>Feature sequence001 180 255 gene locus_tag LOCUS_t00010 180 255 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 302 1570 gene locus_tag LOCUS_00010 302 1570 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064652.1 protein_id gnl|my_center|LOCUS_00010 1572 1991 gene locus_tag LOCUS_00020 1572 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2003 3046 gene locus_tag LOCUS_00030 gene purM 2003 3046 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879189.1 protein_id gnl|my_center|LOCUS_00030 3216 4925 gene locus_tag LOCUS_00040 3216 4925 CDS product DUF505 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042691877.1 protein_id gnl|my_center|LOCUS_00040 4966 5916 gene locus_tag LOCUS_00050 4966 5916 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878151.1 protein_id gnl|my_center|LOCUS_00050 6792 5908 gene locus_tag LOCUS_00060 6792 5908 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879565.1 protein_id gnl|my_center|LOCUS_00060 7856 6813 gene locus_tag LOCUS_00070 7856 6813 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_00070 7944 8177 gene locus_tag LOCUS_00080 7944 8177 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879883.1 protein_id gnl|my_center|LOCUS_00080 8158 8601 gene locus_tag LOCUS_00090 8158 8601 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_00090 8643 10337 gene locus_tag LOCUS_00100 gene feoB 8643 10337 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012939559.1 protein_id gnl|my_center|LOCUS_00100 10325 10642 gene locus_tag LOCUS_00110 10325 10642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064576.1 protein_id gnl|my_center|LOCUS_00110 10639 11370 gene locus_tag LOCUS_00120 gene tatC 10639 11370 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879009.1 protein_id gnl|my_center|LOCUS_00120 11392 12672 gene locus_tag LOCUS_00130 11392 12672 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878497.1 protein_id gnl|my_center|LOCUS_00130 13039 12653 gene locus_tag LOCUS_00140 13039 12653 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879904.1 protein_id gnl|my_center|LOCUS_00140 14199 13045 gene locus_tag LOCUS_00150 14199 13045 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879903.1 protein_id gnl|my_center|LOCUS_00150 15241 14204 gene locus_tag LOCUS_00160 15241 14204 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871070.1 protein_id gnl|my_center|LOCUS_00160 15930 15238 gene locus_tag LOCUS_00170 15930 15238 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879901.1 protein_id gnl|my_center|LOCUS_00170 16197 16006 gene locus_tag LOCUS_00180 16197 16006 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877934.1 protein_id gnl|my_center|LOCUS_00180 16534 16295 gene locus_tag LOCUS_00190 16534 16295 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877932.1 protein_id gnl|my_center|LOCUS_00190 17706 16576 gene locus_tag LOCUS_00200 gene dsrB 17706 16576 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064231.1 protein_id gnl|my_center|LOCUS_00200 18981 17725 gene locus_tag LOCUS_00210 gene dsrA 18981 17725 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877930.1 protein_id gnl|my_center|LOCUS_00210 19117 19872 gene locus_tag LOCUS_00220 gene cobA 19117 19872 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878738.1 protein_id gnl|my_center|LOCUS_00220 22312 19823 gene locus_tag LOCUS_00230 22312 19823 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878645.1 protein_id gnl|my_center|LOCUS_00230 23551 22328 gene locus_tag LOCUS_00240 gene pgk 23551 22328 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064339.1 protein_id gnl|my_center|LOCUS_00240 24751 23585 gene locus_tag LOCUS_00250 24751 23585 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878861.1 protein_id gnl|my_center|LOCUS_00250 24998 24744 gene locus_tag LOCUS_00260 24998 24744 CDS product DUF2095 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878860.1 protein_id gnl|my_center|LOCUS_00260 25070 25978 gene locus_tag LOCUS_00270 gene trxB 25070 25978 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879051.1 protein_id gnl|my_center|LOCUS_00270 26185 26358 gene locus_tag LOCUS_00280 26185 26358 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878073.1 protein_id gnl|my_center|LOCUS_00280 26367 27452 gene locus_tag LOCUS_00290 gene ftsZ 26367 27452 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878074.1 protein_id gnl|my_center|LOCUS_00290 28380 27436 gene locus_tag LOCUS_00300 28380 27436 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_00300 28424 29047 gene locus_tag LOCUS_00310 28424 29047 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879050.1 protein_id gnl|my_center|LOCUS_00310 29103 31475 gene locus_tag LOCUS_00320 29103 31475 CDS product NosD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024242.1 protein_id gnl|my_center|LOCUS_00320 31481 31903 gene locus_tag LOCUS_00330 31481 31903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 31933 33339 gene locus_tag LOCUS_00340 31933 33339 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878157.1 protein_id gnl|my_center|LOCUS_00340 34758 33334 gene locus_tag LOCUS_00350 34758 33334 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878911.1 protein_id gnl|my_center|LOCUS_00350 37874 34755 gene locus_tag LOCUS_00360 gene ileS 37874 34755 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878137.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence002 302 1708 gene locus_tag LOCUS_00370 gene purD 302 1708 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878654.1 protein_id gnl|my_center|LOCUS_00370 1749 2246 gene locus_tag LOCUS_00380 1749 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 3424 2243 gene locus_tag LOCUS_00390 3424 2243 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879541.1 protein_id gnl|my_center|LOCUS_00390 4353 3448 gene locus_tag LOCUS_00400 4353 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096210.1 protein_id gnl|my_center|LOCUS_00400 5187 4357 gene locus_tag LOCUS_00410 gene speB 5187 4357 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878149.1 protein_id gnl|my_center|LOCUS_00410 5570 5187 gene locus_tag LOCUS_00420 gene eif5A 5570 5187 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878148.1 protein_id gnl|my_center|LOCUS_00420 5912 5607 gene locus_tag LOCUS_00430 gene tatA 5912 5607 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879548.1 protein_id gnl|my_center|LOCUS_00430 6203 5946 gene locus_tag LOCUS_00440 6203 5946 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878287.1 protein_id gnl|my_center|LOCUS_00440 6293 6643 gene locus_tag LOCUS_00450 6293 6643 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878522.1 protein_id gnl|my_center|LOCUS_00450 7225 6626 gene locus_tag LOCUS_00460 gene torD 7225 6626 CDS product molecular chaperone TorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457256.1 protein_id gnl|my_center|LOCUS_00460 8870 7209 gene locus_tag LOCUS_00470 8870 7209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 8995 11865 gene locus_tag LOCUS_00480 8995 11865 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891941.1 protein_id gnl|my_center|LOCUS_00480 11867 12430 gene locus_tag LOCUS_00490 gene fdh3B 11867 12430 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074133.1 protein_id gnl|my_center|LOCUS_00490 12447 12734 gene locus_tag LOCUS_00500 12447 12734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 12731 13642 gene locus_tag LOCUS_00510 12731 13642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 13711 14850 gene locus_tag LOCUS_00520 13711 14850 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879686.1 protein_id gnl|my_center|LOCUS_00520 15234 14824 gene locus_tag LOCUS_00530 15234 14824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878135.1 protein_id gnl|my_center|LOCUS_00530 15464 15231 gene locus_tag LOCUS_00540 15464 15231 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878136.1 protein_id gnl|my_center|LOCUS_00540 15534 15920 gene locus_tag LOCUS_00550 15534 15920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 16786 15917 gene locus_tag LOCUS_00560 gene dapA 16786 15917 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878410.1 protein_id gnl|my_center|LOCUS_00560 16976 16779 gene locus_tag LOCUS_00570 16976 16779 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878411.1 protein_id gnl|my_center|LOCUS_00570 17056 17128 gene locus_tag LOCUS_t00020 17056 17128 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 17509 17790 gene locus_tag LOCUS_00580 17509 17790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 17891 18130 gene locus_tag LOCUS_00590 17891 18130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 18150 18647 gene locus_tag LOCUS_00600 18150 18647 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879790.1 protein_id gnl|my_center|LOCUS_00600 18915 18640 gene locus_tag LOCUS_00610 18915 18640 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879671.1 protein_id gnl|my_center|LOCUS_00610 18962 19951 gene locus_tag LOCUS_00620 gene ilvC 18962 19951 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879477.1 protein_id gnl|my_center|LOCUS_00620 19990 20065 gene locus_tag LOCUS_t00030 19990 20065 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 20092 20694 gene locus_tag LOCUS_00630 gene tmk 20092 20694 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877575.1 protein_id gnl|my_center|LOCUS_00630 20679 20978 gene locus_tag LOCUS_00640 20679 20978 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496859.1 protein_id gnl|my_center|LOCUS_00640 21862 21053 gene locus_tag LOCUS_00650 gene purQ 21862 21053 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878755.1 protein_id gnl|my_center|LOCUS_00650 21916 22920 gene locus_tag LOCUS_00660 21916 22920 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064351.1 protein_id gnl|my_center|LOCUS_00660 22917 23210 gene locus_tag LOCUS_00670 22917 23210 CDS product DUF2551 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878713.1 protein_id gnl|my_center|LOCUS_00670 23207 23965 gene locus_tag LOCUS_00680 gene uppS 23207 23965 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878714.1 protein_id gnl|my_center|LOCUS_00680 23991 25205 gene locus_tag LOCUS_00690 gene prf1 23991 25205 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878715.1 protein_id gnl|my_center|LOCUS_00690 25202 25546 gene locus_tag LOCUS_00700 25202 25546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 25566 26441 gene locus_tag LOCUS_00710 25566 26441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 27861 26413 gene locus_tag LOCUS_00720 27861 26413 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879180.1 protein_id gnl|my_center|LOCUS_00720 27899 28867 gene locus_tag LOCUS_00730 27899 28867 CDS product NOL1/NOP2/sun family putative RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879531.1 protein_id gnl|my_center|LOCUS_00730 28892 29269 gene locus_tag LOCUS_00740 28892 29269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 29266 29694 gene locus_tag LOCUS_00750 29266 29694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943054.1 protein_id gnl|my_center|LOCUS_00750 29691 30548 gene locus_tag LOCUS_00760 29691 30548 CDS product F420-nonreducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496953.1 protein_id gnl|my_center|LOCUS_00760 30545 30790 gene locus_tag LOCUS_00770 30545 30790 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943057.1 protein_id gnl|my_center|LOCUS_00770 30800 31972 gene locus_tag LOCUS_00780 30800 31972 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_00780 31985 32701 gene locus_tag LOCUS_00790 31985 32701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 32688 32978 gene locus_tag LOCUS_00800 32688 32978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 32975 33298 gene locus_tag LOCUS_00810 32975 33298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 33303 33800 gene locus_tag LOCUS_00820 33303 33800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878721.1 protein_id gnl|my_center|LOCUS_00820 33797 34426 gene locus_tag LOCUS_00830 33797 34426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 34431 35201 gene locus_tag LOCUS_00840 34431 35201 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878199.1 protein_id gnl|my_center|LOCUS_00840 35206 35388 gene locus_tag LOCUS_00850 35206 35388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 35400 35750 gene locus_tag LOCUS_00860 35400 35750 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877438.1 protein_id gnl|my_center|LOCUS_00860 35747 36568 gene locus_tag LOCUS_00870 35747 36568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 37588 36563 gene locus_tag LOCUS_00880 37588 36563 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878344.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence003 129 278 gene locus_tag LOCUS_00890 129 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00890 900 640 gene locus_tag LOCUS_00900 900 640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 1232 888 gene locus_tag LOCUS_00910 1232 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 1304 3241 gene locus_tag LOCUS_00920 1304 3241 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878431.1 protein_id gnl|my_center|LOCUS_00920 4628 3228 gene locus_tag LOCUS_00930 4628 3228 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978827.1 protein_id gnl|my_center|LOCUS_00930 4890 4817 gene locus_tag LOCUS_t00040 4890 4817 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5046 5237 gene locus_tag LOCUS_00940 5046 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 5237 5443 gene locus_tag LOCUS_00950 5237 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 5449 5799 gene locus_tag LOCUS_00960 5449 5799 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064575.1 protein_id gnl|my_center|LOCUS_00960 5928 7076 gene locus_tag LOCUS_00970 5928 7076 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181452.1 protein_id gnl|my_center|LOCUS_00970 7115 7990 gene locus_tag LOCUS_00980 gene ilvE 7115 7990 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878433.1 protein_id gnl|my_center|LOCUS_00980 7983 8477 gene locus_tag LOCUS_00990 7983 8477 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878434.1 protein_id gnl|my_center|LOCUS_00990 8474 9466 gene locus_tag LOCUS_01000 8474 9466 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878435.1 protein_id gnl|my_center|LOCUS_01000 9439 10128 gene locus_tag LOCUS_01010 9439 10128 CDS product A24 family peptidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878436.1 protein_id gnl|my_center|LOCUS_01010 10146 11498 gene locus_tag LOCUS_01020 gene glmM 10146 11498 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877965.1 protein_id gnl|my_center|LOCUS_01020 12183 12111 gene locus_tag LOCUS_t00050 12183 12111 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 12261 12872 gene locus_tag LOCUS_01030 12261 12872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881155.1 protein_id gnl|my_center|LOCUS_01030 12875 13381 gene locus_tag LOCUS_01040 gene pyrE 12875 13381 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318736.1 protein_id gnl|my_center|LOCUS_01040 13409 13786 gene locus_tag LOCUS_01050 13409 13786 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095548.1 protein_id gnl|my_center|LOCUS_01050 13791 14267 gene locus_tag LOCUS_01060 gene rplM 13791 14267 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878624.1 protein_id gnl|my_center|LOCUS_01060 14270 14668 gene locus_tag LOCUS_01070 14270 14668 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064334.1 protein_id gnl|my_center|LOCUS_01070 14704 14916 gene locus_tag LOCUS_01080 14704 14916 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878626.1 protein_id gnl|my_center|LOCUS_01080 14901 14977 gene locus_tag LOCUS_t00060 14901 14977 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 15060 15215 gene locus_tag LOCUS_01090 15060 15215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 15873 15220 gene locus_tag LOCUS_01100 15873 15220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878503.1 protein_id gnl|my_center|LOCUS_01100 15910 16179 gene locus_tag LOCUS_01110 15910 16179 CDS product NMD3-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208643.1 protein_id gnl|my_center|LOCUS_01110 16214 16287 gene locus_tag LOCUS_t00070 16214 16287 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16445 16323 gene locus_tag LOCUS_01120 16445 16323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 16567 16442 gene locus_tag LOCUS_01130 16567 16442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 17784 16564 gene locus_tag LOCUS_01140 gene mmdA 17784 16564 CDS product methylmalonyl-CoA decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879706.1 protein_id gnl|my_center|LOCUS_01140 18890 17781 gene locus_tag LOCUS_01150 18890 17781 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405030.1 protein_id gnl|my_center|LOCUS_01150 21472 18887 gene locus_tag LOCUS_01160 21472 18887 CDS product UPF0182 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878918.1 protein_id gnl|my_center|LOCUS_01160 22507 21488 gene locus_tag LOCUS_01170 22507 21488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 24051 22489 gene locus_tag LOCUS_01180 24051 22489 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064447.1 protein_id gnl|my_center|LOCUS_01180 24096 24872 gene locus_tag LOCUS_01190 24096 24872 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878521.1 protein_id gnl|my_center|LOCUS_01190 25097 24873 gene locus_tag LOCUS_01200 25097 24873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 25737 25114 gene locus_tag LOCUS_01210 gene nep1 25737 25114 CDS product 16S rRNA (pseudouridine-N1-)-methyltransferase Nep1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878237.1 protein_id gnl|my_center|LOCUS_01210 26123 25731 gene locus_tag LOCUS_01220 26123 25731 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879542.1 protein_id gnl|my_center|LOCUS_01220 26754 26221 gene locus_tag LOCUS_01230 26754 26221 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096095.1 protein_id gnl|my_center|LOCUS_01230 27544 26759 gene locus_tag LOCUS_01240 gene rio1 27544 26759 CDS product RIO-type serine/threonine-protein kinase Rio1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879299.1 protein_id gnl|my_center|LOCUS_01240 27619 28161 gene locus_tag LOCUS_01250 27619 28161 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979580.1 protein_id gnl|my_center|LOCUS_01250 28149 28403 gene locus_tag LOCUS_01260 28149 28403 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846653.1 protein_id gnl|my_center|LOCUS_01260 28406 29518 gene locus_tag LOCUS_01270 28406 29518 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096516.1 protein_id gnl|my_center|LOCUS_01270 29506 30363 gene locus_tag LOCUS_01280 29506 30363 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879544.1 protein_id gnl|my_center|LOCUS_01280 30410 30973 gene locus_tag LOCUS_01290 gene rpoE 30410 30973 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878613.1 protein_id gnl|my_center|LOCUS_01290 30966 31154 gene locus_tag LOCUS_01300 30966 31154 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878612.1 protein_id gnl|my_center|LOCUS_01300 31151 31726 gene locus_tag LOCUS_01310 31151 31726 CDS product GTP-dependent dephospho-CoA kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023601.1 protein_id gnl|my_center|LOCUS_01310 31710 32018 gene locus_tag LOCUS_01320 31710 32018 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064676.1 protein_id gnl|my_center|LOCUS_01320 32029 32193 gene locus_tag LOCUS_01330 32029 32193 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878609.1 protein_id gnl|my_center|LOCUS_01330 32212 33183 gene locus_tag LOCUS_01340 32212 33183 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878608.1 protein_id gnl|my_center|LOCUS_01340 33215 33287 gene locus_tag LOCUS_t00080 33215 33287 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 33328 33519 gene locus_tag LOCUS_01350 33328 33519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 34498 33467 gene locus_tag LOCUS_01360 34498 33467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879728.1 protein_id gnl|my_center|LOCUS_01360 34545 35096 gene locus_tag LOCUS_01370 34545 35096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318956.1 protein_id gnl|my_center|LOCUS_01370 35690 35088 gene locus_tag LOCUS_01380 35690 35088 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877878.1 protein_id gnl|my_center|LOCUS_01380 36106 35690 gene locus_tag LOCUS_01390 36106 35690 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879219.1 protein_id gnl|my_center|LOCUS_01390 36192 36845 gene locus_tag LOCUS_01400 36192 36845 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870241.1 protein_id gnl|my_center|LOCUS_01400 36889 37464 gene locus_tag LOCUS_01410 36889 37464 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878335.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence004 90 905 gene locus_tag LOCUS_01420 gene nrfD 90 905 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879873.1 protein_id gnl|my_center|LOCUS_01420 1306 902 gene locus_tag LOCUS_01430 1306 902 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867291.1 protein_id gnl|my_center|LOCUS_01430 1550 1308 gene locus_tag LOCUS_01440 1550 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01440 1999 1550 gene locus_tag LOCUS_01450 1999 1550 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320322.1 protein_id gnl|my_center|LOCUS_01450 2106 2477 gene locus_tag LOCUS_01460 2106 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 2521 2889 gene locus_tag LOCUS_01470 2521 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 2922 3758 gene locus_tag LOCUS_01480 2922 3758 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064457.1 protein_id gnl|my_center|LOCUS_01480 5139 3751 gene locus_tag LOCUS_01490 5139 3751 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878203.1 protein_id gnl|my_center|LOCUS_01490 5212 6303 gene locus_tag LOCUS_01500 5212 6303 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878649.1 protein_id gnl|my_center|LOCUS_01500 7295 6300 gene locus_tag LOCUS_01510 7295 6300 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877631.1 protein_id gnl|my_center|LOCUS_01510 7343 7849 gene locus_tag LOCUS_01520 7343 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 7818 8066 gene locus_tag LOCUS_01530 7818 8066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 8054 9214 gene locus_tag LOCUS_01540 8054 9214 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064241.1 protein_id gnl|my_center|LOCUS_01540 9211 10350 gene locus_tag LOCUS_01550 9211 10350 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879900.1 protein_id gnl|my_center|LOCUS_01550 10662 11588 gene locus_tag LOCUS_01560 10662 11588 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870499.1 protein_id gnl|my_center|LOCUS_01560 11795 11559 gene locus_tag LOCUS_01570 11795 11559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 12210 11746 gene locus_tag LOCUS_01580 12210 11746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01580 12272 12877 gene locus_tag LOCUS_01590 12272 12877 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877716.1 protein_id gnl|my_center|LOCUS_01590 12902 13162 gene locus_tag LOCUS_01600 12902 13162 CDS product RpoL/Rpb11 RNA polymerase subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877718.1 protein_id gnl|my_center|LOCUS_01600 15648 13165 gene locus_tag LOCUS_01610 gene aglB3 15648 13165 CDS product dolichyl-phosphooligosaccharide-protein glycotransferase AglB3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877887.1 protein_id gnl|my_center|LOCUS_01610 15689 16552 gene locus_tag LOCUS_01620 gene rio2 15689 16552 CDS product RIO-type serine/threonine-protein kinase Rio2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879913.1 protein_id gnl|my_center|LOCUS_01620 16623 16898 gene locus_tag LOCUS_01630 16623 16898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 17588 16890 gene locus_tag LOCUS_01640 17588 16890 CDS product HesA/MoeB/ThiF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683937.1 protein_id gnl|my_center|LOCUS_01640 17638 18660 gene locus_tag LOCUS_01650 17638 18660 CDS product type II glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682815.1 protein_id gnl|my_center|LOCUS_01650 19111 18650 gene locus_tag LOCUS_01660 gene mobB 19111 18650 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879742.1 protein_id gnl|my_center|LOCUS_01660 21003 19108 gene locus_tag LOCUS_01670 21003 19108 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546184.1 protein_id gnl|my_center|LOCUS_01670 21644 21000 gene locus_tag LOCUS_01680 gene psmB 21644 21000 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094873.1 protein_id gnl|my_center|LOCUS_01680 22879 21689 gene locus_tag LOCUS_01690 22879 21689 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879290.1 protein_id gnl|my_center|LOCUS_01690 24345 22942 gene locus_tag LOCUS_01700 gene cysS 24345 22942 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877918.1 protein_id gnl|my_center|LOCUS_01700 25348 24350 gene locus_tag LOCUS_01710 25348 24350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877545.1 protein_id gnl|my_center|LOCUS_01710 25976 25299 gene locus_tag LOCUS_01720 25976 25299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 26347 25970 gene locus_tag LOCUS_01730 26347 25970 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878243.1 protein_id gnl|my_center|LOCUS_01730 26382 26852 gene locus_tag LOCUS_01740 gene rimI 26382 26852 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208657.1 protein_id gnl|my_center|LOCUS_01740 27081 26803 gene locus_tag LOCUS_01750 27081 26803 CDS product UPF0058 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878241.1 protein_id gnl|my_center|LOCUS_01750 27247 27318 gene locus_tag LOCUS_t00090 27247 27318 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 28175 27318 gene locus_tag LOCUS_01760 28175 27318 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878818.1 protein_id gnl|my_center|LOCUS_01760 28249 29661 gene locus_tag LOCUS_01770 gene proS 28249 29661 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064425.1 protein_id gnl|my_center|LOCUS_01770 29661 29903 gene locus_tag LOCUS_01780 29661 29903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 30750 29905 gene locus_tag LOCUS_01790 30750 29905 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878916.1 protein_id gnl|my_center|LOCUS_01790 30820 31467 gene locus_tag LOCUS_01800 30820 31467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 31592 31464 gene locus_tag LOCUS_01810 31592 31464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence005 2 238 gene locus_tag LOCUS_01820 2 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 729 259 gene locus_tag LOCUS_01830 729 259 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296886.1 protein_id gnl|my_center|LOCUS_01830 1404 742 gene locus_tag LOCUS_01840 1404 742 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878876.1 protein_id gnl|my_center|LOCUS_01840 3134 1401 gene locus_tag LOCUS_01850 3134 1401 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095651.1 protein_id gnl|my_center|LOCUS_01850 4192 3134 gene locus_tag LOCUS_01860 4192 3134 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965343.1 protein_id gnl|my_center|LOCUS_01860 5145 4294 gene locus_tag LOCUS_01870 5145 4294 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_01870 5835 5155 gene locus_tag LOCUS_01880 5835 5155 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048174238.1 protein_id gnl|my_center|LOCUS_01880 6464 5832 gene locus_tag LOCUS_01890 6464 5832 