUS_02560 829 1632 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986953.1 protein_id gnl|my_center|LOCUS_02560 1956 2912 gene locus_tag LOCUS_02570 1956 2912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence0053 781 80 gene locus_tag LOCUS_02580 gene thiE 781 80 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_02580 1219 2520 gene locus_tag LOCUS_02590 1219 2520 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326127.1 protein_id gnl|my_center|LOCUS_02590 3646 2768 gene locus_tag LOCUS_02600 3646 2768 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393019.1 protein_id gnl|my_center|LOCUS_02600 3968 4537 gene locus_tag LOCUS_02610 3968 4537 CDS product cysteine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234256.1 protein_id gnl|my_center|LOCUS_02610 >Feature sequence0054 470 1474 gene locus_tag LOCUS_02620 470 1474 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_02620 1471 2439 gene locus_tag LOCUS_02630 1471 2439 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937471.1 protein_id gnl|my_center|LOCUS_02630 2511 2723 gene locus_tag LOCUS_02640 2511 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 2726 2977 gene locus_tag LOCUS_02650 2726 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 >Feature sequence0055 189 701 gene locus_tag LOCUS_02660 189 701 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257850.1 protein_id gnl|my_center|LOCUS_02660 701 1030 gene locus_tag LOCUS_02670 gene nuoK 701 1030 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_02670 1110 2576 gene locus_tag LOCUS_02680 1110 2576 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064242829.1 protein_id gnl|my_center|LOCUS_02680 2573 2833 gene locus_tag LOCUS_02690 2573 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 2833 4614 gene locus_tag LOCUS_02700 2833 4614 CDS product Na(+)/H(+) antiporter subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969263.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence0056 1419 616 gene locus_tag LOCUS_02710 1419 616 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767448.1 protein_id gnl|my_center|LOCUS_02710 2678 1416 gene locus_tag LOCUS_02720 gene waaL-os 2678 1416 CDS product outer core oligosaccharide ligase WaaL-os inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816144.1 protein_id gnl|my_center|LOCUS_02720 4469 2739 gene locus_tag LOCUS_02730 gene msbA 4469 2739 CDS product lipid A export permease/ATP-binding protein MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942900.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence0057 <1 606 gene locus_tag LOCUS_02740 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393855.1:F0F1 ATP synthase subunit beta 641 1057 gene locus_tag LOCUS_02750 641 1057 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_02750 1171 2592 gene locus_tag LOCUS_02760 gene gltA 1171 2592 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_02760 4571 2679 gene locus_tag LOCUS_02770 4571 2679 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791909.1 protein_id gnl|my_center|LOCUS_02770 >Feature sequence0058 789 1358 gene locus_tag LOCUS_02780 789 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 1355 2965 gene locus_tag LOCUS_02790 1355 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence0059 2796 1771 gene locus_tag LOCUS_02800 2796 1771 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937626.1 protein_id gnl|my_center|LOCUS_02800 2856 4010 gene locus_tag LOCUS_02810 gene dinB 2856 4010 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173513996.1 protein_id gnl|my_center|LOCUS_02810 4250 4444 gene locus_tag LOCUS_02820 4250 4444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 >Feature sequence0060 1421 351 gene locus_tag LOCUS_02830 1421 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3314 1446 gene locus_tag LOCUS_02840 3314 1446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 <4630 3616 gene locus_tag LOCUS_02850 <4630 3616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546286.1:PBP1A family penicillin-binding protein >Feature sequence0061 1628 1341 gene locus_tag LOCUS_02860 1628 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 1890 1612 gene locus_tag LOCUS_02870 1890 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 3151 2105 gene locus_tag LOCUS_02880 3151 2105 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957954.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence0062 <1 1161 gene locus_tag LOCUS_02890 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205226061.1:methyl-accepting chemotaxis protein 1201 3360 gene locus_tag LOCUS_02900 1201 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 3595 4089 gene locus_tag LOCUS_02910 3595 4089 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545419.1 protein_id gnl|my_center|LOCUS_02910 >Feature sequence0063 2887 1985 gene locus_tag LOCUS_02920 2887 1985 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942175.1 protein_id gnl|my_center|LOCUS_02920 3346 2972 gene locus_tag LOCUS_02930 3346 2972 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 protein_id gnl|my_center|LOCUS_02930 3890 3603 gene locus_tag LOCUS_02940 3890 3603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 4218 3910 gene locus_tag LOCUS_02950 4218 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 4539 4336 gene locus_tag LOCUS_02960 4539 4336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence0064 1450 410 gene locus_tag LOCUS_02970 1450 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 1589 2008 gene locus_tag LOCUS_02980 1589 2008 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_02980 3365 2154 gene locus_tag LOCUS_02990 gene tyrS 3365 2154 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941800.1 protein_id gnl|my_center|LOCUS_02990 <4538 3435 gene locus_tag LOCUS_03000 <4538 3435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941798.1:ribonuclease Y >Feature sequence0065 <1 1169 gene locus_tag LOCUS_03010 <1 1169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393509.1:NAD-dependent DNA ligase LigA 1201 1482 gene locus_tag LOCUS_03020 1201 1482 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_03020 1592 1846 gene locus_tag LOCUS_03030 1592 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 1864 2631 gene locus_tag LOCUS_03040 1864 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3043 2723 gene locus_tag LOCUS_03050 3043 2723 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940042.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence0066 3625 2822 gene locus_tag LOCUS_03060 3625 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 4487 3678 gene locus_tag LOCUS_03070 4487 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 >Feature sequence0067 626 1360 gene locus_tag LOCUS_03080 626 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 2222 1407 gene locus_tag LOCUS_03090 2222 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3259 2210 gene locus_tag LOCUS_03100 3259 2210 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_03100 <4463 3279 gene locus_tag LOCUS_03110 <4463 3279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003660689.1:DNA repair protein RecN >Feature sequence0068 1342 1184 gene locus_tag LOCUS_03120 1342 1184 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081114.1 protein_id gnl|my_center|LOCUS_03120 2633 1455 gene locus_tag LOCUS_03130 2633 1455 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939297.1 protein_id gnl|my_center|LOCUS_03130 2816 4384 gene locus_tag LOCUS_03140 gene norR 2816 4384 CDS product nitric oxide reductase transcriptional regulator NorR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010816.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence0069 <1 907 gene locus_tag LOCUS_03150 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392502.1:NADH-quinone oxidoreductase subunit N 1328 1002 gene locus_tag LOCUS_03160 1328 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2585 1356 gene locus_tag LOCUS_03170 2585 1356 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_03170 3130 2744 gene locus_tag LOCUS_03180 3130 2744 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496603.1 protein_id gnl|my_center|LOCUS_03180 3373 3215 gene locus_tag LOCUS_03190 3373 3215 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940442.1 protein_id gnl|my_center|LOCUS_03190 3610 3401 gene locus_tag LOCUS_03200 3610 3401 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940352.1 protein_id gnl|my_center|LOCUS_03200 4088 3714 gene locus_tag LOCUS_03210 4088 3714 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_03210 4417 4169 gene locus_tag LOCUS_03220 4417 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 >Feature sequence0070 <1 1344 gene locus_tag LOCUS_03230 <1 1344 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895403.1:glucose-6-phosphate isomerase 1571 2851 gene locus_tag LOCUS_03240 gene dsrA 1571 2851 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393107.1 protein_id gnl|my_center|LOCUS_03240 2901 4043 gene locus_tag LOCUS_03250 gene dsrB 2901 4043 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393106.1 protein_id gnl|my_center|LOCUS_03250 4114 4359 gene locus_tag LOCUS_03260 4114 4359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 >Feature sequence0071 199 1131 gene locus_tag LOCUS_03270 199 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1139 2362 gene locus_tag LOCUS_03280 gene ftsA 1139 2362 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_03280 2574 3770 gene locus_tag LOCUS_03290 gene ftsZ 2574 3770 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939769.1 protein_id gnl|my_center|LOCUS_03290 >Feature sequence0072 1136 192 gene locus_tag LOCUS_03300 1136 192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 2345 1242 gene locus_tag LOCUS_03310 2345 1242 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_03310 3479 2382 gene locus_tag LOCUS_03320 gene ychF 3479 2382 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941325.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence0073 255 1196 gene locus_tag LOCUS_03330 255 1196 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393617.1 protein_id gnl|my_center|LOCUS_03330 1201 1893 gene locus_tag LOCUS_03340 gene aroD 1201 1893 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083186615.1 protein_id gnl|my_center|LOCUS_03340 1877 2755 gene locus_tag LOCUS_03350 1877 2755 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892481.1 protein_id gnl|my_center|LOCUS_03350 2752 4032 gene locus_tag LOCUS_03360 gene aroA 2752 4032 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031206.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence0074 1378 572 gene locus_tag LOCUS_03370 1378 572 CDS product Na(+)-translocating NADH-quinone reductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003105182.1 protein_id gnl|my_center|LOCUS_03370 2579 1371 gene locus_tag LOCUS_03380 2579 1371 CDS product NADH:ubiquinone reductase (Na(+)-transporting) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109478.1 protein_id gnl|my_center|LOCUS_03380 3962 2616 gene locus_tag LOCUS_03390 3962 2616 CDS product Na(+)-translocating NADH-quinone reductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225561.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence0075 640 990 gene locus_tag LOCUS_03400 640 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 2276 1194 gene locus_tag LOCUS_03410 2276 1194 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546105.1 protein_id gnl|my_center|LOCUS_03410 3028 2345 gene locus_tag LOCUS_03420 3028 2345 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005074240.1 protein_id gnl|my_center|LOCUS_03420 <4267 3052 gene locus_tag LOCUS_03430 <4267 3052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021623.1:tetratricopeptide repeat protein >Feature sequence0076 447 139 gene locus_tag LOCUS_03440 447 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 968 2347 gene locus_tag LOCUS_03450 968 2347 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941275.1 protein_id gnl|my_center|LOCUS_03450 2438 3289 gene locus_tag LOCUS_03460 gene ccsB 2438 3289 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_03460 <4258 3411 gene locus_tag LOCUS_03470 <4258 3411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941242.1:glycine--tRNA ligase subunit beta >Feature sequence0077 461 1606 gene locus_tag LOCUS_03480 gene cydB 461 1606 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786920.1 protein_id gnl|my_center|LOCUS_03480 1659 2150 gene locus_tag LOCUS_03490 1659 2150 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920478.1 protein_id gnl|my_center|LOCUS_03490 2236 2502 gene locus_tag LOCUS_03500 2236 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 2499 4034 gene locus_tag LOCUS_03510 2499 4034 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence0078 326 541 gene locus_tag LOCUS_03520 326 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 929 600 gene locus_tag LOCUS_03530 929 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 955 1374 gene locus_tag LOCUS_03540 955 1374 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965636.1 protein_id gnl|my_center|LOCUS_03540 2135 1392 gene locus_tag LOCUS_03550 gene tatC 2135 1392 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545000.1 protein_id gnl|my_center|LOCUS_03550 2304 3581 gene locus_tag LOCUS_03560 gene serS 2304 3581 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_03560 <4224 3627 gene locus_tag LOCUS_03570 <4224 3627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583317.1:D-alanine--D-alanine ligase >Feature sequence0079 1107 280 gene locus_tag LOCUS_03580 1107 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 1656 1372 gene locus_tag LOCUS_03590 1656 1372 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_03590 3118 1913 gene locus_tag LOCUS_03600 3118 1913 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_03600 3299 3550 gene locus_tag LOCUS_03610 3299 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 <4224 3586 gene locus_tag LOCUS_03620 <4224 3586 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546351.1:YggS family pyridoxal phosphate-dependent enzyme >Feature sequence0080 1179 2705 gene locus_tag LOCUS_03630 1179 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 3274 2744 gene locus_tag LOCUS_03640 3274 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 >Feature sequence0081 1560 628 gene locus_tag LOCUS_03650 1560 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 2853 1666 gene locus_tag LOCUS_03660 gene nifS 2853 1666 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942654.1 protein_id gnl|my_center|LOCUS_03660 3689 2853 gene locus_tag LOCUS_03670 gene nifU 3689 2853 CDS product Fe-S cluster assembly protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937968.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence0082 1147 749 gene locus_tag LOCUS_03680 1147 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1494 1147 gene locus_tag LOCUS_03690 1494 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 1759 3915 gene locus_tag LOCUS_03700 1759 3915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence0083 984 265 gene locus_tag LOCUS_03710 984 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 1352 1966 gene locus_tag LOCUS_03720 gene cbiM 1352 1966 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_03720 1963 2583 gene locus_tag LOCUS_03730 1963 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 2594 3373 gene locus_tag LOCUS_03740 2594 3373 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940035.1 protein_id gnl|my_center|LOCUS_03740 3370 4125 gene locus_tag LOCUS_03750 gene cbiQ 3370 4125 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence0084 <1 1361 gene locus_tag LOCUS_03760 <1 1361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117762.1:HlyD family efflux transporter periplasmic adaptor subunit 1391 3547 gene locus_tag LOCUS_03770 1391 3547 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117761.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence0085 1418 2440 gene locus_tag LOCUS_03780 1418 2440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 2931 2557 gene locus_tag LOCUS_03790 2931 2557 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933714.1 protein_id gnl|my_center|LOCUS_03790 4057 3116 gene locus_tag LOCUS_03800 4057 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 >Feature sequence0086 266 1003 gene locus_tag LOCUS_03810 266 1003 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944007.1 protein_id gnl|my_center|LOCUS_03810 3982 1052 gene locus_tag LOCUS_03820 3982 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 >Feature sequence0087 2 508 gene locus_tag LOCUS_03830 2 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 505 1608 gene locus_tag LOCUS_03840 505 1608 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080270.1 protein_id gnl|my_center|LOCUS_03840 1608 2396 gene locus_tag LOCUS_03850 1608 2396 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_03850 2383 3105 gene locus_tag LOCUS_03860 2383 3105 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_03860 4092 3262 gene locus_tag LOCUS_03870 4092 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence0088 1450 1220 gene locus_tag LOCUS_03880 gene rpmE 1450 1220 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_03880 2811 1564 gene locus_tag LOCUS_03890 gene rho 2811 1564 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_03890 4080 3520 gene locus_tag LOCUS_03900 gene coaE 4080 3520 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387006.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence0089 <1 2196 gene locus_tag LOCUS_03910 <1 2196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545874.1:PEP/pyruvate-binding domain-containing protein 2210 2578 gene locus_tag LOCUS_03920 2210 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2625 3419 gene locus_tag LOCUS_03930 2625 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 >Feature sequence0090 1217 330 gene locus_tag LOCUS_03940 1217 330 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707673.1 protein_id gnl|my_center|LOCUS_03940 1396 1896 gene locus_tag LOCUS_03950 1396 1896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 1950 4124 gene locus_tag LOCUS_03960 1950 4124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence0091 56 313 gene locus_tag LOCUS_03970 56 313 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229888.1 protein_id gnl|my_center|LOCUS_03970 358 690 gene locus_tag LOCUS_03980 358 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 703 1050 gene locus_tag LOCUS_03990 703 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 1066 1239 gene locus_tag LOCUS_04000 1066 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 2513 1386 gene locus_tag LOCUS_04010 2513 1386 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011731604.1 protein_id gnl|my_center|LOCUS_04010 3020 3358 gene locus_tag LOCUS_04020 3020 3358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 <4114 3416 gene locus_tag LOCUS_04030 <4114 3416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546519.1:radical SAM protein >Feature sequence0092 676 284 gene locus_tag LOCUS_04040 676 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 1688 663 gene locus_tag LOCUS_04050 gene fliM 1688 663 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941089.1 protein_id gnl|my_center|LOCUS_04050 2222 1701 gene locus_tag LOCUS_04060 2222 1701 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881216.1 protein_id gnl|my_center|LOCUS_04060 2992 2246 gene locus_tag LOCUS_04070 2992 2246 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 protein_id gnl|my_center|LOCUS_04070 3771 3004 gene locus_tag LOCUS_04080 3771 3004 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence0093 <1 524 gene locus_tag LOCUS_04090 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864121.1:tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB 730 1272 gene locus_tag LOCUS_04100 730 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_04100 1443 2381 gene locus_tag LOCUS_04110 1443 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2398 2874 gene locus_tag LOCUS_04120 2398 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 <4097 2937 gene locus_tag LOCUS_04130 <4097 2937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880529.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE >Feature sequence0094 1431 1982 gene locus_tag LOCUS_04140 gene pyrE 1431 1982 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_04140 1987 2157 gene locus_tag LOCUS_04150 1987 2157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 2331 2801 gene locus_tag LOCUS_04160 2331 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 3545 2907 gene locus_tag LOCUS_04170 3545 2907 CDS product outer membrane beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928712.1 protein_id gnl|my_center|LOCUS_04170 >Feature sequence0095 3 626 gene locus_tag LOCUS_04180 3 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 645 2018 gene locus_tag LOCUS_04190 645 2018 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_04190 2072 2686 gene locus_tag LOCUS_04200 2072 2686 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028173662.1 protein_id gnl|my_center|LOCUS_04200 2774 3532 gene locus_tag LOCUS_04210 2774 3532 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851426.1 protein_id gnl|my_center|LOCUS_04210 <4083 3550 gene locus_tag LOCUS_04220 <4083 3550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404409.1:tryptophan--tRNA ligase >Feature sequence0096 <1 881 gene locus_tag LOCUS_04230 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225013.1:BTAD domain-containing putative transcriptional regulator 1052 977 gene locus_tag LOCUS_t00030 1052 977 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1380 2417 gene locus_tag LOCUS_04240 1380 2417 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_04240 2692 3573 gene locus_tag LOCUS_04250 gene mreC 2692 3573 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence0097 1332 2414 gene locus_tag LOCUS_04260 1332 2414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2439 3185 gene locus_tag LOCUS_04270 2439 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 3207 3848 gene locus_tag LOCUS_04280 3207 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 >Feature sequence0098 2768 1665 gene locus_tag LOCUS_04290 gene pheA 2768 1665 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943245.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence0099 1448 669 gene locus_tag LOCUS_04300 1448 669 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940782.1 protein_id gnl|my_center|LOCUS_04300 1577 3190 gene locus_tag LOCUS_04310 gene nadB 1577 3190 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942471.1 protein_id gnl|my_center|LOCUS_04310 3256 3627 gene locus_tag LOCUS_04320 3256 3627 CDS product DUF1992 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842486.