>Feature sequence001 537 169 gene locus_tag LOCUS_00010 537 169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1315 617 gene locus_tag LOCUS_00020 1315 617 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080208.1 protein_id gnl|my_center|LOCUS_00020 2236 1547 gene locus_tag LOCUS_00030 2236 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 4120 2363 gene locus_tag LOCUS_00040 4120 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 4743 4120 gene locus_tag LOCUS_00050 4743 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5131 7182 gene locus_tag LOCUS_00060 5131 7182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7732 7190 gene locus_tag LOCUS_00070 7732 7190 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812954.1 protein_id gnl|my_center|LOCUS_00070 8285 9289 gene locus_tag LOCUS_00080 8285 9289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 9446 10426 gene locus_tag LOCUS_00090 9446 10426 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088167.1 protein_id gnl|my_center|LOCUS_00090 11566 10724 gene locus_tag LOCUS_00100 11566 10724 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405001.1 protein_id gnl|my_center|LOCUS_00100 12752 11571 gene locus_tag LOCUS_00110 gene aroC 12752 11571 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879991.1 protein_id gnl|my_center|LOCUS_00110 12820 13071 gene locus_tag LOCUS_00120 12820 13071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 14040 13822 gene locus_tag LOCUS_00130 14040 13822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14357 15001 gene locus_tag LOCUS_00140 14357 15001 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223578.1 protein_id gnl|my_center|LOCUS_00140 15554 15348 gene locus_tag LOCUS_00150 15554 15348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15532 16128 gene locus_tag LOCUS_00160 15532 16128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 >Feature sequence002 286 38 gene locus_tag LOCUS_00170 286 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 1383 475 gene locus_tag LOCUS_00180 1383 475 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902562.1 protein_id gnl|my_center|LOCUS_00180 2462 1383 gene locus_tag LOCUS_00190 2462 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 5139 2689 gene locus_tag LOCUS_00200 5139 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 8021 5430 gene locus_tag LOCUS_00210 8021 5430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 8924 8148 gene locus_tag LOCUS_00220 gene phnC 8924 8148 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000569258.1 protein_id gnl|my_center|LOCUS_00220 9913 9017 gene locus_tag LOCUS_00230 9913 9017 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000915065.1 protein_id gnl|my_center|LOCUS_00230 10432 11004 gene locus_tag LOCUS_00240 gene raiA 10432 11004 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773749.1 protein_id gnl|my_center|LOCUS_00240 11089 11565 gene locus_tag LOCUS_00250 11089 11565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 13214 12003 gene locus_tag LOCUS_00260 gene thiI 13214 12003 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391742.1 protein_id gnl|my_center|LOCUS_00260 14073 13222 gene locus_tag LOCUS_00270 14073 13222 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257863.1 protein_id gnl|my_center|LOCUS_00270 >Feature sequence003 529 1713 gene locus_tag LOCUS_00280 529 1713 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940010.1 protein_id gnl|my_center|LOCUS_00280 2071 3012 gene locus_tag LOCUS_00290 2071 3012 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940009.1 protein_id gnl|my_center|LOCUS_00290 3205 4470 gene locus_tag LOCUS_00300 3205 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 4457 5227 gene locus_tag LOCUS_00310 4457 5227 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773590.1 protein_id gnl|my_center|LOCUS_00310 5227 5937 gene locus_tag LOCUS_00320 5227 5937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940006.1 protein_id gnl|my_center|LOCUS_00320 6655 6161 gene locus_tag LOCUS_00330 6655 6161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 6881 8008 gene locus_tag LOCUS_00340 gene alr 6881 8008 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542276.1 protein_id gnl|my_center|LOCUS_00340 8447 8599 gene locus_tag LOCUS_00350 8447 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 8640 9701 gene locus_tag LOCUS_00360 8640 9701 CDS product M4 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028408.1 protein_id gnl|my_center|LOCUS_00360 9698 10192 gene locus_tag LOCUS_00370 9698 10192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 10531 10196 gene locus_tag LOCUS_00380 10531 10196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 12042 10678 gene locus_tag LOCUS_00390 12042 10678 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969758.1 protein_id gnl|my_center|LOCUS_00390 <13025 12472 gene locus_tag LOCUS_00400 <13025 12472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909322.1:DNA repair protein RecO >Feature sequence004 <1 813 gene locus_tag LOCUS_00410 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868526.1:pyruvate kinase 815 1513 gene locus_tag LOCUS_00420 815 1513 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_00420 1757 2605 gene locus_tag LOCUS_00430 1757 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 4509 3277 gene locus_tag LOCUS_00440 4509 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 5057 4506 gene locus_tag LOCUS_00450 5057 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 5469 5068 gene locus_tag LOCUS_00460 5469 5068 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546602.1 protein_id gnl|my_center|LOCUS_00460 6458 5466 gene locus_tag LOCUS_00470 6458 5466 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_00470 7514 6462 gene locus_tag LOCUS_00480 7514 6462 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080192.1 protein_id gnl|my_center|LOCUS_00480 8229 7804 gene locus_tag LOCUS_00490 8229 7804 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250967.1 protein_id gnl|my_center|LOCUS_00490 8769 8248 gene locus_tag LOCUS_00500 8769 8248 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227870.1 protein_id gnl|my_center|LOCUS_00500 9554 8769 gene locus_tag LOCUS_00510 9554 8769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 9979 9551 gene locus_tag LOCUS_00520 9979 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 10549 10064 gene locus_tag LOCUS_00530 10549 10064 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867668.1 protein_id gnl|my_center|LOCUS_00530 11006 10593 gene locus_tag LOCUS_00540 11006 10593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 11328 11071 gene locus_tag LOCUS_00550 11328 11071 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933389.1 protein_id gnl|my_center|LOCUS_00550 >Feature sequence005 <1 1481 gene locus_tag LOCUS_00560 <1 1481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein 1600 4311 gene locus_tag LOCUS_00570 1600 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 4804 8340 gene locus_tag LOCUS_00580 4804 8340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 8832 11522 gene locus_tag LOCUS_00590 8832 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 >Feature sequence006 1839 262 gene locus_tag LOCUS_00600 1839 262 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_00600 4110 1918 gene locus_tag LOCUS_00610 gene nuoL 4110 1918 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392500.1 protein_id gnl|my_center|LOCUS_00610 4472 4161 gene locus_tag LOCUS_00620 gene nuoK 4472 4161 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257849.1 protein_id gnl|my_center|LOCUS_00620 5018 4524 gene locus_tag LOCUS_00630 5018 4524 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392498.1 protein_id gnl|my_center|LOCUS_00630 6219 5032 gene locus_tag LOCUS_00640 gene nuoH 6219 5032 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_00640 6685 6326 gene locus_tag LOCUS_00650 gene ndhC 6685 6326 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257856.1 protein_id gnl|my_center|LOCUS_00650 7151 7723 gene locus_tag LOCUS_00660 7151 7723 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259489.1 protein_id gnl|my_center|LOCUS_00660 8206 8541 gene locus_tag LOCUS_00670 8206 8541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 8796 8548 gene locus_tag LOCUS_00680 gene xseB 8796 8548 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483079.1 protein_id gnl|my_center|LOCUS_00680 9815 9009 gene locus_tag LOCUS_00690 9815 9009 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256410.1 protein_id gnl|my_center|LOCUS_00690 <12055 9828 gene locus_tag LOCUS_00700 <12055 9828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256869.1:transglycosylase SLT domain-containing protein >Feature sequence007 1411 2070 gene locus_tag LOCUS_00710 1411 2070 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985059.1 protein_id gnl|my_center|LOCUS_00710 2325 2131 gene locus_tag LOCUS_00720 2325 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 2742 3029 gene locus_tag LOCUS_00730 2742 3029 CDS product isoamylase early set domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477072.1 protein_id gnl|my_center|LOCUS_00730 3105 4067 gene locus_tag LOCUS_00740 3105 4067 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479988.1 protein_id gnl|my_center|LOCUS_00740 4481 4053 gene locus_tag LOCUS_00750 4481 4053 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_00750 4795 6213 gene locus_tag LOCUS_00760 4795 6213 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257378.1 protein_id gnl|my_center|LOCUS_00760 6595 10275 gene locus_tag LOCUS_00770 6595 10275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 10462 11271 gene locus_tag LOCUS_00780 10462 11271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 >Feature sequence008 <1 2368 gene locus_tag LOCUS_00790 <1 2368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246149.1:ATP-dependent helicase MrfA 3079 2417 gene locus_tag LOCUS_00800 3079 2417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00800 