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877913.1 protein_id gnl|my_center|LOCUS_01890 6967 6452 gene locus_tag LOCUS_01900 6967 6452 CDS product DUF531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877914.1 protein_id gnl|my_center|LOCUS_01900 7018 7590 gene locus_tag LOCUS_01910 7018 7590 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_01910 8524 7601 gene locus_tag LOCUS_01920 8524 7601 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761948.1 protein_id gnl|my_center|LOCUS_01920 7624 7697 gene locus_tag LOCUS_t00100 7624 7697 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8575 9489 gene locus_tag LOCUS_01930 gene guaA 8575 9489 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877764.1 protein_id gnl|my_center|LOCUS_01930 10002 9490 gene locus_tag LOCUS_01940 10002 9490 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869779.1 protein_id gnl|my_center|LOCUS_01940 10738 9974 gene locus_tag LOCUS_01950 gene tatC 10738 9974 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023410.1 protein_id gnl|my_center|LOCUS_01950 10817 10892 gene locus_tag LOCUS_t00110 10817 10892 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12225 10891 gene locus_tag LOCUS_01960 12225 10891 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_01960 12309 13340 gene locus_tag LOCUS_01970 12309 13340 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880717.1 protein_id gnl|my_center|LOCUS_01970 14691 13414 gene locus_tag LOCUS_01980 14691 13414 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878158.1 protein_id gnl|my_center|LOCUS_01980 14766 15206 gene locus_tag LOCUS_01990 14766 15206 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879774.1 protein_id gnl|my_center|LOCUS_01990 15216 15722 gene locus_tag LOCUS_02000 gene rpsD 15216 15722 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879773.1 protein_id gnl|my_center|LOCUS_02000 15728 16120 gene locus_tag LOCUS_02010 15728 16120 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879772.1 protein_id gnl|my_center|LOCUS_02010 16134 16919 gene locus_tag LOCUS_02020 16134 16919 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879771.1 protein_id gnl|my_center|LOCUS_02020 18825 16912 gene locus_tag LOCUS_02030 18825 16912 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878495.1 protein_id gnl|my_center|LOCUS_02030 20470 18809 gene locus_tag LOCUS_02040 20470 18809 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878496.1 protein_id gnl|my_center|LOCUS_02040 20541 21281 gene locus_tag LOCUS_02050 20541 21281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 21271 21717 gene locus_tag LOCUS_02060 21271 21717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 21701 22084 gene locus_tag LOCUS_02070 21701 22084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 22089 22481 gene locus_tag LOCUS_02080 22089 22481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 22460 23125 gene locus_tag LOCUS_02090 22460 23125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence006 <1 563 gene locus_tag LOCUS_02100 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879419.1:putative RNA uridine N3 methyltransferase 560 1558 gene locus_tag LOCUS_02110 gene rpl3p 560 1558 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_02110 1564 2319 gene locus_tag LOCUS_02120 gene rpl4p 1564 2319 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879417.1 protein_id gnl|my_center|LOCUS_02120 2316 2558 gene locus_tag LOCUS_02130 2316 2558 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064486.1 protein_id gnl|my_center|LOCUS_02130 2569 3285 gene locus_tag LOCUS_02140 2569 3285 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879415.1 protein_id gnl|my_center|LOCUS_02140 3316 3717 gene locus_tag LOCUS_02150 gene rpsS 3316 3717 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879414.1 protein_id gnl|my_center|LOCUS_02150 3724 4188 gene locus_tag LOCUS_02160 gene rplV 3724 4188 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064485.1 protein_id gnl|my_center|LOCUS_02160 4190 4888 gene locus_tag LOCUS_02170 4190 4888 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879412.1 protein_id gnl|my_center|LOCUS_02170 4848 5021 gene locus_tag LOCUS_02180 4848 5021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 5018 5314 gene locus_tag LOCUS_02190 gene rnp1 5018 5314 CDS product ribonuclease P component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879410.1 protein_id gnl|my_center|LOCUS_02190 5308 5628 gene locus_tag LOCUS_02200 5308 5628 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879409.1 protein_id gnl|my_center|LOCUS_02200 5625 6023 gene locus_tag LOCUS_02210 gene rpl14p 5625 6023 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_02210 6033 6395 gene locus_tag LOCUS_02220 gene rplX 6033 6395 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879407.1 protein_id gnl|my_center|LOCUS_02220 6401 7099 gene locus_tag LOCUS_02230 6401 7099 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879406.1 protein_id gnl|my_center|LOCUS_02230 7103 7660 gene locus_tag LOCUS_02240 7103 7660 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879405.1 protein_id gnl|my_center|LOCUS_02240 7660 7818 gene locus_tag LOCUS_02250 7660 7818 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879404.1 protein_id gnl|my_center|LOCUS_02250 7818 8213 gene locus_tag LOCUS_02260 7818 8213 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064747.1 protein_id gnl|my_center|LOCUS_02260 8224 8763 gene locus_tag LOCUS_02270 8224 8763 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319356.1 protein_id gnl|my_center|LOCUS_02270 8773 9168 gene locus_tag LOCUS_02280 8773 9168 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879401.1 protein_id gnl|my_center|LOCUS_02280 9174 9617 gene locus_tag LOCUS_02290 9174 9617 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546237.1 protein_id gnl|my_center|LOCUS_02290 9622 10182 gene locus_tag LOCUS_02300 9622 10182 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319359.1 protein_id gnl|my_center|LOCUS_02300 10184 10792 gene locus_tag LOCUS_02310 gene rpsE 10184 10792 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879398.1 protein_id gnl|my_center|LOCUS_02310 10798 11268 gene locus_tag LOCUS_02320 gene rpmD 10798 11268 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879397.1 protein_id gnl|my_center|LOCUS_02320 11274 11807 gene locus_tag LOCUS_02330 11274 11807 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270492.1 protein_id gnl|my_center|LOCUS_02330 11810 13321 gene locus_tag LOCUS_02340 gene secY 11810 13321 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319363.1 protein_id gnl|my_center|LOCUS_02340 13321 13938 gene locus_tag LOCUS_02350 13321 13938 CDS product DUF106 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879394.1 protein_id gnl|my_center|LOCUS_02350 13945 14502 gene locus_tag LOCUS_02360 13945 14502 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879393.1 protein_id gnl|my_center|LOCUS_02360 14646 14455 gene locus_tag LOCUS_02370 14646 14455 CDS product DUF2116 family Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878373.1 protein_id gnl|my_center|LOCUS_02370 15657 14695 gene locus_tag LOCUS_02380 15657 14695 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878259.1 protein_id gnl|my_center|LOCUS_02380 16375 15707 gene locus_tag LOCUS_02390 16375 15707 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879499.1 protein_id gnl|my_center|LOCUS_02390 17076 16372 gene locus_tag LOCUS_02400 17076 16372 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879740.1 protein_id gnl|my_center|LOCUS_02400 17514 18548 gene locus_tag LOCUS_02410 17514 18548 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875832.1 protein_id gnl|my_center|LOCUS_02410 18553 19098 gene locus_tag LOCUS_02420 18553 19098 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_02420 19095 19361 gene locus_tag LOCUS_02430 gene porD 19095 19361 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020092.1 protein_id gnl|my_center|LOCUS_02430 19371 20540 gene locus_tag LOCUS_02440 gene porA 19371 20540 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_02440 20545 21489 gene locus_tag LOCUS_02450 gene porB 20545 21489 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877344.1 protein_id gnl|my_center|LOCUS_02450 >Feature sequence007 847 131 gene locus_tag LOCUS_02460 847 131 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879137.1 protein_id gnl|my_center|LOCUS_02460 901 1848 gene locus_tag LOCUS_02470 901 1848 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979599.1 protein_id gnl|my_center|LOCUS_02470 1845 2405 gene locus_tag LOCUS_02480 1845 2405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 2445 2819 gene locus_tag LOCUS_02490 2445 2819 CDS product molybdopterin dinucleotide binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870681.1 protein_id gnl|my_center|LOCUS_02490 2816 4084 gene locus_tag LOCUS_02500 2816 4084 CDS product formylmethanofuran dehydrogenase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879422.1 protein_id gnl|my_center|LOCUS_02500 4078 5721 gene locus_tag LOCUS_02510 4078 5721 CDS product formylmethanofuran dehydrogenase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879423.1 protein_id gnl|my_center|LOCUS_02510 5715 6416 gene locus_tag LOCUS_02520 5715 6416 CDS product formylmethanofuran dehydrogenase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270512.1 protein_id gnl|my_center|LOCUS_02520 7104 6403 gene locus_tag LOCUS_02530 7104 6403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 8003 7101 gene locus_tag LOCUS_02540 gene mer 8003 7101 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_02540 8052 8585 gene locus_tag LOCUS_02550 8052 8585 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879683.1 protein_id gnl|my_center|LOCUS_02550 9786 8572 gene locus_tag LOCUS_02560 9786 8572 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274451.1 protein_id gnl|my_center|LOCUS_02560 10205 9783 gene locus_tag LOCUS_02570 10205 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 11227 10193 gene locus_tag LOCUS_02580 gene nuoH 11227 10193 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591312.1 protein_id gnl|my_center|LOCUS_02580 13404 11233 gene locus_tag LOCUS_02590 13404 11233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 13732 13397 gene locus_tag LOCUS_02600 13732 13397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 14879 13737 gene locus_tag LOCUS_02610 14879 13737 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064736.1 protein_id gnl|my_center|LOCUS_02610 16714 14867 gene locus_tag LOCUS_02620 16714 14867 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879321.1 protein_id gnl|my_center|LOCUS_02620 18102 16711 gene locus_tag LOCUS_02630 18102 16711 CDS product complex I subunit 5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879320.1 protein_id gnl|my_center|LOCUS_02630 18361 18095 gene locus_tag LOCUS_02640 18361 18095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 18792 18358 gene locus_tag LOCUS_02650 18792 18358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 19711 18830 gene locus_tag LOCUS_02660 gene fhcD 19711 18830 CDS product formylmethanofuran--tetrahydromethanopterin N-formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879696.1 protein_id gnl|my_center|LOCUS_02660 19741 19932 gene locus_tag LOCUS_02670 19741 19932 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064446.1 protein_id gnl|my_center|LOCUS_02670 20560 19922 gene locus_tag LOCUS_02680 20560 19922 CDS product HisA/HisF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878216.1 protein_id gnl|my_center|LOCUS_02680 <21986 20557 gene locus_tag LOCUS_02690 <21986 20557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061038.1:H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA >Feature sequence008 3526 119 gene locus_tag LOCUS_02700 gene infB 3526 119 CDS product intein-containing translation initiation factor aIF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250256.1 protein_id gnl|my_center|LOCUS_02700 4021 3572 gene locus_tag LOCUS_02710 gene ndk 4021 3572 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_02710 4069 4362 gene locus_tag LOCUS_02720 4069 4362 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868800.1 protein_id gnl|my_center|LOCUS_02720 4531 4352 gene locus_tag LOCUS_02730 4531 4352 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878269.1 protein_id gnl|my_center|LOCUS_02730 4742 4533 gene locus_tag LOCUS_02740 4742 4533 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878268.1 protein_id gnl|my_center|LOCUS_02740 5136 4774 gene locus_tag LOCUS_02750 gene rpl7ae 5136 4774 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878267.1 protein_id gnl|my_center|LOCUS_02750 7292 5214 gene locus_tag LOCUS_02760 7292 5214 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878834.1 protein_id gnl|my_center|LOCUS_02760 7618 7289 gene locus_tag LOCUS_02770 7618 7289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879004.1 protein_id gnl|my_center|LOCUS_02770 7693 8292 gene locus_tag LOCUS_02780 gene hisH 7693 8292 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879754.1 protein_id gnl|my_center|LOCUS_02780 9221 8289 gene locus_tag LOCUS_02790 9221 8289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878934.1 protein_id gnl|my_center|LOCUS_02790 9492 9226 gene locus_tag LOCUS_02800 9492 9226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 9564 9636 gene locus_tag LOCUS_t00120 9564 9636 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 9699 11537 gene locus_tag LOCUS_02810 9699 11537 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879914.1 protein_id gnl|my_center|LOCUS_02810 11562 12302 gene locus_tag LOCUS_02820 gene artA 11562 12302 CDS product archaeosortase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879538.1 protein_id gnl|my_center|LOCUS_02820 12299 12865 gene locus_tag LOCUS_02830 12299 12865 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879537.1 protein_id gnl|my_center|LOCUS_02830 12972 13439 gene locus_tag LOCUS_02840 12972 13439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 13436 13771 gene locus_tag LOCUS_02850 13436 13771 CDS product dihydroneopterin aldolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319505.1 protein_id gnl|my_center|LOCUS_02850 13796 13975 gene locus_tag LOCUS_02860 13796 13975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 13972 14754 gene locus_tag LOCUS_02870 gene surE 13972 14754 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878442.1 protein_id gnl|my_center|LOCUS_02870 14747 15415 gene locus_tag LOCUS_02880 gene rpiA 14747 15415 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878443.1 protein_id gnl|my_center|LOCUS_02880 16175 15558 gene locus_tag LOCUS_02890 16175 15558 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878019.1 protein_id gnl|my_center|LOCUS_02890 16575 16177 gene locus_tag LOCUS_02900 16575 16177 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_02900 16646 17206 gene locus_tag LOCUS_02910 16646 17206 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251182.1 protein_id gnl|my_center|LOCUS_02910 17203 18309 gene locus_tag LOCUS_02920 17203 18309 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763330.1 protein_id gnl|my_center|LOCUS_02920 18588 18301 gene locus_tag LOCUS_02930 18588 18301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 18748 19974 gene locus_tag LOCUS_02940 18748 19974 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879234.1 protein_id gnl|my_center|LOCUS_02940 21015 19948 gene locus_tag LOCUS_02950 21015 19948 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867725.1 protein_id gnl|my_center|LOCUS_02950 21283 21017 gene locus_tag LOCUS_02960 21283 21017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878384.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence009 264 639 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gataaaatcagactatattaggattgaaag 1168 617 gene locus_tag LOCUS_02970 1168 617 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867165.1 protein_id gnl|my_center|LOCUS_02970 2069 1533 gene locus_tag LOCUS_02980 2069 1533 CDS product PUA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877572.1 protein_id gnl|my_center|LOCUS_02980 2434 2030 gene locus_tag LOCUS_02990 2434 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877573.1 protein_id gnl|my_center|LOCUS_02990 2839 2480 gene locus_tag LOCUS_03000 2839 2480 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879687.1 protein_id gnl|my_center|LOCUS_03000 3489 2836 gene locus_tag LOCUS_03010 3489 2836 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877882.1 protein_id gnl|my_center|LOCUS_03010 3511 4599 gene locus_tag LOCUS_03020 gene mfnA 3511 4599 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879496.1 protein_id gnl|my_center|LOCUS_03020 4648 4911 gene locus_tag LOCUS_03030 4648 4911 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879046.1 protein_id gnl|my_center|LOCUS_03030 4964 5647 gene locus_tag LOCUS_03040 4964 5647 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249999.1 protein_id gnl|my_center|LOCUS_03040 5644 6249 gene locus_tag LOCUS_03050 5644 6249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 6246 6845 gene locus_tag LOCUS_03060 6246 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 6829 7434 gene locus_tag LOCUS_03070 6829 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 7434 7988 gene locus_tag LOCUS_03080 7434 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 8859 7966 gene locus_tag LOCUS_03090 gene thiL 8859 7966 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064276.1 protein_id gnl|my_center|LOCUS_03090 8896 10155 gene locus_tag LOCUS_03100 8896 10155 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879190.1 protein_id gnl|my_center|LOCUS_03100 10881 10147 gene locus_tag LOCUS_03110 10881 10147 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064224.1 protein_id gnl|my_center|LOCUS_03110 10934 11866 gene locus_tag LOCUS_03120 10934 11866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 11863 12978 gene locus_tag LOCUS_03130 11863 12978 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444228.1 protein_id gnl|my_center|LOCUS_03130 12962 13876 gene locus_tag LOCUS_03140 12962 13876 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_03140 15643 14012 gene locus_tag LOCUS_03150 gene argS 15643 14012 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878394.1 protein_id gnl|my_center|LOCUS_03150 16606 15674 gene locus_tag LOCUS_03160 16606 15674 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879293.1 protein_id gnl|my_center|LOCUS_03160 17201 16608 gene locus_tag LOCUS_03170 gene phoU 17201 16608 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878857.1 protein_id gnl|my_center|LOCUS_03170 17920 17213 gene locus_tag LOCUS_03180 17920 17213 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879335.1 protein_id gnl|my_center|LOCUS_03180 18633 17902 gene locus_tag LOCUS_03190 gene cbiQ 18633 17902 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879336.1 protein_id gnl|my_center|LOCUS_03190 19520 18630 gene locus_tag LOCUS_03200 19520 18630 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064472.1 protein_id gnl|my_center|LOCUS_03200 20100 19567 gene locus_tag LOCUS_03210 20100 19567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 20860 20072 gene locus_tag LOCUS_03220 20860 20072 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879112.1 protein_id gnl|my_center|LOCUS_03220 21013 20867 gene locus_tag LOCUS_03230 21013 20867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 >Feature sequence010 <1 1220 gene locus_tag LOCUS_03240 <1 1220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878155.1:DNA topoisomerase VI subunit B 1274 1537 gene locus_tag LOCUS_03250 1274 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 1542 2249 gene locus_tag LOCUS_03260 1542 2249 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_03260 2697 2383 gene locus_tag LOCUS_03270 2697 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 2859 5666 gene locus_tag LOCUS_03280 gene leuS 2859 5666 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879908.1 protein_id gnl|my_center|LOCUS_03280 5699 6673 gene locus_tag LOCUS_03290 gene cofG 5699 6673 CDS product 7,8-didemethyl-8-hydroxy-5-deazariboflavin synthase subunit CofG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878300.1 protein_id gnl|my_center|LOCUS_03290 6648 7664 gene locus_tag LOCUS_03300 gene cofH 6648 7664 CDS product 5-amino-6-(D-ribitylamino)uracil--L-tyrosine 4-hydroxyphenyl transferase CofH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878301.1 protein_id gnl|my_center|LOCUS_03300 9562 8216 gene locus_tag LOCUS_03310 gene purB 9562 8216 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879731.1 protein_id gnl|my_center|LOCUS_03310 9804 9613 gene locus_tag LOCUS_03320 9804 9613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 9852 10196 gene locus_tag LOCUS_03330 9852 10196 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877623.1 protein_id gnl|my_center|LOCUS_03330 10232 10585 gene locus_tag LOCUS_03340 10232 10585 CDS product YlbF family regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878558.1 protein_id gnl|my_center|LOCUS_03340 10636 11412 gene locus_tag LOCUS_03350 10636 11412 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878754.1 protein_id gnl|my_center|LOCUS_03350 11409 11690 gene locus_tag LOCUS_03360 gene hisE 11409 11690 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021409.1 protein_id gnl|my_center|LOCUS_03360 11687 11965 gene locus_tag LOCUS_03370 gene srp19 11687 11965 CDS product signal recognition particle SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878753.1 protein_id gnl|my_center|LOCUS_03370 11962 12909 gene locus_tag LOCUS_03380 11962 12909 CDS product TIGR01177 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878752.1 protein_id gnl|my_center|LOCUS_03380 12933 13886 gene locus_tag LOCUS_03390 gene dph2 12933 13886 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879298.1 protein_id gnl|my_center|LOCUS_03390 14371 13883 gene locus_tag LOCUS_03400 14371 13883 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879257.1 protein_id gnl|my_center|LOCUS_03400 14751 15089 gene locus_tag LOCUS_03410 gene speD 14751 15089 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879107.1 protein_id gnl|my_center|LOCUS_03410 15167 15679 gene locus_tag LOCUS_03420 15167 15679 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878350.1 protein_id gnl|my_center|LOCUS_03420 15676 16548 gene locus_tag LOCUS_03430 15676 16548 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013684142.1 protein_id gnl|my_center|LOCUS_03430 16545 17690 gene locus_tag LOCUS_03440 16545 17690 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878352.1 protein_id gnl|my_center|LOCUS_03440 17681 18562 gene locus_tag LOCUS_03450 17681 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274381.1 protein_id gnl|my_center|LOCUS_03450 18582 18866 gene locus_tag LOCUS_03460 gene gatC 18582 18866 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 protein_id gnl|my_center|LOCUS_03460 18869 20230 gene locus_tag LOCUS_03470 gene gatA 18869 20230 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879818.1 protein_id gnl|my_center|LOCUS_03470 >Feature sequence011 <1 686 gene locus_tag LOCUS_03480 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878939.1:fructose-1,6-bisphosphate aldolase/phosphatase 1099 683 gene locus_tag LOCUS_03490 1099 683 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878568.1 protein_id gnl|my_center|LOCUS_03490 2105 1038 gene locus_tag LOCUS_03500 gene priL 2105 1038 CDS product DNA primase regulatory subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877843.1 protein_id gnl|my_center|LOCUS_03500 2839 2102 gene locus_tag LOCUS_03510 2839 2102 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877842.1 protein_id gnl|my_center|LOCUS_03510 3067 2873 gene locus_tag LOCUS_03520 3067 2873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 3959 3117 gene locus_tag LOCUS_03530 gene ubiA 3959 3117 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879665.1 protein_id gnl|my_center|LOCUS_03530 4488 3943 gene locus_tag LOCUS_03540 4488 3943 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878428.1 protein_id gnl|my_center|LOCUS_03540 4735 4469 gene locus_tag LOCUS_03550 4735 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879719.1 protein_id gnl|my_center|LOCUS_03550 4812 4886 gene locus_tag LOCUS_t00130 4812 4886 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5330 6526 gene locus_tag LOCUS_03560 5330 6526 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081432771.1 protein_id gnl|my_center|LOCUS_03560 6547 6714 gene locus_tag LOCUS_03570 6547 6714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 6660 7757 gene locus_tag LOCUS_03580 gene hisC 6660 7757 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423302.1 protein_id gnl|my_center|LOCUS_03580 8246 7746 gene locus_tag LOCUS_03590 8246 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 9200 8256 gene locus_tag LOCUS_03600 9200 8256 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879529.1 protein_id gnl|my_center|LOCUS_03600 10614 9205 gene locus_tag LOCUS_03610 10614 9205 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878354.1 protein_id gnl|my_center|LOCUS_03610 10662 11411 gene locus_tag LOCUS_03620 10662 11411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 11432 11839 gene locus_tag LOCUS_03630 11432 11839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878020.1 protein_id gnl|my_center|LOCUS_03630 12159 11830 gene locus_tag LOCUS_03640 12159 11830 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_03640 12527 12144 gene locus_tag LOCUS_03650 gene crcB 12527 12144 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023830.1 protein_id gnl|my_center|LOCUS_03650 13294 12509 gene locus_tag LOCUS_03660 13294 12509 CDS product prenyltransferase/squalene oxidase repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879040.1 protein_id gnl|my_center|LOCUS_03660 13529 13314 gene locus_tag LOCUS_03670 13529 13314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 14570 13764 gene locus_tag LOCUS_03680 14570 13764 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879200.1 protein_id gnl|my_center|LOCUS_03680 14633 15355 gene locus_tag LOCUS_03690 14633 15355 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878991.1 protein_id gnl|my_center|LOCUS_03690 15378 15683 gene locus_tag LOCUS_03700 15378 15683 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879026.1 protein_id gnl|my_center|LOCUS_03700 15703 16050 gene locus_tag LOCUS_03710 15703 16050 CDS product RNA polymerase Rpb4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064405.1 protein_id gnl|my_center|LOCUS_03710 16055 16630 gene locus_tag LOCUS_03720 16055 16630 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879028.1 protein_id gnl|my_center|LOCUS_03720 17757 16627 gene locus_tag LOCUS_03730 17757 16627 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877767.1 protein_id gnl|my_center|LOCUS_03730 18677 17754 gene locus_tag LOCUS_03740 18677 17754 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878297.1 protein_id gnl|my_center|LOCUS_03740 19355 18714 gene locus_tag LOCUS_03750 19355 18714 CDS product histidinol phosphate phosphatase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879047.1 protein_id gnl|my_center|LOCUS_03750 >Feature sequence012 305 42 gene locus_tag LOCUS_03760 305 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 771 1022 gene locus_tag LOCUS_03770 771 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 2789 1023 gene locus_tag LOCUS_03780 2789 1023 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877518.1 protein_id gnl|my_center|LOCUS_03780 3082 2816 gene locus_tag LOCUS_03790 3082 2816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4935 3079 gene locus_tag LOCUS_03800 4935 3079 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878055.1 protein_id gnl|my_center|LOCUS_03800 5007 5534 gene locus_tag LOCUS_03810 5007 5534 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877737.1 protein_id gnl|my_center|LOCUS_03810 7172 5535 gene locus_tag LOCUS_03820 7172 5535 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878530.1 protein_id gnl|my_center|LOCUS_03820 10383 7138 gene locus_tag LOCUS_03830 10383 7138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 10520 11896 gene locus_tag LOCUS_03840 10520 11896 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_03840 11889 13376 gene locus_tag LOCUS_03850 11889 13376 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979518.1 protein_id gnl|my_center|LOCUS_03850 13382 13693 gene locus_tag LOCUS_03860 13382 13693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 14360 13656 gene locus_tag LOCUS_03870 gene larB 14360 13656 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878770.1 protein_id gnl|my_center|LOCUS_03870 17610 14344 gene locus_tag LOCUS_03880 gene carB 17610 14344 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_03880 18693 17620 gene locus_tag LOCUS_03890 gene carA 18693 17620 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878768.1 protein_id gnl|my_center|LOCUS_03890 <19496 18690 gene locus_tag LOCUS_03900 <19496 18690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878767.