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence0100 162 1496 gene locus_tag LOCUS_04330 162 1496 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405103.1 protein_id gnl|my_center|LOCUS_04330 1682 2419 gene locus_tag LOCUS_04340 1682 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 3671 2586 gene locus_tag LOCUS_04350 gene ispG 3671 2586 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence0101 1608 1213 gene locus_tag LOCUS_04360 1608 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 2013 1714 gene locus_tag LOCUS_04370 2013 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2363 2010 gene locus_tag LOCUS_04380 2363 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 3235 2390 gene locus_tag LOCUS_04390 3235 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 <3961 3328 gene locus_tag LOCUS_04400 <3961 3328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940947.1:cytochrome c3 family protein >Feature sequence0102 562 1047 gene locus_tag LOCUS_04410 562 1047 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537230.1 protein_id gnl|my_center|LOCUS_04410 1751 1089 gene locus_tag LOCUS_04420 1751 1089 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038490.1 protein_id gnl|my_center|LOCUS_04420 2191 1901 gene locus_tag LOCUS_04430 2191 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04430 2417 2097 gene locus_tag LOCUS_04440 2417 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04440 2810 2965 gene locus_tag LOCUS_04450 2810 2965 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092374840.1 protein_id gnl|my_center|LOCUS_04450 3146 3868 gene locus_tag LOCUS_04460 3146 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 >Feature sequence0103 681 163 gene locus_tag LOCUS_04470 681 163 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037393763.1 protein_id gnl|my_center|LOCUS_04470 880 1548 gene locus_tag LOCUS_04480 880 1548 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524311.1 protein_id gnl|my_center|LOCUS_04480 1511 1834 gene locus_tag LOCUS_04490 1511 1834 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255937.1 protein_id gnl|my_center|LOCUS_04490 2926 1916 gene locus_tag LOCUS_04500 2926 1916 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763737.1 protein_id gnl|my_center|LOCUS_04500 3416 2997 gene locus_tag LOCUS_04510 3416 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence0104 1383 919 gene locus_tag LOCUS_04520 gene nrdR 1383 919 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_04520 2648 1395 gene locus_tag LOCUS_04530 2648 1395 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942252.1 protein_id gnl|my_center|LOCUS_04530 3302 2877 gene locus_tag LOCUS_04540 gene rpiB 3302 2877 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_04540 <3943 3428 gene locus_tag LOCUS_04550 <3943 3428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544941.1:beta-ketoacyl-ACP synthase II >Feature sequence0105 <1 611 gene locus_tag LOCUS_04560 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142291.1:glutamate--cysteine ligase 598 2136 gene locus_tag LOCUS_04570 598 2136 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_04570 2133 3185 gene locus_tag LOCUS_04580 2133 3185 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191693.1 protein_id gnl|my_center|LOCUS_04580 >Feature sequence0106 1713 118 gene locus_tag LOCUS_04590 1713 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 3163 1961 gene locus_tag LOCUS_04600 gene nrfD 3163 1961 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940748.1 protein_id gnl|my_center|LOCUS_04600 <3929 3163 gene locus_tag LOCUS_04610 <3929 3163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940747.1:4Fe-4S dicluster domain-containing protein >Feature sequence0107 1301 2761 gene locus_tag LOCUS_04620 gene cls 1301 2761 CDS product cardiolipin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362111.1 protein_id gnl|my_center|LOCUS_04620 2781 3497 gene locus_tag LOCUS_04630 2781 3497 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082427.1 protein_id gnl|my_center|LOCUS_04630 >Feature sequence0108 1459 44 gene locus_tag LOCUS_04640 gene hslU 1459 44 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938760.1 protein_id gnl|my_center|LOCUS_04640 2117 1584 gene locus_tag LOCUS_04650 gene hslV 2117 1584 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_04650 3094 2174 gene locus_tag LOCUS_04660 gene xerC 3094 2174 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_04660 3189 3485 gene locus_tag LOCUS_04670 3189 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 >Feature sequence0109 800 144 gene locus_tag LOCUS_04680 800 144 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269258.1 protein_id gnl|my_center|LOCUS_04680 2255 882 gene locus_tag LOCUS_04690 gene miaB 2255 882 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992205.1 protein_id gnl|my_center|LOCUS_04690 2571 2359 gene locus_tag LOCUS_04700 2571 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 <3882 2592 gene locus_tag LOCUS_04710 <3882 2592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986778.1:adenylosuccinate lyase >Feature sequence0110 265 447 gene locus_tag LOCUS_04720 265 447 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_04720 483 731 gene locus_tag LOCUS_04730 483 731 CDS product TatA/E family twin arginine-targeting protein translocase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057225.1 protein_id gnl|my_center|LOCUS_04730 1053 2189 gene locus_tag LOCUS_04740 1053 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791395.1 protein_id gnl|my_center|LOCUS_04740 2147 3787 gene locus_tag LOCUS_04750 2147 3787 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940548.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence0111 119 427 gene locus_tag LOCUS_04760 119 427 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927166.1 protein_id gnl|my_center|LOCUS_04760 424 567 gene locus_tag LOCUS_04770 424 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 571 1467 gene locus_tag LOCUS_04780 571 1467 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_04780 1479 1943 gene locus_tag LOCUS_04790 1479 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2060 1968 gene locus_tag LOCUS_t00040 2060 1968 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2159 2074 gene locus_tag LOCUS_t00050 2159 2074 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2282 3793 gene locus_tag LOCUS_04800 2282 3793 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence0112 43 378 gene locus_tag LOCUS_04810 43 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 368 691 gene locus_tag LOCUS_04820 368 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1022 2059 gene locus_tag LOCUS_04830 1022 2059 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence0113 2297 351 gene locus_tag LOCUS_04840 gene glgB 2297 351 CDS product 1,4-alpha-glucan branching enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056426.1 protein_id gnl|my_center|LOCUS_04840 3708 2536 gene locus_tag LOCUS_04850 3708 2536 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545883.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence0114 <1 1513 gene locus_tag LOCUS_04860 <1 1513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035887521.1:MBOAT family O-acyltransferase 1513 3351 gene locus_tag LOCUS_04870 1513 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 >Feature sequence0115 751 1176 gene locus_tag LOCUS_04880 gene aprB 751 1176 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_04880 1239 3251 gene locus_tag LOCUS_04890 gene aprA 1239 3251 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938147.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence0116 1315 536 gene locus_tag LOCUS_04900 1315 536 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083169.1 protein_id gnl|my_center|LOCUS_04900 1828 2889 gene locus_tag LOCUS_04910 1828 2889 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099539.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence0117 1693 158 gene locus_tag LOCUS_04920 gene rng 1693 158 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_04920 2050 1928 gene locus_tag LOCUS_04930 2050 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 2028 2876 gene locus_tag LOCUS_04940 2028 2876 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_04940 >Feature sequence0118 594 202 gene locus_tag LOCUS_04950 594 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938981.1 protein_id gnl|my_center|LOCUS_04950 892 2301 gene locus_tag LOCUS_04960 892 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04960 2646 3038 gene locus_tag LOCUS_04970 2646 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence0119 2922 1534 gene locus_tag LOCUS_04980 2922 1534 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938822.1 protein_id gnl|my_center|LOCUS_04980 <3800 2966 gene locus_tag LOCUS_04990 <3800 2966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:OmpA family protein >Feature sequence0120 210 578 gene locus_tag LOCUS_05000 210 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 880 641 gene locus_tag LOCUS_05010 880 641 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358284.1 protein_id gnl|my_center|LOCUS_05010 2610 883 gene locus_tag LOCUS_05020 2610 883 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_05020 2937 2644 gene locus_tag LOCUS_05030 2937 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 3546 3731 gene locus_tag LOCUS_05040 3546 3731 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence0121 1756 59 gene locus_tag LOCUS_05050 1756 59 CDS product AarF/UbiB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941749.1 protein_id gnl|my_center|LOCUS_05050 2135 1839 gene locus_tag LOCUS_05060 2135 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2592 2191 gene locus_tag LOCUS_05070 2592 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 <3792 2615 gene locus_tag LOCUS_05080 <3792 2615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942999.1:chloride channel protein >Feature sequence0122 612 49 gene locus_tag LOCUS_05090 612 49 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933341.1 protein_id gnl|my_center|LOCUS_05090 2571 835 gene locus_tag LOCUS_05100 2571 835 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338330.1 protein_id gnl|my_center|LOCUS_05100 2838 2584 gene locus_tag LOCUS_05110 2838 2584 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458022.1 protein_id gnl|my_center|LOCUS_05110 <3789 3205 gene locus_tag LOCUS_05120 <3789 3205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814892.1:3'-5' exonuclease >Feature sequence0123 1420 3651 gene locus_tag LOCUS_05130 1420 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence0124 <1 593 gene locus_tag LOCUS_05140 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011836716.1:glycogen synthase GlgA 610 1587 gene locus_tag LOCUS_05150 610 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1615 2619 gene locus_tag LOCUS_05160 gene gap 1615 2619 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_05160 2725 3462 gene locus_tag LOCUS_05170 2725 3462 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence0125 820 1560 gene locus_tag LOCUS_05180 820 1560 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_05180 1586 3304 gene locus_tag LOCUS_05190 1586 3304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 >Feature sequence0126 1025 441 gene locus_tag LOCUS_05200 1025 441 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546804.1 protein_id gnl|my_center|LOCUS_05200 1552 1016 gene locus_tag LOCUS_05210 1552 1016 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545381.1 protein_id gnl|my_center|LOCUS_05210 1914 1540 gene locus_tag LOCUS_05220 gene nuoA 1914 1540 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179273.1 protein_id gnl|my_center|LOCUS_05220 2430 1927 gene locus_tag LOCUS_05230 2430 1927 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_05230 <3718 2446 gene locus_tag LOCUS_05240 <3718 2446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937484.1:thiosulfate reductase >Feature sequence0127 <1 844 gene locus_tag LOCUS_05250 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071609.1:transglutaminase family protein 2776 1184 gene locus_tag LOCUS_05260 2776 1184 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941565.1 protein_id gnl|my_center|LOCUS_05260 3565 2906 gene locus_tag LOCUS_05270 3565 2906 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932569.1 protein_id gnl|my_center|LOCUS_05270 >Feature sequence0128 1710 775 gene locus_tag LOCUS_05280 1710 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2246 2551 gene locus_tag LOCUS_05290 2246 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 2842 3246 gene locus_tag LOCUS_05300 2842 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3404 3604 gene locus_tag LOCUS_05310 3404 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 >Feature sequence0129 444 1601 gene locus_tag LOCUS_05320 444 1601 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680885.1 protein_id gnl|my_center|LOCUS_05320 1631 1960 gene locus_tag LOCUS_05330 gene yhbY 1631 1960 CDS product ribosome assembly RNA-binding protein YhbY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941918.1 protein_id gnl|my_center|LOCUS_05330 2306 3535 gene locus_tag LOCUS_05340 2306 3535 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176674.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence0130 607 852 gene locus_tag LOCUS_05350 607 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 899 1603 gene locus_tag LOCUS_05360 gene hypB 899 1603 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_05360 1645 3369 gene locus_tag LOCUS_05370 gene sulP 1645 3369 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404965.1 protein_id gnl|my_center|LOCUS_05370 >Feature sequence0131 3540 2002 gene locus_tag LOCUS_05380 3540 2002 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387814.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence0132 941 1384 gene locus_tag LOCUS_05390 941 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 1713 3044 gene locus_tag LOCUS_05400 1713 3044 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942709.1 protein_id gnl|my_center|LOCUS_05400 3028 3186 gene locus_tag LOCUS_05410 3028 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence0133 1101 100 gene locus_tag LOCUS_05420 gene galT 1101 100 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546259.1 protein_id gnl|my_center|LOCUS_05420 1470 1108 gene locus_tag LOCUS_05430 gene dksA 1470 1108 CDS product RNA polymerase-binding protein DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940956.1 protein_id gnl|my_center|LOCUS_05430 2077 1592 gene locus_tag LOCUS_05440 gene moaC 2077 1592 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018306447.1 protein_id gnl|my_center|LOCUS_05440 3238 2081 gene locus_tag LOCUS_05450 gene dnaJ 3238 2081 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_05450 3607 3332 gene locus_tag LOCUS_05460 3607 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence0134 1618 329 gene locus_tag LOCUS_05470 1618 329 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707506.1 protein_id gnl|my_center|LOCUS_05470 1791 3137 gene locus_tag LOCUS_05480 1791 3137 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101557.1 protein_id gnl|my_center|LOCUS_05480 >Feature sequence0135 650 2893 gene locus_tag LOCUS_05490 gene prsT 650 2893 CDS product PEP-CTERM system TPR-repeat protein PrsT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942631.1 protein_id gnl|my_center|LOCUS_05490 2896 3438 gene locus_tag LOCUS_05500 gene hpt 2896 3438 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938879.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence0136 1362 343 gene locus_tag LOCUS_05510 1362 343 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_05510 <3617 1355 gene locus_tag LOCUS_05520 <3617 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940682.1:DNA gyrase subunit A >Feature sequence0137 510 1436 gene locus_tag LOCUS_05530 gene argF 510 1436 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_05530 1579 2778 gene locus_tag LOCUS_05540 1579 2778 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940829.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence0138 116 1036 gene locus_tag LOCUS_05550 116 1036 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_182015315.1 protein_id gnl|my_center|LOCUS_05550 1038 2351 gene locus_tag LOCUS_05560 1038 2351 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_05560 2386 2670 gene locus_tag LOCUS_05570 2386 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 3412 2837 gene locus_tag LOCUS_05580 3412 2837 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943440.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence0139 <1 725 gene locus_tag LOCUS_05590 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942871.1:stage 0 sporulation family protein 727 2688 gene locus_tag LOCUS_05600 gene metG 727 2688 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939333.1 protein_id gnl|my_center|LOCUS_05600 2762 3058 gene locus_tag LOCUS_05610 2762 3058 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_05610 3065 3370 gene locus_tag LOCUS_05620 3065 3370 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_05620 >Feature sequence0140 <1 1053 gene locus_tag LOCUS_05630 <1 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462039.1:3-phosphoserine/phosphohydroxythreonine transaminase 1093 1968 gene locus_tag LOCUS_05640 1093 1968 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986530.1 protein_id gnl|my_center|LOCUS_05640 2008 3057 gene locus_tag LOCUS_05650 gene rlmN 2008 3057 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence0141 1286 765 gene locus_tag LOCUS_05660 1286 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 1946 1308 gene locus_tag LOCUS_05670 1946 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 2669 1959 gene locus_tag LOCUS_05680 2669 1959 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_05680 <3552 2674 gene locus_tag LOCUS_05690 <3552 2674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942675.1:type IV pilus assembly protein PilM >Feature sequence0142 <1 635 gene locus_tag LOCUS_05700 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037393019.1:LysR family transcriptional regulator 695 1510 gene locus_tag LOCUS_05710 695 1510 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151652833.1 protein_id gnl|my_center|LOCUS_05710 1613 2221 gene locus_tag LOCUS_05720 1613 2221 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095436.1 protein_id gnl|my_center|LOCUS_05720 <3538 2416 gene locus_tag LOCUS_05730 <3538 2416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010921248.1:DUF4153 domain-containing protein >Feature sequence0143 1229 555 gene locus_tag LOCUS_05740 1229 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 3093 1426 gene locus_tag LOCUS_05750 3093 1426 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937340.1 protein_id gnl|my_center|LOCUS_05750 >Feature sequence0144 1651 476 gene locus_tag LOCUS_05760 1651 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 2633 2854 gene locus_tag LOCUS_05770 2633 2854 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939842.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence0145 <1 641 gene locus_tag LOCUS_05780 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000621434.1:NADH-quinone oxidoreductase subunit NuoD 638 1588 gene locus_tag LOCUS_05790 gene nuoH 638 1588 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_05790 1585 2034 gene locus_tag LOCUS_05800 1585 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence0146 1361 57 gene locus_tag LOCUS_05810 1361 57 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_05810 1632 2306 gene locus_tag LOCUS_05820 1632 2306 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939218.1 protein_id gnl|my_center|LOCUS_05820 2412 3005 gene locus_tag LOCUS_05830 2412 3005 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939175.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence0147 1212 550 gene locus_tag LOCUS_05840 gene phoU 1212 550 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_05840 1424 2131 gene locus_tag LOCUS_05850 1424 2131 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941763.1 protein_id gnl|my_center|LOCUS_05850 >Feature sequence0148 >Feature sequence0149 2962 1163 gene locus_tag LOCUS_05860 gene typA 2962 1163 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002219266.1 protein_id gnl|my_center|LOCUS_05860 >Feature sequence0150 2889 400 gene locus_tag LOCUS_05870 2889 400 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065536.1 protein_id gnl|my_center|LOCUS_05870 <3490 2947 gene locus_tag LOCUS_05880 <3490 2947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193486976.1:glycosyltransferase family 1 protein >Feature sequence0151 <1 912 gene locus_tag LOCUS_05890 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007326889.1:HDOD domain-containing protein 909 1643 gene locus_tag LOCUS_05900 909 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2175 1696 gene locus_tag LOCUS_05910 2175 1696 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_05910 2838 2200 gene locus_tag LOCUS_05920 2838 2200 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360256.1 protein_id gnl|my_center|LOCUS_05920 <3486 2896 gene locus_tag LOCUS_05930 <3486 2896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249435.1:HD domain-containing protein >Feature sequence0152 <1 1013 gene locus_tag LOCUS_05940 <1 1013 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942333.1:bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II 1065 1532 gene locus_tag LOCUS_05950 gene ribE 1065 1532 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_05950 1556 1981 gene locus_tag LOCUS_05960 gene nusB 1556 1981 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_05960 >Feature sequence0153 287 541 gene locus_tag LOCUS_05970 287 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 666 872 gene locus_tag LOCUS_05980 666 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 >Feature sequence0154 2618 1935 gene locus_tag LOCUS_05990 2618 1935 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_05990 2956 3435 gene locus_tag LOCUS_06000 2956 3435 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937552.1 protein_id gnl|my_center|LOCUS_06000 >Feature sequence0155 646 1176 gene locus_tag LOCUS_06010 gene lptA 646 1176 CDS product lipopolysaccharide ABC transporter substrate-binding protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369494.1 protein_id gnl|my_center|LOCUS_06010 1173 1907 gene locus_tag LOCUS_06020 gene lptB 1173 1907 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942533.1 protein_id gnl|my_center|LOCUS_06020 1953 3404 gene locus_tag LOCUS_06030 gene rpoN 1953 3404 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942532.1 protein_id gnl|my_center|LOCUS_06030 >Feature sequence0156 2016 352 gene locus_tag LOCUS_06040 2016 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2686 2030 gene locus_tag LOCUS_06050 2686 2030 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030700.1 protein_id gnl|my_center|LOCUS_06050 <3436 2698 gene locus_tag LOCUS_06060 <3436 2698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989811.1:exodeoxyribonuclease III >Feature sequence0157 <1 1517 gene locus_tag LOCUS_06070 <1 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891886.1:quinol dehydrogenase ferredoxin subunit NapH 2406 1684 gene locus_tag LOCUS_06080 gene tatC 2406 1684 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880807.1 protein_id gnl|my_center|LOCUS_06080 2831 2403 gene locus_tag LOCUS_06090 2831 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3344 2979 gene locus_tag LOCUS_06100 3344 2979 CDS product nitrous oxide-stimulated promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459318.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence0158 >Feature sequence0159 451 915 gene locus_tag LOCUS_06110 451 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 922 2361 gene locus_tag LOCUS_06120 gene qseE 922 2361 CDS product two component system sensor histidine kinase QseE/GlrK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001311037.1 protein_id gnl|my_center|LOCUS_06120 2427 2963 gene locus_tag LOCUS_06130 2427 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 >Feature sequence0160 773 321 gene locus_tag LOCUS_06140 773 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 <3395 947 gene locus_tag LOCUS_06150 <3395 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000083904.1:copper-exporting P-type ATPase CopA >Feature sequence0161 870 412 gene locus_tag LOCUS_06160 870 412 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269184.1 protein_id gnl|my_center|LOCUS_06160 1800 1033 gene locus_tag LOCUS_06170 1800 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2817 1816 gene locus_tag LOCUS_06180 2817 1816 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938844.1 protein_id gnl|my_center|LOCUS_06180 <3386 2847 gene locus_tag LOCUS_06190 <3386 2847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266553.1:8-oxoguanine deaminase >Feature sequence0162 2274 757 gene locus_tag LOCUS_06200 2274 757 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791433.1 protein_id gnl|my_center|LOCUS_06200 <3367 2309 gene locus_tag LOCUS_06210 <3367 2309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943687.1:radical SAM protein >Feature sequence0163 1153 92 gene locus_tag LOCUS_06220 gene purM 1153 92 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_06220 1415 1615 gene locus_tag LOCUS_06230 1415 1615 CDS product DUF2065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940433.1 protein_id gnl|my_center|LOCUS_06230 1915 3297 gene locus_tag LOCUS_06240 gene mgtE 1915 3297 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141924.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence0164 <1 979 gene locus_tag LOCUS_06250 <1 979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943183.1:methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO 3076 1031 gene locus_tag LOCUS_06260 3076 1031 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence0165 1810 842 gene locus_tag LOCUS_06270 1810 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 3162 1834 gene locus_tag LOCUS_06280 3162 1834 CDS product HlyD family type I secretion periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706512.1 protein_id gnl|my_center|LOCUS_06280 >Feature sequence0166 2919 571 gene locus_tag LOCUS_06290 2919 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence0167 <3343 198 gene locus_tag LOCUS_06300 <3343 198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence0168 38 397 gene locus_tag LOCUS_06310 38 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 407 2242 gene locus_tag LOCUS_06320 407 2242 CDS product penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943700.1 protein_id gnl|my_center|LOCUS_06320 >Feature sequence0169 553 1644 gene locus_tag LOCUS_06330 553 1644 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_06330 2231 1665 gene locus_tag LOCUS_06340 2231 1665 CDS product manganese efflux pump MntP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940170.1 protein_id gnl|my_center|LOCUS_06340 <3320 2293 gene locus_tag LOCUS_06350 <3320 2293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546465.1:acetylornithine transaminase >Feature sequence0170 <1 1703 gene locus_tag LOCUS_06360 <1 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922355.1:YhaN family protein 1945 2637 gene locus_tag LOCUS_06370 1945 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence0171 281 1453 gene locus_tag LOCUS_06380 gene radA 281 1453 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940957.1 protein_id gnl|my_center|LOCUS_06380 1668 2267 gene locus_tag LOCUS_06390 1668 2267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 3052 2279 gene locus_tag LOCUS_06400 gene bioC 3052 2279 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931743.