4170 3127 gene locus_tag LOCUS_00810 4170 3127 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812002.1 protein_id gnl|my_center|LOCUS_00810 5191 4220 gene locus_tag LOCUS_00820 5191 4220 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144111.1 protein_id gnl|my_center|LOCUS_00820 7191 5335 gene locus_tag LOCUS_00830 7191 5335 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256915.1 protein_id gnl|my_center|LOCUS_00830 8449 7445 gene locus_tag LOCUS_00840 8449 7445 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258123.1 protein_id gnl|my_center|LOCUS_00840 9449 8442 gene locus_tag LOCUS_00850 9449 8442 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258124.1 protein_id gnl|my_center|LOCUS_00850 <11402 9623 gene locus_tag LOCUS_00860 <11402 9623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258812.1:mannose-1-phosphate guanyltransferase >Feature sequence009 737 3097 gene locus_tag LOCUS_00870 737 3097 CDS product transglutaminaseTgpA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259434.1 protein_id gnl|my_center|LOCUS_00870 4597 3320 gene locus_tag LOCUS_00880 4597 3320 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258489.1 protein_id gnl|my_center|LOCUS_00880 5254 4604 gene locus_tag LOCUS_00890 5254 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 5898 5251 gene locus_tag LOCUS_00900 5898 5251 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257009.1 protein_id gnl|my_center|LOCUS_00900 6421 7551 gene locus_tag LOCUS_00910 6421 7551 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259079.1 protein_id gnl|my_center|LOCUS_00910 7777 8967 gene locus_tag LOCUS_00920 7777 8967 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259080.1 protein_id gnl|my_center|LOCUS_00920 8970 10178 gene locus_tag LOCUS_00930 8970 10178 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259081.1 protein_id gnl|my_center|LOCUS_00930 10230 11009 gene locus_tag LOCUS_00940 10230 11009 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259082.1 protein_id gnl|my_center|LOCUS_00940 >Feature sequence010 481 296 gene locus_tag LOCUS_00950 481 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 2050 986 gene locus_tag LOCUS_00960 2050 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 2212 2982 gene locus_tag LOCUS_00970 2212 2982 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_00970 2979 3839 gene locus_tag LOCUS_00980 gene murI 2979 3839 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_00980 3844 5769 gene locus_tag LOCUS_00990 3844 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 5805 6464 gene locus_tag LOCUS_01000 5805 6464 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461976.1 protein_id gnl|my_center|LOCUS_01000 6479 7498 gene locus_tag LOCUS_01010 6479 7498 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765045.1 protein_id gnl|my_center|LOCUS_01010 8192 7488 gene locus_tag LOCUS_01020 8192 7488 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_01020 8484 8912 gene locus_tag LOCUS_01030 8484 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 8980 9543 gene locus_tag LOCUS_01040 8980 9543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 10559 9591 gene locus_tag LOCUS_01050 10559 9591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 >Feature sequence011 344 805 gene locus_tag LOCUS_01060 344 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 1100 3292 gene locus_tag LOCUS_01070 1100 3292 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869551.1 protein_id gnl|my_center|LOCUS_01070 3401 4396 gene locus_tag LOCUS_01080 3401 4396 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085774.1 protein_id gnl|my_center|LOCUS_01080 4393 4863 gene locus_tag LOCUS_01090 gene rnhA 4393 4863 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084134.1 protein_id gnl|my_center|LOCUS_01090 5698 4871 gene locus_tag LOCUS_01100 gene yidA 5698 4871 CDS product sugar-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704455.1 protein_id gnl|my_center|LOCUS_01100 6555 5695 gene locus_tag LOCUS_01110 gene prmC 6555 5695 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257490.1 protein_id gnl|my_center|LOCUS_01110 7204 6581 gene locus_tag LOCUS_01120 7204 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 8111 7233 gene locus_tag LOCUS_01130 8111 7233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 9342 8272 gene locus_tag LOCUS_01140 gene prfA 9342 8272 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869569.1 protein_id gnl|my_center|LOCUS_01140 9918 9349 gene locus_tag LOCUS_01150 9918 9349 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633254.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence012 784 1512 gene locus_tag LOCUS_01160 784 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 1537 1773 gene locus_tag LOCUS_01170 1537 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 1822 3156 gene locus_tag LOCUS_01180 1822 3156 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391475.1 protein_id gnl|my_center|LOCUS_01180 3339 4361 gene locus_tag LOCUS_01190 3339 4361 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_01190 4374 6083 gene locus_tag LOCUS_01200 4374 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 6094 6909 gene locus_tag LOCUS_01210 6094 6909 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887678.1 protein_id gnl|my_center|LOCUS_01210 6921 7634 gene locus_tag LOCUS_01220 6921 7634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173391.1 protein_id gnl|my_center|LOCUS_01220 7846 9360 gene locus_tag LOCUS_01230 7846 9360 CDS product thermostable carboxypeptidase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174078.1 protein_id gnl|my_center|LOCUS_01230 9418 9768 gene locus_tag LOCUS_01240 9418 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 <10622 9841 gene locus_tag LOCUS_01250 <10622 9841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256863.1:imidazolonepropionase >Feature sequence013 1978 107 gene locus_tag LOCUS_01260 gene uvrC 1978 107 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257899.1 protein_id gnl|my_center|LOCUS_01260 2900 2121 gene locus_tag LOCUS_01270 gene cofE 2900 2121 CDS product coenzyme F420-0:L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876650.1 protein_id gnl|my_center|LOCUS_01270 3579 2905 gene locus_tag LOCUS_01280 gene npdG 3579 2905 CDS product NADPH-dependent F420 reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060779.1 protein_id gnl|my_center|LOCUS_01280 3790 5202 gene locus_tag LOCUS_01290 3790 5202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 5210 6019 gene locus_tag LOCUS_01300 5210 6019 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257704.1 protein_id gnl|my_center|LOCUS_01300 6194 9784 gene locus_tag LOCUS_01310 6194 9784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 >Feature sequence014 <1 529 gene locus_tag LOCUS_01320 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256862.1:histidine ammonia-lyase 729 2438 gene locus_tag LOCUS_01330 gene ade 729 2438 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338640.1 protein_id gnl|my_center|LOCUS_01330 4040 2499 gene locus_tag LOCUS_01340 gene rny 4040 2499 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258580.1 protein_id gnl|my_center|LOCUS_01340 4752 4096 gene locus_tag LOCUS_01350 gene recX 4752 4096 CDS product recombination regulator RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243354.1 protein_id gnl|my_center|LOCUS_01350 6024 5005 gene locus_tag LOCUS_01360 gene recA 6024 5005 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030442.1 protein_id gnl|my_center|LOCUS_01360 6343 6182 gene locus_tag LOCUS_01370 6343 6182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 8156 6336 gene locus_tag LOCUS_01380 8156 6336 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391425.1 protein_id gnl|my_center|LOCUS_01380 8578 8192 gene locus_tag LOCUS_01390 8578 8192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 9507 8575 gene locus_tag LOCUS_01400 9507 8575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 >Feature sequence015 605 1018 gene locus_tag LOCUS_01410 605 1018 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_01410 1174 1037 gene locus_tag LOCUS_01420 1174 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 3444 1534 gene locus_tag LOCUS_01430 gene acs 3444 1534 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255917.1 protein_id gnl|my_center|LOCUS_01430 5406 3499 gene locus_tag LOCUS_01440 5406 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 5588 5406 gene locus_tag LOCUS_01450 5588 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 6124 5621 gene locus_tag LOCUS_01460 6124 5621 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879260.1 protein_id gnl|my_center|LOCUS_01460 6790 6137 gene locus_tag LOCUS_01470 gene upp 6790 6137 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257403.1 protein_id gnl|my_center|LOCUS_01470 7604 7212 gene locus_tag LOCUS_01480 7604 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 7878 8903 gene locus_tag LOCUS_01490 gene ruvB 7878 8903 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941738.1 protein_id gnl|my_center|LOCUS_01490 9044 9754 gene locus_tag LOCUS_01500 9044 9754 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256366.1 protein_id gnl|my_center|LOCUS_01500 >Feature sequence016 <1 847 gene locus_tag LOCUS_01510 <1 847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256315.1:dTDP-4-dehydrorhamnose reductase 914 1144 gene locus_tag LOCUS_01520 914 1144 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227972.1 protein_id gnl|my_center|LOCUS_01520 1141 1524 gene locus_tag LOCUS_01530 1141 1524 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141769.1 protein_id gnl|my_center|LOCUS_01530 1577 2455 gene locus_tag LOCUS_01540 1577 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 2706 2386 gene locus_tag LOCUS_01550 2706 2386 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015575.1 protein_id gnl|my_center|LOCUS_01550 2895 2719 gene locus_tag LOCUS_01560 2895 