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase >Feature sequence013 5 286 gene locus_tag LOCUS_03910 5 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 283 861 gene locus_tag LOCUS_03920 283 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 858 3323 gene locus_tag LOCUS_03930 858 3323 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879887.1 protein_id gnl|my_center|LOCUS_03930 3293 4222 gene locus_tag LOCUS_03940 3293 4222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 4219 5169 gene locus_tag LOCUS_03950 4219 5169 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064578.1 protein_id gnl|my_center|LOCUS_03950 5881 5144 gene locus_tag LOCUS_03960 5881 5144 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_03960 6201 5860 gene locus_tag LOCUS_03970 gene queD 6201 5860 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320165.1 protein_id gnl|my_center|LOCUS_03970 6890 6198 gene locus_tag LOCUS_03980 6890 6198 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877948.1 protein_id gnl|my_center|LOCUS_03980 7575 6862 gene locus_tag LOCUS_03990 gene queC 7575 6862 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877949.1 protein_id gnl|my_center|LOCUS_03990 8685 7603 gene locus_tag LOCUS_04000 8685 7603 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064554.1 protein_id gnl|my_center|LOCUS_04000 10187 8688 gene locus_tag LOCUS_04010 10187 8688 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_04010 12022 10226 gene locus_tag LOCUS_04020 gene cooS 12022 10226 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870233.1 protein_id gnl|my_center|LOCUS_04020 12820 12152 gene locus_tag LOCUS_04030 12820 12152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 12894 13169 gene locus_tag LOCUS_04040 12894 13169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 13166 13774 gene locus_tag LOCUS_04050 13166 13774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 13771 14433 gene locus_tag LOCUS_04060 13771 14433 CDS product TIGR00289 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868261.1 protein_id gnl|my_center|LOCUS_04060 14547 15707 gene locus_tag LOCUS_04070 14547 15707 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979004.1 protein_id gnl|my_center|LOCUS_04070 15737 16357 gene locus_tag LOCUS_04080 15737 16357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 16384 17385 gene locus_tag LOCUS_04090 gene pdxS 16384 17385 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878015.1 protein_id gnl|my_center|LOCUS_04090 19063 17396 gene locus_tag LOCUS_04100 19063 17396 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051765.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence014 1152 388 gene locus_tag LOCUS_04110 1152 388 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877985.1 protein_id gnl|my_center|LOCUS_04110 1222 2016 gene locus_tag LOCUS_04120 1222 2016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 2261 2785 gene locus_tag LOCUS_04130 2261 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2769 3032 gene locus_tag LOCUS_04140 2769 3032 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064523.1 protein_id gnl|my_center|LOCUS_04140 3037 3486 gene locus_tag LOCUS_04150 3037 3486 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879561.1 protein_id gnl|my_center|LOCUS_04150 3496 3825 gene locus_tag LOCUS_04160 3496 3825 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064758.1 protein_id gnl|my_center|LOCUS_04160 3831 3983 gene locus_tag LOCUS_04170 3831 3983 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879559.1 protein_id gnl|my_center|LOCUS_04170 3988 4275 gene locus_tag LOCUS_04180 3988 4275 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879558.1 protein_id gnl|my_center|LOCUS_04180 4277 4930 gene locus_tag LOCUS_04190 4277 4930 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879557.1 protein_id gnl|my_center|LOCUS_04190 4943 5116 gene locus_tag LOCUS_04200 gene rpl18a 4943 5116 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879556.1 protein_id gnl|my_center|LOCUS_04200 5127 5543 gene locus_tag LOCUS_04210 gene pfdA 5127 5543 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879555.1 protein_id gnl|my_center|LOCUS_04210 5543 6619 gene locus_tag LOCUS_04220 gene ftsY 5543 6619 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879554.1 protein_id gnl|my_center|LOCUS_04220 7374 6622 gene locus_tag LOCUS_04230 7374 6622 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878917.1 protein_id gnl|my_center|LOCUS_04230 7481 7918 gene locus_tag LOCUS_04240 7481 7918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496618.1 protein_id gnl|my_center|LOCUS_04240 9158 7911 gene locus_tag LOCUS_04250 gene gatD 9158 7911 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319255.1 protein_id gnl|my_center|LOCUS_04250 10569 9160 gene locus_tag LOCUS_04260 gene argH 10569 9160 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878383.1 protein_id gnl|my_center|LOCUS_04260 10795 10550 gene locus_tag LOCUS_04270 10795 10550 CDS product RNA repair domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012939633.1 protein_id gnl|my_center|LOCUS_04270 11304 10792 gene locus_tag LOCUS_04280 11304 10792 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877928.1 protein_id gnl|my_center|LOCUS_04280 11396 12031 gene locus_tag LOCUS_04290 11396 12031 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_04290 12028 12381 gene locus_tag LOCUS_04300 12028 12381 CDS product DUF2073 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064681.1 protein_id gnl|my_center|LOCUS_04300 12384 12668 gene locus_tag LOCUS_04310 12384 12668 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878679.1 protein_id gnl|my_center|LOCUS_04310 13117 12665 gene locus_tag LOCUS_04320 13117 12665 CDS product inosine monophosphate cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879306.1 protein_id gnl|my_center|LOCUS_04320 14112 13114 gene locus_tag LOCUS_04330 gene rtcA 14112 13114 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878932.1 protein_id gnl|my_center|LOCUS_04330 14160 15002 gene locus_tag LOCUS_04340 14160 15002 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878207.1 protein_id gnl|my_center|LOCUS_04340 15211 14999 gene locus_tag LOCUS_04350 15211 14999 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877844.1 protein_id gnl|my_center|LOCUS_04350 15312 16493 gene locus_tag LOCUS_04360 15312 16493 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064188.1 protein_id gnl|my_center|LOCUS_04360 16523 17752 gene locus_tag LOCUS_04370 gene icd 16523 17752 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence015 960 2267 gene locus_tag LOCUS_04380 gene truD 960 2267 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879173.1 protein_id gnl|my_center|LOCUS_04380 2567 2259 gene locus_tag LOCUS_04390 2567 2259 CDS product DUF5611 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878607.1 protein_id gnl|my_center|LOCUS_04390 2616 3332 gene locus_tag LOCUS_04400 2616 3332 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878746.1 protein_id gnl|my_center|LOCUS_04400 3325 3726 gene locus_tag LOCUS_04410 3325 3726 CDS product DUF473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878745.1 protein_id gnl|my_center|LOCUS_04410 4082 3708 gene locus_tag LOCUS_04420 4082 3708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 4575 4114 gene locus_tag LOCUS_04430 gene ribC 4575 4114 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878913.1 protein_id gnl|my_center|LOCUS_04430 5669 4572 gene locus_tag LOCUS_04440 5669 4572 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878914.1 protein_id gnl|my_center|LOCUS_04440 5715 5984 gene locus_tag LOCUS_04450 5715 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878255.1 protein_id gnl|my_center|LOCUS_04450 7047 5953 gene locus_tag LOCUS_04460 7047 5953 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867610.1 protein_id gnl|my_center|LOCUS_04460 7474 7040 gene locus_tag LOCUS_04470 7474 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 7535 8452 gene locus_tag LOCUS_04480 gene argF 7535 8452 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878750.1 protein_id gnl|my_center|LOCUS_04480 8737 8459 gene locus_tag LOCUS_04490 gene albA 8737 8459 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_04490 8816 8899 gene locus_tag LOCUS_t00140 8816 8899 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8942 10609 gene locus_tag LOCUS_04500 8942 10609 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877907.1 protein_id gnl|my_center|LOCUS_04500 10641 11531 gene locus_tag LOCUS_04510 gene mdh 10641 11531 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878358.1 protein_id gnl|my_center|LOCUS_04510 11528 12292 gene locus_tag LOCUS_04520 11528 12292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980179.1 protein_id gnl|my_center|LOCUS_04520 13331 12375 gene locus_tag LOCUS_04530 13331 12375 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879462.1 protein_id gnl|my_center|LOCUS_04530 13993 13361 gene locus_tag LOCUS_04540 13993 13361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 15003 13990 gene locus_tag LOCUS_04550 15003 13990 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249779.1 protein_id gnl|my_center|LOCUS_04550 15124 15990 gene locus_tag LOCUS_04560 15124 15990 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879191.1 protein_id gnl|my_center|LOCUS_04560 16000 16452 gene locus_tag LOCUS_04570 16000 16452 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318917.1 protein_id gnl|my_center|LOCUS_04570 16445 17440 gene locus_tag LOCUS_04580 gene amrS 16445 17440 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 protein_id gnl|my_center|LOCUS_04580 >Feature sequence016 911 1702 gene locus_tag LOCUS_04590 911 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 1651 1905 gene locus_tag LOCUS_04600 1651 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 3240 2155 gene locus_tag LOCUS_04610 3240 2155 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496893.1 protein_id gnl|my_center|LOCUS_04610 3393 4685 gene locus_tag LOCUS_04620 3393 4685 CDS product cobyrinate a,c-diamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064814.1 protein_id gnl|my_center|LOCUS_04620 4783 5433 gene locus_tag LOCUS_04630 4783 5433 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964674.1 protein_id gnl|my_center|LOCUS_04630 5426 5704 gene locus_tag LOCUS_04640 5426 5704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5793 6530 gene locus_tag LOCUS_04650 gene cbiQ 5793 6530 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877313.1 protein_id gnl|my_center|LOCUS_04650 6527 7504 gene locus_tag LOCUS_04660 6527 7504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 7455 7940 gene locus_tag LOCUS_04670 7455 7940 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878235.1 protein_id gnl|my_center|LOCUS_04670 7940 8539 gene locus_tag LOCUS_04680 7940 8539 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878230.1 protein_id gnl|my_center|LOCUS_04680 8541 9248 gene locus_tag LOCUS_04690 8541 9248 CDS product cobalt-precorrin-4/precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878229.1 protein_id gnl|my_center|LOCUS_04690 9254 9934 gene locus_tag LOCUS_04700 9254 9934 CDS product cobalt-precorrin 5A hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274383.1 protein_id gnl|my_center|LOCUS_04700 9918 10667 gene locus_tag LOCUS_04710 9918 10667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04710 10669 11265 gene locus_tag LOCUS_04720 10669 11265 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024140.1 protein_id gnl|my_center|LOCUS_04720 11249 12160 gene locus_tag LOCUS_04730 11249 12160 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878226.1 protein_id gnl|my_center|LOCUS_04730 12153 12710 gene locus_tag LOCUS_04740 12153 12710 CDS product cobalt-precorrin-7 (C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878225.1 protein_id gnl|my_center|LOCUS_04740 12715 13098 gene locus_tag LOCUS_04750 gene cbiX 12715 13098 CDS product sirohydrochlorin cobaltochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878224.1 protein_id gnl|my_center|LOCUS_04750 13098 14480 gene locus_tag LOCUS_04760 gene cobQ 13098 14480 CDS product cobyric acid synthase CobQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878835.1 protein_id gnl|my_center|LOCUS_04760 15615 14473 gene locus_tag LOCUS_04770 15615 14473 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878324.1 protein_id gnl|my_center|LOCUS_04770 15902 15612 gene locus_tag LOCUS_04780 15902 15612 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868393.1 protein_id gnl|my_center|LOCUS_04780 16719 15904 gene locus_tag LOCUS_04790 gene hisF 16719 15904 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878322.1 protein_id gnl|my_center|LOCUS_04790 16892 17530 gene locus_tag LOCUS_04800 16892 17530 CDS product DUF6293 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879479.1 protein_id gnl|my_center|LOCUS_04800 >Feature sequence017 1234 1896 gene locus_tag LOCUS_04810 1234 1896 CDS product TrmB family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878727.1 protein_id gnl|my_center|LOCUS_04810 1893 2450 gene locus_tag LOCUS_04820 1893 2450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2407 3015 gene locus_tag LOCUS_04830 2407 3015 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879497.1 protein_id gnl|my_center|LOCUS_04830 2985 3863 gene locus_tag LOCUS_04840 gene moaA 2985 3863 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879498.1 protein_id gnl|my_center|LOCUS_04840 3888 5546 gene locus_tag LOCUS_04850 3888 5546 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320246.1 protein_id gnl|my_center|LOCUS_04850 6003 5536 gene locus_tag LOCUS_04860 gene cgi121 6003 5536 CDS product KEOPS complex subunit Cgi121 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878026.1 protein_id gnl|my_center|LOCUS_04860 6970 6191 gene locus_tag LOCUS_04870 6970 6191 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878032.1 protein_id gnl|my_center|LOCUS_04870 7142 6954 gene locus_tag LOCUS_04880 7142 6954 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878033.1 protein_id gnl|my_center|LOCUS_04880 8235 7192 gene locus_tag LOCUS_04890 8235 7192 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096393.1 protein_id gnl|my_center|LOCUS_04890 8966 8217 gene locus_tag LOCUS_04900 8966 8217 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879850.1 protein_id gnl|my_center|LOCUS_04900 9484 9008 gene locus_tag LOCUS_04910 9484 9008 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878419.1 protein_id gnl|my_center|LOCUS_04910 10278 9475 gene locus_tag LOCUS_04920 10278 9475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 10897 10328 gene locus_tag LOCUS_04930 10897 10328 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879329.1 protein_id gnl|my_center|LOCUS_04930 11709 10894 gene locus_tag LOCUS_04940 11709 10894 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879330.1 protein_id gnl|my_center|LOCUS_04940 11776 12798 gene locus_tag LOCUS_04950 11776 12798 CDS product bis-aminopropyl spermidine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064426.1 protein_id gnl|my_center|LOCUS_04950 12801 13271 gene locus_tag LOCUS_04960 12801 13271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878902.1 protein_id gnl|my_center|LOCUS_04960 16897 13490 gene locus_tag LOCUS_04970 16897 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence018 1033 242 gene locus_tag LOCUS_04980 1033 242 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879799.1 protein_id gnl|my_center|LOCUS_04980 1067 1498 gene locus_tag LOCUS_04990 1067 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 2183 1470 gene locus_tag LOCUS_05000 2183 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064496.1 protein_id gnl|my_center|LOCUS_05000 3041 2199 gene locus_tag LOCUS_05010 gene hisG 3041 2199 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020275.1 protein_id gnl|my_center|LOCUS_05010 4330 3050 gene locus_tag LOCUS_05020 4330 3050 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877564.1 protein_id gnl|my_center|LOCUS_05020 4329 6059 gene locus_tag LOCUS_05030 4329 6059 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878782.1 protein_id gnl|my_center|LOCUS_05030 6064 7704 gene locus_tag LOCUS_05040 6064 7704 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941764.1 protein_id gnl|my_center|LOCUS_05040 7724 8869 gene locus_tag LOCUS_05050 7724 8869 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879875.1 protein_id gnl|my_center|LOCUS_05050 10165 8861 gene locus_tag LOCUS_05060 10165 8861 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879505.1 protein_id gnl|my_center|LOCUS_05060 10216 10374 gene locus_tag LOCUS_05070 10216 10374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 10367 10807 gene locus_tag LOCUS_05080 10367 10807 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249298.1 protein_id gnl|my_center|LOCUS_05080 10851 11543 gene locus_tag LOCUS_05090 10851 11543 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869576.1 protein_id gnl|my_center|LOCUS_05090 11589 13880 gene locus_tag LOCUS_05100 11589 13880 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496762.1 protein_id gnl|my_center|LOCUS_05100 15184 13877 gene locus_tag LOCUS_05110 gene srp54 15184 13877 CDS product signal recognition particle protein SRP54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878126.1 protein_id gnl|my_center|LOCUS_05110 15971 15219 gene locus_tag LOCUS_05120 15971 15219 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879273.1 protein_id gnl|my_center|LOCUS_05120 <16609 15976 gene locus_tag LOCUS_05130 <16609 15976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878440.1:DNA topoisomerase IV subunit A >Feature sequence019 <1 644 gene locus_tag LOCUS_05140 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877732.1:ABC transporter ATP-binding protein 825 1763 gene locus_tag LOCUS_05150 gene endA 825 1763 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156029509.1 protein_id gnl|my_center|LOCUS_05150 1939 4044 gene locus_tag LOCUS_05160 1939 4044 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546462.1 protein_id gnl|my_center|LOCUS_05160 4046 4612 gene locus_tag LOCUS_05170 4046 4612 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546510.1 protein_id gnl|my_center|LOCUS_05170 4623 5552 gene locus_tag LOCUS_05180 4623 5552 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022853557.1 protein_id gnl|my_center|LOCUS_05180 5558 5965 gene locus_tag LOCUS_05190 5558 5965 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842401.1 protein_id gnl|my_center|LOCUS_05190 5970 6923 gene locus_tag LOCUS_05200 5970 6923 CDS product F420-non-reducing hydrogenase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545939.1 protein_id gnl|my_center|LOCUS_05200 6929 8431 gene locus_tag LOCUS_05210 6929 8431 CDS product F420-non-reducing hydrogenase subunit A, selenocysteine-containing inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545782.1 protein_id gnl|my_center|LOCUS_05210 8438 8923 gene locus_tag LOCUS_05220 8438 8923 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545540.1 protein_id gnl|my_center|LOCUS_05220 9175 8867 gene locus_tag LOCUS_05230 9175 8867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 9812 9210 gene locus_tag LOCUS_05240 9812 9210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05240 9921 11756 gene locus_tag LOCUS_05250 gene pheA 9921 11756 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683139.1 protein_id gnl|my_center|LOCUS_05250 12657 11899 gene locus_tag LOCUS_05260 12657 11899 CDS product presenilin family intramembrane aspartyl protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096160.1 protein_id gnl|my_center|LOCUS_05260 14463 12685 gene locus_tag LOCUS_05270 14463 12685 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064494.1 protein_id gnl|my_center|LOCUS_05270 15045 14788 gene locus_tag LOCUS_05280 15045 14788 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879857.1 protein_id gnl|my_center|LOCUS_05280 >Feature sequence020 450 166 gene locus_tag LOCUS_05290 450 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 486 1655 gene locus_tag LOCUS_05300 gene thrC 486 1655 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878813.1 protein_id gnl|my_center|LOCUS_05300 1652 2239 gene locus_tag LOCUS_05310 1652 2239 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250761.1 protein_id gnl|my_center|LOCUS_05310 2323 3822 gene locus_tag LOCUS_05320 gene lysS 2323 3822 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878711.1 protein_id gnl|my_center|LOCUS_05320 4161 3826 gene locus_tag LOCUS_05330 4161 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 4951 4214 gene locus_tag LOCUS_05340 4951 4214 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879181.1 protein_id gnl|my_center|LOCUS_05340 5934 4948 gene locus_tag LOCUS_05350 5934 4948 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024396.1 protein_id gnl|my_center|LOCUS_05350 6809 5931 gene locus_tag LOCUS_05360 6809 5931 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878561.1 protein_id gnl|my_center|LOCUS_05360 7570 6806 gene locus_tag LOCUS_05370 7570 6806 CDS product F420-dependent methylenetetrahydromethanopterin dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878217.1 protein_id gnl|my_center|LOCUS_05370 8897 7617 gene locus_tag LOCUS_05380 gene acsC 8897 7617 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877883.1 protein_id gnl|my_center|LOCUS_05380 9997 8894 gene locus_tag LOCUS_05390 9997 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 10686 9994 gene locus_tag LOCUS_05400 10686 9994 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877885.1 protein_id gnl|my_center|LOCUS_05400 12287 10683 gene locus_tag LOCUS_05410 gene cdhC 12287 10683 CDS product CO dehydrogenase/CO-methylating acetyl-CoA synthase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877886.1 protein_id gnl|my_center|LOCUS_05410 12790 12284 gene locus_tag LOCUS_05420 gene cdhB 12790 12284 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095236.1 protein_id gnl|my_center|LOCUS_05420 15177 12796 gene locus_tag LOCUS_05430 gene cdhA 15177 12796 CDS product CO dehydrogenase/acetyl-CoA synthase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878596.