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence0172 1214 498 gene locus_tag LOCUS_06410 1214 498 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792492.1 protein_id gnl|my_center|LOCUS_06410 1413 2708 gene locus_tag LOCUS_06420 1413 2708 CDS product CSLREA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256201.1 protein_id gnl|my_center|LOCUS_06420 2831 2917 gene locus_tag LOCUS_t00060 2831 2917 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0173 189 1082 gene locus_tag LOCUS_06430 189 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence0174 664 290 gene locus_tag LOCUS_06440 gene dsrJ 664 290 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938584.1 protein_id gnl|my_center|LOCUS_06440 2326 692 gene locus_tag LOCUS_06450 2326 692 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393112.1 protein_id gnl|my_center|LOCUS_06450 <3279 2408 gene locus_tag LOCUS_06460 <3279 2408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938586.1:sulfate reduction electron transfer complex DsrMKJOP subunit DsrM >Feature sequence0175 <1 1290 gene locus_tag LOCUS_06470 <1 1290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942849.1:leucine--tRNA ligase 1367 1909 gene locus_tag LOCUS_06480 1367 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 <3254 2034 gene locus_tag LOCUS_06490 <3254 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582597.1:transketolase >Feature sequence0176 724 476 gene locus_tag LOCUS_06500 724 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 970 2535 gene locus_tag LOCUS_06510 970 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 >Feature sequence0177 400 1731 gene locus_tag LOCUS_06520 400 1731 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_06520 2688 1753 gene locus_tag LOCUS_06530 gene era 2688 1753 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360270.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence0178 <1 752 gene locus_tag LOCUS_06540 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930601.1:glutamine ABC transporter substrate-binding protein >Feature sequence0179 493 1101 gene locus_tag LOCUS_06550 493 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence0180 195 1247 gene locus_tag LOCUS_06560 195 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence0181 1918 815 gene locus_tag LOCUS_06570 gene aroC 1918 815 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938193.1 protein_id gnl|my_center|LOCUS_06570 2586 1996 gene locus_tag LOCUS_06580 2586 1996 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258976.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence0182 130 420 gene locus_tag LOCUS_06590 130 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1401 595 gene locus_tag LOCUS_06600 1401 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 <3174 1413 gene locus_tag LOCUS_06610 <3174 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964346.1:MMPL family transporter >Feature sequence0183 1047 346 gene locus_tag LOCUS_06620 gene yrfG 1047 346 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942337.1 protein_id gnl|my_center|LOCUS_06620 <3165 1044 gene locus_tag LOCUS_06630 <3165 1044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940695.1:transcription-repair coupling factor >Feature sequence0184 1218 4 gene locus_tag LOCUS_06640 gene coaBC 1218 4 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941785.1 protein_id gnl|my_center|LOCUS_06640 1735 1244 gene locus_tag LOCUS_06650 1735 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 2183 2992 gene locus_tag LOCUS_06660 2183 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 >Feature sequence0185 56 706 gene locus_tag LOCUS_06670 56 706 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545667.1 protein_id gnl|my_center|LOCUS_06670 1034 1834 gene locus_tag LOCUS_06680 gene rpsB 1034 1834 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_06680 1987 2580 gene locus_tag LOCUS_06690 gene tsf 1987 2580 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_06690 >Feature sequence0186 <1 1002 gene locus_tag LOCUS_06700 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072397.1:signal peptide peptidase SppA 1199 2158 gene locus_tag LOCUS_06710 1199 2158 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937994.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence0187 64 1020 gene locus_tag LOCUS_06720 64 1020 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_06720 1039 2313 gene locus_tag LOCUS_06730 1039 2313 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_06730 <3109 2428 gene locus_tag LOCUS_06740 <3109 2428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943351.1:DNA/RNA nuclease SfsA >Feature sequence0188 <1 898 gene locus_tag LOCUS_06750 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880089.1:sigma-54-dependent Fis family transcriptional regulator 1218 1778 gene locus_tag LOCUS_06760 1218 1778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 1809 2216 gene locus_tag LOCUS_06770 1809 2216 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392707.1 protein_id gnl|my_center|LOCUS_06770 2277 2948 gene locus_tag LOCUS_06780 2277 2948 CDS product methylenetetrahydrofolate reductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392706.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence0189 186 758 gene locus_tag LOCUS_06790 186 758 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764719.1 protein_id gnl|my_center|LOCUS_06790 783 1310 gene locus_tag LOCUS_06800 783 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 1307 1771 gene locus_tag LOCUS_06810 1307 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1859 2182 gene locus_tag LOCUS_06820 1859 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 2551 2372 gene locus_tag LOCUS_06830 2551 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 >Feature sequence0190 1752 985 gene locus_tag LOCUS_06840 1752 985 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262110.1 protein_id gnl|my_center|LOCUS_06840 2865 1771 gene locus_tag LOCUS_06850 2865 1771 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764114.1 protein_id gnl|my_center|LOCUS_06850 3086 2868 gene locus_tag LOCUS_06860 3086 2868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence0191 786 199 gene locus_tag LOCUS_06870 gene fdh3B 786 199 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_06870 <3076 965 gene locus_tag LOCUS_06880 <3076 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706856.1:formate dehydrogenase subunit alpha >Feature sequence0192 <3073 2229 gene locus_tag LOCUS_06890 <3073 2229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009968194.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence0193 <1 1254 gene locus_tag LOCUS_06900 <1 1254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942254.1:TolC family protein 1259 2167 gene locus_tag LOCUS_06910 1259 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 2115 2420 gene locus_tag LOCUS_06920 2115 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 >Feature sequence0194 856 245 gene locus_tag LOCUS_06930 856 245 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_06930 2437 938 gene locus_tag LOCUS_06940 gene trpE 2437 938 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943019.1 protein_id gnl|my_center|LOCUS_06940 2948 2676 gene locus_tag LOCUS_06950 gene rpsT 2948 2676 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence0195 632 1630 gene locus_tag LOCUS_06960 gene lpxC 632 1630 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555040.1 protein_id gnl|my_center|LOCUS_06960 1836 2645 gene locus_tag LOCUS_06970 gene proC 1836 2645 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence0196 476 2041 gene locus_tag LOCUS_06980 476 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2499 2891 gene locus_tag LOCUS_06990 gene tsaA 2499 2891 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877399.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence0197 <1 936 gene locus_tag LOCUS_07000 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545185.1:NADH-quinone oxidoreductase subunit M 984 2429 gene locus_tag LOCUS_07010 984 2429 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_07010 >Feature sequence0198 856 128 gene locus_tag LOCUS_07020 856 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 1018 2835 gene locus_tag LOCUS_07030 1018 2835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence0199 <1 880 gene locus_tag LOCUS_07040 <1 880 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073029.1:TRAP transporter large permease 964 1455 gene locus_tag LOCUS_07050 964 1455 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087770.1 protein_id gnl|my_center|LOCUS_07050 2282 1470 gene locus_tag LOCUS_07060 2282 1470 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948822.1 protein_id gnl|my_center|LOCUS_07060 2533 2946 gene locus_tag LOCUS_07070 2533 2946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence0200 1391 666 gene locus_tag LOCUS_07080 1391 666 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255934.1 protein_id gnl|my_center|LOCUS_07080 2615 1953 gene locus_tag LOCUS_07090 2615 1953 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255933.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence0201 <1 1365 gene locus_tag LOCUS_07100 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941028.1:OmpA family protein <3013 1615 gene locus_tag LOCUS_07110 <3013 1615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839181.1:SLC13 family permease >Feature sequence0202 1883 1659 gene locus_tag LOCUS_07120 1883 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 >Feature sequence0203 1368 583 gene locus_tag LOCUS_07130 1368 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2368 1355 gene locus_tag LOCUS_07140 gene fliG 2368 1355 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941079.1 protein_id gnl|my_center|LOCUS_07140 <3010 2378 gene locus_tag LOCUS_07150 <3010 2378 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918789.1:flagellar basal-body MS-ring/collar protein FliF >Feature sequence0204 841 1404 gene locus_tag LOCUS_07160 841 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 2146 1346 gene locus_tag LOCUS_07170 2146 1346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 >Feature sequence0205 228 1184 gene locus_tag LOCUS_07180 228 1184 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_07180 1824 1336 gene locus_tag LOCUS_07190 1824 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140870.1 protein_id gnl|my_center|LOCUS_07190 2340 1909 gene locus_tag LOCUS_07200 gene lysM 2340 1909 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098729.1 protein_id gnl|my_center|LOCUS_07200 <2992 2455 gene locus_tag LOCUS_07210 <2992 2455 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705529.1:tellurite resistance TerB family protein >Feature sequence0206 195 1796 gene locus_tag LOCUS_07220 gene rpoD 195 1796 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943710.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence0207 702 1013 gene locus_tag LOCUS_07230 gene rplU 702 1013 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964569.1 protein_id gnl|my_center|LOCUS_07230 1056 1310 gene locus_tag LOCUS_07240 gene rpmA 1056 1310 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_07240 1493 2494 gene locus_tag LOCUS_07250 gene obgE 1493 2494 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392098.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence0208 <1 903 gene locus_tag LOCUS_07260 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013529893.1:ABC transporter ATP-binding protein 893 1969 gene locus_tag LOCUS_07270 893 1969 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389657.1 protein_id gnl|my_center|LOCUS_07270 1969 2898 gene locus_tag LOCUS_07280 1969 2898 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389656.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence0209 99 692 gene locus_tag LOCUS_07290 99 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 1236 2450 gene locus_tag LOCUS_07300 1236 2450 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087257.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence0210 844 143 gene locus_tag LOCUS_07310 844 143 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039188.1 protein_id gnl|my_center|LOCUS_07310 2316 967 gene locus_tag LOCUS_07320 gene gdhA 2316 967 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_07320 2634 2341 gene locus_tag LOCUS_07330 2634 2341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2902 2627 gene locus_tag LOCUS_07340 2902 2627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence0211 96 1403 gene locus_tag LOCUS_07350 96 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1514 2338 gene locus_tag LOCUS_07360 gene nrfC 1514 2338 CDS product cytochrome c nitrite reductase Fe-S protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005466518.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence0212 195 1013 gene locus_tag LOCUS_07370 195 1013 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460056.1 protein_id gnl|my_center|LOCUS_07370 991 1950 gene locus_tag LOCUS_07380 991 1950 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868809.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence0213 <1 1588 gene locus_tag LOCUS_07390 <1 1588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791698.1:PEP/pyruvate-binding domain-containing protein 1727 2749 gene locus_tag LOCUS_07400 1727 2749 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937555.1 protein_id gnl|my_center|LOCUS_07400 >Feature sequence0214 548 195 gene locus_tag LOCUS_07410 548 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 841 551 gene locus_tag LOCUS_07420 841 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1436 864 gene locus_tag LOCUS_07430 1436 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1908 1549 gene locus_tag LOCUS_07440 1908 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 <2950 1886 gene locus_tag LOCUS_07450 <2950 1886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943673.1:flagellar basal body P-ring protein FlgI >Feature sequence0215 1213 806 gene locus_tag LOCUS_07460 1213 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1662 1216 gene locus_tag LOCUS_07470 gene fliS 1662 1216 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943663.1 protein_id gnl|my_center|LOCUS_07470 2942 1668 gene locus_tag LOCUS_07480 gene fliD 2942 1668 CDS product flagellar filament capping protein FliD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943664.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence0216 320 1990 gene locus_tag LOCUS_07490 320 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 <2947 2022 gene locus_tag LOCUS_07500 <2947 2022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007244780.1:aspartate-semialdehyde dehydrogenase >Feature sequence0217 >Feature sequence0218 776 850 gene locus_tag LOCUS_t00070 776 850 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 935 1363 gene locus_tag LOCUS_07510 gene rplM 935 1363 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_07510 1381 1773 gene locus_tag LOCUS_07520 gene rpsI 1381 1773 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720163.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence0219 >Feature sequence0220 1291 53 gene locus_tag LOCUS_07530 1291 53 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938325.1 protein_id gnl|my_center|LOCUS_07530 2010 1384 gene locus_tag LOCUS_07540 gene upp 2010 1384 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001295473.1 protein_id gnl|my_center|LOCUS_07540 2846 2295 gene locus_tag LOCUS_07550 2846 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence0221 <1 1649 gene locus_tag LOCUS_07560 <1 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880473.1:YvcK family protein 1790 2158 gene locus_tag LOCUS_07570 1790 2158 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941946.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence0222 241 762 gene locus_tag LOCUS_07580 gene creA 241 762 CDS product protein CreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815531.1 protein_id gnl|my_center|LOCUS_07580 999 829 gene locus_tag LOCUS_07590 999 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1146 1289 gene locus_tag LOCUS_07600 1146 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 2263 1529 gene locus_tag LOCUS_07610 2263 1529 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943860.1 protein_id gnl|my_center|LOCUS_07610 <2912 2345 gene locus_tag LOCUS_07620 <2912 2345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966865.1:HD domain-containing protein >Feature sequence0223 760 1245 gene locus_tag LOCUS_07630 gene greA 760 1245 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694444.1 protein_id gnl|my_center|LOCUS_07630 2054 1443 gene locus_tag LOCUS_07640 gene fadR 2054 1443 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_07640 >Feature sequence0224 >Feature sequence0225 1629 40 gene locus_tag LOCUS_07650 1629 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 2394 1642 gene locus_tag LOCUS_07660 2394 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2622 2503 gene locus_tag LOCUS_07670 2622 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence0226 <1 1285 gene locus_tag LOCUS_07680 <1 1285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881097.1:glycosyltransferase family 2 protein 2387 1203 gene locus_tag LOCUS_07690 2387 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence0227 1656 1195 gene locus_tag LOCUS_07700 1656 1195 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_07700 2202 1735 gene locus_tag LOCUS_07710 2202 1735 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941072.1 protein_id gnl|my_center|LOCUS_07710 2690 2319 gene locus_tag LOCUS_07720 2690 2319 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941071.1 protein_id gnl|my_center|LOCUS_07720 >Feature sequence0228 <2882 812 gene locus_tag LOCUS_07730 <2882 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707150.1:beta-ketoacyl-ACP synthase >Feature sequence0229 410 1273 gene locus_tag LOCUS_07740 410 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1482 2753 gene locus_tag LOCUS_07750 1482 2753 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence0230 2015 279 gene locus_tag LOCUS_07760 2015 279 CDS product NAD-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706852.1 protein_id gnl|my_center|LOCUS_07760 >Feature sequence0231 1449 2693 gene locus_tag LOCUS_07770 1449 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence0232 >Feature sequence0233 269 2266 gene locus_tag LOCUS_07780 gene shc 269 2266 CDS product squalene--hopene cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941348.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence0234 >Feature sequence0235 1804 50 gene locus_tag LOCUS_07790 1804 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 <2816 1813 gene locus_tag LOCUS_07800 <2816 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021765.1:DUF2341 domain-containing protein >Feature sequence0236 2474 1566 gene locus_tag LOCUS_07810 2474 1566 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229746.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence0237 712 1053 gene locus_tag LOCUS_07820 712 1053 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_07820 1728 1309 gene locus_tag LOCUS_07830 1728 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 <2806 2229 gene locus_tag LOCUS_07840 <2806 2229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703177.1:two-component system response regulator GlrR >Feature sequence0238 254 1924 gene locus_tag LOCUS_07850 gene yidC 254 1924 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence0239 709 1998 gene locus_tag LOCUS_07860 709 1998 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942548.1 protein_id gnl|my_center|LOCUS_07860 2089 2619 gene locus_tag LOCUS_07870 2089 2619 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942547.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence0240 501 425 gene locus_tag LOCUS_t00080 501 425 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2492 573 gene locus_tag LOCUS_07880 2492 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 >Feature sequence0241 <1 727 gene locus_tag LOCUS_07890 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787732.1:LptF/LptG family permease 724 1626 gene locus_tag LOCUS_07900 724 1626 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_07900 >Feature sequence0242 3 824 gene locus_tag LOCUS_07910 3 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1176 1427 gene locus_tag LOCUS_07920 1176 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 1982 2683 gene locus_tag LOCUS_07930 1982 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0243 287 15 gene locus_tag LOCUS_07940 287 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 895 374 gene locus_tag LOCUS_07950 895 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 <2771 892 gene locus_tag LOCUS_07960 <2771 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545662.1:PBP1A family penicillin-binding protein >Feature sequence0244 <1 660 gene locus_tag LOCUS_07970 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_092157593.1:phosphoenolpyruvate--protein phosphotransferase 657 1661 gene locus_tag LOCUS_07980 gene thiL 657 1661 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence0245 468 911 gene locus_tag LOCUS_07990 468 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 911 1762 gene locus_tag LOCUS_08000 911 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1875 2672 gene locus_tag LOCUS_08010 1875 2672 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990006.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence0246 >Feature sequence0247 2189 1059 gene locus_tag LOCUS_08020 gene dnaN 2189 1059 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence0248 2 313 gene locus_tag LOCUS_08030 2 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 427 1857 gene locus_tag LOCUS_08040 427 1857 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478391.1 protein_id gnl|my_center|LOCUS_08040 2655 1894 gene locus_tag LOCUS_08050 2655 1894 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460477.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence0249 501 416 gene locus_tag LOCUS_t00090 501 416 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1109 636 gene locus_tag LOCUS_08060 gene tadA 1109 636 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810985.1 protein_id gnl|my_center|LOCUS_08060 1263 2636 gene locus_tag LOCUS_08070 1263 2636 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940478.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence0250 1086 832 gene locus_tag LOCUS_08080 1086 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2558 1203 gene locus_tag LOCUS_08090 2558 1203 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942128.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence0251 <2734 1933 gene locus_tag LOCUS_08100 <2734 1933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044858.1:ATP-binding protein >Feature sequence0252 2603 1431 gene locus_tag LOCUS_08110 2603 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence0253 133 1206 gene locus_tag LOCUS_08120 133 1206 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311608.1 protein_id gnl|my_center|LOCUS_08120 1604 1440 gene locus_tag LOCUS_08130 1604 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 1915 2232 gene locus_tag LOCUS_08140 1915 2232 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941982.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence0254 2371 809 gene locus_tag LOCUS_08150 2371 809 CDS product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence0255 <2714 162 gene locus_tag LOCUS_08160 <2714 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942467.1:DNA mismatch repair protein MutS >Feature sequence0256 316 393 gene locus_tag LOCUS_t00100 316 393 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 460 1365 gene locus_tag LOCUS_08170 460 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2539 1382 gene locus_tag LOCUS_08180 2539 1382 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813006.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence0257 1188 187 gene locus_tag LOCUS_08190 1188 187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 <2700 1660 gene locus_tag LOCUS_08200 <2700 1660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943546.1:sigma-54 dependent transcriptional regulator >Feature sequence0258 1518 136 gene locus_tag LOCUS_08210 1518 136 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392943.1 protein_id gnl|my_center|LOCUS_08210 2561 1557 gene locus_tag LOCUS_08220 gene pfkB 2561 1557 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244923.