2719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 3127 2888 gene locus_tag LOCUS_01570 3127 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 3165 3389 gene locus_tag LOCUS_01580 3165 3389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 5218 3710 gene locus_tag LOCUS_01590 5218 3710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 7086 5221 gene locus_tag LOCUS_01600 7086 5221 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324152.1 protein_id gnl|my_center|LOCUS_01600 7646 7176 gene locus_tag LOCUS_01610 7646 7176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 9939 8188 gene locus_tag LOCUS_01620 9939 8188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence017 1451 927 gene locus_tag LOCUS_01630 1451 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 2339 1740 gene locus_tag LOCUS_01640 2339 1740 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880959.1 protein_id gnl|my_center|LOCUS_01640 2524 3309 gene locus_tag LOCUS_01650 gene cobB2 2524 3309 CDS product NAD-dependent protein deacylase Cob2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877626.1 protein_id gnl|my_center|LOCUS_01650 5421 3388 gene locus_tag LOCUS_01660 5421 3388 CDS product FG-GAP-like repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141450.1 protein_id gnl|my_center|LOCUS_01660 6517 5543 gene locus_tag LOCUS_01670 6517 5543 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255943.1 protein_id gnl|my_center|LOCUS_01670 7537 6581 gene locus_tag LOCUS_01680 gene secF 7537 6581 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258878.1 protein_id gnl|my_center|LOCUS_01680 8929 7574 gene locus_tag LOCUS_01690 gene secD 8929 7574 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258879.1 protein_id gnl|my_center|LOCUS_01690 >Feature sequence018 1670 891 gene locus_tag LOCUS_01700 1670 891 CDS product SWIM zinc finger family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064836.1 protein_id gnl|my_center|LOCUS_01700 4920 1705 gene locus_tag LOCUS_01710 4920 1705 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142263.1 protein_id gnl|my_center|LOCUS_01710 5709 7145 gene locus_tag LOCUS_01720 5709 7145 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815926.1 protein_id gnl|my_center|LOCUS_01720 7214 8131 gene locus_tag LOCUS_01730 7214 8131 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940421.1 protein_id gnl|my_center|LOCUS_01730 8124 8975 gene locus_tag LOCUS_01740 8124 8975 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086912.1 protein_id gnl|my_center|LOCUS_01740 >Feature sequence019 1976 360 gene locus_tag LOCUS_01750 1976 360 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257008.1 protein_id gnl|my_center|LOCUS_01750 2507 2079 gene locus_tag LOCUS_01760 2507 2079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 2711 2627 gene locus_tag LOCUS_t00010 2711 2627 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4432 2744 gene locus_tag LOCUS_01770 4432 2744 CDS product peptide ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258196.1 protein_id gnl|my_center|LOCUS_01770 4678 4457 gene locus_tag LOCUS_01780 gene secG 4678 4457 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258195.1 protein_id gnl|my_center|LOCUS_01780 4975 5778 gene locus_tag LOCUS_01790 4975 5778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 5858 6739 gene locus_tag LOCUS_01800 5858 6739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 6903 9437 gene locus_tag LOCUS_01810 6903 9437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence020 1603 1971 gene locus_tag LOCUS_01820 1603 1971 CDS product YccF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056657.1 protein_id gnl|my_center|LOCUS_01820 2131 2808 gene locus_tag LOCUS_01830 gene lepB 2131 2808 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392487.1 protein_id gnl|my_center|LOCUS_01830 2805 3383 gene locus_tag LOCUS_01840 gene rpiB 2805 3383 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161952859.1 protein_id gnl|my_center|LOCUS_01840 3400 4305 gene locus_tag LOCUS_01850 3400 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4271 4963 gene locus_tag LOCUS_01860 4271 4963 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257323.1 protein_id gnl|my_center|LOCUS_01860 4964 5719 gene locus_tag LOCUS_01870 4964 5719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 7005 5743 gene locus_tag LOCUS_01880 7005 5743 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941582.1 protein_id gnl|my_center|LOCUS_01880 7459 7187 gene locus_tag LOCUS_01890 7459 7187 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868835.1 protein_id gnl|my_center|LOCUS_01890 8137 7826 gene locus_tag LOCUS_01900 8137 7826 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_01900 8451 8137 gene locus_tag LOCUS_01910 8451 8137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 9120 8455 gene locus_tag LOCUS_01920 9120 8455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141518.1 protein_id gnl|my_center|LOCUS_01920 <9732 9117 gene locus_tag LOCUS_01930 <9732 9117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815263.1:ethanolamine utilization protein EutJ >Feature sequence021 1481 1020 gene locus_tag LOCUS_01940 1481 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 1645 2445 gene locus_tag LOCUS_01950 1645 2445 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_01950 3992 2718 gene locus_tag LOCUS_01960 3992 2718 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459409.1 protein_id gnl|my_center|LOCUS_01960 4396 4878 gene locus_tag LOCUS_01970 4396 4878 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172509.1 protein_id gnl|my_center|LOCUS_01970 4883 5224 gene locus_tag LOCUS_01980 4883 5224 CDS product DUF952 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142756.1 protein_id gnl|my_center|LOCUS_01980 7509 5614 gene locus_tag LOCUS_01990 7509 5614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 8063 7512 gene locus_tag LOCUS_02000 8063 7512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 8547 8963 gene locus_tag LOCUS_02010 8547 8963 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172491.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence022 317 1771 gene locus_tag LOCUS_02020 317 1771 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081252.1 protein_id gnl|my_center|LOCUS_02020 2328 3434 gene locus_tag LOCUS_02030 gene gcvT 2328 3434 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259334.1 protein_id gnl|my_center|LOCUS_02030 3706 4098 gene locus_tag LOCUS_02040 gene gcvH 3706 4098 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228002.1 protein_id gnl|my_center|LOCUS_02040 4101 5480 gene locus_tag LOCUS_02050 gene gcvPA 4101 5480 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909428.1 protein_id gnl|my_center|LOCUS_02050 5477 6943 gene locus_tag LOCUS_02060 gene gcvPB 5477 6943 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259338.1 protein_id gnl|my_center|LOCUS_02060 7472 7158 gene locus_tag LOCUS_02070 7472 7158 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258652.1 protein_id gnl|my_center|LOCUS_02070 8052 7660 gene locus_tag LOCUS_02080 8052 7660 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259321.1 protein_id gnl|my_center|LOCUS_02080 8523 8302 gene locus_tag LOCUS_02090 8523 8302 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083352.1 protein_id gnl|my_center|LOCUS_02090 9453 8620 gene locus_tag LOCUS_02100 9453 8620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 >Feature sequence023 1812 364 gene locus_tag LOCUS_02110 1812 364 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_02110 3545 2061 gene locus_tag LOCUS_02120 3545 2061 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_02120 5556 3619 gene locus_tag LOCUS_02130 gene nuoL 5556 3619 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941017.1 protein_id gnl|my_center|LOCUS_02130 5867 5562 gene locus_tag LOCUS_02140 gene nuoK 5867 5562 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480224.1 protein_id gnl|my_center|LOCUS_02140 6423 5920 gene locus_tag LOCUS_02150 6423 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 6990 6511 gene locus_tag LOCUS_02160 6990 6511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 8070 7042 gene locus_tag LOCUS_02170 gene nuoH 8070 7042 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227702.1 protein_id gnl|my_center|LOCUS_02170 <9394 8291 gene locus_tag LOCUS_02180 <9394 8291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482725.1:formate dehydrogenase subunit alpha >Feature sequence024 225 860 gene locus_tag LOCUS_02190 225 860 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634004.1 protein_id gnl|my_center|LOCUS_02190 869 1654 gene locus_tag LOCUS_02200 869 1654 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022068.1 protein_id gnl|my_center|LOCUS_02200 2407 1700 gene locus_tag LOCUS_02210 2407 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 5428 2444 gene locus_tag LOCUS_02220 5428 2444 CDS product PEP/pyruvate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761136.1 protein_id gnl|my_center|LOCUS_02220 5979 7328 gene locus_tag LOCUS_02230 gene gdhA 5979 7328 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_02230 7965 7804 gene locus_tag LOCUS_02240 7965 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 8474 7998 gene locus_tag LOCUS_02250 8474 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 <9183 8538 gene locus_tag LOCUS_02260 <9183 8538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003807632.1:xanthine dehydrogenase family protein molybdopterin-binding subunit >Feature sequence025 79 756 gene locus_tag LOCUS_02270 79 756 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256718.1 protein_id gnl|my_center|LOCUS_02270 753 1196 gene locus_tag LOCUS_02280 753 1196 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268889.1 protein_id gnl|my_center|LOCUS_02280 1238 1837 gene locus_tag LOCUS_02290 1238 1837 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_02290 1838 2749 gene locus_tag LOCUS_02300 1838 2749 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_02300 