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence021 1 186 gene locus_tag LOCUS_05440 1 186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 221 934 gene locus_tag LOCUS_05450 221 934 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_05450 940 3534 gene locus_tag LOCUS_05460 gene valS 940 3534 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879713.1 protein_id gnl|my_center|LOCUS_05460 3646 4404 gene locus_tag LOCUS_05470 3646 4404 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319512.1 protein_id gnl|my_center|LOCUS_05470 4457 5680 gene locus_tag LOCUS_05480 4457 5680 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878039.1 protein_id gnl|my_center|LOCUS_05480 7107 5677 gene locus_tag LOCUS_05490 7107 5677 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878747.1 protein_id gnl|my_center|LOCUS_05490 7663 7139 gene locus_tag LOCUS_05500 7663 7139 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878302.1 protein_id gnl|my_center|LOCUS_05500 8760 7660 gene locus_tag LOCUS_05510 8760 7660 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979979.1 protein_id gnl|my_center|LOCUS_05510 13615 8807 gene locus_tag LOCUS_05520 13615 8807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 13977 14322 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgttctctttatgagattc >Feature sequence022 1361 225 gene locus_tag LOCUS_05530 1361 225 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064561.1 protein_id gnl|my_center|LOCUS_05530 1566 1342 gene locus_tag LOCUS_05540 1566 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 2033 1563 gene locus_tag LOCUS_05550 2033 1563 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877952.1 protein_id gnl|my_center|LOCUS_05550 2515 2072 gene locus_tag LOCUS_05560 2515 2072 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878603.1 protein_id gnl|my_center|LOCUS_05560 2569 4044 gene locus_tag LOCUS_05570 2569 4044 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878682.1 protein_id gnl|my_center|LOCUS_05570 4049 4435 gene locus_tag LOCUS_05580 4049 4435 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064682.1 protein_id gnl|my_center|LOCUS_05580 5233 4418 gene locus_tag LOCUS_05590 5233 4418 CDS product carboxylate/amino acid/amine transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064409.1 protein_id gnl|my_center|LOCUS_05590 7695 5260 gene locus_tag LOCUS_05600 gene radA 7695 5260 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250850.1 protein_id gnl|my_center|LOCUS_05600 7965 9197 gene locus_tag LOCUS_05610 7965 9197 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877984.1 protein_id gnl|my_center|LOCUS_05610 9231 9314 gene locus_tag LOCUS_t00150 9231 9314 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9345 10055 gene locus_tag LOCUS_05620 9345 10055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 10052 10576 gene locus_tag LOCUS_05630 10052 10576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 11196 10573 gene locus_tag LOCUS_05640 11196 10573 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878012.1 protein_id gnl|my_center|LOCUS_05640 12994 11318 gene locus_tag LOCUS_05650 gene ade 12994 11318 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877751.1 protein_id gnl|my_center|LOCUS_05650 13617 13030 gene locus_tag LOCUS_05660 13617 13030 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877750.1 protein_id gnl|my_center|LOCUS_05660 13701 13775 gene locus_tag LOCUS_t00160 13701 13775 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 13903 14052 gene locus_tag LOCUS_05670 13903 14052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 15258 14296 gene locus_tag LOCUS_05680 15258 14296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence023 1392 523 gene locus_tag LOCUS_05690 1392 523 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877798.1 protein_id gnl|my_center|LOCUS_05690 2154 1402 gene locus_tag LOCUS_05700 2154 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3357 2155 gene locus_tag LOCUS_05710 3357 2155 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879269.1 protein_id gnl|my_center|LOCUS_05710 4057 3377 gene locus_tag LOCUS_05720 4057 3377 CDS product (5-formylfuran-3-yl)methyl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879685.1 protein_id gnl|my_center|LOCUS_05720 4999 4070 gene locus_tag LOCUS_05730 4999 4070 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064243.1 protein_id gnl|my_center|LOCUS_05730 5032 6000 gene locus_tag LOCUS_05740 5032 6000 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879746.1 protein_id gnl|my_center|LOCUS_05740 6025 6780 gene locus_tag LOCUS_05750 6025 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05750 6777 7763 gene locus_tag LOCUS_05760 6777 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05760 7745 9940 gene locus_tag LOCUS_05770 gene hdrA2 7745 9940 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878733.1 protein_id gnl|my_center|LOCUS_05770 10026 11138 gene locus_tag LOCUS_05780 10026 11138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 11123 11413 gene locus_tag LOCUS_05790 11123 11413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 11427 11687 gene locus_tag LOCUS_05800 11427 11687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 11802 12014 gene locus_tag LOCUS_05810 11802 12014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 12004 12264 gene locus_tag LOCUS_05820 12004 12264 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879831.1 protein_id gnl|my_center|LOCUS_05820 13116 12259 gene locus_tag LOCUS_05830 13116 12259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 13948 13103 gene locus_tag LOCUS_05840 13948 13103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 14235 13945 gene locus_tag LOCUS_05850 14235 13945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 14846 15199 gene locus_tag LOCUS_05860 14846 15199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence024 1753 236 gene locus_tag LOCUS_05870 1753 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870914.1 protein_id gnl|my_center|LOCUS_05870 7095 1750 gene locus_tag LOCUS_05880 7095 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879582.1 protein_id gnl|my_center|LOCUS_05880 7847 7125 gene locus_tag LOCUS_05890 7847 7125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064515.1 protein_id gnl|my_center|LOCUS_05890 9825 7888 gene locus_tag LOCUS_05900 9825 7888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064516.1 protein_id gnl|my_center|LOCUS_05900 11138 9903 gene locus_tag LOCUS_05910 11138 9903 CDS product vWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878941.1 protein_id gnl|my_center|LOCUS_05910 12543 11113 gene locus_tag LOCUS_05920 12543 11113 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064393.1 protein_id gnl|my_center|LOCUS_05920 12852 12565 gene locus_tag LOCUS_05930 12852 12565 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867625.1 protein_id gnl|my_center|LOCUS_05930 13267 12836 gene locus_tag LOCUS_05940 13267 12836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 13328 13753 gene locus_tag LOCUS_05950 gene moaC 13328 13753 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879639.1 protein_id gnl|my_center|LOCUS_05950 13976 13743 gene locus_tag LOCUS_05960 13976 13743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 <15100 13997 gene locus_tag LOCUS_05970 <15100 13997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004069588.1:glycerate kinase >Feature sequence025 <1 1976 gene locus_tag LOCUS_05980 <1 1976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878706.1:acetate--CoA ligase 1978 3033 gene locus_tag LOCUS_05990 1978 3033 CDS product phosphotransacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096596.1 protein_id gnl|my_center|LOCUS_05990 3020 3775 gene locus_tag LOCUS_06000 3020 3775 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496515.1 protein_id gnl|my_center|LOCUS_06000 3804 4565 gene locus_tag LOCUS_06010 gene cofE 3804 4565 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879745.1 protein_id gnl|my_center|LOCUS_06010 6402 4552 gene locus_tag LOCUS_06020 gene iorA 6402 4552 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878986.1 protein_id gnl|my_center|LOCUS_06020 6471 7010 gene locus_tag LOCUS_06030 6471 7010 CDS product S26 family signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879287.1 protein_id gnl|my_center|LOCUS_06030 7007 8050 gene locus_tag LOCUS_06040 7007 8050 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795164.1 protein_id gnl|my_center|LOCUS_06040 8573 8025 gene locus_tag LOCUS_06050 8573 8025 CDS product imidazoleglycerol-phosphate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878485.1 protein_id gnl|my_center|LOCUS_06050 9277 8570 gene locus_tag LOCUS_06060 gene hisA 9277 8570 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878486.1 protein_id gnl|my_center|LOCUS_06060 10340 9288 gene locus_tag LOCUS_06070 10340 9288 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877839.1 protein_id gnl|my_center|LOCUS_06070 10482 11294 gene locus_tag LOCUS_06080 10482 11294 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878402.1 protein_id gnl|my_center|LOCUS_06080 11961 11209 gene locus_tag LOCUS_06090 11961 11209 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250819.1 protein_id gnl|my_center|LOCUS_06090 12794 11958 gene locus_tag LOCUS_06100 gene pstA 12794 11958 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250818.1 protein_id gnl|my_center|LOCUS_06100 13695 12787 gene locus_tag LOCUS_06110 gene pstC 13695 12787 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250817.1 protein_id gnl|my_center|LOCUS_06110 <14478 13718 gene locus_tag LOCUS_06120 <14478 13718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250815.1:phosphate ABC transporter substrate-binding protein PstS >Feature sequence026 147 1157 gene locus_tag LOCUS_06130 147 1157 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878988.1 protein_id gnl|my_center|LOCUS_06130 1173 1487 gene locus_tag LOCUS_06140 gene rpl12p 1173 1487 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878989.1 protein_id gnl|my_center|LOCUS_06140 1900 1484 gene locus_tag LOCUS_06150 1900 1484 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878992.1 protein_id gnl|my_center|LOCUS_06150 1943 2407 gene locus_tag LOCUS_06160 1943 2407 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879695.1 protein_id gnl|my_center|LOCUS_06160 2561 2382 gene locus_tag LOCUS_06170 2561 2382 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878831.1 protein_id gnl|my_center|LOCUS_06170 2839 2558 gene locus_tag LOCUS_06180 2839 2558 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878830.1 protein_id gnl|my_center|LOCUS_06180 4152 2845 gene locus_tag LOCUS_06190 gene thiC 4152 2845 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879899.1 protein_id gnl|my_center|LOCUS_06190 4261 4345 gene locus_tag LOCUS_t00170 4261 4345 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4371 5651 gene locus_tag LOCUS_06200 4371 5651 CDS product bifunctional hexulose-6-phosphate synthase/ribonuclease regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878362.1 protein_id gnl|my_center|LOCUS_06200 5670 6674 gene locus_tag LOCUS_06210 gene priS 5670 6674 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064280.1 protein_id gnl|my_center|LOCUS_06210 6664 7179 gene locus_tag LOCUS_06220 6664 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878829.1 protein_id gnl|my_center|LOCUS_06220 7253 7179 gene locus_tag LOCUS_t00180 7253 7179 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 7712 7305 gene locus_tag LOCUS_06230 7712 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 8610 7723 gene locus_tag LOCUS_06240 8610 7723 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877636.1 protein_id gnl|my_center|LOCUS_06240 8740 9603 gene locus_tag LOCUS_06250 8740 9603 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250984.1 protein_id gnl|my_center|LOCUS_06250 10294 9605 gene locus_tag LOCUS_06260 10294 9605 CDS product DUF1624 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878031.1 protein_id gnl|my_center|LOCUS_06260 11373 10291 gene locus_tag LOCUS_06270 gene ftsZ 11373 10291 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064630.1 protein_id gnl|my_center|LOCUS_06270 11466 11900 gene locus_tag LOCUS_06280 11466 11900 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878522.1 protein_id gnl|my_center|LOCUS_06280 11897 12175 gene locus_tag LOCUS_06290 11897 12175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 12121 13041 gene locus_tag LOCUS_06300 12121 13041 CDS product bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877588.1 protein_id gnl|my_center|LOCUS_06300 <13939 13032 gene locus_tag LOCUS_06310 <13939 13032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879003.1:aspartate-semialdehyde dehydrogenase >Feature sequence027 491 1417 gene locus_tag LOCUS_06320 491 1417 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878281.1 protein_id gnl|my_center|LOCUS_06320 1392 2066 gene locus_tag LOCUS_06330 1392 2066 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320172.1 protein_id gnl|my_center|LOCUS_06330 2701 2051 gene locus_tag LOCUS_06340 2701 2051 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_06340 2766 3515 gene locus_tag LOCUS_06350 2766 3515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 3558 5393 gene locus_tag LOCUS_06360 3558 5393 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319085.1 protein_id gnl|my_center|LOCUS_06360 6070 5390 gene locus_tag LOCUS_06370 6070 5390 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064504.1 protein_id gnl|my_center|LOCUS_06370 6375 6067 gene locus_tag LOCUS_06380 gene cutA 6375 6067 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879470.1 protein_id gnl|my_center|LOCUS_06380 6799 6407 gene locus_tag LOCUS_06390 6799 6407 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878487.1 protein_id gnl|my_center|LOCUS_06390 6878 8149 gene locus_tag LOCUS_06400 gene tuf 6878 8149 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878437.1 protein_id gnl|my_center|LOCUS_06400 8175 8495 gene locus_tag LOCUS_06410 gene rpsJ 8175 8495 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878438.1 protein_id gnl|my_center|LOCUS_06410 8500 9417 gene locus_tag LOCUS_06420 gene rnz 8500 9417 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878439.1 protein_id gnl|my_center|LOCUS_06420 10121 9414 gene locus_tag LOCUS_06430 10121 9414 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546217.1 protein_id gnl|my_center|LOCUS_06430 10875 10123 gene locus_tag LOCUS_06440 10875 10123 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095657.1 protein_id gnl|my_center|LOCUS_06440 12293 10872 gene locus_tag LOCUS_06450 12293 10872 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878888.1 protein_id gnl|my_center|LOCUS_06450 12391 13305 gene locus_tag LOCUS_06460 12391 13305 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence028 1523 606 gene locus_tag LOCUS_06470 1523 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1725 1528 gene locus_tag LOCUS_06480 1725 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2522 1722 gene locus_tag LOCUS_06490 2522 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 2901 2512 gene locus_tag LOCUS_06500 2901 2512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 3775 2894 gene locus_tag LOCUS_06510 3775 2894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 4089 3772 gene locus_tag LOCUS_06520 4089 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 4436 4086 gene locus_tag LOCUS_06530 4436 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 5611 4433 gene locus_tag LOCUS_06540 5611 4433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06540 6351 5614 gene locus_tag LOCUS_06550 6351 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 6511 6353 gene locus_tag LOCUS_06560 6511 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 7106 6519 gene locus_tag LOCUS_06570 7106 6519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 8161 7112 gene locus_tag LOCUS_06580 8161 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 8448 8236 gene locus_tag LOCUS_06590 8448 8236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 9107 8445 gene locus_tag LOCUS_06600 9107 8445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 10035 9400 gene locus_tag LOCUS_06610 10035 9400 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878499.1 protein_id gnl|my_center|LOCUS_06610 10189 11418 gene locus_tag LOCUS_06620 10189 11418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 11415 11633 gene locus_tag LOCUS_06630 11415 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11998 11906 gene locus_tag LOCUS_t00190 11998 11906 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 12578 12039 gene locus_tag LOCUS_06640 12578 12039 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879493.1 protein_id gnl|my_center|LOCUS_06640 12597 13280 gene locus_tag LOCUS_06650 12597 13280 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878652.1 protein_id gnl|my_center|LOCUS_06650 >Feature sequence029 429 1166 gene locus_tag LOCUS_06660 429 1166 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879644.1 protein_id gnl|my_center|LOCUS_06660 2284 1163 gene locus_tag LOCUS_06670 2284 1163 CDS product asparagine synthetase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878936.1 protein_id gnl|my_center|LOCUS_06670 2394 3095 gene locus_tag LOCUS_06680 gene rsmA 2394 3095 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879279.1 protein_id gnl|my_center|LOCUS_06680 3076 3546 gene locus_tag LOCUS_06690 3076 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3488 3736 gene locus_tag LOCUS_06700 3488 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 3708 4274 gene locus_tag LOCUS_06710 3708 4274 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879280.1 protein_id gnl|my_center|LOCUS_06710 4297 5307 gene locus_tag LOCUS_06720 4297 5307 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146465.1 protein_id gnl|my_center|LOCUS_06720 5952 5323 gene locus_tag LOCUS_06730 5952 5323 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879673.1 protein_id gnl|my_center|LOCUS_06730 6542 5949 gene locus_tag LOCUS_06740 6542 5949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 7146 6514 gene locus_tag LOCUS_06750 7146 6514 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878484.1 protein_id gnl|my_center|LOCUS_06750 7496 7143 gene locus_tag LOCUS_06760 7496 7143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 8202 7582 gene locus_tag LOCUS_06770 gene ccsA 8202 7582 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228656.1 protein_id gnl|my_center|LOCUS_06770 9998 8199 gene locus_tag LOCUS_06780 9998 8199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 10049 10378 gene locus_tag LOCUS_06790 10049 10378 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274453.1 protein_id gnl|my_center|LOCUS_06790 10614 10375 gene locus_tag LOCUS_06800 10614 10375 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496763.1 protein_id gnl|my_center|LOCUS_06800 10914 10651 gene locus_tag LOCUS_06810 10914 10651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 12087 10915 gene locus_tag LOCUS_06820 12087 10915 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064402.1 protein_id gnl|my_center|LOCUS_06820 12430 12098 gene locus_tag LOCUS_06830 12430 12098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 12795 12427 gene locus_tag LOCUS_06840 12795 12427 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868764.1 protein_id gnl|my_center|LOCUS_06840 12967 12806 gene locus_tag LOCUS_06850 12967 12806 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249479.1 protein_id gnl|my_center|LOCUS_06850 13212 12964 gene locus_tag LOCUS_06860 13212 12964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 >Feature sequence030 <1 1521 gene locus_tag LOCUS_06870 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878455.1:tetratricopeptide repeat protein 1558 4629 gene locus_tag LOCUS_06880 1558 4629 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867823.1 protein_id gnl|my_center|LOCUS_06880 5593 4610 gene locus_tag LOCUS_06890 5593 4610 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878029.1 protein_id gnl|my_center|LOCUS_06890 5667 6119 gene locus_tag LOCUS_06900 5667 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 6190 8628 gene locus_tag LOCUS_06910 gene mutS 6190 8628 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583439.1 protein_id gnl|my_center|LOCUS_06910 8607 9098 gene locus_tag LOCUS_06920 8607 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 9598 9407 gene locus_tag LOCUS_06930 9598 9407 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227795.1 protein_id gnl|my_center|LOCUS_06930 9676 10857 gene locus_tag LOCUS_06940 9676 10857 CDS product bifunctional 5,6,7,8-tetrahydromethanopterin hydro-lyase/3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878802.1 protein_id gnl|my_center|LOCUS_06940 11281 10865 gene locus_tag LOCUS_06950 11281 10865 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064560.1 protein_id gnl|my_center|LOCUS_06950 11921 11286 gene locus_tag LOCUS_06960 11921 11286 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879188.1 protein_id gnl|my_center|LOCUS_06960 12378 11899 gene locus_tag LOCUS_06970 12378 11899 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878928.1 protein_id gnl|my_center|LOCUS_06970 12895 12371 gene locus_tag LOCUS_06980 12895 12371 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064391.1 protein_id gnl|my_center|LOCUS_06980 12984 12911 gene locus_tag LOCUS_t00200 12984 12911 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence031 311 802 gene locus_tag LOCUS_06990 311 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879514.1 protein_id gnl|my_center|LOCUS_06990 2023 803 gene locus_tag LOCUS_07000 gene pan 2023 803 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_07000 2106 2558 gene locus_tag LOCUS_07010 2106 2558 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064503.1 protein_id gnl|my_center|LOCUS_07010 3246 2536 gene locus_tag LOCUS_07020 3246 2536 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013682933.1 protein_id gnl|my_center|LOCUS_07020 3653 3243 gene locus_tag LOCUS_07030 3653 3243 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_07030 4294 3692 gene locus_tag LOCUS_07040 4294 3692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 5589 4291 gene locus_tag LOCUS_07050 5589 4291 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 protein_id gnl|my_center|LOCUS_07050 6891 5650 gene locus_tag LOCUS_07060 6891 5650 CDS product TIGR00300 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871002.1 protein_id gnl|my_center|LOCUS_07060 7520 6909 gene locus_tag LOCUS_07070 7520 6909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 8590 7517 gene locus_tag LOCUS_07080 gene mqnC 8590 7517 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877897.1 protein_id gnl|my_center|LOCUS_07080 9167 8571 gene locus_tag LOCUS_07090 9167 8571 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878286.1 protein_id gnl|my_center|LOCUS_07090 9535 9164 gene locus_tag LOCUS_07100 gene sepF 9535 9164 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 protein_id gnl|my_center|LOCUS_07100 10129 9566 gene locus_tag LOCUS_07110 10129 9566 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878709.1 protein_id gnl|my_center|LOCUS_07110 11301 10126 gene locus_tag LOCUS_07120 11301 10126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 12466 11312 gene locus_tag LOCUS_07130 12466 11312 CDS product tubulin/FtsZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064350.1 protein_id gnl|my_center|LOCUS_07130 12513 12881 gene locus_tag LOCUS_07140 12513 12881 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877543.1 protein_id gnl|my_center|LOCUS_07140 >Feature sequence032 636 379 gene locus_tag LOCUS_07150 636 379 CDS product septation protein SpoVG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879274.1 protein_id gnl|my_center|LOCUS_07150 1556 681 gene locus_tag LOCUS_07160 gene mvk 1556 681 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879778.1 protein_id gnl|my_center|LOCUS_07160 2936 1641 gene locus_tag LOCUS_07170 gene aspS 2936 1641 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878420.1 protein_id gnl|my_center|LOCUS_07170 4199 2964 gene locus_tag LOCUS_07180 gene hisD 4199 2964 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877723.1 protein_id gnl|my_center|LOCUS_07180 4248 4323 gene locus_tag LOCUS_t00210 4248 4323 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4346 5215 gene locus_tag LOCUS_07190 4346 5215 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879765.1 protein_id gnl|my_center|LOCUS_07190 5252 5476 gene locus_tag LOCUS_07200 5252 5476 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_07200 5483 5662 gene locus_tag LOCUS_07210 5483 5662 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878375.1 protein_id gnl|my_center|LOCUS_07210 5663 7048 gene locus_tag LOCUS_07220 gene purF 5663 7048 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878374.1 protein_id gnl|my_center|LOCUS_07220 7053 7532 gene locus_tag LOCUS_07230 7053 7532 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878133.1 protein_id gnl|my_center|LOCUS_07230 7526 8434 gene locus_tag LOCUS_07240 gene mch 7526 8434 CDS product methenyltetrahydromethanopterin cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879428.1 protein_id gnl|my_center|LOCUS_07240 8431 9315 gene locus_tag LOCUS_07250 8431 9315 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_07250 9284 10072 gene locus_tag LOCUS_07260 9284 10072 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868227.1 protein_id gnl|my_center|LOCUS_07260 10146 10072 gene locus_tag LOCUS_t00220 10146 10072 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 10688 10176 gene locus_tag LOCUS_07270 10688 10176 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878254.1 protein_id gnl|my_center|LOCUS_07270 10741 10816 gene locus_tag LOCUS_t00230 10741 10816 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 11109 10816 gene locus_tag LOCUS_07280 11109 10816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879820.1 protein_id gnl|my_center|LOCUS_07280 <12886 11122 gene locus_tag LOCUS_07290 <12886 11122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879387.1:elongation factor EF-2 >Feature sequence033 555 1412 gene locus_tag LOCUS_07300 555 1412 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879048.1 protein_id gnl|my_center|LOCUS_07300 2515 1409 gene locus_tag LOCUS_07310 gene trm14 2515 1409 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869937.1 protein_id gnl|my_center|LOCUS_07310 2572 2805 gene locus_tag LOCUS_07320 2572 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2829 3392 gene locus_tag LOCUS_07330 2829 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3392 5035 gene locus_tag LOCUS_07340 gene ilvD 3392 5035 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878514.1 protein_id gnl|my_center|LOCUS_07340 5017 5979 gene locus_tag LOCUS_07350 5017 5979 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064460.1 protein_id gnl|my_center|LOCUS_07350 6648 5959 gene locus_tag LOCUS_07360 6648 5959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 7828 6671 gene locus_tag LOCUS_07370 gene serB 7828 6671 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064533.1 protein_id gnl|my_center|LOCUS_07370 7904 8029 gene locus_tag LOCUS_07380 7904 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 8550 8026 gene locus_tag LOCUS_07390 gene rplJ 8550 8026 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_07390 8651 10153 gene locus_tag LOCUS_07400 8651 10153 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_07400 10670 10146 gene locus_tag LOCUS_07410 10670 10146 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879241.1 protein_id gnl|my_center|LOCUS_07410 11520 10861 gene locus_tag LOCUS_07420 11520 10861 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878772.1 protein_id gnl|my_center|LOCUS_07420 11681 12799 gene locus_tag LOCUS_07430 11681 12799 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879245.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence034 964 425 gene locus_tag LOCUS_07440 964 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 1346 996 gene locus_tag LOCUS_07450 1346 996 CDS product CGGC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870086.1 protein_id gnl|my_center|LOCUS_07450 1438 2037 gene locus_tag LOCUS_07460 gene rpsB 1438 2037 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878629.1 protein_id gnl|my_center|LOCUS_07460 2037 2378 gene locus_tag LOCUS_07470 2037 2378 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877793.1 protein_id gnl|my_center|LOCUS_07470 2375 3115 gene locus_tag LOCUS_07480 2375 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 3194 3799 gene locus_tag LOCUS_07490 3194 3799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 3827 5581 gene locus_tag LOCUS_07500 3827 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 5641 6435 gene locus_tag LOCUS_07510 5641 6435 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877622.1 protein_id gnl|my_center|LOCUS_07510 7862 6432 gene locus_tag LOCUS_07520 7862 6432 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_07520 8556 7894 gene locus_tag LOCUS_07530 8556 7894 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877951.1 protein_id gnl|my_center|LOCUS_07530 8609 9259 gene locus_tag LOCUS_07540 8609 9259 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879579.1 protein_id gnl|my_center|LOCUS_07540 9368 10024 gene locus_tag LOCUS_07550 9368 10024 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270482.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence035 833 276 gene locus_tag LOCUS_07560 833 276 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_07560 906 2147 gene locus_tag LOCUS_07570 906 2147 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878531.1 protein_id gnl|my_center|LOCUS_07570 2151 4775 gene locus_tag LOCUS_07580 gene rad50 2151 4775 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878532.1 protein_id gnl|my_center|LOCUS_07580 4735 5832 gene locus_tag LOCUS_07590 4735 5832 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878533.1 protein_id gnl|my_center|LOCUS_07590 6669 5812 gene locus_tag LOCUS_07600 6669 5812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879515.1 protein_id gnl|my_center|LOCUS_07600 6896 6636 gene locus_tag LOCUS_07610 gene eif1A 6896 6636 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064286.1 protein_id gnl|my_center|LOCUS_07610 8116 6908 gene locus_tag LOCUS_07620 8116 6908 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867958.1 protein_id gnl|my_center|LOCUS_07620 9138 8158 gene locus_tag LOCUS_07630 9138 8158 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878279.1 protein_id gnl|my_center|LOCUS_07630 9770 9195 gene locus_tag LOCUS_07640 9770 9195 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879808.1 protein_id gnl|my_center|LOCUS_07640 <12683 9956 gene locus_tag LOCUS_07650 <12683 9956 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:PKD domain-containing protein >Feature sequence036 578 276 gene locus_tag LOCUS_07660 578 276 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878661.1 protein_id gnl|my_center|LOCUS_07660 1597 575 gene locus_tag LOCUS_07670 1597 575 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319644.1 protein_id gnl|my_center|LOCUS_07670 2166 1603 gene locus_tag LOCUS_07680 2166 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 2434 2189 gene locus_tag LOCUS_07690 2434 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 4542 2449 gene locus_tag LOCUS_07700 4542 2449 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878656.1 protein_id gnl|my_center|LOCUS_07700 4864 4529 gene locus_tag LOCUS_07710 gene ahaH 4864 4529 CDS product ATP synthase archaeal subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591748.1 protein_id gnl|my_center|LOCUS_07710 5029 5940 gene locus_tag LOCUS_07720 5029 5940 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096256.1 protein_id gnl|my_center|LOCUS_07720 6111 7469 gene locus_tag LOCUS_07730 6111 7469 CDS product putative sulfate exporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462139.1 protein_id gnl|my_center|LOCUS_07730 7493 8374 gene locus_tag LOCUS_07740 7493 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 8383 9684 gene locus_tag LOCUS_07750 gene rbcL 8383 9684 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879134.1 protein_id gnl|my_center|LOCUS_07750 10622 9681 gene locus_tag LOCUS_07760 10622 9681 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879112.1 protein_id gnl|my_center|LOCUS_07760 11836 10619 gene locus_tag LOCUS_07770 11836 10619 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879739.