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence0259 <1 912 gene locus_tag LOCUS_08230 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943466.1:preprotein translocase subunit SecY 979 1707 gene locus_tag LOCUS_08240 gene map 979 1707 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942767.1 protein_id gnl|my_center|LOCUS_08240 1831 2067 gene locus_tag LOCUS_08250 gene infA 1831 2067 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_08250 2329 2691 gene locus_tag LOCUS_08260 gene rpsM 2329 2691 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence0260 243 2270 gene locus_tag LOCUS_08270 243 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence0261 1161 349 gene locus_tag LOCUS_08280 1161 349 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941482.1 protein_id gnl|my_center|LOCUS_08280 1994 1164 gene locus_tag LOCUS_08290 1994 1164 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941483.1 protein_id gnl|my_center|LOCUS_08290 2441 2055 gene locus_tag LOCUS_08300 2441 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence0262 2682 1900 gene locus_tag LOCUS_08310 2682 1900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 >Feature sequence0263 2443 2033 gene locus_tag LOCUS_08320 2443 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence0264 2510 1500 gene locus_tag LOCUS_08330 gene mobAB 2510 1500 CDS product bifunctional molybdenum cofactor guanylyltransferase MobA/molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927249.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence0265 290 1315 gene locus_tag LOCUS_08340 290 1315 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence0266 12 1007 gene locus_tag LOCUS_08350 12 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 1014 2057 gene locus_tag LOCUS_08360 1014 2057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259701.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence0267 477 553 gene locus_tag LOCUS_t00110 477 553 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 743 1552 gene locus_tag LOCUS_08370 743 1552 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_08370 1720 2442 gene locus_tag LOCUS_08380 1720 2442 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545753.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence0268 2387 129 gene locus_tag LOCUS_08390 2387 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence0269 2242 2403 gene locus_tag LOCUS_08400 2242 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 >Feature sequence0270 >Feature sequence0271 1 852 gene locus_tag LOCUS_08410 1 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 861 1340 gene locus_tag LOCUS_08420 861 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1352 2461 gene locus_tag LOCUS_08430 1352 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 >Feature sequence0272 590 1297 gene locus_tag LOCUS_08440 590 1297 CDS product N-(5'-phosphoribosyl)anthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903201.1 protein_id gnl|my_center|LOCUS_08440 1509 2540 gene locus_tag LOCUS_08450 1509 2540 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980425.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence0273 93 539 gene locus_tag LOCUS_08460 93 539 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_08460 1964 618 gene locus_tag LOCUS_08470 1964 618 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086559.1 protein_id gnl|my_center|LOCUS_08470 2620 2168 gene locus_tag LOCUS_08480 2620 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence0274 90 758 gene locus_tag LOCUS_08490 90 758 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_08490 1764 979 gene locus_tag LOCUS_08500 1764 979 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937704.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence0275 1719 22 gene locus_tag LOCUS_08510 1719 22 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073843.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0276 2134 251 gene locus_tag LOCUS_08520 gene mnmG 2134 251 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944073.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence0277 1398 613 gene locus_tag LOCUS_08530 1398 613 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006314342.1 protein_id gnl|my_center|LOCUS_08530 2015 1401 gene locus_tag LOCUS_08540 2015 1401 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925345.1 protein_id gnl|my_center|LOCUS_08540 >Feature sequence0278 128 1783 gene locus_tag LOCUS_08550 128 1783 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869041.1 protein_id gnl|my_center|LOCUS_08550 1777 2316 gene locus_tag LOCUS_08560 1777 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence0279 871 101 gene locus_tag LOCUS_08570 871 101 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261960.1 protein_id gnl|my_center|LOCUS_08570 2079 856 gene locus_tag LOCUS_08580 2079 856 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014876895.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence0280 >Feature sequence0281 189 102 gene locus_tag LOCUS_t00120 189 102 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 455 1441 gene locus_tag LOCUS_08590 455 1441 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_08590 <2590 1416 gene locus_tag LOCUS_08600 <2590 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942449.1:pyridoxine 5'-phosphate synthase >Feature sequence0282 <2586 692 gene locus_tag LOCUS_08610 <2586 692 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein >Feature sequence0283 929 285 gene locus_tag LOCUS_08620 gene fsa 929 285 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544952.1 protein_id gnl|my_center|LOCUS_08620 1192 926 gene locus_tag LOCUS_08630 1192 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 1897 1358 gene locus_tag LOCUS_08640 gene folK 1897 1358 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036940.1 protein_id gnl|my_center|LOCUS_08640 <2586 1974 gene locus_tag LOCUS_08650 <2586 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545687.1:4-hydroxy-tetrahydrodipicolinate reductase >Feature sequence0284 >Feature sequence0285 <2583 1062 gene locus_tag LOCUS_08660 <2583 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939841.1:ferrous iron transport protein B >Feature sequence0286 1652 477 gene locus_tag LOCUS_08670 1652 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 2565 1777 gene locus_tag LOCUS_08680 2565 1777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence0287 992 240 gene locus_tag LOCUS_08690 gene trmD 992 240 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_08690 1550 1017 gene locus_tag LOCUS_08700 gene rimM 1550 1017 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113830.1 protein_id gnl|my_center|LOCUS_08700 1783 1553 gene locus_tag LOCUS_08710 1783 1553 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_08710 2041 1784 gene locus_tag LOCUS_08720 gene rpsP 2041 1784 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357434.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence0288 237 1778 gene locus_tag LOCUS_08730 237 1778 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921157.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence0289 <2567 514 gene locus_tag LOCUS_08740 <2567 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta >Feature sequence0290 287 1234 gene locus_tag LOCUS_08750 gene fabD 287 1234 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392463.1 protein_id gnl|my_center|LOCUS_08750 >Feature sequence0291 <2558 2043 gene locus_tag LOCUS_08760 <2558 2043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877685.1:molecular chaperone TorD family protein >Feature sequence0292 <1 1434 gene locus_tag LOCUS_08770 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930368.1:iron ABC transporter permease 1437 2522 gene locus_tag LOCUS_08780 1437 2522 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809599.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence0293 <2557 1245 gene locus_tag LOCUS_08790 <2557 1245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011816977.1:exodeoxyribonuclease V subunit beta >Feature sequence0294 <1 1183 gene locus_tag LOCUS_08800 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein >Feature sequence0295 357 1463 gene locus_tag LOCUS_08810 357 1463 CDS product choloylglycine hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263137.1 protein_id gnl|my_center|LOCUS_08810 1592 2410 gene locus_tag LOCUS_08820 1592 2410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969426.1 protein_id gnl|my_center|LOCUS_08820 >Feature sequence0296 1226 189 gene locus_tag LOCUS_08830 gene galE 1226 189 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_08830 1395 1580 gene locus_tag LOCUS_08840 1395 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence0297 38 1003 gene locus_tag LOCUS_08850 38 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 <2549 1364 gene locus_tag LOCUS_08860 <2549 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073547.1:inorganic phosphate transporter >Feature sequence0298 317 937 gene locus_tag LOCUS_08870 317 937 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392875.1 protein_id gnl|my_center|LOCUS_08870 2268 1039 gene locus_tag LOCUS_08880 2268 1039 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence0299 598 2292 gene locus_tag LOCUS_08890 598 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 >Feature sequence0300 128 2491 gene locus_tag LOCUS_08900 128 2491 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940549.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence0301 401 1696 gene locus_tag LOCUS_08910 gene flhF 401 1696 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460748.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence0302 225 31 gene locus_tag LOCUS_08920 225 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 630 1802 gene locus_tag LOCUS_08930 630 1802 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583673.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence0303 28 861 gene locus_tag LOCUS_08940 28 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384461.1 protein_id gnl|my_center|LOCUS_08940 866 2122 gene locus_tag LOCUS_08950 866 2122 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence0304 <1 902 gene locus_tag LOCUS_08960 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940701.1:tol-pal system protein YbgF 936 1712 gene locus_tag LOCUS_08970 936 1712 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_08970 1724 2182 gene locus_tag LOCUS_08980 1724 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 >Feature sequence0305 <1 757 gene locus_tag LOCUS_08990 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938056.1:HAMP domain-containing sensor histidine kinase 807 1898 gene locus_tag LOCUS_09000 807 1898 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546515.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence0306 678 1616 gene locus_tag LOCUS_09010 678 1616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 1812 2405 gene locus_tag LOCUS_09020 1812 2405 CDS product HdeD family acid-resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948431.1 protein_id gnl|my_center|LOCUS_09020 >Feature sequence0307 <1 1468 gene locus_tag LOCUS_09030 <1 1468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937484.1:thiosulfate reductase 1465 1917 gene locus_tag LOCUS_09040 1465 1917 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545501.1 protein_id gnl|my_center|LOCUS_09040 >Feature sequence0308 1355 1053 gene locus_tag LOCUS_09050 1355 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09050 2126 1371 gene locus_tag LOCUS_09060 2126 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09060 >Feature sequence0309 <1 562 gene locus_tag LOCUS_09070 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956687.1:adenylate/guanylate cyclase domain-containing protein 609 1235 gene locus_tag LOCUS_09080 609 1235 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968514.1 protein_id gnl|my_center|LOCUS_09080 1232 2473 gene locus_tag LOCUS_09090 1232 2473 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542268.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence0310 2151 1183 gene locus_tag LOCUS_09100 2151 1183 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813418.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence0311 >Feature sequence0312 218 340 gene locus_tag LOCUS_09110 218 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 514 1596 gene locus_tag LOCUS_09120 514 1596 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389655.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence0313 534 1274 gene locus_tag LOCUS_09130 534 1274 CDS product 3-ketoacyl-ACP reductase FabG2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261527.1 protein_id gnl|my_center|LOCUS_09130 1274 1885 gene locus_tag LOCUS_09140 1274 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 >Feature sequence0314 <1 2164 gene locus_tag LOCUS_09150 <1 2164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389138.1:two-component system sensor histidine kinase AtoS >Feature sequence0315 28 1962 gene locus_tag LOCUS_09160 gene dnaX 28 1962 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940771.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence0316 >Feature sequence0317 32 682 gene locus_tag LOCUS_09170 32 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939499.1 protein_id gnl|my_center|LOCUS_09170 689 1576 gene locus_tag LOCUS_09180 689 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence0318 166 927 gene locus_tag LOCUS_09190 166 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09190 1075 2160 gene locus_tag LOCUS_09200 1075 2160 CDS product IS91 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118140.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence0319 289 1368 gene locus_tag LOCUS_09210 289 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939755.1 protein_id gnl|my_center|LOCUS_09210 >Feature sequence0320 625 212 gene locus_tag LOCUS_09220 gene gspI 625 212 CDS product type II secretion system minor pseudopilin GspI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000837699.1 protein_id gnl|my_center|LOCUS_09220 1170 622 gene locus_tag LOCUS_09230 1170 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1630 1175 gene locus_tag LOCUS_09240 gene gspG 1630 1175 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_09240 2299 1676 gene locus_tag LOCUS_09250 2299 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence0321 1030 455 gene locus_tag LOCUS_09260 1030 455 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869265.1 protein_id gnl|my_center|LOCUS_09260 1415 1143 gene locus_tag LOCUS_09270 1415 1143 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043863.1 protein_id gnl|my_center|LOCUS_09270 1949 2413 gene locus_tag LOCUS_09280 1949 2413 CDS product CYTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055869.1 protein_id gnl|my_center|LOCUS_09280 >Feature sequence0322 >Feature sequence0323 >Feature sequence0324 1993 1247 gene locus_tag LOCUS_09290 gene folE2 1993 1247 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_09290 2422 2063 gene locus_tag LOCUS_09300 2422 2063 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081556.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence0325 397 1167 gene locus_tag LOCUS_09310 397 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 2080 1322 gene locus_tag LOCUS_09320 2080 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence0326 1613 651 gene locus_tag LOCUS_09330 1613 651 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114295.1 protein_id gnl|my_center|LOCUS_09330 <2456 1606 gene locus_tag LOCUS_09340 <2456 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895572.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence0327 369 971 gene locus_tag LOCUS_09350 369 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1557 1811 gene locus_tag LOCUS_09360 1557 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 <2453 1833 gene locus_tag LOCUS_09370 <2453 1833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_109031481.1:SDR family oxidoreductase >Feature sequence0328 3 143 gene locus_tag LOCUS_09380 3 143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 144 434 gene locus_tag LOCUS_09390 144 434 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_09390 488 892 gene locus_tag LOCUS_09400 488 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 1058 1134 gene locus_tag LOCUS_t00130 1058 1134 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1296 2021 gene locus_tag LOCUS_09410 1296 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence0329 >Feature sequence0330 >Feature sequence0331 908 420 gene locus_tag LOCUS_09420 gene ruvC 908 420 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_09420 1661 912 gene locus_tag LOCUS_09430 1661 912 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_09430 2334 1717 gene locus_tag LOCUS_09440 2334 1717 CDS product RlmE family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939535.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence0332 373 804 gene locus_tag LOCUS_09450 373 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1835 1044 gene locus_tag LOCUS_09460 1835 1044 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence0333 1407 991 gene locus_tag LOCUS_09470 1407 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 1863 1480 gene locus_tag LOCUS_09480 1863 1480 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388948.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence0334 1302 892 gene locus_tag LOCUS_09490 gene nikR 1302 892 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_09490 <2407 1328 gene locus_tag LOCUS_09500 <2407 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938869.1:M48 family metallopeptidase >Feature sequence0335 1674 850 gene locus_tag LOCUS_09510 1674 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0336 413 868 gene locus_tag LOCUS_09520 413 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 868 1851 gene locus_tag LOCUS_09530 868 1851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence0337 1236 529 gene locus_tag LOCUS_09540 1236 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2017 1229 gene locus_tag LOCUS_09550 gene murI 2017 1229 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943554.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence0338 417 698 gene locus_tag LOCUS_09560 417 698 CDS product integration host factor subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003493505.1 protein_id gnl|my_center|LOCUS_09560 1568 951 gene locus_tag LOCUS_09570 1568 951 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942241.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence0339 <1 1558 gene locus_tag LOCUS_09580 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763446.1:GspE/PulE family protein 1597 2052 gene locus_tag LOCUS_09590 gene smpB 1597 2052 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942353.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence0340 2014 641 gene locus_tag LOCUS_09600 2014 641 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence0341 >Feature sequence0342 1817 879 gene locus_tag LOCUS_09610 1817 879 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990687.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence0343 <2384 465 gene locus_tag LOCUS_09620 <2384 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001829677.1:ribonuclease R >Feature sequence0344 1380 253 gene locus_tag LOCUS_09630 1380 253 CDS product branched-chain amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937853.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence0345 268 801 gene locus_tag LOCUS_09640 268 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 2072 843 gene locus_tag LOCUS_09650 2072 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence0346 <1 520 gene locus_tag LOCUS_09660 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941333.1:DUF3108 domain-containing protein 924 523 gene locus_tag LOCUS_09670 924 523 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207691809.1 protein_id gnl|my_center|LOCUS_09670 1544 1086 gene locus_tag LOCUS_09680 1544 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 >Feature sequence0347 1874 1461 gene locus_tag LOCUS_09690 1874 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2095 1871 gene locus_tag LOCUS_09700 2095 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence0348 >Feature sequence0349 1242 94 gene locus_tag LOCUS_09710 1242 94 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958239.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence0350 <1 580 gene locus_tag LOCUS_09720 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706034.1:xanthine dehydrogenase molybdenum-binding subunit XdhA 591 1466 gene locus_tag LOCUS_09730 gene xdhB 591 1466 CDS product xanthine dehydrogenase FAD-binding subunit XdhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706035.1 protein_id gnl|my_center|LOCUS_09730 1466 1933 gene locus_tag LOCUS_09740 1466 1933 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948907.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence0351 351 151 gene locus_tag LOCUS_09750 351 151 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391770.1 protein_id gnl|my_center|LOCUS_09750 2195 600 gene locus_tag LOCUS_09760 gene lnt 2195 600 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545206.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence0352 425 132 gene locus_tag LOCUS_09770 gene fliE 425 132 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941077.1 protein_id gnl|my_center|LOCUS_09770 906 475 gene locus_tag LOCUS_09780 gene flgC 906 475 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_09780 1370 957 gene locus_tag LOCUS_09790 gene flgB 1370 957 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941075.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence0353 >Feature sequence0354 331 1137 gene locus_tag LOCUS_09800 gene recO 331 1137 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909322.1 protein_id gnl|my_center|LOCUS_09800 <2353 1121 gene locus_tag LOCUS_09810 <2353 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122252.1:DEAD/DEAH box helicase >Feature sequence0355 2187 481 gene locus_tag LOCUS_09820 2187 481 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722319.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence0356 182 1276 gene locus_tag LOCUS_09830 gene flhB 182 1276 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231949.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence0357 <1 1339 gene locus_tag LOCUS_09840 <1 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943603.1:bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase >Feature sequence0358 <1 830 gene locus_tag LOCUS_09850 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057690.1:radical SAM protein 839 2035 gene locus_tag LOCUS_09860 839 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 >Feature sequence0359 <1 1248 gene locus_tag LOCUS_09870 <1 1248 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000617932.1:sigma-54-dependent response regulator transcription factor ZraR >Feature sequence0360 1555 203 gene locus_tag LOCUS_09880 gene glmM 1555 203 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence0361 548 1660 gene locus_tag LOCUS_09890 548 1660 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence0362 1491 91 gene locus_tag LOCUS_09900 1491 91 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392987.1 protein_id gnl|my_center|LOCUS_09900 2204 1488 gene locus_tag LOCUS_09910 2204 1488 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083233.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence0363 638 1153 gene locus_tag LOCUS_09920 638 1153 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546210.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence0364 <1 595 gene locus_tag LOCUS_09930 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325817.1:beta-ketoacyl-[acyl-carrier-protein] synthase family protein 957 1208 gene locus_tag LOCUS_09940 957 1208 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921431.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence0365 1733 567 gene locus_tag LOCUS_09950 gene dinB 1733 567 CDS product DNA polymerase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942261.1 protein_id gnl|my_center|LOCUS_09950 <2331 1812 gene locus_tag LOCUS_09960 <2331 1812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391812.1:DUF72 domain-containing protein >Feature sequence0366 392 12 gene locus_tag LOCUS_09970 392 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1722 463 gene locus_tag LOCUS_09980 1722 463 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784141.1 protein_id gnl|my_center|LOCUS_09980 <2329 1719 gene locus_tag LOCUS_09990 <2329 1719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003121626.1:polyphosphate kinase 2 >Feature sequence0367 <2327 690 gene locus_tag LOCUS_10000 <2327 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 >Feature sequence0368 564 1043 gene locus_tag LOCUS_10010 564 1043 CDS product CarD family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938863.1 protein_id gnl|my_center|LOCUS_10010 1284 2225 gene locus_tag LOCUS_10020 1284 2225 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940759.1 protein_id gnl|my_center|LOCUS_10020 >Feature sequence0369 2 1261 gene locus_tag LOCUS_10030 2 1261 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762240.1 protein_id gnl|my_center|LOCUS_10030 1266 1745 gene locus_tag LOCUS_10040 1266 1745 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_10040 1745 2140 gene locus_tag LOCUS_10050 1745 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence0370 <1 2078 gene locus_tag LOCUS_10060 <1 2078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941940.1:ATP-binding protein >Feature sequence0371 1506 676 gene locus_tag LOCUS_10070 1506 676 CDS product DUF4405 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546502.1 protein_id gnl|my_center|LOCUS_10070 2189 2102 gene locus_tag LOCUS_t00140 2189 2102 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0372 >Feature sequence0373 599 2035 gene locus_tag LOCUS_10080 gene selA 599 2035 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940143.