3276 2956 gene locus_tag LOCUS_02310 3276 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3251 3466 gene locus_tag LOCUS_02320 3251 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5110 3950 gene locus_tag LOCUS_02330 5110 3950 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650945.1 protein_id gnl|my_center|LOCUS_02330 6412 5150 gene locus_tag LOCUS_02340 6412 5150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 >Feature sequence026 3129 421 gene locus_tag LOCUS_02350 3129 421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 4081 3248 gene locus_tag LOCUS_02360 4081 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 5156 4329 gene locus_tag LOCUS_02370 5156 4329 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330566.1 protein_id gnl|my_center|LOCUS_02370 6087 5161 gene locus_tag LOCUS_02380 6087 5161 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003533462.1 protein_id gnl|my_center|LOCUS_02380 7622 6189 gene locus_tag LOCUS_02390 7622 6189 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968416.1 protein_id gnl|my_center|LOCUS_02390 <9142 8059 gene locus_tag LOCUS_02400 <9142 8059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256990.1:ROK family transcriptional regulator >Feature sequence027 882 1118 gene locus_tag LOCUS_02410 882 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 2215 1115 gene locus_tag LOCUS_02420 2215 1115 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256879.1 protein_id gnl|my_center|LOCUS_02420 2784 3071 gene locus_tag LOCUS_02430 2784 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 3068 3730 gene locus_tag LOCUS_02440 3068 3730 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_02440 3859 4239 gene locus_tag LOCUS_02450 3859 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 5699 4245 gene locus_tag LOCUS_02460 gene nhaA 5699 4245 CDS product sodium/proton antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001049644.1 protein_id gnl|my_center|LOCUS_02460 7331 6300 gene locus_tag LOCUS_02470 7331 6300 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257791.1 protein_id gnl|my_center|LOCUS_02470 7822 7355 gene locus_tag LOCUS_02480 7822 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 8964 7819 gene locus_tag LOCUS_02490 8964 7819 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256015.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence028 488 1435 gene locus_tag LOCUS_02500 gene rsgA 488 1435 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257131.1 protein_id gnl|my_center|LOCUS_02500 1710 3929 gene locus_tag LOCUS_02510 1710 3929 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257189.1 protein_id gnl|my_center|LOCUS_02510 4646 4248 gene locus_tag LOCUS_02520 4646 4248 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971327.1 protein_id gnl|my_center|LOCUS_02520 4869 4630 gene locus_tag LOCUS_02530 4869 4630 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545607.1 protein_id gnl|my_center|LOCUS_02530 5221 7053 gene locus_tag LOCUS_02540 5221 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 7201 7884 gene locus_tag LOCUS_02550 7201 7884 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259730.1 protein_id gnl|my_center|LOCUS_02550 7922 8746 gene locus_tag LOCUS_02560 7922 8746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 >Feature sequence029 3439 1646 gene locus_tag LOCUS_02570 3439 1646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257580.1 protein_id gnl|my_center|LOCUS_02570 3925 4944 gene locus_tag LOCUS_02580 3925 4944 CDS product LLM class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256339.1 protein_id gnl|my_center|LOCUS_02580 5361 4999 gene locus_tag LOCUS_02590 5361 4999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 5789 8164 gene locus_tag LOCUS_02600 5789 8164 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767612.1 protein_id gnl|my_center|LOCUS_02600 >Feature sequence030 1601 159 gene locus_tag LOCUS_02610 1601 159 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057246.1 protein_id gnl|my_center|LOCUS_02610 3396 1615 gene locus_tag LOCUS_02620 3396 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 4129 3401 gene locus_tag LOCUS_02630 4129 3401 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839424.1 protein_id gnl|my_center|LOCUS_02630 <8296 4486 gene locus_tag LOCUS_02640 <8296 4486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393372.1:DNA polymerase III subunit alpha >Feature sequence031 396 578 gene locus_tag LOCUS_02650 396 578 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002153498.1 protein_id gnl|my_center|LOCUS_02650 692 1090 gene locus_tag LOCUS_02660 gene rpsH 692 1090 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925182.1 protein_id gnl|my_center|LOCUS_02660 1184 1729 gene locus_tag LOCUS_02670 gene rplF 1184 1729 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583360.1 protein_id gnl|my_center|LOCUS_02670 1763 2131 gene locus_tag LOCUS_02680 gene rplR 1763 2131 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925411.1 protein_id gnl|my_center|LOCUS_02680 2162 2710 gene locus_tag LOCUS_02690 gene rpsE 2162 2710 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003892859.1 protein_id gnl|my_center|LOCUS_02690 2714 2908 gene locus_tag LOCUS_02700 gene rpmD 2714 2908 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974250.1 protein_id gnl|my_center|LOCUS_02700 2905 3360 gene locus_tag LOCUS_02710 gene rplO 2905 3360 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225819.1 protein_id gnl|my_center|LOCUS_02710 3413 4735 gene locus_tag LOCUS_02720 gene secY 3413 4735 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258251.1 protein_id gnl|my_center|LOCUS_02720 4905 5576 gene locus_tag LOCUS_02730 gene map 4905 5576 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013913605.1 protein_id gnl|my_center|LOCUS_02730 5863 6237 gene locus_tag LOCUS_02740 gene rpsM 5863 6237 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869905.1 protein_id gnl|my_center|LOCUS_02740 6364 6762 gene locus_tag LOCUS_02750 gene rpsK 6364 6762 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_02750 6824 7462 gene locus_tag LOCUS_02760 gene rpsD 6824 7462 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393909.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence032 <1 748 gene locus_tag LOCUS_02770 <1 748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257484.1:immune inhibitor A 755 2047 gene locus_tag LOCUS_02780 755 2047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 2108 3220 gene locus_tag LOCUS_02790 2108 3220 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257503.1 protein_id gnl|my_center|LOCUS_02790 3304 3912 gene locus_tag LOCUS_02800 3304 3912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 4150 4689 gene locus_tag LOCUS_02810 4150 4689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 4719 5645 gene locus_tag LOCUS_02820 4719 5645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 5688 6866 gene locus_tag LOCUS_02830 5688 6866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 6926 7531 gene locus_tag LOCUS_02840 6926 7531 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256556.1 protein_id gnl|my_center|LOCUS_02840 >Feature sequence033 1878 175 gene locus_tag LOCUS_02850 1878 175 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479769.1 protein_id gnl|my_center|LOCUS_02850 2021 3421 gene locus_tag LOCUS_02860 2021 3421 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679079.1 protein_id gnl|my_center|LOCUS_02860 4238 3462 gene locus_tag LOCUS_02870 gene map 4238 3462 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480012.1 protein_id gnl|my_center|LOCUS_02870 6142 4247 gene locus_tag LOCUS_02880 gene selB 6142 4247 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256152.1 protein_id gnl|my_center|LOCUS_02880 7366 6149 gene locus_tag LOCUS_02890 7366 6149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240460.1 protein_id gnl|my_center|LOCUS_02890 <8158 7499 gene locus_tag LOCUS_02900 <8158 7499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003390868.1:3-hydroxybutyryl-CoA dehydrogenase >Feature sequence034 <1 1299 gene locus_tag LOCUS_02910 <1 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929460.1:pitrilysin family protein 1299 1703 gene locus_tag LOCUS_02920 gene acpS 1299 1703 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256379.1 protein_id gnl|my_center|LOCUS_02920 2053 1667 gene locus_tag LOCUS_02930 2053 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 2268 2053 gene locus_tag LOCUS_02940 2268 2053 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_02940 3235 2594 gene locus_tag LOCUS_02950 3235 2594 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_02950 3350 4675 gene locus_tag LOCUS_02960 3350 4675 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392478.1 protein_id gnl|my_center|LOCUS_02960 4907 6973 gene locus_tag LOCUS_02970 gene fusA 4907 6973 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392656.1 protein_id gnl|my_center|LOCUS_02970 7596 7988 gene locus_tag LOCUS_02980 7596 7988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence035 1167 868 gene locus_tag LOCUS_02990 1167 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1764 1207 gene locus_tag LOCUS_03000 1764 1207 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017175.1 protein_id gnl|my_center|LOCUS_03000 2070 3323 gene locus_tag LOCUS_03010 gene fabF 2070 3323 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881115.1 protein_id gnl|my_center|LOCUS_03010 3313 4605 gene locus_tag LOCUS_03020 3313 4605 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258268.1 protein_id gnl|my_center|LOCUS_03020 4750 5484 gene locus_tag LOCUS_03030 4750 5484 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259042.1 protein_id gnl|my_center|LOCUS_03030 5584 6027 gene locus_tag LOCUS_03040 5584 6027 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_03040 6130 7101 gene locus_tag LOCUS_03050 6130 7101 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037397288.1 protein_id gnl|my_center|LOCUS_03050 >Feature