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence037 <1 835 gene locus_tag LOCUS_07780 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761986.1:magnesium chelatase subunit H 840 2684 gene locus_tag LOCUS_07790 840 2684 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761987.1 protein_id gnl|my_center|LOCUS_07790 2722 3534 gene locus_tag LOCUS_07800 2722 3534 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878034.1 protein_id gnl|my_center|LOCUS_07800 3539 4486 gene locus_tag LOCUS_07810 3539 4486 CDS product methylcobamide--CoM methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584103.1 protein_id gnl|my_center|LOCUS_07810 4483 5445 gene locus_tag LOCUS_07820 4483 5445 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250397.1 protein_id gnl|my_center|LOCUS_07820 5442 6017 gene locus_tag LOCUS_07830 5442 6017 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878293.1 protein_id gnl|my_center|LOCUS_07830 6044 6388 gene locus_tag LOCUS_07840 6044 6388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 6390 9776 gene locus_tag LOCUS_07850 gene smc 6390 9776 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879055.1 protein_id gnl|my_center|LOCUS_07850 9773 10372 gene locus_tag LOCUS_07860 9773 10372 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879056.1 protein_id gnl|my_center|LOCUS_07860 10369 10854 gene locus_tag LOCUS_07870 gene scpB 10369 10854 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879077.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence038 122 361 gene locus_tag LOCUS_07880 122 361 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_07880 536 1483 gene locus_tag LOCUS_07890 536 1483 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879092.1 protein_id gnl|my_center|LOCUS_07890 1585 2247 gene locus_tag LOCUS_07900 gene flaB3 1585 2247 CDS product flagellin B3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248995.1 protein_id gnl|my_center|LOCUS_07900 2312 2719 gene locus_tag LOCUS_07910 2312 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2725 3402 gene locus_tag LOCUS_07920 2725 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 3469 3810 gene locus_tag LOCUS_07930 3469 3810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3811 4239 gene locus_tag LOCUS_07940 3811 4239 CDS product flagellar protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249001.1 protein_id gnl|my_center|LOCUS_07940 4243 4932 gene locus_tag LOCUS_07950 4243 4932 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496652.1 protein_id gnl|my_center|LOCUS_07950 4929 6563 gene locus_tag LOCUS_07960 4929 6563 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249003.1 protein_id gnl|my_center|LOCUS_07960 6572 8206 gene locus_tag LOCUS_07970 gene flaJ 6572 8206 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496654.1 protein_id gnl|my_center|LOCUS_07970 8265 8594 gene locus_tag LOCUS_07980 8265 8594 CDS product archaellum operon transcriptional activator EarA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248991.1 protein_id gnl|my_center|LOCUS_07980 8581 9450 gene locus_tag LOCUS_07990 8581 9450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 9579 10904 gene locus_tag LOCUS_08000 9579 10904 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004068250.1 protein_id gnl|my_center|LOCUS_08000 10897 11190 gene locus_tag LOCUS_08010 10897 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 >Feature sequence039 2404 212 gene locus_tag LOCUS_08020 gene katG 2404 212 CDS product catalase/peroxidase HPI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966622.1 protein_id gnl|my_center|LOCUS_08020 2519 2914 gene locus_tag LOCUS_08030 2519 2914 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879721.1 protein_id gnl|my_center|LOCUS_08030 2983 3095 gene locus_tag LOCUS_r00010 2983 3095 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 3164 4024 gene locus_tag LOCUS_08040 3164 4024 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879523.1 protein_id gnl|my_center|LOCUS_08040 4058 5017 gene locus_tag LOCUS_08050 4058 5017 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879169.1 protein_id gnl|my_center|LOCUS_08050 5014 5379 gene locus_tag LOCUS_08060 5014 5379 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023990.1 protein_id gnl|my_center|LOCUS_08060 5812 5351 gene locus_tag LOCUS_08070 gene pyrI 5812 5351 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877621.1 protein_id gnl|my_center|LOCUS_08070 6705 5809 gene locus_tag LOCUS_08080 gene pyrB 6705 5809 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064165.1 protein_id gnl|my_center|LOCUS_08080 6783 7868 gene locus_tag LOCUS_08090 6783 7868 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879550.1 protein_id gnl|my_center|LOCUS_08090 7825 8418 gene locus_tag LOCUS_08100 7825 8418 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878689.1 protein_id gnl|my_center|LOCUS_08100 9541 8381 gene locus_tag LOCUS_08110 9541 8381 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877916.1 protein_id gnl|my_center|LOCUS_08110 10701 9574 gene locus_tag LOCUS_08120 10701 9574 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878837.1 protein_id gnl|my_center|LOCUS_08120 <11558 10703 gene locus_tag LOCUS_08130 <11558 10703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878838.1:AMP phosphorylase >Feature sequence040 1910 390 gene locus_tag LOCUS_08140 1910 390 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878453.1 protein_id gnl|my_center|LOCUS_08140 2962 1907 gene locus_tag LOCUS_08150 2962 1907 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878452.1 protein_id gnl|my_center|LOCUS_08150 3112 3038 gene locus_tag LOCUS_t00240 3112 3038 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 4773 3133 gene locus_tag LOCUS_08160 4773 3133 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877754.1 protein_id gnl|my_center|LOCUS_08160 4812 5345 gene locus_tag LOCUS_08170 4812 5345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 5667 5233 gene locus_tag LOCUS_08180 5667 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012940349.1 protein_id gnl|my_center|LOCUS_08180 5935 5669 gene locus_tag LOCUS_08190 5935 5669 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878078.1 protein_id gnl|my_center|LOCUS_08190 6211 6137 gene locus_tag LOCUS_t00250 6211 6137 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 6279 6950 gene locus_tag LOCUS_08200 gene pyrH 6279 6950 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879534.1 protein_id gnl|my_center|LOCUS_08200 6963 7541 gene locus_tag LOCUS_08210 6963 7541 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879543.1 protein_id gnl|my_center|LOCUS_08210 8356 7538 gene locus_tag LOCUS_08220 8356 7538 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879758.1 protein_id gnl|my_center|LOCUS_08220 8409 9068 gene locus_tag LOCUS_08230 8409 9068 CDS product DUF5612 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878900.1 protein_id gnl|my_center|LOCUS_08230 9103 9696 gene locus_tag LOCUS_08240 9103 9696 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021463.1 protein_id gnl|my_center|LOCUS_08240 9972 9691 gene locus_tag LOCUS_08250 9972 9691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 10556 10011 gene locus_tag LOCUS_08260 10556 10011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 <11487 10717 gene locus_tag LOCUS_08270 <11487 10717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877746.1:zinc metalloprotease HtpX >Feature sequence041 882 421 gene locus_tag LOCUS_08280 882 421 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319908.1 protein_id gnl|my_center|LOCUS_08280 1994 930 gene locus_tag LOCUS_08290 1994 930 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064535.1 protein_id gnl|my_center|LOCUS_08290 2048 2803 gene locus_tag LOCUS_08300 gene dph5 2048 2803 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877888.1 protein_id gnl|my_center|LOCUS_08300 2835 3011 gene locus_tag LOCUS_08310 2835 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 3008 3391 gene locus_tag LOCUS_08320 3008 3391 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208718.1 protein_id gnl|my_center|LOCUS_08320 3959 3351 gene locus_tag LOCUS_08330 3959 3351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683780.1 protein_id gnl|my_center|LOCUS_08330 3984 6686 gene locus_tag LOCUS_08340 gene alaS 3984 6686 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879744.1 protein_id gnl|my_center|LOCUS_08340 6741 7145 gene locus_tag LOCUS_08350 6741 7145 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877590.1 protein_id gnl|my_center|LOCUS_08350 7142 8860 gene locus_tag LOCUS_08360 7142 8860 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877591.1 protein_id gnl|my_center|LOCUS_08360 9818 8853 gene locus_tag LOCUS_08370 9818 8853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270489.1 protein_id gnl|my_center|LOCUS_08370 9867 9998 gene locus_tag LOCUS_08380 9867 9998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 9995 11323 gene locus_tag LOCUS_08390 9995 11323 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590803.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence042 829 77 gene locus_tag LOCUS_08400 gene trpA 829 77 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867582.1 protein_id gnl|my_center|LOCUS_08400 1992 826 gene locus_tag LOCUS_08410 gene trpB 1992 826 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867583.1 protein_id gnl|my_center|LOCUS_08410 2363 1989 gene locus_tag LOCUS_08420 2363 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 2976 2344 gene locus_tag LOCUS_08430 2976 2344 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867584.1 protein_id gnl|my_center|LOCUS_08430 3547 2978 gene locus_tag LOCUS_08440 3547 2978 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867585.1 protein_id gnl|my_center|LOCUS_08440 4569 3544 gene locus_tag LOCUS_08450 4569 3544 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867586.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08450 5788 4814 gene locus_tag LOCUS_08460 gene trpD 5788 4814 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867587.1 protein_id gnl|my_center|LOCUS_08460 6461 5781 gene locus_tag LOCUS_08470 gene trpC 6461 5781 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053642.1 protein_id gnl|my_center|LOCUS_08470 8234 6531 gene locus_tag LOCUS_08480 gene glyS 8234 6531 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096515.1 protein_id gnl|my_center|LOCUS_08480 8838 8431 gene locus_tag LOCUS_08490 8838 8431 CDS product DUF2127 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877595.1 protein_id gnl|my_center|LOCUS_08490 9144 8854 gene locus_tag LOCUS_08500 9144 8854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 9743 9147 gene locus_tag LOCUS_08510 9743 9147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 9812 10318 gene locus_tag LOCUS_08520 9812 10318 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878317.1 protein_id gnl|my_center|LOCUS_08520 10426 11025 gene locus_tag LOCUS_08530 10426 11025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence043 <1 909 gene locus_tag LOCUS_08540 <1 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878159.1:TldD/PmbA family protein 2141 1209 gene locus_tag LOCUS_08550 2141 1209 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877868.1 protein_id gnl|my_center|LOCUS_08550 2234 2461 gene locus_tag LOCUS_08560 2234 2461 CDS product Like-Sm ribonucleoprotein core inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094490.1 protein_id gnl|my_center|LOCUS_08560 2499 2876 gene locus_tag LOCUS_08570 2499 2876 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877870.1 protein_id gnl|my_center|LOCUS_08570 2911 3999 gene locus_tag LOCUS_08580 2911 3999 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879038.1 protein_id gnl|my_center|LOCUS_08580 4812 3979 gene locus_tag LOCUS_08590 4812 3979 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274369.1 protein_id gnl|my_center|LOCUS_08590 4883 5500 gene locus_tag LOCUS_08600 4883 5500 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879199.1 protein_id gnl|my_center|LOCUS_08600 7649 5487 gene locus_tag LOCUS_08610 gene hdrA2 7649 5487 CDS product CoB-CoM heterodisulfide reductase HdrA2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878733.1 protein_id gnl|my_center|LOCUS_08610 7740 8474 gene locus_tag LOCUS_08620 7740 8474 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878035.1 protein_id gnl|my_center|LOCUS_08620 10007 8424 gene locus_tag LOCUS_08630 gene pyrG 10007 8424 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877763.1 protein_id gnl|my_center|LOCUS_08630 10191 10012 gene locus_tag LOCUS_08640 10191 10012 CDS product methytransferase partner Trm112 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064196.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence044 132 773 gene locus_tag LOCUS_08650 132 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 963 4226 gene locus_tag LOCUS_08660 963 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 4480 4800 gene locus_tag LOCUS_08670 4480 4800 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877726.1 protein_id gnl|my_center|LOCUS_08670 4797 5537 gene locus_tag LOCUS_08680 4797 5537 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877727.1 protein_id gnl|my_center|LOCUS_08680 5558 6283 gene locus_tag LOCUS_08690 5558 6283 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878498.1 protein_id gnl|my_center|LOCUS_08690 7113 6280 gene locus_tag LOCUS_08700 7113 6280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7159 7650 gene locus_tag LOCUS_08710 gene cyaB 7159 7650 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 protein_id gnl|my_center|LOCUS_08710 7671 8774 gene locus_tag LOCUS_08720 7671 8774 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762578.1 protein_id gnl|my_center|LOCUS_08720 9735 8767 gene locus_tag LOCUS_08730 9735 8767 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879606.1 protein_id gnl|my_center|LOCUS_08730 10727 9732 gene locus_tag LOCUS_08740 10727 9732 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877749.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence045 300 109 gene locus_tag LOCUS_08750 300 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08750 634 314 gene locus_tag LOCUS_08760 634 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08760 1117 710 gene locus_tag LOCUS_08770 1117 710 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254061.1 protein_id gnl|my_center|LOCUS_08770 1319 1098 gene locus_tag LOCUS_08780 1319 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878112.1 protein_id gnl|my_center|LOCUS_08780 2821 1391 gene locus_tag LOCUS_08790 2821 1391 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878099.1 protein_id gnl|my_center|LOCUS_08790 2931 3161 gene locus_tag LOCUS_08800 gene rpl37A 2931 3161 CDS product 50S ribosomal protein L37Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877571.1 protein_id gnl|my_center|LOCUS_08800 3166 3303 gene locus_tag LOCUS_08810 3166 3303 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877570.1 protein_id gnl|my_center|LOCUS_08810 3313 3741 gene locus_tag LOCUS_08820 gene ribH 3313 3741 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879619.1 protein_id gnl|my_center|LOCUS_08820 3725 4846 gene locus_tag LOCUS_08830 3725 4846 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879620.1 protein_id gnl|my_center|LOCUS_08830 4976 5605 gene locus_tag LOCUS_08840 4976 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878651.1 protein_id gnl|my_center|LOCUS_08840 6223 5585 gene locus_tag LOCUS_08850 6223 5585 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879602.1 protein_id gnl|my_center|LOCUS_08850 6281 7099 gene locus_tag LOCUS_08860 6281 7099 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878595.1 protein_id gnl|my_center|LOCUS_08860 7104 7670 gene locus_tag LOCUS_08870 7104 7670 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064673.1 protein_id gnl|my_center|LOCUS_08870 8453 7890 gene locus_tag LOCUS_08880 8453 7890 CDS product [protein ADP-ribosylglutamate] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250841.1 protein_id gnl|my_center|LOCUS_08880 8499 9002 gene locus_tag LOCUS_08890 8499 9002 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146602.1 protein_id gnl|my_center|LOCUS_08890 9014 10951 gene locus_tag LOCUS_08900 9014 10951 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877725.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence046 2328 1759 gene locus_tag LOCUS_08910 2328 1759 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871101.1 protein_id gnl|my_center|LOCUS_08910 2499 4058 gene locus_tag LOCUS_08920 2499 4058 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064281.1 protein_id gnl|my_center|LOCUS_08920 4061 5215 gene locus_tag LOCUS_08930 4061 5215 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094870.1 protein_id gnl|my_center|LOCUS_08930 5269 6438 gene locus_tag LOCUS_08940 gene mpgS 5269 6438 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 protein_id gnl|my_center|LOCUS_08940 6426 7214 gene locus_tag LOCUS_08950 gene mpgP 6426 7214 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_08950 7219 9798 gene locus_tag LOCUS_08960 7219 9798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence047 318 614 gene locus_tag LOCUS_08970 318 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 535 1581 gene locus_tag LOCUS_08980 535 1581 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250852.1 protein_id gnl|my_center|LOCUS_08980 2251 1745 gene locus_tag LOCUS_08990 2251 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2996 2241 gene locus_tag LOCUS_09000 2996 2241 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_09000 4301 3276 gene locus_tag LOCUS_09010 gene csm5 4301 3276 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_09010 5163 4291 gene locus_tag LOCUS_09020 gene csm4 5163 4291 CDS product type III-A CRISPR-associated RAMP protein Csm4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021930.1 protein_id gnl|my_center|LOCUS_09020 5966 5166 gene locus_tag LOCUS_09030 gene csm3 5966 5166 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545354.1 protein_id gnl|my_center|LOCUS_09030 6516 5968 gene locus_tag LOCUS_09040 6516 5968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 8938 6521 gene locus_tag LOCUS_09050 8938 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 9608 8943 gene locus_tag LOCUS_09060 9608 8943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence048 539 1297 gene locus_tag LOCUS_09070 539 1297 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879698.1 protein_id gnl|my_center|LOCUS_09070 1328 1555 gene locus_tag LOCUS_09080 1328 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1548 1850 gene locus_tag LOCUS_09090 1548 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2133 4004 gene locus_tag LOCUS_09100 gene gyrB 2133 4004 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_09100 4551 3985 gene locus_tag LOCUS_09110 4551 3985 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_09110 5117 4551 gene locus_tag LOCUS_09120 5117 4551 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879239.1 protein_id gnl|my_center|LOCUS_09120 5945 5145 gene locus_tag LOCUS_09130 5945 5145 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879142.1 protein_id gnl|my_center|LOCUS_09130 6460 5924 gene locus_tag LOCUS_09140 6460 5924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 7722 6580 gene locus_tag LOCUS_09150 gene coaBC 7722 6580 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274444.1 protein_id gnl|my_center|LOCUS_09150 8108 7719 gene locus_tag LOCUS_09160 8108 7719 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870381.1 protein_id gnl|my_center|LOCUS_09160 9009 8149 gene locus_tag LOCUS_09170 9009 8149 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878248.1 protein_id gnl|my_center|LOCUS_09170 9098 10447 gene locus_tag LOCUS_09180 9098 10447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence049 975 238 gene locus_tag LOCUS_09190 975 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1733 972 gene locus_tag LOCUS_09200 1733 972 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879460.1 protein_id gnl|my_center|LOCUS_09200 1784 3142 gene locus_tag LOCUS_09210 gene cobB 1784 3142 CDS product hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320008.1 protein_id gnl|my_center|LOCUS_09210 3483 3139 gene locus_tag LOCUS_09220 3483 3139 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879717.1 protein_id gnl|my_center|LOCUS_09220 3696 4448 gene locus_tag LOCUS_09230 gene hmeA 3696 4448 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878006.1 protein_id gnl|my_center|LOCUS_09230 4460 5662 gene locus_tag LOCUS_09240 gene hmeB 4460 5662 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_09240 5655 6665 gene locus_tag LOCUS_09250 gene dsrM 5655 6665 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878008.1 protein_id gnl|my_center|LOCUS_09250 6676 8349 gene locus_tag LOCUS_09260 gene hmeD 6676 8349 CDS product Hdr-like menaquinol oxidoreductase iron-sulfur subunit HmeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878009.1 protein_id gnl|my_center|LOCUS_09260 8351 8743 gene locus_tag LOCUS_09270 gene hmeE 8351 8743 CDS product Hdr-like menaquinol oxidoreductase cytochrome c subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064247.1 protein_id gnl|my_center|LOCUS_09270 9466 8720 gene locus_tag LOCUS_09280 9466 8720 CDS product tRNA(His) guanylyltransferase Thg1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060935.1 protein_id gnl|my_center|LOCUS_09280 9686 9438 gene locus_tag LOCUS_09290 9686 9438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 >Feature sequence050 1498 338 gene locus_tag LOCUS_09300 1498 338 CDS product sodium:calcium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877762.1 protein_id gnl|my_center|LOCUS_09300 1589 2326 gene locus_tag LOCUS_09310 1589 2326 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545002.1 protein_id gnl|my_center|LOCUS_09310 2326 2970 gene locus_tag LOCUS_09320 2326 2970 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878728.1 protein_id gnl|my_center|LOCUS_09320 3017 4024 gene locus_tag LOCUS_09330 gene amrS 3017 4024 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878827.1 protein_id gnl|my_center|LOCUS_09330 4021 4605 gene locus_tag LOCUS_09340 gene trmY 4021 4605 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064324.1 protein_id gnl|my_center|LOCUS_09340 5138 4584 gene locus_tag LOCUS_09350 5138 4584 CDS product DUF2150 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878606.1 protein_id gnl|my_center|LOCUS_09350 6395 5175 gene locus_tag LOCUS_09360 gene ahcY 6395 5175 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879492.1 protein_id gnl|my_center|LOCUS_09360 6448 6843 gene locus_tag LOCUS_09370 6448 6843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 7492 6818 gene locus_tag LOCUS_09380 7492 6818 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877867.1 protein_id gnl|my_center|LOCUS_09380 7719 7489 gene locus_tag LOCUS_09390 7719 7489 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877866.1 protein_id gnl|my_center|LOCUS_09390 9074 7746 gene locus_tag LOCUS_09400 9074 7746 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879849.1 protein_id gnl|my_center|LOCUS_09400 9498 9076 gene locus_tag LOCUS_09410 9498 9076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 10186 9488 gene locus_tag LOCUS_09420 gene rlmB 10186 9488 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879886.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence051 960 325 gene locus_tag LOCUS_09430 gene npdG 960 325 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878392.1 protein_id gnl|my_center|LOCUS_09430 2106 1126 gene locus_tag LOCUS_09440 2106 1126 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878132.1 protein_id gnl|my_center|LOCUS_09440 2730 2152 gene locus_tag LOCUS_09450 2730 2152 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877617.1 protein_id gnl|my_center|LOCUS_09450 3035 2727 gene locus_tag LOCUS_09460 3035 2727 CDS product TIGR00304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879769.1 protein_id gnl|my_center|LOCUS_09460 3246 3037 gene locus_tag LOCUS_09470 3246 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3293 4537 gene locus_tag LOCUS_09480 3293 4537 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878430.1 protein_id gnl|my_center|LOCUS_09480 5807 4530 gene locus_tag LOCUS_09490 gene tiaS 5807 4530 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase TiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879748.1 protein_id gnl|my_center|LOCUS_09490 7057 5804 gene locus_tag LOCUS_09500 7057 5804 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064499.1 protein_id gnl|my_center|LOCUS_09500 7152 9611 gene locus_tag LOCUS_09510 7152 9611 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_09510 9616 10161 gene locus_tag LOCUS_09520 9616 10161 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879872.