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence0374 2110 23 gene locus_tag LOCUS_10090 gene pnp 2110 23 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914012.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence0375 1245 817 gene locus_tag LOCUS_10100 1245 817 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943436.1 protein_id gnl|my_center|LOCUS_10100 1547 2209 gene locus_tag LOCUS_10110 1547 2209 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence0376 918 1595 gene locus_tag LOCUS_10120 918 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 <2313 1637 gene locus_tag LOCUS_10130 <2313 1637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001201260.1:TIGR00266 family protein >Feature sequence0377 <1 671 gene locus_tag LOCUS_10140 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263947.1:ATP-dependent DNA helicase RecQ 664 1392 gene locus_tag LOCUS_10150 664 1392 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_10150 1389 1805 gene locus_tag LOCUS_10160 1389 1805 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943269.1 protein_id gnl|my_center|LOCUS_10160 >Feature sequence0378 742 287 gene locus_tag LOCUS_10170 742 287 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004152114.1 protein_id gnl|my_center|LOCUS_10170 1716 748 gene locus_tag LOCUS_10180 1716 748 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence0379 1378 2226 gene locus_tag LOCUS_10190 1378 2226 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940340.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence0380 >Feature sequence0381 1164 94 gene locus_tag LOCUS_10200 gene rfbB 1164 94 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943002.1 protein_id gnl|my_center|LOCUS_10200 <2303 1275 gene locus_tag LOCUS_10210 <2303 1275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206542.1:DcaP family trimeric outer membrane transporter >Feature sequence0382 474 1379 gene locus_tag LOCUS_10220 474 1379 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940619.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence0383 <1 2122 gene locus_tag LOCUS_10230 <1 2122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942226.1:CBS domain-containing protein >Feature sequence0384 <1 560 gene locus_tag LOCUS_10240 <1 560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028181.1:endo alpha-1,4 polygalactosaminidase 1810 590 gene locus_tag LOCUS_10250 gene dacB 1810 590 CDS product serine-type D-Ala-D-Ala carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479070.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence0385 217 1425 gene locus_tag LOCUS_10260 gene qmoC 217 1425 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938150.1 protein_id gnl|my_center|LOCUS_10260 1543 1618 gene locus_tag LOCUS_t00150 1543 1618 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1713 1797 gene locus_tag LOCUS_t00160 1713 1797 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1911 1986 gene locus_tag LOCUS_t00170 1911 1986 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 2039 2113 gene locus_tag LOCUS_t00180 2039 2113 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0386 225 301 gene locus_tag LOCUS_t00190 225 301 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 662 1225 gene locus_tag LOCUS_10270 662 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 1782 1591 gene locus_tag LOCUS_10280 1782 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 2057 1782 gene locus_tag LOCUS_10290 2057 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence0387 181 1395 gene locus_tag LOCUS_10300 181 1395 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388109.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence0388 1005 502 gene locus_tag LOCUS_10310 gene tadA 1005 502 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940742.1 protein_id gnl|my_center|LOCUS_10310 1703 1470 gene locus_tag LOCUS_10320 1703 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence0389 741 310 gene locus_tag LOCUS_10330 741 310 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_10330 2106 799 gene locus_tag LOCUS_10340 2106 799 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_10340 >Feature sequence0390 402 935 gene locus_tag LOCUS_10350 402 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 928 1881 gene locus_tag LOCUS_10360 928 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence0391 >Feature sequence0392 <1 544 gene locus_tag LOCUS_10370 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938355.1:ABC transporter ATP-binding protein 850 479 gene locus_tag LOCUS_10380 850 479 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000024297.1 protein_id gnl|my_center|LOCUS_10380 1056 1439 gene locus_tag LOCUS_10390 1056 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence0393 664 1107 gene locus_tag LOCUS_10400 664 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1356 2138 gene locus_tag LOCUS_10410 1356 2138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence0394 1721 636 gene locus_tag LOCUS_10420 gene murG 1721 636 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_10420 1933 1712 gene locus_tag LOCUS_10430 1933 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence0395 1188 97 gene locus_tag LOCUS_10440 1188 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 >Feature sequence0396 >Feature sequence0397 926 1435 gene locus_tag LOCUS_10450 926 1435 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044348005.1 protein_id gnl|my_center|LOCUS_10450 1582 1451 gene locus_tag LOCUS_10460 1582 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 >Feature sequence0398 <1 679 gene locus_tag LOCUS_10470 <1 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940912.1:B12-binding domain-containing radical SAM protein 798 1070 gene locus_tag LOCUS_10480 798 1070 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_10480 1067 1402 gene locus_tag LOCUS_10490 1067 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 1818 2144 gene locus_tag LOCUS_10500 1818 2144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence0399 <2265 1053 gene locus_tag LOCUS_10510 <2265 1053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942202.1:PAS domain S-box protein >Feature sequence0400 885 427 gene locus_tag LOCUS_10520 gene fabZ 885 427 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942905.1 protein_id gnl|my_center|LOCUS_10520 1967 891 gene locus_tag LOCUS_10530 gene lpxD 1967 891 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942906.1 protein_id gnl|my_center|LOCUS_10530 >Feature sequence0401 1675 830 gene locus_tag LOCUS_10540 1675 830 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768044.1 protein_id gnl|my_center|LOCUS_10540 <2251 1672 gene locus_tag LOCUS_10550 <2251 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626293.1:ABC transporter permease >Feature sequence0402 <1 1802 gene locus_tag LOCUS_10560 <1 1802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144200.1:VCBS repeat-containing protein >Feature sequence0403 79 1413 gene locus_tag LOCUS_10570 79 1413 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943170.1 protein_id gnl|my_center|LOCUS_10570 1946 1491 gene locus_tag LOCUS_10580 1946 1491 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942446.1 protein_id gnl|my_center|LOCUS_10580 2242 1943 gene locus_tag LOCUS_10590 2242 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 >Feature sequence0404 1115 141 gene locus_tag LOCUS_10600 1115 141 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937322.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence0405 2142 1522 gene locus_tag LOCUS_10610 2142 1522 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890562.1 protein_id gnl|my_center|LOCUS_10610 >Feature sequence0406 1237 149 gene locus_tag LOCUS_10620 1237 149 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_10620 <2230 1230 gene locus_tag LOCUS_10630 <2230 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_080510933.1:formate dehydrogenase subunit alpha >Feature sequence0407 822 1799 gene locus_tag LOCUS_10640 822 1799 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120272.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence0408 1583 216 gene locus_tag LOCUS_10650 1583 216 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920272.1 protein_id gnl|my_center|LOCUS_10650 >Feature sequence0409 187 113 gene locus_tag LOCUS_t00200 187 113 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 249 992 gene locus_tag LOCUS_10660 gene rnc 249 992 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557292.1 protein_id gnl|my_center|LOCUS_10660 989 2083 gene locus_tag LOCUS_10670 989 2083 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942867.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence0410 1796 1368 gene locus_tag LOCUS_10680 1796 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 >Feature sequence0411 626 474 gene locus_tag LOCUS_10690 626 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1543 878 gene locus_tag LOCUS_10700 1543 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence0412 940 1875 gene locus_tag LOCUS_10710 940 1875 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389853.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence0413 <1 1045 gene locus_tag LOCUS_10720 <1 1045 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680321.1:peptidylprolyl isomerase 2080 1076 gene locus_tag LOCUS_10730 2080 1076 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence0414 82 930 gene locus_tag LOCUS_10740 82 930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1013 1501 gene locus_tag LOCUS_10750 1013 1501 CDS product putative molybdenum carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921917.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence0415 1637 549 gene locus_tag LOCUS_10760 gene cobT 1637 549 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393223.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence0416 79 702 gene locus_tag LOCUS_10770 79 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 706 1281 gene locus_tag LOCUS_10780 gene purN 706 1281 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326621.1 protein_id gnl|my_center|LOCUS_10780 1363 1902 gene locus_tag LOCUS_10790 gene pyrR 1363 1902 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887753.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence0417 1149 859 gene locus_tag LOCUS_10800 1149 859 CDS product lipid-A-disaccharide synthase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972149.1 protein_id gnl|my_center|LOCUS_10800 1897 1142 gene locus_tag LOCUS_10810 1897 1142 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038929.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence0418 2103 403 gene locus_tag LOCUS_10820 2103 403 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941450.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence0419 <1 2012 gene locus_tag LOCUS_10830 <1 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940804.1:primosomal protein N' >Feature sequence0420 <1 733 gene locus_tag LOCUS_10840 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943908.1:FAD-linked oxidase C-terminal domain-containing protein 885 1079 gene locus_tag LOCUS_10850 gene rpsU 885 1079 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313768.1 protein_id gnl|my_center|LOCUS_10850 1250 2146 gene locus_tag LOCUS_10860 gene xerD 1250 2146 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398985.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence0421 314 991 gene locus_tag LOCUS_10870 314 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence0422 >Feature sequence0423 27 317 gene locus_tag LOCUS_10880 27 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 588 872 gene locus_tag LOCUS_10890 588 872 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942058.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence0424 >Feature sequence0425 >Feature sequence0426 1002 199 gene locus_tag LOCUS_10900 1002 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 <2171 1400 gene locus_tag LOCUS_10910 <2171 1400 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421529.1:SAM-dependent chlorinase/fluorinase >Feature sequence0427 >Feature sequence0428 601 116 gene locus_tag LOCUS_10920 601 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence0429 441 253 gene locus_tag LOCUS_10930 441 253 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877934.1 protein_id gnl|my_center|LOCUS_10930 1232 456 gene locus_tag LOCUS_10940 1232 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 <2149 1286 gene locus_tag LOCUS_10950 <2149 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545424.1:glutamine-hydrolyzing GMP synthase >Feature sequence0430 645 268 gene locus_tag LOCUS_10960 645 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1336 905 gene locus_tag LOCUS_10970 1336 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 <2146 1333 gene locus_tag LOCUS_10980 <2146 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941081.1:FliI/YscN family ATPase >Feature sequence0431 <2144 1010 gene locus_tag LOCUS_10990 <2144 1010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence0432 956 207 gene locus_tag LOCUS_11000 gene fabG 956 207 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_11000 2143 953 gene locus_tag LOCUS_11010 2143 953 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545166.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence0433 1089 1703 gene locus_tag LOCUS_11020 1089 1703 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090793.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence0434 626 183 gene locus_tag LOCUS_11030 626 183 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707183.1 protein_id gnl|my_center|LOCUS_11030 <2140 1050 gene locus_tag LOCUS_11040 <2140 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202943321.1:LL-diaminopimelate aminotransferase >Feature sequence0435 >Feature sequence0436 <1 850 gene locus_tag LOCUS_11050 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073027.1:TRAP transporter substrate-binding protein 918 1460 gene locus_tag LOCUS_11060 918 1460 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073028.1 protein_id gnl|my_center|LOCUS_11060 >Feature sequence0437 1281 994 gene locus_tag LOCUS_11070 gene groES 1281 994 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_11070 <2125 1520 gene locus_tag LOCUS_11080 <2125 1520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244231.1:branched-chain amino acid aminotransferase >Feature sequence0438 399 599 gene locus_tag LOCUS_11090 399 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 612 1430 gene locus_tag LOCUS_11100 612 1430 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_11100 1812 2063 gene locus_tag LOCUS_11110 1812 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence0439 <1 1575 gene locus_tag LOCUS_11120 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942443.1:citramalate synthase 1819 2076 gene locus_tag LOCUS_11130 1819 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence0440 <1 661 gene locus_tag LOCUS_11140 <1 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851309.1:pilus (MSHA type) biogenesis protein MshL 709 1734 gene locus_tag LOCUS_11150 709 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2113 1844 gene locus_tag LOCUS_11160 2113 1844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence0441 <1 1133 gene locus_tag LOCUS_11170 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002359214.1:DegV family protein 1139 1843 gene locus_tag LOCUS_11180 1139 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 >Feature sequence0442 464 982 gene locus_tag LOCUS_11190 464 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence0443 >Feature sequence0444 1369 365 gene locus_tag LOCUS_11200 1369 365 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943443.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence0445 385 642 gene locus_tag LOCUS_11210 385 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 653 1897 gene locus_tag LOCUS_11220 653 1897 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074037.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence0446 >Feature sequence0447 1083 1517 gene locus_tag LOCUS_11230 1083 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence0448 272 955 gene locus_tag LOCUS_11240 272 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1053 2045 gene locus_tag LOCUS_11250 1053 2045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence0449 1563 208 gene locus_tag LOCUS_11260 gene der 1563 208 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942865.1 protein_id gnl|my_center|LOCUS_11260 <2090 1550 gene locus_tag LOCUS_11270 <2090 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107905.1:RNase adapter RapZ >Feature sequence0450 >Feature sequence0451 >Feature sequence0452 172 1008 gene locus_tag LOCUS_11280 172 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1900 2022 gene locus_tag LOCUS_11290 1900 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence0453 <2086 1497 gene locus_tag LOCUS_11300 <2086 1497 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546183.1:phosphatase PAP2 family protein >Feature sequence0454 <1 541 gene locus_tag LOCUS_11310 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002221846.1:elongation factor Tu 552 866 gene locus_tag LOCUS_11320 gene rpsJ 552 866 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_11320 979 1566 gene locus_tag LOCUS_11330 gene rplC 979 1566 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_11330 >Feature sequence0455 2030 921 gene locus_tag LOCUS_11340 2030 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence0456 243 1688 gene locus_tag LOCUS_11350 gene gatA 243 1688 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence0457 1866 1063 gene locus_tag LOCUS_11360 1866 1063 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence0458 >Feature sequence0459 125 1723 gene locus_tag LOCUS_11370 125 1723 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142581.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence0460 1979 1341 gene locus_tag LOCUS_11380 1979 1341 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941401.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence0461 1325 531 gene locus_tag LOCUS_11390 1325 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 1858 1331 gene locus_tag LOCUS_11400 1858 1331 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970030.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence0462 541 269 gene locus_tag LOCUS_11410 541 269 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791188.1 protein_id gnl|my_center|LOCUS_11410 1624 797 gene locus_tag LOCUS_11420 gene larE 1624 797 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461498.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence0463 919 98 gene locus_tag LOCUS_11430 919 98 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704580.1 protein_id gnl|my_center|LOCUS_11430 2030 1260 gene locus_tag LOCUS_11440 2030 1260 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence0464 1422 436 gene locus_tag LOCUS_11450 1422 436 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_11450 1653 1859 gene locus_tag LOCUS_11460 1653 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence0465 >Feature sequence0466 1854 1363 gene locus_tag LOCUS_11470 1854 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence0467 1359 130 gene locus_tag LOCUS_11480 1359 130 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812916.1 protein_id gnl|my_center|LOCUS_11480 <2059 1485 gene locus_tag LOCUS_11490 <2059 1485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943204.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB >Feature sequence0468 1421 1116 gene locus_tag LOCUS_11500 1421 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1984 1418 gene locus_tag LOCUS_11510 1984 1418 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence0469 <2055 222 gene locus_tag LOCUS_11520 <2055 222 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002857979.1:4Fe-4S dicluster domain-containing protein >Feature sequence0470 433 1737 gene locus_tag LOCUS_11530 433 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence0471 223 486 gene locus_tag LOCUS_11540 223 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence0472 <2046 349 gene locus_tag LOCUS_11550 <2046 349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_110170977.1:VWA domain-containing protein >Feature sequence0473 48 494 gene locus_tag LOCUS_11560 gene ndhC 48 494 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932448.1 protein_id gnl|my_center|LOCUS_11560 464 988 gene locus_tag LOCUS_11570 464 988 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392493.1 protein_id gnl|my_center|LOCUS_11570 975 1421 gene locus_tag LOCUS_11580 975 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence0474 219 1361 gene locus_tag LOCUS_11590 219 1361 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_11590 1358 1678 gene locus_tag LOCUS_11600 1358 1678 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938537.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence0475 166 1521 gene locus_tag LOCUS_11610 166 1521 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809603.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence0476 1432 218 gene locus_tag LOCUS_11620 1432 218 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence0477 <2039 463 gene locus_tag LOCUS_11630 <2039 463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940681.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence0478 26 421 gene locus_tag LOCUS_11640 26 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 997 455 gene locus_tag LOCUS_11650 gene cobO 997 455 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197530100.1 protein_id gnl|my_center|LOCUS_11650 1620 994 gene locus_tag LOCUS_11660 1620 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence0479 >Feature sequence0480 <1 1877 gene locus_tag LOCUS_11670 <1 1877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940774.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence0481 1917 1030 gene locus_tag LOCUS_11680 1917 1030 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869240.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence0482 >Feature sequence0483 594 247 gene locus_tag LOCUS_11690 594 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 1957 698 gene locus_tag LOCUS_11700 1957 698 CDS product SO_0444 family Cu/Zn efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932494.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0484 1204 170 gene locus_tag LOCUS_11710 gene moaA 1204 170 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_11710 >Feature sequence0485 >Feature sequence0486 <1 611 gene locus_tag LOCUS_11720 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940832.1:argininosuccinate lyase 608 1678 gene locus_tag LOCUS_11730 608 1678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence0487 <1 1942 gene locus_tag LOCUS_11740 <1 1942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004525850.1:DNA topoisomerase III >Feature sequence0488 115 1062 gene locus_tag LOCUS_11750 115 1062 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706439.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence0489 <1 1948 gene locus_tag LOCUS_11760 <1 1948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121001.1:ATP-binding protein >Feature sequence0490 1050 493 gene locus_tag LOCUS_11770 1050 493 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938865.1 protein_id gnl|my_center|LOCUS_11770 <2009 1178 gene locus_tag LOCUS_11780 <2009 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941322.1:ribose-phosphate pyrophosphokinase >Feature sequence0491 773 1585 gene locus_tag LOCUS_11790 gene nirQ 773 1585 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence0492 1812 700 gene locus_tag LOCUS_11800 1812 700 CDS product two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071150.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence0493 3 218 gene locus_tag LOCUS_11810 3 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 215 712 gene locus_tag LOCUS_11820 215 712 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938185.1 protein_id gnl|my_center|LOCUS_11820 749 825 gene locus_tag LOCUS_t00210 749 825 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1303 1575 gene locus_tag LOCUS_11830 1303 1575 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812968.1 protein_id gnl|my_center|LOCUS_11830 1965 1642 gene locus_tag LOCUS_11840 1965 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 >Feature sequence0494 1621 551 gene locus_tag LOCUS_11850 1621 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence0495 1555 170 gene locus_tag LOCUS_11860 1555 170 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence0496 <1991 1161 gene locus_tag LOCUS_11870 <1991 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940973.1:aminopeptidase N >Feature sequence0497 <1991 752 gene locus_tag LOCUS_11880 <1991 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941395.1:proton-conducting transporter membrane subunit >Feature sequence0498 220 1572 gene locus_tag LOCUS_11890 gene acsC 220 1572 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545537.