sequence036 1186 476 gene locus_tag LOCUS_03060 1186 476 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763250.1 protein_id gnl|my_center|LOCUS_03060 1941 1186 gene locus_tag LOCUS_03070 1941 1186 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809682.1 protein_id gnl|my_center|LOCUS_03070 2909 1938 gene locus_tag LOCUS_03080 2909 1938 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546311.1 protein_id gnl|my_center|LOCUS_03080 3766 2906 gene locus_tag LOCUS_03090 3766 2906 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_03090 5200 3866 gene locus_tag LOCUS_03100 5200 3866 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240446.1 protein_id gnl|my_center|LOCUS_03100 7636 5606 gene locus_tag LOCUS_03110 7636 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 7662 7838 gene locus_tag LOCUS_03120 7662 7838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence037 605 135 gene locus_tag LOCUS_03130 605 135 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_03130 952 650 gene locus_tag LOCUS_03140 952 650 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_03140 1956 1228 gene locus_tag LOCUS_03150 1956 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 3201 1966 gene locus_tag LOCUS_03160 3201 1966 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_03160 4363 3587 gene locus_tag LOCUS_03170 4363 3587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 6200 4707 gene locus_tag LOCUS_03180 6200 4707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 6705 6295 gene locus_tag LOCUS_03190 6705 6295 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218995.1 protein_id gnl|my_center|LOCUS_03190 7310 6738 gene locus_tag LOCUS_03200 7310 6738 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461231.1 protein_id gnl|my_center|LOCUS_03200 7835 7491 gene locus_tag LOCUS_03210 7835 7491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence038 74 409 gene locus_tag LOCUS_03220 74 409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 1217 555 gene locus_tag LOCUS_03230 1217 555 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029248.1 protein_id gnl|my_center|LOCUS_03230 2658 1189 gene locus_tag LOCUS_03240 2658 1189 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391571.1 protein_id gnl|my_center|LOCUS_03240 3143 3847 gene locus_tag LOCUS_03250 3143 3847 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939740.1 protein_id gnl|my_center|LOCUS_03250 4408 4686 gene locus_tag LOCUS_03260 4408 4686 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_03260 4954 6015 gene locus_tag LOCUS_03270 4954 6015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 6179 7570 gene locus_tag LOCUS_03280 6179 7570 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461542.1 protein_id gnl|my_center|LOCUS_03280 >Feature sequence039 <1 619 gene locus_tag LOCUS_03290 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259187.1:argininosuccinate lyase 867 2189 gene locus_tag LOCUS_03300 gene thrC 867 2189 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122990.1 protein_id gnl|my_center|LOCUS_03300 2280 2927 gene locus_tag LOCUS_03310 2280 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 3741 2815 gene locus_tag LOCUS_03320 3741 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 5170 3833 gene locus_tag LOCUS_03330 5170 3833 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081535.1 protein_id gnl|my_center|LOCUS_03330 5386 5174 gene locus_tag LOCUS_03340 5386 5174 CDS product DUF951 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909342.1 protein_id gnl|my_center|LOCUS_03340 5609 6115 gene locus_tag LOCUS_03350 5609 6115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 6202 7419 gene locus_tag LOCUS_03360 6202 7419 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence040 152 715 gene locus_tag LOCUS_03370 152 715 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244053.1 protein_id gnl|my_center|LOCUS_03370 809 937 gene locus_tag LOCUS_03380 809 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 1090 2100 gene locus_tag LOCUS_03390 1090 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 3091 2126 gene locus_tag LOCUS_03400 gene etfA 3091 2126 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398999.1 protein_id gnl|my_center|LOCUS_03400 3871 3104 gene locus_tag LOCUS_03410 3871 3104 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259383.1 protein_id gnl|my_center|LOCUS_03410 5787 4336 gene locus_tag LOCUS_03420 gene gndA 5787 4336 CDS product NADP-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230365.1 protein_id gnl|my_center|LOCUS_03420 6327 6857 gene locus_tag LOCUS_03430 gene aroH 6327 6857 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325001.1 protein_id gnl|my_center|LOCUS_03430 6854 7723 gene locus_tag LOCUS_03440 gene pheA 6854 7723 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038038884.1 protein_id gnl|my_center|LOCUS_03440 >Feature sequence041 238 1245 gene locus_tag LOCUS_03450 238 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 1712 1437 gene locus_tag LOCUS_03460 1712 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 3077 1728 gene locus_tag LOCUS_03470 3077 1728 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880851.1 protein_id gnl|my_center|LOCUS_03470 4049 4438 gene locus_tag LOCUS_03480 4049 4438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 5862 4519 gene locus_tag LOCUS_03490 5862 4519 CDS product patatin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259127.1 protein_id gnl|my_center|LOCUS_03490 6492 5875 gene locus_tag LOCUS_03500 6492 5875 CDS product polyhydroxyalkanoate synthesis regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405394.1 protein_id gnl|my_center|LOCUS_03500 6734 7369 gene locus_tag LOCUS_03510 gene fadR 6734 7369 CDS product TetR family transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227711.1 protein_id gnl|my_center|LOCUS_03510 >Feature sequence042 1969 428 gene locus_tag LOCUS_03520 1969 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 2769 2017 gene locus_tag LOCUS_03530 2769 2017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 3734 2757 gene locus_tag LOCUS_03540 3734 2757 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258376.1 protein_id gnl|my_center|LOCUS_03540 4335 3775 gene locus_tag LOCUS_03550 4335 3775 CDS product DUF4126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003896486.1 protein_id gnl|my_center|LOCUS_03550 6507 4504 gene locus_tag LOCUS_03560 6507 4504 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228453.1 protein_id gnl|my_center|LOCUS_03560 6859 7356 gene locus_tag LOCUS_03570 6859 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence043 840 232 gene locus_tag LOCUS_03580 840 232 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087592.1 protein_id gnl|my_center|LOCUS_03580 1934 837 gene locus_tag LOCUS_03590 gene ugpC 1934 837 CDS product sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867305.1 protein_id gnl|my_center|LOCUS_03590 3357 2053 gene locus_tag LOCUS_03600 3357 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 5371 3542 gene locus_tag LOCUS_03610 5371 3542 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969594.1 protein_id gnl|my_center|LOCUS_03610 6669 5950 gene locus_tag LOCUS_03620 6669 5950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 6913 6746 gene locus_tag LOCUS_03630 6913 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 7338 6916 gene locus_tag LOCUS_03640 7338 6916 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680561.1 protein_id gnl|my_center|LOCUS_03640 7570 7310 gene locus_tag LOCUS_03650 7570 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 >Feature sequence044 906 553 gene locus_tag LOCUS_03660 906 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1618 6162 gene locus_tag LOCUS_03670 1618 6162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 >Feature sequence045 541 2013 gene locus_tag LOCUS_03680 541 2013 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972091.1 protein_id gnl|my_center|LOCUS_03680 2190 2480 gene locus_tag LOCUS_03690 gene eutM 2190 2480 CDS product ethanolamine utilization microcompartment protein EutM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003423991.1 protein_id gnl|my_center|LOCUS_03690 2490 3938 gene locus_tag LOCUS_03700 2490 3938 CDS product ethanolamine ammonia-lyase reactivating factor EutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015945509.1 protein_id gnl|my_center|LOCUS_03700 3970 5337 gene locus_tag LOCUS_03710 3970 5337 CDS product ethanolamine ammonia-lyase subunit EutB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868826.1 protein_id gnl|my_center|LOCUS_03710 5352 6305 gene locus_tag LOCUS_03720 gene eutC 5352 6305 CDS product ethanolamine ammonia-lyase subunit EutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462272.1 protein_id gnl|my_center|LOCUS_03720 6432 7091 gene locus_tag LOCUS_03730 gene eutL 6432 7091 CDS product ethanolamine utilization microcompartment protein EutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462275.