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence052 143 697 gene locus_tag LOCUS_09530 143 697 CDS product GMP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878817.1 protein_id gnl|my_center|LOCUS_09530 1217 678 gene locus_tag LOCUS_09540 1217 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877925.1 protein_id gnl|my_center|LOCUS_09540 1251 2510 gene locus_tag LOCUS_09550 gene lysA 1251 2510 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878303.1 protein_id gnl|my_center|LOCUS_09550 2507 3202 gene locus_tag LOCUS_09560 2507 3202 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878046.1 protein_id gnl|my_center|LOCUS_09560 3238 3723 gene locus_tag LOCUS_09570 3238 3723 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878644.1 protein_id gnl|my_center|LOCUS_09570 4638 3709 gene locus_tag LOCUS_09580 4638 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4751 4677 gene locus_tag LOCUS_t00260 4751 4677 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5206 4793 gene locus_tag LOCUS_09590 gene nikR 5206 4793 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878246.1 protein_id gnl|my_center|LOCUS_09590 9929 5244 gene locus_tag LOCUS_09600 9929 5244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence053 461 144 gene locus_tag LOCUS_09610 461 144 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879020.1 protein_id gnl|my_center|LOCUS_09610 2769 463 gene locus_tag LOCUS_09620 2769 463 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879019.1 protein_id gnl|my_center|LOCUS_09620 3592 2804 gene locus_tag LOCUS_09630 3592 2804 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064458.1 protein_id gnl|my_center|LOCUS_09630 3670 4788 gene locus_tag LOCUS_09640 3670 4788 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_09640 5373 4780 gene locus_tag LOCUS_09650 5373 4780 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978111.1 protein_id gnl|my_center|LOCUS_09650 5765 5370 gene locus_tag LOCUS_09660 5765 5370 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878788.1 protein_id gnl|my_center|LOCUS_09660 6951 5770 gene locus_tag LOCUS_09670 6951 5770 CDS product beta-ketoacyl synthase N-terminal-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878787.1 protein_id gnl|my_center|LOCUS_09670 7366 6992 gene locus_tag LOCUS_09680 7366 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 7956 7363 gene locus_tag LOCUS_09690 7956 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 8369 7953 gene locus_tag LOCUS_09700 8369 7953 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319975.1 protein_id gnl|my_center|LOCUS_09700 8486 8566 gene locus_tag LOCUS_t00270 8486 8566 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10030 8519 gene locus_tag LOCUS_09710 10030 8519 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879747.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence054 124 384 gene locus_tag LOCUS_09720 124 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879782.1 protein_id gnl|my_center|LOCUS_09720 1690 362 gene locus_tag LOCUS_09730 1690 362 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878676.1 protein_id gnl|my_center|LOCUS_09730 2574 1687 gene locus_tag LOCUS_09740 gene mptA 2574 1687 CDS product GTP cyclohydrolase MptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878675.1 protein_id gnl|my_center|LOCUS_09740 5975 2685 gene locus_tag LOCUS_09750 5975 2685 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053708.1 protein_id gnl|my_center|LOCUS_09750 6070 6831 gene locus_tag LOCUS_09760 6070 6831 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320550.1 protein_id gnl|my_center|LOCUS_09760 6819 7358 gene locus_tag LOCUS_09770 6819 7358 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879804.1 protein_id gnl|my_center|LOCUS_09770 7336 7803 gene locus_tag LOCUS_09780 7336 7803 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879803.1 protein_id gnl|my_center|LOCUS_09780 8935 7772 gene locus_tag LOCUS_09790 8935 7772 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879532.1 protein_id gnl|my_center|LOCUS_09790 8987 9916 gene locus_tag LOCUS_09800 8987 9916 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879283.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence055 2664 847 gene locus_tag LOCUS_09810 2664 847 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878896.1 protein_id gnl|my_center|LOCUS_09810 3521 2664 gene locus_tag LOCUS_09820 gene cbiB 3521 2664 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249814.1 protein_id gnl|my_center|LOCUS_09820 3567 4259 gene locus_tag LOCUS_09830 gene cobS 3567 4259 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867168.1 protein_id gnl|my_center|LOCUS_09830 4923 4264 gene locus_tag LOCUS_09840 4923 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5054 5209 gene locus_tag LOCUS_09850 5054 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 5271 5564 gene locus_tag LOCUS_09860 5271 5564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 5533 5718 gene locus_tag LOCUS_09870 5533 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 6323 6156 gene locus_tag LOCUS_09880 6323 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 6551 7105 gene locus_tag LOCUS_09890 6551 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 7581 7114 gene locus_tag LOCUS_09900 7581 7114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 8004 9641 gene locus_tag LOCUS_09910 gene gltX 8004 9641 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868499.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence056 <1 529 gene locus_tag LOCUS_09920 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879245.1:ammonium transporter 616 1806 gene locus_tag LOCUS_09930 616 1806 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878477.1 protein_id gnl|my_center|LOCUS_09930 1816 2145 gene locus_tag LOCUS_09940 1816 2145 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_09940 2168 2938 gene locus_tag LOCUS_09950 gene nadE 2168 2938 CDS product NAD(+) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878500.1 protein_id gnl|my_center|LOCUS_09950 3464 2919 gene locus_tag LOCUS_09960 3464 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 3555 4181 gene locus_tag LOCUS_09970 3555 4181 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066452.1 protein_id gnl|my_center|LOCUS_09970 4773 4159 gene locus_tag LOCUS_09980 4773 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 4880 5173 gene locus_tag LOCUS_09990 4880 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 5173 5691 gene locus_tag LOCUS_10000 5173 5691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 5737 8040 gene locus_tag LOCUS_10010 5737 8040 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081868573.1 protein_id gnl|my_center|LOCUS_10010 8878 8024 gene locus_tag LOCUS_10020 8878 8024 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879868.1 protein_id gnl|my_center|LOCUS_10020 9663 8875 gene locus_tag LOCUS_10030 9663 8875 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879867.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence057 <1 571 gene locus_tag LOCUS_10040 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878168.1:Kae1-associated kinase Bud32 1410 568 gene locus_tag LOCUS_10050 1410 568 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250758.1 protein_id gnl|my_center|LOCUS_10050 2056 1412 gene locus_tag LOCUS_10060 2056 1412 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879809.1 protein_id gnl|my_center|LOCUS_10060 3539 2178 gene locus_tag LOCUS_10070 gene serS 3539 2178 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879527.1 protein_id gnl|my_center|LOCUS_10070 4818 3571 gene locus_tag LOCUS_10080 4818 3571 CDS product homoaconitate hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879688.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence058 1373 540 gene locus_tag LOCUS_10090 1373 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1413 2168 gene locus_tag LOCUS_10100 1413 2168 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879474.1 protein_id gnl|my_center|LOCUS_10100 2193 3272 gene locus_tag LOCUS_10110 2193 3272 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879526.1 protein_id gnl|my_center|LOCUS_10110 3295 3912 gene locus_tag LOCUS_10120 3295 3912 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_10120 3909 4613 gene locus_tag LOCUS_10130 3909 4613 CDS product TrmJ/YjtD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064465.1 protein_id gnl|my_center|LOCUS_10130 4648 5055 gene locus_tag LOCUS_10140 4648 5055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6055 5039 gene locus_tag LOCUS_10150 6055 5039 CDS product CofH family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064223.1 protein_id gnl|my_center|LOCUS_10150 6965 6033 gene locus_tag LOCUS_10160 gene aglJ 6965 6033 CDS product S-layer glycoprotein N-glycosyltransferase AglJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877894.1 protein_id gnl|my_center|LOCUS_10160 7555 6965 gene locus_tag LOCUS_10170 7555 6965 CDS product orotate phosphoribosyltransferase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877893.1 protein_id gnl|my_center|LOCUS_10170 8022 7552 gene locus_tag LOCUS_10180 gene nob1 8022 7552 CDS product type II toxin-antitoxin system toxin endoribonuclease Nob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877892.1 protein_id gnl|my_center|LOCUS_10180 9223 8132 gene locus_tag LOCUS_10190 gene thiI 9223 8132 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_10190 9459 9250 gene locus_tag LOCUS_10200 9459 9250 CDS product histone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878990.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence059 585 112 gene locus_tag LOCUS_10210 585 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878211.1 protein_id gnl|my_center|LOCUS_10210 1147 575 gene locus_tag LOCUS_10220 1147 575 CDS product undecaprenyl diphosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064638.1 protein_id gnl|my_center|LOCUS_10220 1192 2283 gene locus_tag LOCUS_10230 1192 2283 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878209.1 protein_id gnl|my_center|LOCUS_10230 4056 2227 gene locus_tag LOCUS_10240 4056 2227 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878208.1 protein_id gnl|my_center|LOCUS_10240 4111 4431 gene locus_tag LOCUS_10250 4111 4431 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878605.1 protein_id gnl|my_center|LOCUS_10250 4428 5603 gene locus_tag LOCUS_10260 4428 5603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 5626 6339 gene locus_tag LOCUS_10270 gene thyX 5626 6339 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546288.1 protein_id gnl|my_center|LOCUS_10270 6421 8466 gene locus_tag LOCUS_10280 gene acs 6421 8466 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877873.1 protein_id gnl|my_center|LOCUS_10280 8498 9016 gene locus_tag LOCUS_10290 8498 9016 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879824.1 protein_id gnl|my_center|LOCUS_10290 >Feature sequence060 2551 737 gene locus_tag LOCUS_10300 gene rpoB 2551 737 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879380.1 protein_id gnl|my_center|LOCUS_10300 4096 2552 gene locus_tag LOCUS_10310 4096 2552 CDS product DNA-directed RNA polymerase subunit B'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879379.1 protein_id gnl|my_center|LOCUS_10310 4389 4102 gene locus_tag LOCUS_10320 4389 4102 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870552.1 protein_id gnl|my_center|LOCUS_10320 4485 4411 gene locus_tag LOCUS_t00280 4485 4411 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5549 4545 gene locus_tag LOCUS_10330 5549 4545 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877740.1 protein_id gnl|my_center|LOCUS_10330 6295 5546 gene locus_tag LOCUS_10340 6295 5546 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064192.1 protein_id gnl|my_center|LOCUS_10340 6632 6706 gene locus_tag LOCUS_t00290 6632 6706 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7088 7360 gene locus_tag LOCUS_10350 7088 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 7312 7812 gene locus_tag LOCUS_10360 7312 7812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 8536 8204 gene locus_tag LOCUS_10370 8536 8204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879839.1 protein_id gnl|my_center|LOCUS_10370 8625 8882 gene locus_tag LOCUS_10380 8625 8882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 8872 9072 gene locus_tag LOCUS_10390 8872 9072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 9045 9260 gene locus_tag LOCUS_10400 9045 9260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 >Feature sequence061 1 4761 gene locus_tag LOCUS_10410 1 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 5254 5006 gene locus_tag LOCUS_10420 5254 5006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 5532 5732 gene locus_tag LOCUS_10430 5532 5732 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250462.1 protein_id gnl|my_center|LOCUS_10430 5725 5961 gene locus_tag LOCUS_10440 5725 5961 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250461.1 protein_id gnl|my_center|LOCUS_10440 6106 6897 gene locus_tag LOCUS_10450 6106 6897 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890071.1 protein_id gnl|my_center|LOCUS_10450 6902 7201 gene locus_tag LOCUS_10460 6902 7201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 7198 7428 gene locus_tag LOCUS_10470 7198 7428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 7438 7710 gene locus_tag LOCUS_10480 7438 7710 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877614.1 protein_id gnl|my_center|LOCUS_10480 7893 8096 gene locus_tag LOCUS_10490 7893 8096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 8078 8446 gene locus_tag LOCUS_10500 8078 8446 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846392.1 protein_id gnl|my_center|LOCUS_10500 8530 8670 gene locus_tag LOCUS_10510 8530 8670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10510 >Feature sequence062 313 888 gene locus_tag LOCUS_10520 313 888 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879281.1 protein_id gnl|my_center|LOCUS_10520 1079 885 gene locus_tag LOCUS_10530 1079 885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1229 1152 gene locus_tag LOCUS_t00300 1229 1152 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1745 1248 gene locus_tag LOCUS_10540 1745 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2089 1742 gene locus_tag LOCUS_10550 2089 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2361 2552 gene locus_tag LOCUS_10560 2361 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3308 2697 gene locus_tag LOCUS_10570 3308 2697 CDS product KaiC associated regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064643.1 protein_id gnl|my_center|LOCUS_10570 4177 3320 gene locus_tag LOCUS_10580 4177 3320 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878298.1 protein_id gnl|my_center|LOCUS_10580 4383 4219 gene locus_tag LOCUS_10590 4383 4219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 4790 4380 gene locus_tag LOCUS_10600 4790 4380 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877967.1 protein_id gnl|my_center|LOCUS_10600 5573 4815 gene locus_tag LOCUS_10610 5573 4815 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877968.1 protein_id gnl|my_center|LOCUS_10610 5628 6329 gene locus_tag LOCUS_10620 5628 6329 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879429.1 protein_id gnl|my_center|LOCUS_10620 6354 7925 gene locus_tag LOCUS_10630 6354 7925 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064253.1 protein_id gnl|my_center|LOCUS_10630 8662 7922 gene locus_tag LOCUS_10640 gene proC 8662 7922 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869320.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence063 782 198 gene locus_tag LOCUS_10650 782 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 1380 805 gene locus_tag LOCUS_10660 1380 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 3827 1614 gene locus_tag LOCUS_10670 3827 1614 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878955.1 protein_id gnl|my_center|LOCUS_10670 4925 3852 gene locus_tag LOCUS_10680 4925 3852 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878523.1 protein_id gnl|my_center|LOCUS_10680 5183 5704 gene locus_tag LOCUS_10690 5183 5704 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064733.1 protein_id gnl|my_center|LOCUS_10690 6517 5681 gene locus_tag LOCUS_10700 gene dapF 6517 5681 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878250.1 protein_id gnl|my_center|LOCUS_10700 6565 6649 gene locus_tag LOCUS_t00310 6565 6649 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7141 6629 gene locus_tag LOCUS_10710 7141 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 8222 7215 gene locus_tag LOCUS_10720 8222 7215 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320500.1 protein_id gnl|my_center|LOCUS_10720 8823 8212 gene locus_tag LOCUS_10730 8823 8212 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878665.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence064 1796 123 gene locus_tag LOCUS_10740 1796 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 1897 1970 gene locus_tag LOCUS_t00320 1897 1970 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2288 1971 gene locus_tag LOCUS_10750 2288 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879752.1 protein_id gnl|my_center|LOCUS_10750 3628 2303 gene locus_tag LOCUS_10760 3628 2303 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274480.1 protein_id gnl|my_center|LOCUS_10760 3705 4583 gene locus_tag LOCUS_10770 3705 4583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870975.1 protein_id gnl|my_center|LOCUS_10770 4580 6244 gene locus_tag LOCUS_10780 4580 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 6278 8470 gene locus_tag LOCUS_10790 6278 8470 CDS product amino acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879109.1 protein_id gnl|my_center|LOCUS_10790 8763 8467 gene locus_tag LOCUS_10800 8763 8467 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064559.1 protein_id gnl|my_center|LOCUS_10800 >Feature sequence065 700 44 gene locus_tag LOCUS_10810 700 44 CDS product Dna2/Cas4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879670.1 protein_id gnl|my_center|LOCUS_10810 750 1328 gene locus_tag LOCUS_10820 gene cas4 750 1328 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980587.1 protein_id gnl|my_center|LOCUS_10820 1463 1380 gene locus_tag LOCUS_t00330 1463 1380 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1544 2833 gene locus_tag LOCUS_10830 gene hemA 1544 2833 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879467.1 protein_id gnl|my_center|LOCUS_10830 2751 3710 gene locus_tag LOCUS_10840 gene hemB 2751 3710 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236609709.1 protein_id gnl|my_center|LOCUS_10840 3996 4161 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gataaaatcagactatattaggattgaaag 3996 4554 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gataaaatcagactatattaggattgaaag 5121 4537 gene locus_tag LOCUS_10850 5121 4537 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249797.1 protein_id gnl|my_center|LOCUS_10850 6097 5111 gene locus_tag LOCUS_10860 6097 5111 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867162.1 protein_id gnl|my_center|LOCUS_10860 6189 7631 gene locus_tag LOCUS_10870 gene ppcA 6189 7631 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060929.1 protein_id gnl|my_center|LOCUS_10870 7854 7612 gene locus_tag LOCUS_10880 7854 7612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 <8652 7856 gene locus_tag LOCUS_10890 <8652 7856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048086080.1:hydrogenase formation protein HypD >Feature sequence066 5628 3199 gene locus_tag LOCUS_10900 5628 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 5869 5537 gene locus_tag LOCUS_10910 5869 5537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 7757 5940 gene locus_tag LOCUS_10920 7757 5940 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146750.1 protein_id gnl|my_center|LOCUS_10920 8571 7798 gene locus_tag LOCUS_10930 gene larE 8571 7798 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878066.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence067 235 1686 gene locus_tag LOCUS_10940 235 1686 CDS product menaquinone biosynthesis decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877720.1 protein_id gnl|my_center|LOCUS_10940 2687 1683 gene locus_tag LOCUS_10950 2687 1683 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880716.1 protein_id gnl|my_center|LOCUS_10950 3191 2853 gene locus_tag LOCUS_10960 3191 2853 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_10960 3457 3170 gene locus_tag LOCUS_10970 3457 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 4596 3493 gene locus_tag LOCUS_10980 gene argJ 4596 3493 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878643.1 protein_id gnl|my_center|LOCUS_10980 4664 5908 gene locus_tag LOCUS_10990 gene hisS 4664 5908 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879138.1 protein_id gnl|my_center|LOCUS_10990 5905 6663 gene locus_tag LOCUS_11000 5905 6663 CDS product hydroxymethylpyrimidine/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879697.1 protein_id gnl|my_center|LOCUS_11000 6664 6737 gene locus_tag LOCUS_t00340 6664 6737 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6807 8045 gene locus_tag LOCUS_11010 6807 8045 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274451.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence068 2906 2598 gene locus_tag LOCUS_11020 2906 2598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3917 2928 gene locus_tag LOCUS_11030 gene argC 3917 2928 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879563.1 protein_id gnl|my_center|LOCUS_11030 4829 3930 gene locus_tag LOCUS_11040 4829 3930 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319540.1 protein_id gnl|my_center|LOCUS_11040 4862 5521 gene locus_tag LOCUS_11050 gene tpiA 4862 5521 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064694.1 protein_id gnl|my_center|LOCUS_11050 5645 5848 gene locus_tag LOCUS_11060 5645 5848 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249873.1 protein_id gnl|my_center|LOCUS_11060 5859 6596 gene locus_tag LOCUS_11070 5859 6596 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877900.1 protein_id gnl|my_center|LOCUS_11070 6593 8020 gene locus_tag LOCUS_11080 6593 8020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence069 658 29 gene locus_tag LOCUS_11090 658 29 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591675.1 protein_id gnl|my_center|LOCUS_11090 825 655 gene locus_tag LOCUS_11100 825 655 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064219.1 protein_id gnl|my_center|LOCUS_11100 1533 862 gene locus_tag LOCUS_11110 1533 862 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877858.1 protein_id gnl|my_center|LOCUS_11110 1553 1897 gene locus_tag LOCUS_11120 gene hisI 1553 1897 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879442.1 protein_id gnl|my_center|LOCUS_11120 1909 2778 gene locus_tag LOCUS_11130 1909 2778 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867380.1 protein_id gnl|my_center|LOCUS_11130 2906 2706 gene locus_tag LOCUS_11140 2906 2706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 2994 3302 gene locus_tag LOCUS_11150 2994 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 3868 3299 gene locus_tag LOCUS_11160 3868 3299 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878945.1 protein_id gnl|my_center|LOCUS_11160 3985 4299 gene locus_tag LOCUS_11170 3985 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 4286 5173 gene locus_tag LOCUS_11180 4286 5173 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021606.1 protein_id gnl|my_center|LOCUS_11180 5170 5886 gene locus_tag LOCUS_11190 5170 5886 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_11190 5944 6960 gene locus_tag LOCUS_11200 5944 6960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 7006 7413 gene locus_tag LOCUS_11210 7006 7413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 7419 8204 gene locus_tag LOCUS_11220 7419 8204 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence070 1286 18 gene locus_tag LOCUS_11230 1286 18 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064354.1 protein_id gnl|my_center|LOCUS_11230 2317 1361 gene locus_tag LOCUS_11240 2317 1361 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096340.1 protein_id gnl|my_center|LOCUS_11240 3380 2322 gene locus_tag LOCUS_11250 gene fni 3380 2322 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064552.1 protein_id gnl|my_center|LOCUS_11250 4123 3401 gene locus_tag LOCUS_11260 4123 3401 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012965876.1 protein_id gnl|my_center|LOCUS_11260 7586 4110 gene locus_tag LOCUS_11270 gene polC 7586 4110 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879218.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence071 36 248 gene locus_tag LOCUS_11280 36 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 226 1374 gene locus_tag LOCUS_11290 226 1374 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250179.1 protein_id gnl|my_center|LOCUS_11290 1519 1827 gene locus_tag LOCUS_11300 1519 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2290 5793 gene locus_tag LOCUS_11310 gene gyrA 2290 5793 CDS product intein-containing DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012634405.1 protein_id gnl|my_center|LOCUS_11310 6352 5780 gene locus_tag LOCUS_11320 6352 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 7451 6333 gene locus_tag LOCUS_11330 7451 6333 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879852.1 protein_id gnl|my_center|LOCUS_11330 7522 7761 gene locus_tag LOCUS_11340 7522 7761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 7843 7977 gene locus_tag LOCUS_11350 7843 7977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence072 1260 13 gene locus_tag LOCUS_11360 1260 13 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_11360 1342 1980 gene locus_tag LOCUS_11370 1342 1980 CDS product winged helix-turn-helix domain-containing protein/riboflavin kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319832.1 protein_id gnl|my_center|LOCUS_11370 1977 2684 gene locus_tag LOCUS_11380 gene ribB 1977 2684 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879598.1 protein_id gnl|my_center|LOCUS_11380 2677 3333 gene locus_tag LOCUS_11390 2677 3333 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546415.1 protein_id gnl|my_center|LOCUS_11390 3330 4268 gene locus_tag LOCUS_11400 3330 4268 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545868.1 protein_id gnl|my_center|LOCUS_11400 4293 5438 gene locus_tag LOCUS_11410 4293 5438 CDS product acetylornithine/succinylornithine family transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877594.1 protein_id gnl|my_center|LOCUS_11410 5465 6856 gene locus_tag LOCUS_11420 5465 6856 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_11420 <7989 6840 gene locus_tag LOCUS_11430 <7989 6840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878819.1:site-2 protease family protein >Feature sequence073 2135 555 gene locus_tag LOCUS_11440 gene arcS 2135 555 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878091.1 protein_id gnl|my_center|LOCUS_11440 3565 2111 gene locus_tag LOCUS_11450 gene tgtA 3565 2111 CDS product tRNA guanosine(15) transglycosylase TgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878092.1 protein_id gnl|my_center|LOCUS_11450 3955 3590 gene locus_tag LOCUS_11460 3955 3590 CDS product DNA polymerase ligase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023353.1 protein_id gnl|my_center|LOCUS_11460 5121 3961 gene locus_tag LOCUS_11470 gene dnaG 5121 3961 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879392.1 protein_id gnl|my_center|LOCUS_11470 6134 5193 gene locus_tag LOCUS_11480 gene twy1 6134 5193 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879750.1 protein_id gnl|my_center|LOCUS_11480 6265 7296 gene locus_tag LOCUS_11490 6265 7296 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879715.1 protein_id gnl|my_center|LOCUS_11490 7740 7471 gene locus_tag LOCUS_11500 7740 7471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence074 1550 561 gene locus_tag LOCUS_11510 1550 561 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296895.1 protein_id gnl|my_center|LOCUS_11510 1639 2616 gene locus_tag LOCUS_11520 1639 2616 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877753.1 protein_id gnl|my_center|LOCUS_11520 3225 2617 gene locus_tag LOCUS_11530 gene hxlB 3225 2617 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879292.1 protein_id gnl|my_center|LOCUS_11530 4081 3203 gene locus_tag LOCUS_11540 4081 3203 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879459.1 protein_id gnl|my_center|LOCUS_11540 4656 4078 gene locus_tag LOCUS_11550 4656 4078 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879458.1 protein_id gnl|my_center|LOCUS_11550 6227 4653 gene locus_tag LOCUS_11560 gene serA 6227 4653 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878316.1 protein_id gnl|my_center|LOCUS_11560 6308 6724 gene locus_tag LOCUS_11570 6308 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence075 347 702 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaatctcataaggagaacggaaact 811 1371 gene locus_tag LOCUS_11580 811 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 3194 1878 gene locus_tag LOCUS_11590 3194 1878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 3974 3201 gene locus_tag LOCUS_11600 3974 3201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 4227 4523 gene locus_tag LOCUS_11610 4227 4523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 4710 5222 gene locus_tag LOCUS_11620 4710 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 5231 5572 gene locus_tag LOCUS_11630 5231 5572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 5604 5825 gene locus_tag LOCUS_11640 5604 5825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 6495 6346 gene locus_tag LOCUS_11650 6495 6346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 6576 7103 gene locus_tag LOCUS_11660 6576 7103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 >Feature sequence076 474 402 gene locus_tag LOCUS_t00350 474 402 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 1642 512 gene locus_tag LOCUS_11670 gene ribA 1642 512 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877991.1 protein_id gnl|my_center|LOCUS_11670 1941 1696 gene locus_tag LOCUS_11680 1941 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2165 1938 gene locus_tag LOCUS_11690 2165 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 3436 2147 gene locus_tag LOCUS_11700 3436 2147 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878202.1 protein_id gnl|my_center|LOCUS_11700 4780 3464 gene locus_tag LOCUS_11710 4780 3464 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064356.1 protein_id gnl|my_center|LOCUS_11710 4884 5480 gene locus_tag LOCUS_11720 4884 5480 CDS product GPR1/FUN34/YaaH family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940055.1 protein_id gnl|my_center|LOCUS_11720 5568 5493 gene locus_tag LOCUS_t00360 5568 5493 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5682 6485 gene locus_tag LOCUS_11730 5682 6485 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878129.