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence0499 >Feature sequence0500 769 32 gene locus_tag LOCUS_11900 gene flgF 769 32 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_11900 1398 991 gene locus_tag LOCUS_11910 1398 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1982 1488 gene locus_tag LOCUS_11920 1982 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 >Feature sequence0501 <1982 61 gene locus_tag LOCUS_11930 <1982 61 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938149.1:hydrogenase iron-sulfur subunit >Feature sequence0502 <1 1359 gene locus_tag LOCUS_11940 <1 1359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020247.1:DEAD/DEAH box helicase >Feature sequence0503 <1 1441 gene locus_tag LOCUS_11950 <1 1441 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704392.1:two-component system response regulator <1976 1464 gene locus_tag LOCUS_11960 <1976 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002209718.1:aspartate/glutamate racemase family protein >Feature sequence0504 >Feature sequence0505 1408 215 gene locus_tag LOCUS_11970 1408 215 CDS product PBS lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393103.1 protein_id gnl|my_center|LOCUS_11970 <1972 1405 gene locus_tag LOCUS_11980 <1972 1405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence0506 >Feature sequence0507 <1 686 gene locus_tag LOCUS_11990 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941403.1:NADH-quinone oxidoreductase subunit C 731 1516 gene locus_tag LOCUS_12000 731 1516 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941404.1 protein_id gnl|my_center|LOCUS_12000 >Feature sequence0508 <1 508 gene locus_tag LOCUS_12010 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392758.1:glutamate-1-semialdehyde 2,1-aminomutase 588 815 gene locus_tag LOCUS_12020 588 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 829 1257 gene locus_tag LOCUS_12030 829 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 >Feature sequence0509 1460 72 gene locus_tag LOCUS_12040 1460 72 CDS product IS4-like element ISDha5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808317.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence0510 21 449 gene locus_tag LOCUS_12050 21 449 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_12050 655 1527 gene locus_tag LOCUS_12060 655 1527 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258401.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence0511 <1941 816 gene locus_tag LOCUS_12070 <1941 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943489.1:elongation factor G >Feature sequence0512 <1940 416 gene locus_tag LOCUS_12080 <1940 416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein >Feature sequence0513 46 378 gene locus_tag LOCUS_12090 46 378 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence0514 1606 488 gene locus_tag LOCUS_12100 1606 488 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941744.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence0515 171 947 gene locus_tag LOCUS_12110 171 947 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878638.1 protein_id gnl|my_center|LOCUS_12110 >Feature sequence0516 >Feature sequence0517 1301 786 gene locus_tag LOCUS_12120 1301 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 <1930 1342 gene locus_tag LOCUS_12130 <1930 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958614.1:adenosylhomocysteinase >Feature sequence0518 1068 394 gene locus_tag LOCUS_12140 gene tolQ 1068 394 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940706.1 protein_id gnl|my_center|LOCUS_12140 <1928 1350 gene locus_tag LOCUS_12150 <1928 1350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942409.1:polyprenyl synthetase family protein >Feature sequence0519 <1 1546 gene locus_tag LOCUS_12160 <1 1546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259627.1:PAS domain S-box protein >Feature sequence0520 110 889 gene locus_tag LOCUS_12170 110 889 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105341.1 protein_id gnl|my_center|LOCUS_12170 <1924 895 gene locus_tag LOCUS_12180 <1924 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227876.1:MFS transporter >Feature sequence0521 >Feature sequence0522 140 1420 gene locus_tag LOCUS_12190 gene ssnA 140 1420 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence0523 42 1844 gene locus_tag LOCUS_12200 42 1844 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919618.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence0524 584 75 gene locus_tag LOCUS_12210 584 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1502 633 gene locus_tag LOCUS_12220 gene rsmA 1502 633 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651552.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence0525 265 1017 gene locus_tag LOCUS_12230 gene larB 265 1017 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940816.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence0526 814 889 gene locus_tag LOCUS_t00220 814 889 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0527 >Feature sequence0528 <1 844 gene locus_tag LOCUS_12240 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943635.1:phosphomethylpyrimidine synthase ThiC 1727 966 gene locus_tag LOCUS_12250 1727 966 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962275.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence0529 <1 763 gene locus_tag LOCUS_12260 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072444.1:3-deoxy-manno-octulosonate cytidylyltransferase >Feature sequence0530 <1 1131 gene locus_tag LOCUS_12270 <1 1131 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942180.1:exodeoxyribonuclease V subunit gamma >Feature sequence0531 1279 143 gene locus_tag LOCUS_12280 1279 143 CDS product Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063838431.1 protein_id gnl|my_center|LOCUS_12280 <1901 1338 gene locus_tag LOCUS_12290 <1901 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403684.1:Mur ligase family protein >Feature sequence0532 554 1834 gene locus_tag LOCUS_12300 gene sat 554 1834 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938590.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence0533 654 49 gene locus_tag LOCUS_12310 654 49 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941488.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence0534 98 952 gene locus_tag LOCUS_12320 gene ubiA 98 952 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391644.1 protein_id gnl|my_center|LOCUS_12320 >Feature sequence0535 <1 1195 gene locus_tag LOCUS_12330 <1 1195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase 1199 1402 gene locus_tag LOCUS_12340 1199 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12340 1445 1801 gene locus_tag LOCUS_12350 1445 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence0536 <1890 239 gene locus_tag LOCUS_12360 <1890 239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012164238.1:ChaN family lipoprotein >Feature sequence0537 635 387 gene locus_tag LOCUS_12370 635 387 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_12370 1484 738 gene locus_tag LOCUS_12380 1484 738 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815129.1 protein_id gnl|my_center|LOCUS_12380 1828 1529 gene locus_tag LOCUS_12390 1828 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence0538 595 1152 gene locus_tag LOCUS_12400 gene frr 595 1152 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942563.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence0539 541 792 gene locus_tag LOCUS_12410 541 792 CDS product DUF1844 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937799.1 protein_id gnl|my_center|LOCUS_12410 804 1754 gene locus_tag LOCUS_12420 gene ispE 804 1754 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941321.1 protein_id gnl|my_center|LOCUS_12420 1764 1838 gene locus_tag LOCUS_t00230 1764 1838 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0540 <1 791 gene locus_tag LOCUS_12430 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113853.1:class I SAM-dependent methyltransferase <1886 858 gene locus_tag LOCUS_12440 <1886 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072442.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence0541 334 1599 gene locus_tag LOCUS_12450 334 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1641 1835 gene locus_tag LOCUS_12460 1641 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence0542 432 1487 gene locus_tag LOCUS_12470 432 1487 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence0543 <1 1618 gene locus_tag LOCUS_12480 <1 1618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460040.1:molecular chaperone HtpG >Feature sequence0544 289 975 gene locus_tag LOCUS_12490 289 975 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941310.1 protein_id gnl|my_center|LOCUS_12490 1043 1450 gene locus_tag LOCUS_12500 1043 1450 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence0545 <1 1286 gene locus_tag LOCUS_12510 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941272.1:phosphoribosylamine--glycine ligase >Feature sequence0546 <1 895 gene locus_tag LOCUS_12520 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943547.1:ATP-binding protein >Feature sequence0547 >Feature sequence0548 1743 88 gene locus_tag LOCUS_12530 gene argS 1743 88 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403746.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence0549 91 1404 gene locus_tag LOCUS_12540 91 1404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 >Feature sequence0550 613 23 gene locus_tag LOCUS_12550 613 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence0551 >Feature sequence0552 545 1357 gene locus_tag LOCUS_12560 gene ccsB 545 1357 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence0553 <1858 718 gene locus_tag LOCUS_12570 <1858 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097871.1:colanic acid biosynthesis phosphomannomutase CpsG >Feature sequence0554 <1 925 gene locus_tag LOCUS_12580 <1 925 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943693.1:UDP-N-acetylmuramate--L-alanine ligase 925 1842 gene locus_tag LOCUS_12590 gene murB 925 1842 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460695.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence0555 953 807 gene locus_tag LOCUS_12600 953 807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 <1855 1287 gene locus_tag LOCUS_12610 <1855 1287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004526219.1:lipopolysaccharide heptosyltransferase II >Feature sequence0556 1436 96 gene locus_tag LOCUS_12620 1436 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence0557 32 670 gene locus_tag LOCUS_12630 32 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939792.1 protein_id gnl|my_center|LOCUS_12630 675 1652 gene locus_tag LOCUS_12640 gene bioB 675 1652 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986728.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence0558 740 339 gene locus_tag LOCUS_12650 740 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence0559 639 1073 gene locus_tag LOCUS_12660 639 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1208 1825 gene locus_tag LOCUS_12670 1208 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence0560 1824 892 gene locus_tag LOCUS_12680 1824 892 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393448.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence0561 >Feature sequence0562 1707 286 gene locus_tag LOCUS_12690 gene gatB 1707 286 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943991.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence0563 <1 1252 gene locus_tag LOCUS_12700 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259368.1:fatty acid CoA ligase family protein >Feature sequence0564 1192 344 gene locus_tag LOCUS_12710 gene htpX 1192 344 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545548.1 protein_id gnl|my_center|LOCUS_12710 <1836 1307 gene locus_tag LOCUS_12720 <1836 1307 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390979.1:isoprenoid biosynthesis glyoxalase ElbB >Feature sequence0565 1415 597 gene locus_tag LOCUS_12730 1415 597 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_12730 >Feature sequence0566 >Feature sequence0567 >Feature sequence0568 <1 1523 gene locus_tag LOCUS_12740 <1 1523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546634.1:formate--tetrahydrofolate ligase >Feature sequence0569 <1829 266 gene locus_tag LOCUS_12750 <1829 266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545360.1:DUF294 nucleotidyltransferase-like domain-containing protein >Feature sequence0570 <1829 1092 gene locus_tag LOCUS_12760 <1829 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081543.1:IMP dehydrogenase >Feature sequence0571 <1 569 gene locus_tag LOCUS_12770 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940384.1:META domain-containing protein 1123 722 gene locus_tag LOCUS_12780 1123 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1652 1137 gene locus_tag LOCUS_12790 1652 1137 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941820.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence0572 168 1013 gene locus_tag LOCUS_12800 gene kdsA 168 1013 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_12800 1006 1653 gene locus_tag LOCUS_12810 1006 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 >Feature sequence0573 430 642 gene locus_tag LOCUS_12820 430 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 738 1772 gene locus_tag LOCUS_12830 738 1772 CDS product 3-oxoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922567.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence0574 <1819 682 gene locus_tag LOCUS_12840 <1819 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259703.1:BMP family ABC transporter substrate-binding protein >Feature sequence0575 1051 413 gene locus_tag LOCUS_12850 1051 413 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_12850 <1818 1206 gene locus_tag LOCUS_12860 <1818 1206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938538.1:VacJ family lipoprotein >Feature sequence0576 201 1286 gene locus_tag LOCUS_12870 gene rseP 201 1286 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence0577 618 1304 gene locus_tag LOCUS_12880 618 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 <1815 1283 gene locus_tag LOCUS_12890 <1815 1283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403829.1:DUF3524 domain-containing protein >Feature sequence0578 >Feature sequence0579 862 1536 gene locus_tag LOCUS_12900 862 1536 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462716.1 protein_id gnl|my_center|LOCUS_12900 1811 1560 gene locus_tag LOCUS_12910 1811 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 >Feature sequence0580 1193 1537 gene locus_tag LOCUS_12920 1193 1537 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704715.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence0581 <1 1037 gene locus_tag LOCUS_12930 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001065247.1:lytic polysaccharide monooxygenase 1765 1082 gene locus_tag LOCUS_12940 1765 1082 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence0582 >Feature sequence0583 26 823 gene locus_tag LOCUS_12950 26 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546145.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence0584 395 838 gene locus_tag LOCUS_12960 395 838 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_12960 1640 849 gene locus_tag LOCUS_12970 1640 849 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792195.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence0585 >Feature sequence0586 <1 1384 gene locus_tag LOCUS_12980 <1 1384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939485.1:YcaO-like family protein >Feature sequence0587 >Feature sequence0588 <1 1318 gene locus_tag LOCUS_12990 <1 1318 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073841.1:tetrathionate reductase family octaheme c-type cytochrome <1795 1271 gene locus_tag LOCUS_13000 <1795 1271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853387.1:thermonuclease family protein >Feature sequence0589 <1795 94 gene locus_tag LOCUS_13010 <1795 94 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943252.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence0590 <1794 1087 gene locus_tag LOCUS_13020 <1794 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939072.1:SDR family oxidoreductase >Feature sequence0591 1656 811 gene locus_tag LOCUS_13030 1656 811 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937979.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence0592 323 78 gene locus_tag LOCUS_13040 323 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 731 330 gene locus_tag LOCUS_13050 731 330 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_13050 1201 731 gene locus_tag LOCUS_13060 1201 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 <1791 1211 gene locus_tag LOCUS_13070 <1791 1211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895536.1:DNA recombination protein RmuC >Feature sequence0593 1 1029 gene locus_tag LOCUS_13080 1 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1331 1540 gene locus_tag LOCUS_13090 1331 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 >Feature sequence0594 <1 605 gene locus_tag LOCUS_13100 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201215949.1:amino acid ABC transporter substrate-binding protein >Feature sequence0595 <1 1243 gene locus_tag LOCUS_13110 <1 1243 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388801.1:propionyl-CoA synthetase >Feature sequence0596 81 1259 gene locus_tag LOCUS_13120 gene pgk 81 1259 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence0597 <1778 914 gene locus_tag LOCUS_13130 <1778 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930170.1:phosphate ABC transporter substrate-binding protein PstS >Feature sequence0598 <1775 43 gene locus_tag LOCUS_13140 <1775 43 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403109.1:efflux RND transporter permease subunit >Feature sequence0599 173 787 gene locus_tag LOCUS_13150 173 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence0600 1056 754 gene locus_tag LOCUS_13160 1056 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 <1775 1062 gene locus_tag LOCUS_13170 <1775 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012220518.1:DnaJ C-terminal domain-containing protein >Feature sequence0601 >Feature sequence0602 >Feature sequence0603 <1 513 gene locus_tag LOCUS_13180 <1 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392714.1:ASKHA domain-containing protein 1461 523 gene locus_tag LOCUS_13190 1461 523 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335731.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence0604 >Feature sequence0605 >Feature sequence0606 <1 502 gene locus_tag LOCUS_13200 <1 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937712.1:cobyrinate a,c-diamide synthase >Feature sequence0607 >Feature sequence0608 <1757 986 gene locus_tag LOCUS_13210 <1757 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939137.1:M23 family metallopeptidase >Feature sequence0609 <1754 374 gene locus_tag LOCUS_13220 <1754 374 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081278.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence0610 >Feature sequence0611 1286 144 gene locus_tag LOCUS_13230 1286 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 1666 1283 gene locus_tag LOCUS_13240 1666 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence0612 1343 1576 gene locus_tag LOCUS_13250 1343 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence0613 129 788 gene locus_tag LOCUS_13260 129 788 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_13260 807 1418 gene locus_tag LOCUS_13270 gene rsmD 807 1418 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003431108.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence0614 594 758 gene locus_tag LOCUS_13280 594 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 >Feature sequence0615 >Feature sequence0616 >Feature sequence0617 <1733 1108 gene locus_tag LOCUS_13290 <1733 1108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706869.1:bifunctional molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB/molybdopterin molybdotransferase MoeA >Feature sequence0618 789 79 gene locus_tag LOCUS_13300 gene rph 789 79 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001247078.1 protein_id gnl|my_center|LOCUS_13300 <1732 792 gene locus_tag LOCUS_13310 <1732 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942374.1:phenylacetate--CoA ligase >Feature sequence0619 >Feature sequence0620 <1 649 gene locus_tag LOCUS_13320 <1 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228257.1:amidohydrolase family protein 646 1506 gene locus_tag LOCUS_13330 646 1506 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence0621 1132 293 gene locus_tag LOCUS_13340 gene dapF 1132 293 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939153.1 protein_id gnl|my_center|LOCUS_13340 <1729 1129 gene locus_tag LOCUS_13350 <1729 1129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938936.1:diaminopimelate decarboxylase >Feature sequence0622 204 1679 gene locus_tag LOCUS_13360 204 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence0623 >Feature sequence0624 341 1129 gene locus_tag LOCUS_13370 gene cmoA 341 1129 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence0625 91 627 gene locus_tag LOCUS_13380 gene thpR 91 627 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940713.1 protein_id gnl|my_center|LOCUS_13380 1319 735 gene locus_tag LOCUS_13390 1319 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence0626 32 1606 gene locus_tag LOCUS_13400 32 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence0627 903 343 gene locus_tag LOCUS_13410 903 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 <1706 970 gene locus_tag LOCUS_13420 <1706 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942516.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence0628 867 160 gene locus_tag LOCUS_13430 867 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1446 922 gene locus_tag LOCUS_13440 1446 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 >Feature sequence0629 1560 931 gene locus_tag LOCUS_13450 gene rpsD 1560 931 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence0630 >Feature sequence0631 81 1664 gene locus_tag LOCUS_13460 81 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence0632 759 529 gene locus_tag LOCUS_13470 759 529 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_13470 <1698 847 gene locus_tag LOCUS_13480 <1698 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011331459.1:permease >Feature sequence0633 <1696 781 gene locus_tag LOCUS_13490 <1696 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258910.1:diguanylate cyclase >Feature sequence0634 <1 996 gene locus_tag LOCUS_13500 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678884.1:FtsH protease activity modulator HflK >Feature sequence0635 >Feature sequence0636 <1 703 gene locus_tag LOCUS_13510 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021591.1:ATP-binding protein 722 1033 gene locus_tag LOCUS_13520 722 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence0637 1086 250 gene locus_tag LOCUS_13530 gene mutM 1086 250 CDS product bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102876.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence0638 >Feature sequence0639 384 635 gene locus_tag LOCUS_13540 384 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 1287 1652 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccacgcccccgcgtggggggcgac >Feature sequence0640 >Feature sequence0641 1259 501 gene locus_tag LOCUS_13550 1259 501 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083961.1 protein_id gnl|my_center|LOCUS_13550 1623 1264 gene locus_tag LOCUS_13560 1623 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence0642 281 153 gene locus_tag LOCUS_13570 281 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 596 922 gene locus_tag LOCUS_13580 596 922 CDS product DUF5335 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880739.1 protein_id gnl|my_center|LOCUS_13580 1590 1165 gene locus_tag LOCUS_13590 1590 1165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence0643 >Feature sequence0644 <1666 73 gene locus_tag LOCUS_13600 <1666 73 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459240.1:IS1634 family transposase >Feature sequence0645 1257 37 gene locus_tag LOCUS_13610 1257 37 CDS product glyceraldehyde 3-phosphate dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546756.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence0646 <1663 718 gene locus_tag LOCUS_13620 <1663 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927014.1:zinc-dependent alcohol dehydrogenase family protein >Feature sequence0647 331 1656 gene locus_tag LOCUS_13630 gene dnaA 331 1656 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242674.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence0648 >Feature sequence0649 >Feature sequence0650 >Feature sequence0651 <1 637 gene locus_tag LOCUS_13640 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257385.1:class I SAM-dependent methyltransferase >Feature sequence0652 >Feature sequence0653 >Feature sequence0654 1400 951 gene locus_tag LOCUS_13650 1400 951 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809153.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence0655 64 1392 gene locus_tag LOCUS_13660 64 1392 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000332950.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence0656 51 842 gene locus_tag LOCUS_13670 gene trpD 51 842 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025774851.1 protein_id gnl|my_center|LOCUS_13670 853 1620 gene locus_tag LOCUS_13680 gene trpC 853 1620 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943016.