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence046 124 786 gene locus_tag LOCUS_03740 124 786 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140681.1 protein_id gnl|my_center|LOCUS_03740 792 1379 gene locus_tag LOCUS_03750 792 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 1498 1854 gene locus_tag LOCUS_03760 1498 1854 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_03760 1964 2518 gene locus_tag LOCUS_03770 1964 2518 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081859.1 protein_id gnl|my_center|LOCUS_03770 2566 4314 gene locus_tag LOCUS_03780 2566 4314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03780 4416 6266 gene locus_tag LOCUS_03790 4416 6266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence047 908 249 gene locus_tag LOCUS_03800 908 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 1912 905 gene locus_tag LOCUS_03810 1912 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 2374 2030 gene locus_tag LOCUS_03820 2374 2030 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062280560.1 protein_id gnl|my_center|LOCUS_03820 2679 2377 gene locus_tag LOCUS_03830 2679 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 4556 2751 gene locus_tag LOCUS_03840 gene lepA 4556 2751 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258913.1 protein_id gnl|my_center|LOCUS_03840 4814 7159 gene locus_tag LOCUS_03850 4814 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 7290 7200 gene locus_tag LOCUS_t00020 7290 7200 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7411 7323 gene locus_tag LOCUS_t00030 7411 7323 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 <1 2367 gene locus_tag LOCUS_03860 <1 2367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023741.1:PKD domain-containing protein 2750 3520 gene locus_tag LOCUS_03870 2750 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 3530 5899 gene locus_tag LOCUS_03880 3530 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 6128 7267 gene locus_tag LOCUS_03890 gene sucC 6128 7267 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257007.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence049 1063 176 gene locus_tag LOCUS_03900 1063 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1845 1072 gene locus_tag LOCUS_03910 gene surE 1845 1072 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258539.1 protein_id gnl|my_center|LOCUS_03910 5516 2235 gene locus_tag LOCUS_03920 5516 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 5869 6756 gene locus_tag LOCUS_03930 gene pdxS 5869 6756 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024119184.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence050 1960 1472 gene locus_tag LOCUS_03940 1960 1472 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003564091.1 protein_id gnl|my_center|LOCUS_03940 4030 2459 gene locus_tag LOCUS_03950 4030 2459 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_03950 4916 4296 gene locus_tag LOCUS_03960 4916 4296 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_03960 5762 4920 gene locus_tag LOCUS_03970 gene amrB 5762 4920 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_093005130.1 protein_id gnl|my_center|LOCUS_03970 6276 5857 gene locus_tag LOCUS_03980 6276 5857 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963082.1 protein_id gnl|my_center|LOCUS_03980 6645 7169 gene locus_tag LOCUS_03990 6645 7169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence051 <1 920 gene locus_tag LOCUS_04000 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989997.1:phosphoglycerate kinase 992 1240 gene locus_tag LOCUS_04010 992 1240 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001192482.1 protein_id gnl|my_center|LOCUS_04010 1224 1625 gene locus_tag LOCUS_04020 1224 1625 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_04020 1622 2053 gene locus_tag LOCUS_04030 1622 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 2109 2843 gene locus_tag LOCUS_04040 gene tpiA 2109 2843 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243394.1 protein_id gnl|my_center|LOCUS_04040 2941 3606 gene locus_tag LOCUS_04050 2941 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 3644 6895 gene locus_tag LOCUS_04060 3644 6895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence052 <1 645 gene locus_tag LOCUS_04070 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582804.1:sugar ABC transporter ATP-binding protein 642 1655 gene locus_tag LOCUS_04080 642 1655 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682144.1 protein_id gnl|my_center|LOCUS_04080 1652 2701 gene locus_tag LOCUS_04090 1652 2701 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000878507.1 protein_id gnl|my_center|LOCUS_04090 2811 3935 gene locus_tag LOCUS_04100 gene lsrB 2811 3935 CDS product autoinducer 2 ABC transporter substrate-binding protein LsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209189.1 protein_id gnl|my_center|LOCUS_04100 4010 5566 gene locus_tag LOCUS_04110 gene lsrK 4010 5566 CDS product autoinducer-2 kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042875210.1 protein_id gnl|my_center|LOCUS_04110 5707 6087 gene locus_tag LOCUS_04120 5707 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 7076 6168 gene locus_tag LOCUS_04130 gene miaA 7076 6168 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256258.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence053 822 1865 gene locus_tag LOCUS_04140 gene bfmBAA 822 1865 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000852555.1 protein_id gnl|my_center|LOCUS_04140 1869 2855 gene locus_tag LOCUS_04150 gene bfmBAB 1869 2855 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000290076.1 protein_id gnl|my_center|LOCUS_04150 2874 3131 gene locus_tag LOCUS_04160 2874 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04160 3189 4559 gene locus_tag LOCUS_04170 3189 4559 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257562.1 protein_id gnl|my_center|LOCUS_04170 5094 7007 gene locus_tag LOCUS_04180 5094 7007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 >Feature sequence054 <1 1328 gene locus_tag LOCUS_04190 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082796.1:leucine--tRNA ligase 2503 3405 gene locus_tag LOCUS_04200 2503 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 4301 3450 gene locus_tag LOCUS_04210 4301 3450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 4870 4457 gene locus_tag LOCUS_04220 gene trxA 4870 4457 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173768.1 protein_id gnl|my_center|LOCUS_04220 5056 5190 gene locus_tag LOCUS_04230 5056 5190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 5278 6141 gene locus_tag LOCUS_04240 5278 6141 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762883.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence055 2178 4091 gene locus_tag LOCUS_04250 2178 4091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 4088 4747 gene locus_tag LOCUS_04260 4088 4747 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392490.1 protein_id gnl|my_center|LOCUS_04260 4850 5179 gene locus_tag LOCUS_04270 4850 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 5354 5509 gene locus_tag LOCUS_04280 5354 5509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 5502 5993 gene locus_tag LOCUS_04290 5502 5993 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258287.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence056 168 686 gene locus_tag LOCUS_04300 gene mraZ 168 686 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286645.1 protein_id gnl|my_center|LOCUS_04300 805 1683 gene locus_tag LOCUS_04310 gene rsmH 805 1683 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256657.1 protein_id gnl|my_center|LOCUS_04310 1871 2251 gene locus_tag LOCUS_04320 1871 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2303 4090 gene locus_tag LOCUS_04330 2303 4090 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256655.1 protein_id gnl|my_center|LOCUS_04330 4087 5529 gene locus_tag LOCUS_04340 4087 5529 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256654.1 protein_id gnl|my_center|LOCUS_04340 5596 6597 gene locus_tag LOCUS_04350 gene mraY 5596 6597 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256653.1 protein_id gnl|my_center|LOCUS_04350 >Feature sequence057 <1 1069 gene locus_tag LOCUS_04360 <1 1069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258498.1:DNA polymerase III subunit beta 1188 1832 gene locus_tag LOCUS_04370 1188 1832 CDS product Yip1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120174.1 protein_id gnl|my_center|LOCUS_04370 4221 2281 gene locus_tag LOCUS_04380 gene gyrB 4221 2281 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226808.1 protein_id gnl|my_center|LOCUS_04380 5363 4341 gene locus_tag LOCUS_04390 5363 4341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 6691 5555 gene locus_tag LOCUS_04400 6691 5555 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393538.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence058 2778 3353 gene locus_tag LOCUS_04410 2778 3353 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008192125.1 protein_id gnl|my_center|LOCUS_04410 3346 4356 gene locus_tag LOCUS_04420 3346 4356 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393336.1 protein_id gnl|my_center|LOCUS_04420 5119 4400 gene locus_tag LOCUS_04430 5119 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 5719 6474 gene locus_tag LOCUS_04440 5719 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence059 <1 1162 gene locus_tag LOCUS_04450 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147443659.1:non-ribosomal peptide synthetase 1333 2412 gene locus_tag LOCUS_04460 1333 2412 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003411661.1 protein_id gnl|my_center|LOCUS_04460 2416 3753 gene locus_tag LOCUS_04470 2416 3753 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083122.1 protein_id gnl|my_center|LOCUS_04470 3757 4509 gene locus_tag LOCUS_04480 3757 4509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4627 4842 gene locus_tag LOCUS_04490 4627 4842 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089636.1 protein_id gnl|my_center|LOCUS_04490 4848 5591 gene locus_tag LOCUS_04500 4848 5591 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957443.1 protein_id gnl|my_center|LOCUS_04500 6533 5748 gene locus_tag LOCUS_04510 6533 5748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 >Feature sequence060 1949 81 gene locus_tag LOCUS_04520 1949 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3073 2099 gene locus_tag LOCUS_04530 3073 2099 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584023.1 protein_id gnl|my_center|LOCUS_04530 3972 3070 gene locus_tag LOCUS_04540 3972 3070 CDS product carbohydrate deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261938.1 protein_id gnl|my_center|LOCUS_04540 5368 4061 gene locus_tag LOCUS_04550 5368 4061 CDS product 6-phospho-beta-glucosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000089165.1 protein_id gnl|my_center|LOCUS_04550 <6937 5615 gene locus_tag LOCUS_04560 <6937 5615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257360.1:alpha-L-arabinofuranosidase >Feature sequence061 1679 1915 gene locus_tag LOCUS_04570 gene acpP 1679 1915 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_04570 1994 2599 gene locus_tag LOCUS_04580 1994 2599 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393661.1 protein_id gnl|my_center|LOCUS_04580 2688 3065 gene locus_tag LOCUS_04590 2688 3065 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680926.1 protein_id gnl|my_center|LOCUS_04590 3981 3091 gene locus_tag LOCUS_04600 3981 3091 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256409.1 protein_id gnl|my_center|LOCUS_04600 5700 4282 gene locus_tag LOCUS_04610 5700 4282 CDS product TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942630.1 protein_id gnl|my_center|LOCUS_04610 6869 5697 gene locus_tag LOCUS_04620 6869 5697 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_04620 >Feature sequence062 1544 756 gene locus_tag LOCUS_04630 1544 756 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004533327.1 protein_id gnl|my_center|LOCUS_04630 3566 1785 gene locus_tag LOCUS_04640 3566 1785 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942954.1 protein_id gnl|my_center|LOCUS_04640 4151 4894 gene locus_tag LOCUS_04650 4151 4894 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228173.1 protein_id gnl|my_center|LOCUS_04650 4914 5201 gene locus_tag LOCUS_04660 4914 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence063 1980 4430 gene locus_tag LOCUS_04670 1980 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 4856 4449 gene locus_tag LOCUS_04680 4856 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence064 444 238 gene locus_tag LOCUS_04690 444 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 721 1167 gene locus_tag LOCUS_04700 721 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 1174 2001 gene locus_tag LOCUS_04710 1174 2001 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789758.1 protein_id gnl|my_center|LOCUS_04710 2013 2399 gene locus_tag LOCUS_04720 2013 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 2407 2667 gene locus_tag LOCUS_04730 2407 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 3425 2664 gene locus_tag LOCUS_04740 3425 2664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 3453 4016 gene locus_tag LOCUS_04750 3453 4016 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963441.1 protein_id gnl|my_center|LOCUS_04750 4013 4579 gene locus_tag LOCUS_04760 gene rsmD 4013 4579 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392453.1 protein_id gnl|my_center|LOCUS_04760 5894 4635 gene locus_tag LOCUS_04770 5894 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 6313 5918 gene locus_tag LOCUS_04780 6313 5918 CDS product disulfide oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228417.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence065 357 1613 gene locus_tag LOCUS_04790 357 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 1616 3049 gene locus_tag LOCUS_04800 1616 3049 CDS product UTP--glucose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775783.1 protein_id gnl|my_center|LOCUS_04800 3640 3128 gene locus_tag LOCUS_04810 3640 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 3876 3637 gene locus_tag LOCUS_04820 3876 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 4140 4592 gene locus_tag LOCUS_04830 4140 4592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 5436 6458 gene locus_tag LOCUS_04840 5436 6458 CDS product LacI family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338815.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence066 <1 673 gene locus_tag LOCUS_04850 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011181584.1:DMT family transporter 832 2553 gene locus_tag LOCUS_04860 832 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964567.1 protein_id gnl|my_center|LOCUS_04860 2550 3104 gene locus_tag LOCUS_04870 2550 3104 CDS product DUF4269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495197.1 protein_id gnl|my_center|LOCUS_04870 4042 3167 gene locus_tag LOCUS_04880 4042 3167 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920502.1 protein_id gnl|my_center|LOCUS_04880 4321 5745 gene locus_tag LOCUS_04890 4321 5745 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259349.1 protein_id gnl|my_center|LOCUS_04890 5788 6237 gene locus_tag LOCUS_04900 5788 6237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173734.1 protein_id gnl|my_center|LOCUS_04900 >Feature sequence067 722 351 gene locus_tag LOCUS_04910 gene rplX 722 351 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003728539.1 protein_id gnl|my_center|LOCUS_04910 1106 738 gene locus_tag LOCUS_04920 gene rplN 1106 738 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041323021.1 protein_id gnl|my_center|LOCUS_04920 1392 1126 gene locus_tag LOCUS_04930 1392 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1597 1394 gene locus_tag LOCUS_04940 gene rpmC 1597 1394 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081820.1 protein_id gnl|my_center|LOCUS_04940 2017 1598 gene locus_tag LOCUS_04950 gene rplP 2017 1598 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055943.1 protein_id gnl|my_center|LOCUS_04950 2681 2034 gene locus_tag LOCUS_04960 gene rpsC 2681 2034 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258237.1 protein_id gnl|my_center|LOCUS_04960 3036 2698 gene locus_tag LOCUS_04970 3036 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 3350 3066 gene locus_tag LOCUS_04980 gene rpsS 3350 3066 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909214.1 protein_id gnl|my_center|LOCUS_04980 4199 3363 gene locus_tag LOCUS_04990 gene rplB 4199 3363 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258234.1 protein_id gnl|my_center|LOCUS_04990 4676 4383 gene locus_tag LOCUS_05000 gene rplW 4676 4383 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869926.1 protein_id gnl|my_center|LOCUS_05000 5334 4681 gene locus_tag LOCUS_05010 gene rplD 5334 4681 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127258.1 protein_id gnl|my_center|LOCUS_05010 5994 5341 gene locus_tag LOCUS_05020 gene rplC 5994 5341 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258231.1 protein_id gnl|my_center|LOCUS_05020 6462 6154 gene locus_tag LOCUS_05030 gene rpsJ 6462 6154 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258230.1 protein_id gnl|my_center|LOCUS_05030 >Feature sequence068 <1 686 gene locus_tag LOCUS_05040 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258269.1:ACP S-malonyltransferase 867 1619 gene locus_tag LOCUS_05050 gene fabG 867 1619 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_05050 1638 2000 gene locus_tag LOCUS_05060 1638 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2003 2464 gene locus_tag LOCUS_05070 gene nusB 2003 2464 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909412.1 protein_id gnl|my_center|LOCUS_05070 2470 2949 gene locus_tag LOCUS_05080 2470 2949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 2946 3785 gene locus_tag LOCUS_05090 gene tatC 2946 3785 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259255.1 protein_id gnl|my_center|LOCUS_05090 3893 5215 gene locus_tag LOCUS_05100 3893 5215 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_05100 5797 5360 gene locus_tag LOCUS_05110 5797 5360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 5990 6445 gene locus_tag LOCUS_05120 5990 6445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 >Feature sequence069 1216 587 gene locus_tag LOCUS_05130 1216 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 2269 1424 gene locus_tag LOCUS_05140 2269 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 2644 3912 gene locus_tag LOCUS_05150 gene icd 2644 3912 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479852.1 protein_id gnl|my_center|LOCUS_05150 4699 3986 gene locus_tag LOCUS_05160 4699 3986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 5548 5024 gene locus_tag LOCUS_05170 5548 5024 CDS product GbsR/MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815169.1 protein_id gnl|my_center|LOCUS_05170 <6616 5839 gene locus_tag LOCUS_05180 <6616 5839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941053.1:NAD(P)H-binding protein >Feature sequence070 <1 768 gene locus_tag LOCUS_05190 <1 768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169802142.1:DUF2877 domain-containing protein 855 1889 gene locus_tag LOCUS_05200 855 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 1972 3561 gene locus_tag LOCUS_05210 1972 3561 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258096.1 protein_id gnl|my_center|LOCUS_05210 4231 3611 gene locus_tag LOCUS_05220 gene tmk 4231 3611 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258097.1 protein_id gnl|my_center|LOCUS_05220 5281 4277 gene locus_tag LOCUS_05230 5281 4277 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973127.1 protein_id gnl|my_center|LOCUS_05230 5965 5408 gene locus_tag LOCUS_05240 5965 5408 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933033.1 protein_id gnl|my_center|LOCUS_05240 >Feature sequence071 1634 216 gene locus_tag LOCUS_05250 gene atpD 1634 216 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393855.1 protein_id gnl|my_center|LOCUS_05250 2604 1699 gene locus_tag LOCUS_05260 2604 1699 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258894.1 protein_id gnl|my_center|LOCUS_05260 4212 2707 gene locus_tag LOCUS_05270 gene atpA 4212 2707 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393857.1 protein_id gnl|my_center|LOCUS_05270 4793 4275 gene locus_tag LOCUS_05280 4793 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 5287 4796 gene locus_tag LOCUS_05290 5287 4796 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258897.1 protein_id gnl|my_center|LOCUS_05290 5573 5340 gene locus_tag LOCUS_05300 5573 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 <6579 5701 gene locus_tag LOCUS_05310 <6579 5701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258899.1:F0F1 ATP synthase subunit A >Feature sequence072 2558 2947 gene locus_tag LOCUS_05320 2558 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3976 3083 gene locus_tag LOCUS_05330 3976 3083 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461122.1 protein_id gnl|my_center|LOCUS_05330 4096 4281 gene locus_tag LOCUS_05340 4096 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 5216 4284 gene locus_tag LOCUS_05350 5216 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 6334 5219 gene locus_tag LOCUS_05360 6334 5219 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545010.