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence077 697 386 gene locus_tag LOCUS_11740 697 386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 840 1031 gene locus_tag LOCUS_11750 840 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1012 2472 gene locus_tag LOCUS_11760 1012 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2475 2666 gene locus_tag LOCUS_11770 2475 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2671 3051 gene locus_tag LOCUS_11780 2671 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 3071 3232 gene locus_tag LOCUS_11790 3071 3232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3222 3473 gene locus_tag LOCUS_11800 3222 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 3466 3690 gene locus_tag LOCUS_11810 3466 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3707 4123 gene locus_tag LOCUS_11820 3707 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 4431 4357 gene locus_tag LOCUS_t00370 4431 4357 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4554 5678 gene locus_tag LOCUS_11830 4554 5678 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878920.1 protein_id gnl|my_center|LOCUS_11830 6511 5660 gene locus_tag LOCUS_11840 6511 5660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_11840 6560 6646 gene locus_tag LOCUS_t00380 6560 6646 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 196 492 gene locus_tag LOCUS_11850 196 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 496 1008 gene locus_tag LOCUS_11860 496 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 1010 2542 gene locus_tag LOCUS_11870 gene terL 1010 2542 CDS product phage terminase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939974.1 protein_id gnl|my_center|LOCUS_11870 3110 2718 gene locus_tag LOCUS_11880 3110 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 3203 3433 gene locus_tag LOCUS_11890 3203 3433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 3411 3629 gene locus_tag LOCUS_11900 3411 3629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 3622 4380 gene locus_tag LOCUS_11910 3622 4380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4796 6148 gene locus_tag LOCUS_11920 4796 6148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 6136 7107 gene locus_tag LOCUS_11930 6136 7107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence079 <1 583 gene locus_tag LOCUS_11940 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048095662.1:branched-chain amino acid ABC transporter permease 630 1469 gene locus_tag LOCUS_11950 630 1469 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064160.1 protein_id gnl|my_center|LOCUS_11950 1471 2340 gene locus_tag LOCUS_11960 1471 2340 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877908.1 protein_id gnl|my_center|LOCUS_11960 4200 2311 gene locus_tag LOCUS_11970 4200 2311 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878161.1 protein_id gnl|my_center|LOCUS_11970 5732 4197 gene locus_tag LOCUS_11980 5732 4197 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878162.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence080 1227 58 gene locus_tag LOCUS_11990 1227 58 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879911.1 protein_id gnl|my_center|LOCUS_11990 1318 1887 gene locus_tag LOCUS_12000 1318 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2854 2180 gene locus_tag LOCUS_12010 2854 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3048 4091 gene locus_tag LOCUS_12020 3048 4091 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068322439.1 protein_id gnl|my_center|LOCUS_12020 5670 4084 gene locus_tag LOCUS_12030 5670 4084 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878457.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence081 3066 1423 gene locus_tag LOCUS_12040 gene pheT 3066 1423 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878921.1 protein_id gnl|my_center|LOCUS_12040 3116 3670 gene locus_tag LOCUS_12050 gene thpR 3116 3670 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879646.1 protein_id gnl|my_center|LOCUS_12050 4865 3663 gene locus_tag LOCUS_12060 4865 3663 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878404.1 protein_id gnl|my_center|LOCUS_12060 5310 4849 gene locus_tag LOCUS_12070 5310 4849 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878403.1 protein_id gnl|my_center|LOCUS_12070 6134 5463 gene locus_tag LOCUS_12080 6134 5463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 <6941 6112 gene locus_tag LOCUS_12090 <6941 6112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871021.1:site-specific DNA-methyltransferase >Feature sequence082 158 928 gene locus_tag LOCUS_12100 gene suhB 158 928 CDS product bifunctional fructose-1,6-bisphosphatase/inositol-1-monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879859.1 protein_id gnl|my_center|LOCUS_12100 925 1683 gene locus_tag LOCUS_12110 gene nadK 925 1683 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879860.1 protein_id gnl|my_center|LOCUS_12110 2066 1680 gene locus_tag LOCUS_12120 2066 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 3259 2312 gene locus_tag LOCUS_12130 3259 2312 CDS product beta-ribofuranosylaminobenzene 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879581.1 protein_id gnl|my_center|LOCUS_12130 3756 3262 gene locus_tag LOCUS_12140 3756 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878938.1 protein_id gnl|my_center|LOCUS_12140 4166 3777 gene locus_tag LOCUS_12150 4166 3777 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879577.1 protein_id gnl|my_center|LOCUS_12150 4237 4884 gene locus_tag LOCUS_12160 4237 4884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 4871 5797 gene locus_tag LOCUS_12170 4871 5797 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878512.1 protein_id gnl|my_center|LOCUS_12170 6087 6002 gene locus_tag LOCUS_t00390 6087 6002 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6619 6125 gene locus_tag LOCUS_12180 6619 6125 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064607.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence083 1563 373 gene locus_tag LOCUS_12190 1563 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 1952 2467 gene locus_tag LOCUS_12200 1952 2467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 3200 2412 gene locus_tag LOCUS_12210 3200 2412 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021800.1 protein_id gnl|my_center|LOCUS_12210 3998 3264 gene locus_tag LOCUS_12220 3998 3264 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878178.1 protein_id gnl|my_center|LOCUS_12220 4071 4313 gene locus_tag LOCUS_12230 gene purS 4071 4313 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879434.1 protein_id gnl|my_center|LOCUS_12230 4319 6601 gene locus_tag LOCUS_12240 gene purL 4319 6601 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879433.1 protein_id gnl|my_center|LOCUS_12240 >Feature sequence084 1232 489 gene locus_tag LOCUS_12250 gene rrp41 1232 489 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878000.1 protein_id gnl|my_center|LOCUS_12250 2001 1198 gene locus_tag LOCUS_12260 gene rrp4 2001 1198 CDS product exosome complex protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877999.1 protein_id gnl|my_center|LOCUS_12260 2718 2011 gene locus_tag LOCUS_12270 2718 2011 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877998.1 protein_id gnl|my_center|LOCUS_12270 3465 2725 gene locus_tag LOCUS_12280 gene psmA 3465 2725 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_12280 3796 3470 gene locus_tag LOCUS_12290 3796 3470 CDS product Rpp14/Pop5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064245.1 protein_id gnl|my_center|LOCUS_12290 4176 3793 gene locus_tag LOCUS_12300 4176 3793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 6434 4173 gene locus_tag LOCUS_12310 6434 4173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence085 546 1772 gene locus_tag LOCUS_12320 546 1772 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878166.1 protein_id gnl|my_center|LOCUS_12320 1778 4000 gene locus_tag LOCUS_12330 1778 4000 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878165.1 protein_id gnl|my_center|LOCUS_12330 4027 5301 gene locus_tag LOCUS_12340 gene qmoC 4027 5301 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878164.1 protein_id gnl|my_center|LOCUS_12340 6070 5330 gene locus_tag LOCUS_12350 6070 5330 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064392.1 protein_id gnl|my_center|LOCUS_12350 >Feature sequence086 <1 1847 gene locus_tag LOCUS_12360 <1 1847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879530.1:ribosome rescue protein RqcH 1954 3543 gene locus_tag LOCUS_12370 1954 3543 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064191.1 protein_id gnl|my_center|LOCUS_12370 3512 4018 gene locus_tag LOCUS_12380 3512 4018 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064326.1 protein_id gnl|my_center|LOCUS_12380 4011 4679 gene locus_tag LOCUS_12390 gene pyrF 4011 4679 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064309.1 protein_id gnl|my_center|LOCUS_12390 4812 4621 gene locus_tag LOCUS_12400 4812 4621 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318485.1 protein_id gnl|my_center|LOCUS_12400 4914 5585 gene locus_tag LOCUS_12410 4914 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 5615 6589 gene locus_tag LOCUS_12420 5615 6589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 >Feature sequence087 277 1416 gene locus_tag LOCUS_12430 277 1416 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846352.1 protein_id gnl|my_center|LOCUS_12430 1413 2705 gene locus_tag LOCUS_12440 1413 2705 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978478.1 protein_id gnl|my_center|LOCUS_12440 3306 2674 gene locus_tag LOCUS_12450 3306 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879749.1 protein_id gnl|my_center|LOCUS_12450 3601 3329 gene locus_tag LOCUS_12460 gene albA 3601 3329 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878567.1 protein_id gnl|my_center|LOCUS_12460 3663 4205 gene locus_tag LOCUS_12470 3663 4205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 5097 4192 gene locus_tag LOCUS_12480 5097 4192 CDS product cell division protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879225.1 protein_id gnl|my_center|LOCUS_12480 5181 6599 gene locus_tag LOCUS_12490 5181 6599 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879286.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence088 652 191 gene locus_tag LOCUS_12500 652 191 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249701.1 protein_id gnl|my_center|LOCUS_12500 1349 687 gene locus_tag LOCUS_12510 1349 687 CDS product RPA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878282.1 protein_id gnl|my_center|LOCUS_12510 2266 1346 gene locus_tag LOCUS_12520 2266 1346 CDS product replication protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878283.1 protein_id gnl|my_center|LOCUS_12520 2375 2839 gene locus_tag LOCUS_12530 2375 2839 CDS product DUF2299 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270501.1 protein_id gnl|my_center|LOCUS_12530 3477 2836 gene locus_tag LOCUS_12540 3477 2836 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878664.1 protein_id gnl|my_center|LOCUS_12540 4946 3504 gene locus_tag LOCUS_12550 4946 3504 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064680.1 protein_id gnl|my_center|LOCUS_12550 <6565 4957 gene locus_tag LOCUS_12560 <6565 4957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878662.1:ATP synthase subunit A >Feature sequence089 679 218 gene locus_tag LOCUS_12570 679 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12570 1080 685 gene locus_tag LOCUS_12580 1080 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 2038 1097 gene locus_tag LOCUS_12590 2038 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2676 2170 gene locus_tag LOCUS_12600 2676 2170 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763573.1 protein_id gnl|my_center|LOCUS_12600 2727 3692 gene locus_tag LOCUS_12610 gene ala 2727 3692 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879161.1 protein_id gnl|my_center|LOCUS_12610 3697 4044 gene locus_tag LOCUS_12620 3697 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 5226 4045 gene locus_tag LOCUS_12630 5226 4045 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879741.1 protein_id gnl|my_center|LOCUS_12630 6398 5451 gene locus_tag LOCUS_12640 6398 5451 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877935.1 protein_id gnl|my_center|LOCUS_12640 >Feature sequence090 150 410 gene locus_tag LOCUS_12650 150 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 578 790 gene locus_tag LOCUS_12660 578 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 1474 1103 gene locus_tag LOCUS_12670 1474 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2094 1600 gene locus_tag LOCUS_12680 2094 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2218 2487 gene locus_tag LOCUS_12690 2218 2487 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_12690 2834 2481 gene locus_tag LOCUS_12700 2834 2481 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869618.1 protein_id gnl|my_center|LOCUS_12700 3141 2827 gene locus_tag LOCUS_12710 3141 2827 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809266.1 protein_id gnl|my_center|LOCUS_12710 3506 3330 gene locus_tag LOCUS_12720 3506 3330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3548 4093 gene locus_tag LOCUS_12730 3548 4093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 4377 4120 gene locus_tag LOCUS_12740 4377 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 4925 4437 gene locus_tag LOCUS_12750 gene ilvN 4925 4437 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879215.1 protein_id gnl|my_center|LOCUS_12750 6424 4922 gene locus_tag LOCUS_12760 6424 4922 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879216.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence091 1212 2126 gene locus_tag LOCUS_12770 1212 2126 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879220.1 protein_id gnl|my_center|LOCUS_12770 2123 2932 gene locus_tag LOCUS_12780 2123 2932 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496404.1 protein_id gnl|my_center|LOCUS_12780 2998 2914 gene locus_tag LOCUS_t00400 2998 2914 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4242 3025 gene locus_tag LOCUS_12790 4242 3025 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878570.1 protein_id gnl|my_center|LOCUS_12790 4389 5528 gene locus_tag LOCUS_12800 4389 5528 CDS product TraB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877838.1 protein_id gnl|my_center|LOCUS_12800 5540 6037 gene locus_tag LOCUS_12810 5540 6037 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878520.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence092 315 785 gene locus_tag LOCUS_12820 315 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 1054 1806 gene locus_tag LOCUS_12830 1054 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 2676 2134 gene locus_tag LOCUS_12840 2676 2134 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879307.1 protein_id gnl|my_center|LOCUS_12840 4649 2673 gene locus_tag LOCUS_12850 gene metG 4649 2673 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878950.1 protein_id gnl|my_center|LOCUS_12850 4716 4901 gene locus_tag LOCUS_12860 4716 4901 CDS product DUF5350 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879682.1 protein_id gnl|my_center|LOCUS_12860 5927 4869 gene locus_tag LOCUS_12870 5927 4869 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878318.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence093 2918 330 gene locus_tag LOCUS_12880 2918 330 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_12880 3577 2954 gene locus_tag LOCUS_12890 gene aroD 3577 2954 CDS product type I 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877739.1 protein_id gnl|my_center|LOCUS_12890 4378 3587 gene locus_tag LOCUS_12900 4378 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 5198 4368 gene locus_tag LOCUS_12910 5198 4368 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878859.1 protein_id gnl|my_center|LOCUS_12910 <6209 5191 gene locus_tag LOCUS_12920 <6209 5191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879247.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence094 3857 1449 gene locus_tag LOCUS_12930 3857 1449 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197030926.1 protein_id gnl|my_center|LOCUS_12930 3901 4668 gene locus_tag LOCUS_12940 3901 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 4646 5308 gene locus_tag LOCUS_12950 gene radB 4646 5308 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320585.1 protein_id gnl|my_center|LOCUS_12950 5339 5719 gene locus_tag LOCUS_12960 5339 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274390.1 protein_id gnl|my_center|LOCUS_12960 >Feature sequence095 <1 724 gene locus_tag LOCUS_12970 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065767.1:CRISPR-associated helicase/endonuclease Cas3 758 1048 gene locus_tag LOCUS_12980 758 1048 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869619.1 protein_id gnl|my_center|LOCUS_12980 1041 1331 gene locus_tag LOCUS_12990 1041 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 1496 1377 gene locus_tag LOCUS_13000 1496 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1810 1547 gene locus_tag LOCUS_13010 gene cas2 1810 1547 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064580.1 protein_id gnl|my_center|LOCUS_13010 2762 1812 gene locus_tag LOCUS_13020 gene cas1b 2762 1812 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879922.1 protein_id gnl|my_center|LOCUS_13020 3268 2771 gene locus_tag LOCUS_13030 gene cas4 3268 2771 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879923.1 protein_id gnl|my_center|LOCUS_13030 3594 3827 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gataaaatcagactatgttaggattgaaag 4406 3885 gene locus_tag LOCUS_13040 4406 3885 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064441.1 protein_id gnl|my_center|LOCUS_13040 4444 5571 gene locus_tag LOCUS_13050 gene pscS 4444 5571 CDS product O-phospho-L-seryl-tRNA:Cys-tRNA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877542.1 protein_id gnl|my_center|LOCUS_13050 >Feature sequence096 334 720 gene locus_tag LOCUS_13060 334 720 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879641.1 protein_id gnl|my_center|LOCUS_13060 720 2666 gene locus_tag LOCUS_13070 720 2666 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683176.1 protein_id gnl|my_center|LOCUS_13070 2923 2663 gene locus_tag LOCUS_13080 2923 2663 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879596.1 protein_id gnl|my_center|LOCUS_13080 3671 2913 gene locus_tag LOCUS_13090 3671 2913 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867813.1 protein_id gnl|my_center|LOCUS_13090 3730 4437 gene locus_tag LOCUS_13100 3730 4437 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878152.1 protein_id gnl|my_center|LOCUS_13100 5566 4409 gene locus_tag LOCUS_13110 5566 4409 CDS product winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870915.1 protein_id gnl|my_center|LOCUS_13110 5718 5563 gene locus_tag LOCUS_13120 5718 5563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 >Feature sequence097 167 628 gene locus_tag LOCUS_13130 167 628 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_13130 625 753 gene locus_tag LOCUS_13140 625 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 755 1729 gene locus_tag LOCUS_13150 755 1729 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942059.1 protein_id gnl|my_center|LOCUS_13150 1947 1726 gene locus_tag LOCUS_13160 1947 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 2231 1947 gene locus_tag LOCUS_13170 2231 1947 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146460.1 protein_id gnl|my_center|LOCUS_13170 2632 2228 gene locus_tag LOCUS_13180 2632 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 3070 2708 gene locus_tag LOCUS_13190 3070 2708 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877855.1 protein_id gnl|my_center|LOCUS_13190 4125 3142 gene locus_tag LOCUS_13200 4125 3142 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683404.1 protein_id gnl|my_center|LOCUS_13200 5032 4109 gene locus_tag LOCUS_13210 5032 4109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence098 674 36 gene locus_tag LOCUS_13220 674 36 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591675.1 protein_id gnl|my_center|LOCUS_13220 2635 677 gene locus_tag LOCUS_13230 2635 677 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071676851.1 protein_id gnl|my_center|LOCUS_13230 3055 3225 gene locus_tag LOCUS_13240 3055 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13240 3763 3512 gene locus_tag LOCUS_13250 3763 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 4091 5134 gene locus_tag LOCUS_13260 4091 5134 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496893.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence099 1140 907 gene locus_tag LOCUS_13270 1140 907 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878154.1 protein_id gnl|my_center|LOCUS_13270 2658 1162 gene locus_tag LOCUS_13280 2658 1162 CDS product DUF2070 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877721.1 protein_id gnl|my_center|LOCUS_13280 3788 2655 gene locus_tag LOCUS_13290 3788 2655 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878922.1 protein_id gnl|my_center|LOCUS_13290 3859 3931 gene locus_tag LOCUS_t00410 3859 3931 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <5070 4229 gene locus_tag LOCUS_13300 <5070 4229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879354.1:type III-B CRISPR module RAMP protein Cmr6 >Feature sequence100 3 779 gene locus_tag LOCUS_13310 3 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 776 2962 gene locus_tag LOCUS_13320 776 2962 CDS product hydrophobe/amphiphile efflux-3 (HAE3) family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878724.1 protein_id gnl|my_center|LOCUS_13320 3481 3167 gene locus_tag LOCUS_13330 3481 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878292.1 protein_id gnl|my_center|LOCUS_13330 <5064 3609 gene locus_tag LOCUS_13340 <5064 3609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_202318802.1:type I glutamate--ammonia ligase >Feature sequence101 787 467 gene locus_tag LOCUS_13350 787 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13350 3566 771 gene locus_tag LOCUS_13360 gene cas10 3566 771 CDS product type III-B CRISPR-associated protein Cas10/Cmr2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143274454.1 protein_id gnl|my_center|LOCUS_13360 4669 3563 gene locus_tag LOCUS_13370 gene cmr1 4669 3563 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064480.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence102 1377 238 gene locus_tag LOCUS_13380 1377 238 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763211.1 protein_id gnl|my_center|LOCUS_13380 1744 2013 gene locus_tag LOCUS_13390 1744 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 2007 3050 gene locus_tag LOCUS_13400 2007 3050 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868065.1 protein_id gnl|my_center|LOCUS_13400 4851 4441 gene locus_tag LOCUS_13410 4851 4441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence103 59 1114 gene locus_tag LOCUS_13420 59 1114 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877877.1 protein_id gnl|my_center|LOCUS_13420 1111 1977 gene locus_tag LOCUS_13430 1111 1977 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_13430 1958 2590 gene locus_tag LOCUS_13440 1958 2590 CDS product cysteine-rich small domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878601.1 protein_id gnl|my_center|LOCUS_13440 2627 3418 gene locus_tag LOCUS_13450 2627 3418 CDS product RNA-processing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064527.1 protein_id gnl|my_center|LOCUS_13450 3511 3870 gene locus_tag LOCUS_13460 3511 3870 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064328.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence104 <1 1863 gene locus_tag LOCUS_13470 <1 1863 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064883.1:DUF2341 domain-containing protein 2873 1860 gene locus_tag LOCUS_13480 2873 1860 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878340.1 protein_id gnl|my_center|LOCUS_13480 3426 2908 gene locus_tag LOCUS_13490 3426 2908 CDS product TIGR00295 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878719.1 protein_id gnl|my_center|LOCUS_13490 3505 3810 gene locus_tag LOCUS_13500 gene yciH 3505 3810 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878414.1 protein_id gnl|my_center|LOCUS_13500 4588 3785 gene locus_tag LOCUS_13510 gene truA 4588 3785 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064445.1 protein_id gnl|my_center|LOCUS_13510 4773 4585 gene locus_tag LOCUS_13520 4773 4585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence105 1771 1562 gene locus_tag LOCUS_13530 1771 1562 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878240.1 protein_id gnl|my_center|LOCUS_13530 1931 1755 gene locus_tag LOCUS_13540 1931 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3377 1962 gene locus_tag LOCUS_13550 3377 1962 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879521.1 protein_id gnl|my_center|LOCUS_13550 3427 3711 gene locus_tag LOCUS_13560 3427 3711 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878163.1 protein_id gnl|my_center|LOCUS_13560 3733 4173 gene locus_tag LOCUS_13570 3733 4173 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879807.