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence0657 <1649 806 gene locus_tag LOCUS_13690 <1649 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000661657.1:carbamate kinase family protein >Feature sequence0658 1164 901 gene locus_tag LOCUS_13700 1164 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1487 1161 gene locus_tag LOCUS_13710 1487 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 >Feature sequence0659 1122 532 gene locus_tag LOCUS_13720 1122 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence0660 746 138 gene locus_tag LOCUS_13730 746 138 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_13730 <1639 743 gene locus_tag LOCUS_13740 <1639 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940402.1:tetrathionate reductase family octaheme c-type cytochrome >Feature sequence0661 >Feature sequence0662 >Feature sequence0663 >Feature sequence0664 1093 437 gene locus_tag LOCUS_13750 1093 437 CDS product L-fuculose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178372679.1 protein_id gnl|my_center|LOCUS_13750 <1626 1093 gene locus_tag LOCUS_13760 <1626 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003529406.1:S-methyl-5-thioribose-1-phosphate isomerase >Feature sequence0665 823 1053 gene locus_tag LOCUS_13770 823 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence0666 191 1555 gene locus_tag LOCUS_13780 191 1555 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924829.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence0667 <1 739 gene locus_tag LOCUS_13790 <1 739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942338.1:threonine synthase 749 1588 gene locus_tag LOCUS_13800 749 1588 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_174269896.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence0668 <1 971 gene locus_tag LOCUS_13810 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104871.1:ATP-dependent RNA helicase HrpA 1454 1179 gene locus_tag LOCUS_13820 1454 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence0669 59 319 gene locus_tag LOCUS_13830 59 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence0670 >Feature sequence0671 228 935 gene locus_tag LOCUS_13840 228 935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937857.1 protein_id gnl|my_center|LOCUS_13840 971 1195 gene locus_tag LOCUS_13850 971 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence0672 <1 1373 gene locus_tag LOCUS_13860 <1 1373 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943409.1:efflux RND transporter permease subunit >Feature sequence0673 472 666 gene locus_tag LOCUS_13870 472 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 668 943 gene locus_tag LOCUS_13880 668 943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 <1605 971 gene locus_tag LOCUS_13890 <1605 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259043.1:glucokinase >Feature sequence0674 434 102 gene locus_tag LOCUS_13900 434 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 <1601 531 gene locus_tag LOCUS_13910 <1601 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393048.1:Xaa-Pro peptidase family protein >Feature sequence0675 <1599 119 gene locus_tag LOCUS_13920 <1599 119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227778.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence0676 <1 828 gene locus_tag LOCUS_13930 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943952.1:chaperonin GroEL 1031 1107 gene locus_tag LOCUS_t00240 1031 1107 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0677 >Feature sequence0678 >Feature sequence0679 >Feature sequence0680 <1 694 gene locus_tag LOCUS_13940 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003858544.1:quinolinate synthase NadA >Feature sequence0681 <1 865 gene locus_tag LOCUS_13950 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030239.1:phosphate acetyltransferase >Feature sequence0682 >Feature sequence0683 6 1187 gene locus_tag LOCUS_13960 6 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence0684 175 381 gene locus_tag LOCUS_13970 175 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence0685 645 328 gene locus_tag LOCUS_13980 645 328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1337 855 gene locus_tag LOCUS_13990 1337 855 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence0686 205 1203 gene locus_tag LOCUS_14000 205 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence0687 424 500 gene locus_tag LOCUS_t00250 424 500 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 826 1047 gene locus_tag LOCUS_14010 826 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence0688 <1 853 gene locus_tag LOCUS_14020 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258382.1:glucose-1-phosphate adenylyltransferase >Feature sequence0689 >Feature sequence0690 >Feature sequence0691 318 977 gene locus_tag LOCUS_14030 318 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence0692 >Feature sequence0693 742 509 gene locus_tag LOCUS_14040 742 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1296 799 gene locus_tag LOCUS_14050 1296 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence0694 1560 289 gene locus_tag LOCUS_14060 1560 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence0695 >Feature sequence0696 738 1361 gene locus_tag LOCUS_14070 738 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence0697 1338 865 gene locus_tag LOCUS_14080 gene rpsG 1338 865 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_14080 1558 1373 gene locus_tag LOCUS_14090 1558 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence0698 <1 579 gene locus_tag LOCUS_14100 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272500.1:flagellar type III secretion system pore protein FliP 765 1016 gene locus_tag LOCUS_14110 765 1016 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197529995.1 protein_id gnl|my_center|LOCUS_14110 1013 1453 gene locus_tag LOCUS_14120 1013 1453 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067458002.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence0699 433 1326 gene locus_tag LOCUS_14130 gene rfbA 433 1326 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence0700 >Feature sequence0701 <1551 346 gene locus_tag LOCUS_14140 <1551 346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937845.1:sigma-54 dependent transcriptional regulator >Feature sequence0702 <1 1316 gene locus_tag LOCUS_14150 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939375.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit >Feature sequence0703 1240 623 gene locus_tag LOCUS_14160 1240 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence0704 519 115 gene locus_tag LOCUS_14170 519 115 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938301.1 protein_id gnl|my_center|LOCUS_14170 1163 612 gene locus_tag LOCUS_14180 1163 612 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817044.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence0705 <1538 875 gene locus_tag LOCUS_14190 <1538 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461578.1:ASKHA domain-containing protein >Feature sequence0706 >Feature sequence0707 1305 121 gene locus_tag LOCUS_14200 1305 121 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence0708 <1 732 gene locus_tag LOCUS_14210 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937797.1:HD-GYP domain-containing protein >Feature sequence0709 <1 574 gene locus_tag LOCUS_14220 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434490.1:cyclopropane-fatty-acyl-phospholipid synthase family protein <1529 620 gene locus_tag LOCUS_14230 <1529 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873895.1:DEAD/DEAH box helicase >Feature sequence0710 492 109 gene locus_tag LOCUS_14240 gene hisI 492 109 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932151.1 protein_id gnl|my_center|LOCUS_14240 801 604 gene locus_tag LOCUS_14250 801 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 1067 1507 gene locus_tag LOCUS_14260 1067 1507 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868968.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence0711 483 1478 gene locus_tag LOCUS_14270 483 1478 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545145.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence0712 <1 1414 gene locus_tag LOCUS_14280 <1 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546193.1:isoleucine--tRNA ligase >Feature sequence0713 <1 544 gene locus_tag LOCUS_14290 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924828.1:sensor histidine kinase 581 1021 gene locus_tag LOCUS_14300 581 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0714 1008 1310 gene locus_tag LOCUS_14310 1008 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence0715 <1 1465 gene locus_tag LOCUS_14320 <1 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545466.1:endopeptidase La >Feature sequence0716 410 937 gene locus_tag LOCUS_14330 410 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence0717 >Feature sequence0718 1306 224 gene locus_tag LOCUS_14340 1306 224 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958440.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence0719 972 259 gene locus_tag LOCUS_14350 972 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940985.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence0720 <1511 406 gene locus_tag LOCUS_14360 <1511 406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763530.1:hybrid sensor histidine kinase/response regulator >Feature sequence0721 1236 439 gene locus_tag LOCUS_14370 1236 439 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026183894.1 protein_id gnl|my_center|LOCUS_14370 1508 1290 gene locus_tag LOCUS_14380 1508 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence0722 >Feature sequence0723 756 1397 gene locus_tag LOCUS_14390 756 1397 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035829.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence0724 <1 1356 gene locus_tag LOCUS_14400 <1 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938056.1:HAMP domain-containing sensor histidine kinase >Feature sequence0725 >Feature sequence0726 >Feature sequence0727 >Feature sequence0728 653 261 gene locus_tag LOCUS_14410 gene crcB 653 261 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence0729 831 1142 gene locus_tag LOCUS_14420 831 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1145 1354 gene locus_tag LOCUS_14430 1145 1354 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141125.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence0730 764 231 gene locus_tag LOCUS_14440 764 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 >Feature sequence0731 >Feature sequence0732 <1 1042 gene locus_tag LOCUS_14450 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942578.1:elongation factor G >Feature sequence0733 >Feature sequence0734 65 1138 gene locus_tag LOCUS_14460 65 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence0735 <1 755 gene locus_tag LOCUS_14470 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524778.1:ABC transporter permease >Feature sequence0736 >Feature sequence0737 1080 568 gene locus_tag LOCUS_14480 1080 568 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_14480 >Feature sequence0738 >Feature sequence0739 <1 1186 gene locus_tag LOCUS_14490 <1 1186 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:ATP-binding protein 1403 1292 gene locus_tag LOCUS_r00010 1403 1292 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence0740 >Feature sequence0741 <1 630 gene locus_tag LOCUS_14500 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080600.1:YgcG family protein 716 1291 gene locus_tag LOCUS_14510 716 1291 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence0742 <1 647 gene locus_tag LOCUS_14520 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259030.1:4-alpha-glucanotransferase 677 1249 gene locus_tag LOCUS_14530 677 1249 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459824.1 protein_id gnl|my_center|LOCUS_14530 1336 1411 gene locus_tag LOCUS_t00260 1336 1411 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0743 20 985 gene locus_tag LOCUS_14540 20 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence0744 <1480 229 gene locus_tag LOCUS_14550 <1480 229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929460.1:pitrilysin family protein >Feature sequence0745 429 13 gene locus_tag LOCUS_14560 gene arfB 429 13 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962361.1 protein_id gnl|my_center|LOCUS_14560 <1480 465 gene locus_tag LOCUS_14570 <1480 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460337.1:HDOD domain-containing protein >Feature sequence0746 >Feature sequence0747 >Feature sequence0748 >Feature sequence0749 >Feature sequence0750 <1472 467 gene locus_tag LOCUS_14580 <1472 467 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048696320.1:DNA gyrase/topoisomerase IV subunit A >Feature sequence0751 103 588 gene locus_tag LOCUS_14590 103 588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence0752 <1471 644 gene locus_tag LOCUS_14600 <1471 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940997.1:type II secretion system secretin GspD >Feature sequence0753 429 890 gene locus_tag LOCUS_14610 429 890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence0754 >Feature sequence0755 881 165 gene locus_tag LOCUS_14620 881 165 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000181878.1 protein_id gnl|my_center|LOCUS_14620 1323 1000 gene locus_tag LOCUS_14630 1323 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence0756 101 1108 gene locus_tag LOCUS_14640 101 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence0757 >Feature sequence0758 <1457 417 gene locus_tag LOCUS_14650 <1457 417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041913993.1:type II secretion system ATPase GspE >Feature sequence0759 >Feature sequence0760 >Feature sequence0761 1 465 gene locus_tag LOCUS_14660 1 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 <1452 523 gene locus_tag LOCUS_14670 <1452 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940478.1:sigma-54 dependent transcriptional regulator >Feature sequence0762 152 751 gene locus_tag LOCUS_14680 152 751 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence0763 >Feature sequence0764 >Feature sequence0765 <1445 254 gene locus_tag LOCUS_14690 <1445 254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931831.1:DUF1015 domain-containing protein >Feature sequence0766 <1 683 gene locus_tag LOCUS_14700 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943627.1:cobalt-precorrin-5B (C(1))-methyltransferase >Feature sequence0767 1088 312 gene locus_tag LOCUS_14710 gene fliR 1088 312 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941094.1 protein_id gnl|my_center|LOCUS_14710 1382 1113 gene locus_tag LOCUS_14720 gene fliQ 1382 1113 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000187358.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence0768 385 1035 gene locus_tag LOCUS_14730 385 1035 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937719.1 protein_id gnl|my_center|LOCUS_14730 >Feature sequence0769 <1 508 gene locus_tag LOCUS_14740 <1 508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546244.1:acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase 534 1370 gene locus_tag LOCUS_14750 gene lpxI 534 1370 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence0770 499 663 gene locus_tag LOCUS_14760 499 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence0771 >Feature sequence0772 301 753 gene locus_tag LOCUS_14770 301 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 797 1189 gene locus_tag LOCUS_14780 gene mscL 797 1189 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence0773 >Feature sequence0774 <1 532 gene locus_tag LOCUS_14790 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013223002.1:metallophosphoesterase >Feature sequence0775 >Feature sequence0776 903 40 gene locus_tag LOCUS_14800 903 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 <1427 906 gene locus_tag LOCUS_14810 <1427 906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044863.1:XrtA-associated ATPase >Feature sequence0777 357 106 gene locus_tag LOCUS_14820 357 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 <1425 529 gene locus_tag LOCUS_14830 <1425 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942744.1:catalase/peroxidase HPI >Feature sequence0778 867 400 gene locus_tag LOCUS_14840 gene mraZ 867 400 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172625480.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence0779 <1420 848 gene locus_tag LOCUS_14850 <1420 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869074.1:phosphopyruvate hydratase >Feature sequence0780 >Feature sequence0781 1082 684 gene locus_tag LOCUS_14860 1082 684 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012548117.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence0782 398 1285 gene locus_tag LOCUS_14870 398 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence0783 <1 881 gene locus_tag LOCUS_14880 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942903.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0784 >Feature sequence0785 >Feature sequence0786 >Feature sequence0787 <1 859 gene locus_tag LOCUS_14890 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924828.1:sensor histidine kinase 905 1264 gene locus_tag LOCUS_14900 905 1264 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937557.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence0788 <1 523 gene locus_tag LOCUS_14910 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211594.1:lytic murein transglycosylase B >Feature sequence0789 1160 216 gene locus_tag LOCUS_14920 gene ppk2 1160 216 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence0790 >Feature sequence0791 <1 974 gene locus_tag LOCUS_14930 <1 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141000.1:glycogen/starch/alpha-glucan phosphorylase 1061 1243 gene locus_tag LOCUS_14940 1061 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence0792 >Feature sequence0793 <1 1120 gene locus_tag LOCUS_14950 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002681327.1:PEP/pyruvate-binding domain-containing protein >Feature sequence0794 1398 487 gene locus_tag LOCUS_14960 1398 487 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545708.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence0795 >Feature sequence0796 <1 529 gene locus_tag LOCUS_14970 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879949.1:GGDEF domain-containing protein <1397 678 gene locus_tag LOCUS_14980 <1397 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence0797 720 1247 gene locus_tag LOCUS_14990 720 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence0798 <1 907 gene locus_tag LOCUS_15000 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035535025.1:efflux transporter outer membrane subunit >Feature sequence0799 >Feature sequence0800 <1395 244 gene locus_tag LOCUS_15010 <1395 244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383354.1:protoporphyrinogen oxidase >Feature sequence0801 1125 67 gene locus_tag LOCUS_15020 1125 67 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185463.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence0802 295 1329 gene locus_tag LOCUS_15030 295 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence0803 <1 1073 gene locus_tag LOCUS_15040 <1 1073 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003698035.1:type IV pilus secretin PilQ >Feature sequence0804 <1390 162 gene locus_tag LOCUS_15050 <1390 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263145.1:formate dehydrogenase subunit alpha note possible pseudo, internal stop codon, frameshifted >Feature sequence0805 1268 171 gene locus_tag LOCUS_15060 1268 171 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921980.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence0806 <1 694 gene locus_tag LOCUS_15070 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941850.1:class II fructose-bisphosphate aldolase >Feature sequence0807 <1 961 gene locus_tag LOCUS_15080 <1 961 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444824.1:sodium-extruding oxaloacetate decarboxylase subunit alpha >Feature sequence0808 >Feature sequence0809 1301 162 gene locus_tag LOCUS_15090 1301 162 CDS product IS630-like element ISMsm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003887303.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence0810 >Feature sequence0811 >Feature sequence0812 <1 747 gene locus_tag LOCUS_15100 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542276.1:alanine racemase 695 1135 gene locus_tag LOCUS_15110 695 1135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence0813 >Feature sequence0814 >Feature sequence0815 <1372 162 gene locus_tag LOCUS_15120 <1372 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937814.1:translation initiation factor IF-2 >Feature sequence0816 <1370 810 gene locus_tag LOCUS_15130 <1370 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001295158.1:guanine deaminase >Feature sequence0817 <1368 490 gene locus_tag LOCUS_15140 <1368 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941040.1:sigma-54 dependent transcriptional regulator >Feature sequence0818 >Feature sequence0819 <1 585 gene locus_tag LOCUS_15150 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388967.1:succinate--CoA ligase subunit alpha 592 930 gene locus_tag LOCUS_15160 592 930 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937339.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence0820 <1 622 gene locus_tag LOCUS_15170 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937438.1:ABC transporter permease >Feature sequence0821 >Feature sequence0822 1034 111 gene locus_tag LOCUS_15180 1034 111 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence0823 <1 1150 gene locus_tag LOCUS_15190 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294664.1:PAS domain-containing sensor histidine kinase >Feature sequence0824 755 351 gene locus_tag LOCUS_15200 755 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1059 736 gene locus_tag LOCUS_15210 1059 736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 >Feature sequence0825 190 1086 gene locus_tag LOCUS_15220 190 1086 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence0826 >Feature sequence0827 >Feature sequence0828 83 775 gene locus_tag LOCUS_15230 83 775 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965855.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence0829 463 11 gene locus_tag LOCUS_15240 463 11 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707093.1 protein_id gnl|my_center|LOCUS_15240 1149 496 gene locus_tag LOCUS_15250 1149 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence0830 <1 1338 gene locus_tag LOCUS_15260 <1 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937816.1:transcription termination factor NusA >Feature sequence0831 >Feature sequence0832 >Feature sequence0833 421 1077 gene locus_tag LOCUS_15270 421 1077 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093316.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence0834 >Feature sequence0835 509 210 gene locus_tag LOCUS_15280 509 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 <1343 701 gene locus_tag LOCUS_15290 <1343 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030238.1:acetate kinase >Feature sequence0836 <1342 679 gene locus_tag LOCUS_15300 <1342 679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259079.1:amino acid ABC transporter substrate-binding protein >Feature sequence0837 <1 552 gene locus_tag LOCUS_15310 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_043629981.1:PAS domain S-box protein <1338 766 gene locus_tag LOCUS_15320 <1338 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022279.1:hydantoinase B/oxoprolinase family protein >Feature sequence0838 >Feature sequence0839 <1 651 gene locus_tag LOCUS_15330 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940375.1:peptide chain release factor 3 <1330 701 gene locus_tag LOCUS_15340 <1330 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071102.1:phosphoribosyltransferase family protein >Feature sequence0840 >Feature sequence0841 >Feature sequence0842 >Feature sequence0843 245 1138 gene locus_tag LOCUS_15350 245 1138 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942309.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence0844 781 62 gene locus_tag LOCUS_15360 781 62 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943674.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence0845 >Feature sequence0846 <1 1258 gene locus_tag LOCUS_15370 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940793.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence0847 849 523 gene locus_tag LOCUS_15380 849 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1139 855 gene locus_tag LOCUS_15390 1139 855 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939017.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence0848 >Feature sequence0849 679 335 gene locus_tag LOCUS_15400 679 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence0850 1131 457 gene locus_tag LOCUS_15410 1131 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence0851 920 330 gene locus_tag LOCUS_15420 920 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence0852 <1317 764 gene locus_tag LOCUS_15430 <1317 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962602.1:2-iminoacetate synthase ThiH >Feature sequence0853 493 206 gene locus_tag LOCUS_15440 493 206 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_15440 <1317 675 gene locus_tag LOCUS_15450 <1317 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942052.1:pseudouridine synthase >Feature sequence0854 1111 95 gene locus_tag LOCUS_15460 1111 95 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence0855 234 1196 gene locus_tag LOCUS_15470 234 1196 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114361.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence0856 1082 42 gene locus_tag LOCUS_15480 1082 42 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792562.1 protein_id gnl|my_center|LOCUS_15480 >Feature sequence0857 1214 726 gene locus_tag LOCUS_15490 1214 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence0858 181 1002 gene locus_tag LOCUS_15500 181 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence0859 >Feature sequence0860 >Feature sequence0861 242 1252 gene locus_tag LOCUS_15510 242 1252 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403121.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence0862 <1311 516 gene locus_tag LOCUS_15520 <1311 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921874.1:type II secretion system protein GspK >Feature sequence0863 >Feature sequence0864 1 714 gene locus_tag LOCUS_15530 gene pstA 1 714 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence0865 <1 799 gene locus_tag LOCUS_15540 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545234.1:chemotaxis response regulator protein-glutamate methylesterase >Feature sequence0866 >Feature sequence0867 >Feature sequence0868 579 1121 gene locus_tag LOCUS_15550 579 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence0869 <1303 474 gene locus_tag LOCUS_15560 <1303 474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937425.1:ATP phosphoribosyltransferase >Feature sequence0870 >Feature sequence0871 124 1050 gene locus_tag LOCUS_15570 124 1050 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021191.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence0872 >Feature sequence0873 <1 1093 gene locus_tag LOCUS_15580 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392716.1:acetyl-CoA decarbonylase/synthase complex subunit alpha/beta >Feature sequence0874 >Feature sequence0875 >Feature sequence0876 >Feature sequence0877 1210 275 gene locus_tag LOCUS_15590 1210 275 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172626079.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence0878 538 726 gene locus_tag LOCUS_15600 538 726 CDS product YnbE family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000784063.1 protein_id gnl|my_center|LOCUS_15600 781 1125 gene locus_tag LOCUS_15610 781 1125 CDS product YdbL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001300734.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence0879 >Feature sequence0880 <1 757 gene locus_tag LOCUS_15620 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000219772.1:3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase >Feature sequence0881 <1282 775 gene locus_tag LOCUS_15630 <1282 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972514.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence0882 >Feature sequence0883 >Feature sequence0884 <1 619 gene locus_tag LOCUS_15640 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941152.1:GTP cyclohydrolase FolE2 <1280 608 gene locus_tag LOCUS_15650 <1280 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187560.1:NADP-dependent succinate-semialdehyde dehydrogenase >Feature sequence0885 1238 1032 gene locus_tag LOCUS_15660 1238 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence0886 752 21 gene locus_tag LOCUS_15670 752 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence0887 <1 1147 gene locus_tag LOCUS_15680 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942684.1:sigma-54 dependent transcriptional regulator >Feature sequence0888 >Feature sequence0889 296 901 gene locus_tag LOCUS_15690 296 901 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937833.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence0890 <1 1119 gene locus_tag LOCUS_15700 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958343.1:ATP-binding protein >Feature sequence0891 1157 372 gene locus_tag LOCUS_15710 gene flgG 1157 372 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546478.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence0892 488 844 gene locus_tag LOCUS_15720 488 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence0893 >Feature sequence0894 <1267 402 gene locus_tag LOCUS_15730 <1267 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940762.1:FAD/NAD(P)-binding protein >Feature sequence0895 >Feature sequence0896 304 975 gene locus_tag LOCUS_15740 gene rpe 304 975 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence0897 <1 515 gene locus_tag LOCUS_15750 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005164390.1:poly-beta-1,6-N-acetyl-D-glucosamine synthase 512 1060 gene locus_tag LOCUS_15760 512 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence0898 >Feature sequence0899 >Feature sequence0900 >Feature sequence0901 <1259 388 gene locus_tag LOCUS_15770 <1259 388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940938.1:AEC family transporter >Feature sequence0902 1257 550 gene locus_tag LOCUS_15780 1257 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence0903 130 633 gene locus_tag LOCUS_15790 130 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence0904 <1 522 gene locus_tag LOCUS_15800 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000695952.1:YbhB/YbcL family Raf kinase inhibitor-like protein 996 595 gene locus_tag LOCUS_15810 996 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1114 983 gene locus_tag LOCUS_15820 1114 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 >Feature sequence0905 75 1091 gene locus_tag LOCUS_15830 75 1091 CDS product glycoside hydrolase family 3 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931784.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence0906 140 532 gene locus_tag LOCUS_15840 140 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence0907 88 342 gene locus_tag LOCUS_15850 88 342 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249916.1 protein_id gnl|my_center|LOCUS_15850 339 710 gene locus_tag LOCUS_15860 339 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence0908 >Feature sequence0909 <1 523 gene locus_tag LOCUS_15870 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057313.1:ABC transporter ATP-binding protein >Feature sequence0910 1051 146 gene locus_tag LOCUS_15880 1051 146 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261186.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence0911 >Feature sequence0912 <1247 695 gene locus_tag LOCUS_15890 <1247 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005481653.1:4Fe-4S dicluster domain-containing protein >Feature sequence0913 >Feature sequence0914 >Feature sequence0915 548 778 gene locus_tag LOCUS_15900 548 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence0916 <1 1156 gene locus_tag LOCUS_15910 <1 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943825.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence0917 >Feature sequence0918 486 1226 gene locus_tag LOCUS_15920 486 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence0919 1017 418 gene locus_tag LOCUS_15930 1017 418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence0920 261 911 gene locus_tag LOCUS_15940 261 911 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014524381.1 protein_id gnl|my_center|LOCUS_15940 >Feature sequence0921 <1 1226 gene locus_tag LOCUS_15950 <1 1226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001107117.1:YgeY family selenium metabolism-linked hydrolase >Feature sequence0922 1148 1029 gene locus_tag LOCUS_15960 1148 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence0923 >Feature sequence0924 <1233 217 gene locus_tag LOCUS_15970 <1233 217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930700.1:TolC family protein >Feature sequence0925 <1 554 gene locus_tag LOCUS_15980 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545836.1:biosynthetic-type acetolactate synthase large subunit 604 1086 gene locus_tag LOCUS_15990 gene ilvN 604 1086 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence0926 >Feature sequence0927 615 217 gene locus_tag LOCUS_16000 615 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16000 >Feature sequence0928 >Feature sequence0929 >Feature sequence0930 >Feature sequence0931 1059 1163 gene locus_tag LOCUS_r00020 1059 1163 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence0932 <1 1183 gene locus_tag LOCUS_16010 <1 1183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392350.1:radical SAM protein >Feature sequence0933 >Feature sequence0934 <1 607 gene locus_tag LOCUS_16020 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257225.1:cysteine synthase A >Feature sequence0935 >Feature sequence0936 <1 1071 gene locus_tag LOCUS_16030 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942384.1:indolepyruvate ferredoxin oxidoreductase subunit alpha >Feature sequence0937 >Feature sequence0938 >Feature sequence0939 >Feature sequence0940 >Feature sequence0941 >Feature sequence0942 >Feature sequence0943 >Feature sequence0944 527 916 gene locus_tag LOCUS_16040 527 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence0945 >Feature sequence0946 <1214 614 gene locus_tag LOCUS_16050 <1214 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767399.1:leucyl/phenylalanyl-tRNA--protein transferase >Feature sequence0947 >Feature sequence0948 >Feature sequence0949 >Feature sequence0950 <1211 367 gene locus_tag LOCUS_16060 <1211 367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545636.1:alpha-glucan family phosphorylase >Feature sequence0951 >Feature sequence0952 <1 721 gene locus_tag LOCUS_16070 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815015.1:ABC transporter substrate-binding protein >Feature sequence0953 <1 614 gene locus_tag LOCUS_16080 <1 614 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546471.1:acyl-CoA dehydrogenase family protein >Feature sequence0954 <1202 263 gene locus_tag LOCUS_16090 <1202 263 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941506.1:ATP-binding protein >Feature sequence0955 2 1180 gene locus_tag LOCUS_16100 gene rhlB 2 1180 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119269.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence0956 >Feature sequence0957 >Feature sequence0958 <1 799 gene locus_tag LOCUS_16110 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392052.1:histidinol-phosphate transaminase >Feature sequence0959 >Feature sequence0960 >Feature sequence0961 >Feature sequence0962 >Feature sequence0963 <1194 691 gene locus_tag LOCUS_16120 <1194 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058089.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence0964 119 586 gene locus_tag LOCUS_16130 119 586 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392560.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence0965 1190 759 gene locus_tag LOCUS_16140 1190 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 >Feature sequence0966 <1189 649 gene locus_tag LOCUS_16150 <1189 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114867.1:copper resistance system multicopper oxidase >Feature sequence0967 <1 1142 gene locus_tag LOCUS_16160 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000368910.1:Fic family protein >Feature sequence0968 102 653 gene locus_tag LOCUS_16170 102 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence0969 >Feature sequence0970 >Feature sequence0971 797 288 gene locus_tag LOCUS_16180 gene def 797 288 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940805.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence0972 567 124 gene locus_tag LOCUS_16190 567 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1106 798 gene locus_tag LOCUS_16200 1106 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 >Feature sequence0973 >Feature sequence0974 >Feature sequence0975 592 230 gene locus_tag LOCUS_16210 592 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 754 626 gene locus_tag LOCUS_16220 754 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 884 959 gene locus_tag LOCUS_t00270 884 959 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0976 >Feature sequence0977 >Feature sequence0978 >Feature sequence0979 >Feature sequence0980 >Feature sequence0981 <1165 219 gene locus_tag LOCUS_16230 <1165 219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073986.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0982 >Feature sequence0983 133 819 gene locus_tag LOCUS_16240 133 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence0984 >Feature sequence0985 >Feature sequence0986 <1 868 gene locus_tag LOCUS_16250 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000695320.1:UbiD family decarboxylase >Feature sequence0987 >Feature sequence0988 <1159 169 gene locus_tag LOCUS_16260 <1159 169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000826560.1:ACR3 family arsenite efflux transporter >Feature sequence0989 <1159 426 gene locus_tag LOCUS_16270 <1159 426 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056806.1:ABC transporter ATP-binding protein >Feature sequence0990 >Feature sequence0991 <1157 458 gene locus_tag LOCUS_16280 <1157 458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007337386.1:NADH:ubiquinone reductase (Na(+)-transporting) subunit F >Feature sequence0992 >Feature sequence0993 <1 1018 gene locus_tag LOCUS_16290 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616191.1:multiheme c-type cytochrome >Feature sequence0994 >Feature sequence0995 >Feature sequence0996 >Feature sequence0997 <1154 341 gene locus_tag LOCUS_16300 <1154 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203429.1:dihydroxy-acid dehydratase >Feature sequence0998 335 1111 gene locus_tag LOCUS_16310 335 1111 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392713.1 protein_id gnl|my_center|LOCUS_16310 >Feature sequence0999 1043 768 gene locus_tag LOCUS_16320 1043 768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 >Feature sequence1000 >Feature sequence1001 >Feature sequence1002 >Feature sequence1003 <1148 514 gene locus_tag LOCUS_16330 <1148 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081162185.1:Crp/Fnr family transcriptional regulator >Feature sequence1004 >Feature sequence1005 >Feature sequence1006 >Feature sequence1007 2 730 gene locus_tag LOCUS_16340 2 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence1008 >Feature sequence1009 <1136 417 gene locus_tag LOCUS_16350 <1136 417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039203.1:orotidine-5'-phosphate decarboxylase >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 >Feature sequence1013 >Feature sequence1014 <1129 20 gene locus_tag LOCUS_16360 <1129 20 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000826015.1:patatin-like phospholipase family protein >Feature sequence1015 <1 556 gene locus_tag LOCUS_16370 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393630.1:5-formyltetrahydrofolate cyclo-ligase >Feature sequence1016 <1 552 gene locus_tag LOCUS_16380 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928885.1:tetratricopeptide repeat protein >Feature sequence1017 >Feature sequence1018 672 205 gene locus_tag LOCUS_16390 672 205 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence1019 >Feature sequence1020 >Feature sequence1021 <1 1048 gene locus_tag LOCUS_16400 <1 1048 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012047948.1:dihydropyrimidinase >Feature sequence1022 >Feature sequence1023 >Feature sequence1024 >Feature sequence1025 650 1075 gene locus_tag LOCUS_16410 gene mce 650 1075 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence1026 1075 503 gene locus_tag LOCUS_16420 1075 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 >Feature sequence1027 204 830 gene locus_tag LOCUS_16430 204 830 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_16430 >Feature sequence1028 <1114 414 gene locus_tag LOCUS_16440 <1114 414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943829.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence1029 >Feature sequence1030 >Feature sequence1031 >Feature sequence1032 >Feature sequence1033 <1 596 gene locus_tag LOCUS_16450 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942106.1:proline--tRNA ligase >Feature sequence1034 <1110 51 gene locus_tag LOCUS_16460 <1110 51 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073077.1:Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB >Feature sequence1035 <1110 428 gene locus_tag LOCUS_16470 <1110 428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114800.1:M18 family aminopeptidase >Feature sequence1036 <1108 64 gene locus_tag LOCUS_16480 <1108 64 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940637.1:ATP-binding protein >Feature sequence1037 >Feature sequence1038 829 530 gene locus_tag LOCUS_16490 829 530 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941527.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence1039 89 859 gene locus_tag LOCUS_16500 89 859 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390008.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence1040 <1 564 gene locus_tag LOCUS_16510 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941346.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence1041 >Feature sequence1042 >Feature sequence1043 >Feature sequence1044 >Feature sequence1045 34 417 gene locus_tag LOCUS_16520 gene rsfS 34 417 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002266441.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence1046 <1096 445 gene locus_tag LOCUS_16530 <1096 445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941478.1:ATP-binding protein >Feature sequence1047 >Feature sequence1048 <1 663 gene locus_tag LOCUS_16540 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940711.1:molecular chaperone DnaK >Feature sequence1049 105 857 gene locus_tag LOCUS_16550 gene larB 105 857 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812203.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence1050 1092 517 gene locus_tag LOCUS_16560 1092 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence1051 >Feature sequence1052 <1091 137 gene locus_tag LOCUS_16570 <1091 137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393897.1:thioredoxin-disulfide reductase >Feature sequence1053 >Feature sequence1054 >Feature sequence1055 >Feature sequence1056 87 10 gene locus_tag LOCUS_t00280 87 10 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 180 105 gene locus_tag LOCUS_t00290 180 105 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 420 1025 gene locus_tag LOCUS_16580 420 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence1057 >Feature sequence1058 557 913 gene locus_tag LOCUS_16590 557 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 >Feature sequence1059 <1 999 gene locus_tag LOCUS_16600 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546680.1:phosphoglycerate dehydrogenase >Feature sequence1060 <1083 16 gene locus_tag LOCUS_16610 <1083 16 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943920.1:adenylosuccinate synthase >Feature sequence1061 >Feature sequence1062 885 112 gene locus_tag LOCUS_16620 885 112 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937844.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence1063 21 293 gene locus_tag LOCUS_16630 21 293 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545287.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence1064 92 1063 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatcctcaccggccctttcgggccggtg >Feature sequence1065 >Feature sequence1066 >Feature sequence1067 >Feature sequence1068 >Feature sequence1069 >Feature sequence1070 >Feature sequence1071 831 118 gene locus_tag LOCUS_16640 831 118 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015367602.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence1072 <1 1024 gene locus_tag LOCUS_16650 <1 1024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003812256.1:HlyD family efflux transporter periplasmic adaptor subunit >Feature sequence1073 >Feature sequence1074 >Feature sequence1075 >Feature sequence1076 >Feature sequence1077 904 212 gene locus_tag LOCUS_16660 904 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence1078 >Feature sequence1079 >Feature sequence1080 <1065 271 gene locus_tag LOCUS_16670 <1065 271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792172.1:PhoH family protein >Feature sequence1081 513 791 gene locus_tag LOCUS_16680 513 791 CDS product DUF493 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001138777.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence1082 794 285 gene locus_tag LOCUS_16690 794 285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence1083 >Feature sequence1084 <1059 246 gene locus_tag LOCUS_16700 <1059 246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941660.1:fumarate hydratase >Feature sequence1085 776 57 gene locus_tag LOCUS_16710 776 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence1086 666 85 gene locus_tag LOCUS_16720 666 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence1087 745 371 gene locus_tag LOCUS_16730 745 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16730 >Feature sequence1088 <1 539 gene locus_tag LOCUS_16740 <1 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202279.1:RluA family pseudouridine synthase >Feature sequence1089 >Feature sequence1090 >Feature sequence1091 >Feature sequence1092 >Feature sequence1093 379 942 gene locus_tag LOCUS_16750 379 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 >Feature sequence1094 239 496 gene locus_tag LOCUS_16760 239 496 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525356.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence1095 320 844 gene locus_tag LOCUS_16770 320 844 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence1096 301 534 gene locus_tag LOCUS_16780 301 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence1097 >Feature sequence1098 >Feature sequence1099 >Feature sequence1100 >Feature sequence1101 1042 734 gene locus_tag LOCUS_16790 1042 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence1102 >Feature sequence1103 >Feature sequence1104 >Feature sequence1105 575 150 gene locus_tag LOCUS_16800 575 150 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141959.1 protein_id gnl|my_center|LOCUS_16800 >Feature sequence1106 >Feature sequence1107 <1033 117 gene locus_tag LOCUS_16810 <1033 117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933671.1:mechanosensitive ion channel >Feature sequence1108 84 500 gene locus_tag LOCUS_16820 84 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 >Feature sequence1109 >Feature sequence1110 <1030 97 gene locus_tag LOCUS_16830 <1030 97 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404965.1:sulfate permease >Feature sequence1111 147 899 gene locus_tag LOCUS_16840 gene surE 147 899 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545452.1 protein_id gnl|my_center|LOCUS_16840 >Feature sequence1112 342 683 gene locus_tag LOCUS_16850 342 683 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence1113 <1 904 gene locus_tag LOCUS_16860 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943830.1:glutamate 5-kinase >Feature sequence1114 253 828 gene locus_tag LOCUS_16870 253 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence1115 >Feature sequence1116 >Feature sequence1117 >Feature sequence1118 45 590 gene locus_tag LOCUS_16880 gene rfbC 45 590 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096184.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence1119 679 206 gene locus_tag LOCUS_16890 679 206 CDS product acyloxyacyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944026.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence1120 <1024 74 gene locus_tag LOCUS_16900 <1024 74 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121554.1:autotransporter outer membrane beta-barrel domain-containing protein >Feature sequence1121 <1 887 gene locus_tag LOCUS_16910 <1 887 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037402650.1:ATP-binding protein >Feature sequence1122 >Feature sequence1123 >Feature sequence1124 <1 645 gene locus_tag LOCUS_16920 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943874.1:excinuclease ABC subunit UvrB >Feature sequence1125 >Feature sequence1126 >Feature sequence1127 >Feature sequence1128 <1 996 gene locus_tag LOCUS_16930 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727563.1:DUF3322 and DUF2220 domain-containing protein >Feature sequence1129 >Feature sequence1130 <1016 76 gene locus_tag LOCUS_16940 <1016 76 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881122.1:2-dehydropantoate 2-reductase >Feature sequence1131 >Feature sequence1132 <1 927 gene locus_tag LOCUS_16950 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392119.1:radical SAM family heme chaperone HemW >Feature sequence1133 34 906 gene locus_tag LOCUS_16960 34 906 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851174.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence1134 >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 >Feature sequence1138 >Feature sequence1139 >Feature sequence1140 >Feature sequence1141