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence106 2152 1700 gene locus_tag LOCUS_13580 gene aprB 2152 1700 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879165.1 protein_id gnl|my_center|LOCUS_13580 2583 2236 gene locus_tag LOCUS_13590 2583 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064720.1 protein_id gnl|my_center|LOCUS_13590 3964 2594 gene locus_tag LOCUS_13600 gene sat 3964 2594 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064439.1 protein_id gnl|my_center|LOCUS_13600 4497 4099 gene locus_tag LOCUS_13610 gene hjc 4497 4099 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879457.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence107 1449 442 gene locus_tag LOCUS_13620 gene fen 1449 442 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877775.1 protein_id gnl|my_center|LOCUS_13620 1499 2356 gene locus_tag LOCUS_13630 gene map 1499 2356 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879334.1 protein_id gnl|my_center|LOCUS_13630 2429 3637 gene locus_tag LOCUS_13640 2429 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 3639 4637 gene locus_tag LOCUS_13650 3639 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence108 649 416 gene locus_tag LOCUS_13660 649 416 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878866.1 protein_id gnl|my_center|LOCUS_13660 1266 604 gene locus_tag LOCUS_13670 gene hypB 1266 604 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878865.1 protein_id gnl|my_center|LOCUS_13670 1619 1269 gene locus_tag LOCUS_13680 gene hypA 1619 1269 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319864.1 protein_id gnl|my_center|LOCUS_13680 1683 2660 gene locus_tag LOCUS_13690 1683 2660 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879855.1 protein_id gnl|my_center|LOCUS_13690 2691 3101 gene locus_tag LOCUS_13700 2691 3101 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_13700 3626 3078 gene locus_tag LOCUS_13710 3626 3078 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879726.1 protein_id gnl|my_center|LOCUS_13710 3730 4278 gene locus_tag LOCUS_13720 gene cofC 3730 4278 CDS product 2-phospho-L-lactate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879553.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence109 390 2300 gene locus_tag LOCUS_13730 390 2300 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868350.1 protein_id gnl|my_center|LOCUS_13730 2971 2297 gene locus_tag LOCUS_13740 2971 2297 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878760.1 protein_id gnl|my_center|LOCUS_13740 3041 3424 gene locus_tag LOCUS_13750 3041 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 3409 3741 gene locus_tag LOCUS_13760 3409 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 <4476 3689 gene locus_tag LOCUS_13770 <4476 3689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064249.1:shikimate kinase >Feature sequence110 1055 399 gene locus_tag LOCUS_13780 1055 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 1924 1040 gene locus_tag LOCUS_13790 1924 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3252 1921 gene locus_tag LOCUS_13800 3252 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3984 3277 gene locus_tag LOCUS_13810 gene cas6 3984 3277 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877586.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence111 1350 358 gene locus_tag LOCUS_13820 1350 358 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878353.1 protein_id gnl|my_center|LOCUS_13820 1434 1359 gene locus_tag LOCUS_t00420 1434 1359 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1826 1476 gene locus_tag LOCUS_13830 gene pth2 1826 1476 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879586.1 protein_id gnl|my_center|LOCUS_13830 2080 1823 gene locus_tag LOCUS_13840 2080 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879585.1 protein_id gnl|my_center|LOCUS_13840 2129 3118 gene locus_tag LOCUS_13850 2129 3118 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878993.1 protein_id gnl|my_center|LOCUS_13850 3959 3057 gene locus_tag LOCUS_13860 3959 3057 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877625.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence112 804 2144 gene locus_tag LOCUS_13870 gene cca 804 2144 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879645.1 protein_id gnl|my_center|LOCUS_13870 2543 2100 gene locus_tag LOCUS_13880 2543 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869702.1 protein_id gnl|my_center|LOCUS_13880 3764 2556 gene locus_tag LOCUS_13890 gene eno 3764 2556 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064335.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence113 1191 40 gene locus_tag LOCUS_13900 1191 40 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879120.1 protein_id gnl|my_center|LOCUS_13900 1669 1181 gene locus_tag LOCUS_13910 1669 1181 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879119.1 protein_id gnl|my_center|LOCUS_13910 1745 3163 gene locus_tag LOCUS_13920 gene gatB 1745 3163 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064531.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence114 878 234 gene locus_tag LOCUS_13930 878 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1869 865 gene locus_tag LOCUS_13940 gene cmr4 1869 865 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880200.1 protein_id gnl|my_center|LOCUS_13940 2116 1871 gene locus_tag LOCUS_13950 2116 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2534 2235 gene locus_tag LOCUS_13960 gene crn3 2534 2235 CDS product CRISPR-associated ring nuclease Crn3/Csx3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879357.1 protein_id gnl|my_center|LOCUS_13960 3807 2518 gene locus_tag LOCUS_13970 gene csx1 3807 2518 CDS product CRISPR-associated CARF protein Csx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871190.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence115 <1 1411 gene locus_tag LOCUS_13980 <1 1411 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878793.1:CDC48 family AAA ATPase 1426 1956 gene locus_tag LOCUS_13990 1426 1956 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878792.1 protein_id gnl|my_center|LOCUS_13990 2027 2881 gene locus_tag LOCUS_14000 2027 2881 CDS product RAD55 family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878278.1 protein_id gnl|my_center|LOCUS_14000 2854 3189 gene locus_tag LOCUS_14010 2854 3189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence116 767 414 gene locus_tag LOCUS_14020 767 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 836 2695 gene locus_tag LOCUS_14030 gene gatE 836 2695 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878937.1 protein_id gnl|my_center|LOCUS_14030 2744 2962 gene locus_tag LOCUS_14040 2744 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088857853.1 protein_id gnl|my_center|LOCUS_14040 2959 3183 gene locus_tag LOCUS_14050 2959 3183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 3208 3672 gene locus_tag LOCUS_14060 3208 3672 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878304.1 protein_id gnl|my_center|LOCUS_14060 >Feature sequence117 1029 400 gene locus_tag LOCUS_14070 1029 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2701 1130 gene locus_tag LOCUS_14080 2701 1130 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879889.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence118 <1 800 gene locus_tag LOCUS_14090 <1 800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064256.1:UDP-glucose/GDP-mannose dehydrogenase family protein 899 1150 gene locus_tag LOCUS_14100 899 1150 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979625.1 protein_id gnl|my_center|LOCUS_14100 1134 1538 gene locus_tag LOCUS_14110 1134 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1617 1856 gene locus_tag LOCUS_14120 1617 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1853 2314 gene locus_tag LOCUS_14130 1853 2314 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 protein_id gnl|my_center|LOCUS_14130 2349 2561 gene locus_tag LOCUS_14140 2349 2561 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048094905.1 protein_id gnl|my_center|LOCUS_14140 2548 2979 gene locus_tag LOCUS_14150 2548 2979 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879207.1 protein_id gnl|my_center|LOCUS_14150 3021 3221 gene locus_tag LOCUS_14160 3021 3221 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878591.1 protein_id gnl|my_center|LOCUS_14160 3193 3696 gene locus_tag LOCUS_14170 3193 3696 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877820.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence119 1726 1058 gene locus_tag LOCUS_14180 1726 1058 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_14180 3054 1723 gene locus_tag LOCUS_14190 3054 1723 CDS product COG1361 S-layer family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878519.1 protein_id gnl|my_center|LOCUS_14190 3463 3068 gene locus_tag LOCUS_14200 3463 3068 CDS product YIP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878003.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14200 3712 3545 gene locus_tag LOCUS_14210 3712 3545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence120 >Feature sequence121 1163 189 gene locus_tag LOCUS_14220 gene wtpC 1163 189 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_14220 1890 1138 gene locus_tag LOCUS_14230 gene wtpB 1890 1138 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867277.1 protein_id gnl|my_center|LOCUS_14230 2896 1874 gene locus_tag LOCUS_14240 gene wtpA 2896 1874 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867274.1 protein_id gnl|my_center|LOCUS_14240 3135 2977 gene locus_tag LOCUS_14250 3135 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 3383 3168 gene locus_tag LOCUS_14260 3383 3168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14260 3467 3539 gene locus_tag LOCUS_t00430 3467 3539 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence122 917 369 gene locus_tag LOCUS_14270 917 369 CDS product ferredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879690.1 protein_id gnl|my_center|LOCUS_14270 967 1719 gene locus_tag LOCUS_14280 967 1719 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879261.1 protein_id gnl|my_center|LOCUS_14280 2370 1879 gene locus_tag LOCUS_14290 2370 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 2895 2374 gene locus_tag LOCUS_14300 2895 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence123 215 66 gene locus_tag LOCUS_14310 215 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14310 387 202 gene locus_tag LOCUS_14320 387 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 523 1068 gene locus_tag LOCUS_14330 523 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 2472 1564 gene locus_tag LOCUS_14340 2472 1564 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209211630.1 protein_id gnl|my_center|LOCUS_14340 3407 2454 gene locus_tag LOCUS_14350 3407 2454 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence124 130 462 gene locus_tag LOCUS_14360 130 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 425 622 gene locus_tag LOCUS_14370 425 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 1555 911 gene locus_tag LOCUS_14380 gene pdxT 1555 911 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878016.1 protein_id gnl|my_center|LOCUS_14380 1582 2496 gene locus_tag LOCUS_14390 1582 2496 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867984.1 protein_id gnl|my_center|LOCUS_14390 2828 2613 gene locus_tag LOCUS_14400 2828 2613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14400 3073 2795 gene locus_tag LOCUS_14410 3073 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 >Feature sequence125 <1 714 gene locus_tag LOCUS_14420 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878001.1:exosome complex protein Rrp42 1724 711 gene locus_tag LOCUS_14430 1724 711 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023659.1 protein_id gnl|my_center|LOCUS_14430 2007 2306 gene locus_tag LOCUS_14440 2007 2306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2303 2815 gene locus_tag LOCUS_14450 2303 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence126 >Feature sequence127 >Feature sequence128 472 759 gene locus_tag LOCUS_14460 472 759 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879383.1 protein_id gnl|my_center|LOCUS_14460 783 1202 gene locus_tag LOCUS_14470 783 1202 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879384.1 protein_id gnl|my_center|LOCUS_14470 1242 1670 gene locus_tag LOCUS_14480 1242 1670 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064744.1 protein_id gnl|my_center|LOCUS_14480 1675 2259 gene locus_tag LOCUS_14490 gene rpsG 1675 2259 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879386.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence129 818 135 gene locus_tag LOCUS_14500 818 135 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096431.1 protein_id gnl|my_center|LOCUS_14500 852 2063 gene locus_tag LOCUS_14510 852 2063 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877734.1 protein_id gnl|my_center|LOCUS_14510 2096 2929 gene locus_tag LOCUS_14520 2096 2929 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877735.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence130 685 41 gene locus_tag LOCUS_14530 gene rnhB 685 41 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878125.1 protein_id gnl|my_center|LOCUS_14530 734 1123 gene locus_tag LOCUS_14540 gene trxA 734 1123 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_14540 1120 1815 gene locus_tag LOCUS_14550 1120 1815 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318675.1 protein_id gnl|my_center|LOCUS_14550 1793 2728 gene locus_tag LOCUS_14560 1793 2728 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240222.1 protein_id gnl|my_center|LOCUS_14560 2762 3088 gene locus_tag LOCUS_14570 2762 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878954.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence131 653 2587 gene locus_tag LOCUS_14580 653 2587 CDS product DUF2298 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065896.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence132 1 1416 gene locus_tag LOCUS_14590 1 1416 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229182.1 protein_id gnl|my_center|LOCUS_14590 2618 1428 gene locus_tag LOCUS_14600 2618 1428 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318704.1 protein_id gnl|my_center|LOCUS_14600 3162 2638 gene locus_tag LOCUS_14610 3162 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence133 <1 1669 gene locus_tag LOCUS_14620 <1 1669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064301.1:RtcB family protein 1684 2298 gene locus_tag LOCUS_14630 gene thiE 1684 2298 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879566.1 protein_id gnl|my_center|LOCUS_14630 2304 2711 gene locus_tag LOCUS_14640 2304 2711 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878729.1 protein_id gnl|my_center|LOCUS_14640 2753 3058 gene locus_tag LOCUS_14650 2753 3058 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878730.1 protein_id gnl|my_center|LOCUS_14650 >Feature sequence134 1414 1019 gene locus_tag LOCUS_14660 1414 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 <3019 1414 gene locus_tag LOCUS_14670 <3019 1414 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080572.1:ATP-binding protein >Feature sequence135 1013 225 gene locus_tag LOCUS_14680 gene dapB 1013 225 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878409.1 protein_id gnl|my_center|LOCUS_14680 1211 1840 gene locus_tag LOCUS_14690 1211 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139679809.1 protein_id gnl|my_center|LOCUS_14690 1824 2741 gene locus_tag LOCUS_14700 1824 2741 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_168188351.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence136 6 254 gene locus_tag LOCUS_14710 6 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 518 886 gene locus_tag LOCUS_14720 518 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1561 1304 gene locus_tag LOCUS_14730 1561 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 2084 1566 gene locus_tag LOCUS_14740 gene yjjX 2084 1566 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318533.1 protein_id gnl|my_center|LOCUS_14740 <3000 2081 gene locus_tag LOCUS_14750 <3000 2081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878691.1:replication factor C large subunit >Feature sequence137 784 131 gene locus_tag LOCUS_14760 784 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2100 1012 gene locus_tag LOCUS_14770 2100 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 2435 2172 gene locus_tag LOCUS_14780 2435 2172 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_14780 2745 2407 gene locus_tag LOCUS_14790 2745 2407 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932502.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence138 <1 912 gene locus_tag LOCUS_14800 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879381.1:DNA-directed RNA polymerase subunit A' >Feature sequence139 301 570 gene locus_tag LOCUS_14810 301 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 567 1445 gene locus_tag LOCUS_14820 567 1445 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868361.1 protein_id gnl|my_center|LOCUS_14820 1459 1764 gene locus_tag LOCUS_14830 1459 1764 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870729.1 protein_id gnl|my_center|LOCUS_14830 1761 2111 gene locus_tag LOCUS_14840 1761 2111 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870728.1 protein_id gnl|my_center|LOCUS_14840 >Feature sequence140 128 424 gene locus_tag LOCUS_14850 128 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878778.1 protein_id gnl|my_center|LOCUS_14850 482 1393 gene locus_tag LOCUS_14860 482 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1440 2000 gene locus_tag LOCUS_14870 1440 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1984 2463 gene locus_tag LOCUS_14880 1984 2463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 2827 2513 gene locus_tag LOCUS_14890 2827 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 >Feature sequence141 434 204 gene locus_tag LOCUS_14900 434 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 1691 1942 gene locus_tag LOCUS_14910 1691 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 1939 2097 gene locus_tag LOCUS_14920 1939 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 >Feature sequence142 329 1549 gene locus_tag LOCUS_14930 329 1549 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064633.1 protein_id gnl|my_center|LOCUS_14930 1546 1932 gene locus_tag LOCUS_14940 gene vapC9 1546 1932 CDS product type II toxin-antitoxin system toxin ribonuclease VapC9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878095.1 protein_id gnl|my_center|LOCUS_14940 2579 1929 gene locus_tag LOCUS_14950 2579 1929 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879811.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence143 972 382 gene locus_tag LOCUS_14960 gene engB 972 382 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878823.1 protein_id gnl|my_center|LOCUS_14960 1148 969 gene locus_tag LOCUS_14970 1148 969 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064461.1 protein_id gnl|my_center|LOCUS_14970 1720 1178 gene locus_tag LOCUS_14980 1720 1178 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878930.1 protein_id gnl|my_center|LOCUS_14980 2030 1725 gene locus_tag LOCUS_14990 2030 1725 CDS product AzlD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879250.1 protein_id gnl|my_center|LOCUS_14990 <2652 2015 gene locus_tag LOCUS_15000 <2652 2015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015591675.1:AzlC family ABC transporter permease >Feature sequence144 1906 446 gene locus_tag LOCUS_15010 1906 446 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878256.1 protein_id gnl|my_center|LOCUS_15010 <2614 1937 gene locus_tag LOCUS_15020 <2614 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012289456.1:ATP-binding protein >Feature sequence145 1632 391 gene locus_tag LOCUS_15030 1632 391 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879139.1 protein_id gnl|my_center|LOCUS_15030 1913 1629 gene locus_tag LOCUS_15040 1913 1629 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878647.1 protein_id gnl|my_center|LOCUS_15040 2222 2013 gene locus_tag LOCUS_15050 2222 2013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence146 <1 1040 gene locus_tag LOCUS_15060 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878004.1:DNA-directed DNA polymerase 1077 2210 gene locus_tag LOCUS_15070 1077 2210 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878621.1 protein_id gnl|my_center|LOCUS_15070 >Feature sequence147 305 171 gene locus_tag LOCUS_15080 305 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 651 409 gene locus_tag LOCUS_15090 651 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 722 1840 gene locus_tag LOCUS_15100 722 1840 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879852.1 protein_id gnl|my_center|LOCUS_15100 >Feature sequence148 >Feature sequence149 >Feature sequence150 315 1103 gene locus_tag LOCUS_15110 315 1103 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064238.1 protein_id gnl|my_center|LOCUS_15110 1719 1078 gene locus_tag LOCUS_15120 1719 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 <2299 1735 gene locus_tag LOCUS_15130 <2299 1735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064502.1:class I SAM-dependent methyltransferase family protein >Feature sequence151 367 741 gene locus_tag LOCUS_15140 367 741 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763557.1 protein_id gnl|my_center|LOCUS_15140 755 1570 gene locus_tag LOCUS_15150 gene speE 755 1570 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879823.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence152 221 1663 gene locus_tag LOCUS_15160 gene der 221 1663 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011069468.1 protein_id gnl|my_center|LOCUS_15160 1669 2256 gene locus_tag LOCUS_15170 1669 2256 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence153 64 486 gene locus_tag LOCUS_15180 64 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15180 524 1072 gene locus_tag LOCUS_15190 524 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15190 1072 1269 gene locus_tag LOCUS_15200 1072 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1347 1625 gene locus_tag LOCUS_15210 1347 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 1588 2169 gene locus_tag LOCUS_15220 1588 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 >Feature sequence154 2181 1375 gene locus_tag LOCUS_15230 2181 1375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence155 1126 377 gene locus_tag LOCUS_15240 1126 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 1603 1157 gene locus_tag LOCUS_15250 1603 1157 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319580.1 protein_id gnl|my_center|LOCUS_15250 <2199 1650 gene locus_tag LOCUS_15260 <2199 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878912.1:chloride channel protein >Feature sequence156 <1 1012 gene locus_tag LOCUS_15270 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877755.1:ORC1-type DNA replication protein 1047 1760 gene locus_tag LOCUS_15280 1047 1760 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_15280 >Feature sequence157 805 1113 gene locus_tag LOCUS_15290 805 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 1082 1351 gene locus_tag LOCUS_15300 1082 1351 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003417760.1 protein_id gnl|my_center|LOCUS_15300 1439 1794 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaatcccctcgaatcgggtcatgttttccaa >Feature sequence158 <2069 308 gene locus_tag LOCUS_15310 <2069 308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867777.1:GNAT family N-acetyltransferase >Feature sequence159 1037 1306 gene locus_tag LOCUS_15320 1037 1306 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_15320 1553 1284 gene locus_tag LOCUS_15330 1553 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence160 1166 621 gene locus_tag LOCUS_15340 1166 621 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320297.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence161 >Feature sequence162 <1994 129 gene locus_tag LOCUS_15350 <1994 129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878895.1:PKD domain-containing protein >Feature sequence163 684 1925 gene locus_tag LOCUS_15360 684 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence164 179 1258 gene locus_tag LOCUS_15370 179 1258 CDS product baseplate J/gp47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000951745.1 protein_id gnl|my_center|LOCUS_15370 >Feature sequence165 1217 1798 gene locus_tag LOCUS_15380 1217 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869810.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence166 1046 135 gene locus_tag LOCUS_15390 1046 135 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879648.1 protein_id gnl|my_center|LOCUS_15390 1826 1080 gene locus_tag LOCUS_15400 1826 1080 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877926.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence167 1763 1152 gene locus_tag LOCUS_15410 1763 1152 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879461.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence168 371 661 gene locus_tag LOCUS_15420 371 661 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020159.1 protein_id gnl|my_center|LOCUS_15420 654 1022 gene locus_tag LOCUS_15430 654 1022 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020160.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence169 350 943 gene locus_tag LOCUS_15440 350 943 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878379.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence170 <1 1447 gene locus_tag LOCUS_15450 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852169.1:primosomal protein N' >Feature sequence171 571 14 gene locus_tag LOCUS_15460 gene cas4 571 14 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879370.1 protein_id gnl|my_center|LOCUS_15460 809 531 gene locus_tag LOCUS_15470 gene cas2 809 531 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846845.1 protein_id gnl|my_center|LOCUS_15470 <1751 806 gene locus_tag LOCUS_15480 <1751 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879371.1:CRISPR-associated endonuclease Cas1 >Feature sequence172 <1 751 gene locus_tag LOCUS_15490 <1 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023015.1:2-oxoacid:ferredoxin oxidoreductase subunit beta 791 867 gene locus_tag LOCUS_t00440 791 867 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence173 236 679 gene locus_tag LOCUS_15500 236 679 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867448.1 protein_id gnl|my_center|LOCUS_15500 669 1286 gene locus_tag LOCUS_15510 669 1286 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978387.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence174 134 796 gene locus_tag LOCUS_15520 134 796 CDS product tRNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868627.1 protein_id gnl|my_center|LOCUS_15520 <1575 780 gene locus_tag LOCUS_15530 <1575 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980358.1:chorismate synthase >Feature sequence175 <1 1026 gene locus_tag LOCUS_15540 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877731.1:acetyl-CoA carboxylase biotin carboxylase subunit 1281 1030 gene locus_tag LOCUS_15550 1281 1030 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879278.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence176 1501 950 gene locus_tag LOCUS_15560 1501 950 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270468.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence177 152 1405 gene locus_tag LOCUS_15570 152 1405 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064462.1 protein_id gnl|my_center|LOCUS_15570