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence073 2327 3082 gene locus_tag LOCUS_05370 gene trpC 2327 3082 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_05370 3084 4502 gene locus_tag LOCUS_05380 3084 4502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 4550 5296 gene locus_tag LOCUS_05390 4550 5296 CDS product DUF554 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462325.1 protein_id gnl|my_center|LOCUS_05390 5628 6002 gene locus_tag LOCUS_05400 5628 6002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 >Feature sequence074 871 2037 gene locus_tag LOCUS_05410 871 2037 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337459.1 protein_id gnl|my_center|LOCUS_05410 2124 3245 gene locus_tag LOCUS_05420 2124 3245 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768050.1 protein_id gnl|my_center|LOCUS_05420 3247 4098 gene locus_tag LOCUS_05430 gene potB 3247 4098 CDS product spermidine/putrescine ABC transporter permease PotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000715491.1 protein_id gnl|my_center|LOCUS_05430 4099 4962 gene locus_tag LOCUS_05440 4099 4962 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_05440 5082 5888 gene locus_tag LOCUS_05450 5082 5888 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815921.1 protein_id gnl|my_center|LOCUS_05450 >Feature sequence075 2698 3450 gene locus_tag LOCUS_05460 2698 3450 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250523.1 protein_id gnl|my_center|LOCUS_05460 3995 3534 gene locus_tag LOCUS_05470 3995 3534 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000444695.1 protein_id gnl|my_center|LOCUS_05470 4427 5374 gene locus_tag LOCUS_05480 4427 5374 CDS product uroporphyrinogen decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393601.1 protein_id gnl|my_center|LOCUS_05480 5458 6078 gene locus_tag LOCUS_05490 gene plsY 5458 6078 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392834.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence076 526 56 gene locus_tag LOCUS_05500 526 56 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938350.1 protein_id gnl|my_center|LOCUS_05500 944 660 gene locus_tag LOCUS_05510 944 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 1120 1193 gene locus_tag LOCUS_t00040 1120 1193 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4482 1303 gene locus_tag LOCUS_05520 4482 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 5182 5108 gene locus_tag LOCUS_t00050 5182 5108 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 6318 5293 gene locus_tag LOCUS_05530 gene trxB 6318 5293 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257932.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence077 <1 545 gene locus_tag LOCUS_05540 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909083.1:glutamate 5-kinase 586 1848 gene locus_tag LOCUS_05550 586 1848 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707185.1 protein_id gnl|my_center|LOCUS_05550 1835 2530 gene locus_tag LOCUS_05560 1835 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 5547 3667 gene locus_tag LOCUS_05570 5547 3667 CDS product monovalent cation:proton antiporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395153.1 protein_id gnl|my_center|LOCUS_05570 <6488 5554 gene locus_tag LOCUS_05580 <6488 5554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258219.1:bifunctional ADP-heptose synthase >Feature sequence078 616 2097 gene locus_tag LOCUS_05590 616 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2166 2888 gene locus_tag LOCUS_05600 2166 2888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258681.1 protein_id gnl|my_center|LOCUS_05600 3660 2893 gene locus_tag LOCUS_05610 gene metF 3660 2893 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174022.1 protein_id gnl|my_center|LOCUS_05610 4603 3827 gene locus_tag LOCUS_05620 4603 3827 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256291.1 protein_id gnl|my_center|LOCUS_05620 4979 4623 gene locus_tag LOCUS_05630 gene rplT 4979 4623 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386545.1 protein_id gnl|my_center|LOCUS_05630 5221 5018 gene locus_tag LOCUS_05640 gene rpmI 5221 5018 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545453.1 protein_id gnl|my_center|LOCUS_05640 5903 5307 gene locus_tag LOCUS_05650 5903 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 >Feature sequence079 5682 1822 gene locus_tag LOCUS_05660 5682 1822 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256763.1 protein_id gnl|my_center|LOCUS_05660 >Feature sequence080 3064 797 gene locus_tag LOCUS_05670 3064 797 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_05670 5600 3354 gene locus_tag LOCUS_05680 5600 3354 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence081 <1 631 gene locus_tag LOCUS_05690 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147443659.1:non-ribosomal peptide synthetase >Feature sequence082 2643 1240 gene locus_tag LOCUS_05700 2643 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 3377 2868 gene locus_tag LOCUS_05710 gene rimM 3377 2868 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392484.1 protein_id gnl|my_center|LOCUS_05710 3629 3402 gene locus_tag LOCUS_05720 3629 3402 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870157.1 protein_id gnl|my_center|LOCUS_05720 3982 3713 gene locus_tag LOCUS_05730 3982 3713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 5444 4110 gene locus_tag LOCUS_05740 gene ffh 5444 4110 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813193.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence083 <1 642 gene locus_tag LOCUS_05750 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003229036.1:NAD-dependent epimerase/dehydratase family protein 1943 633 gene locus_tag LOCUS_05760 1943 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 2224 1955 gene locus_tag LOCUS_05770 2224 1955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 2951 2256 gene locus_tag LOCUS_05780 2951 2256 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091835.1 protein_id gnl|my_center|LOCUS_05780 4162 3557 gene locus_tag LOCUS_05790 4162 3557 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583472.1 protein_id gnl|my_center|LOCUS_05790 5679 4159 gene locus_tag LOCUS_05800 5679 4159 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973732.1 protein_id gnl|my_center|LOCUS_05800 5848 5774 gene locus_tag LOCUS_t00060 5848 5774 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence084 482 853 gene locus_tag LOCUS_05810 gene rplQ 482 853 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545032.1 protein_id gnl|my_center|LOCUS_05810 865 1656 gene locus_tag LOCUS_05820 gene truA 865 1656 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118979.1 protein_id gnl|my_center|LOCUS_05820 1699 2130 gene locus_tag LOCUS_05830 gene rplM 1699 2130 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_05830 2145 2546 gene locus_tag LOCUS_05840 gene rpsI 2145 2546 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258262.1 protein_id gnl|my_center|LOCUS_05840 2946 3347 gene locus_tag LOCUS_05850 2946 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3582 4916 gene locus_tag LOCUS_05860 3582 4916 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257949.1 protein_id gnl|my_center|LOCUS_05860 4953 5897 gene locus_tag LOCUS_05870 gene era 4953 5897 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392137.1 protein_id gnl|my_center|LOCUS_05870 >Feature sequence085 959 57 gene locus_tag LOCUS_05880 959 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391696.1 protein_id gnl|my_center|LOCUS_05880 1258 983 gene locus_tag LOCUS_05890 1258 983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3797 1263 gene locus_tag LOCUS_05900 3797 1263 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_05900 4559 5653 gene locus_tag LOCUS_05910 4559 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence086 593 246 gene locus_tag LOCUS_05920 593 246 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074374.1 protein_id gnl|my_center|LOCUS_05920 817 590 gene locus_tag LOCUS_05930 817 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142284.1 protein_id gnl|my_center|LOCUS_05930 946 2262 gene locus_tag LOCUS_05940 946 2262 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897229.1 protein_id gnl|my_center|LOCUS_05940 2460 3452 gene locus_tag LOCUS_05950 gene argF 2460 3452 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_05950 3460 4704 gene locus_tag LOCUS_05960 3460 4704 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705213.1 protein_id gnl|my_center|LOCUS_05960 4776 6131 gene locus_tag LOCUS_05970 gene hydA 4776 6131 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030900.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence087 1288 392 gene locus_tag LOCUS_05980 1288 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 1897 2898 gene locus_tag LOCUS_05990 gene argF 1897 2898 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885260.1 protein_id gnl|my_center|LOCUS_05990 3575 4663 gene locus_tag LOCUS_06000 3575 4663 CDS product tripeptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000052806.1 protein_id gnl|my_center|LOCUS_06000 4712 5764 gene locus_tag LOCUS_06010 4712 5764 CDS product Cj0069 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851763.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence088 3701 75 gene locus_tag LOCUS_06020 3701 75 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258737.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence089 584 1402 gene locus_tag LOCUS_06030 584 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence090 2669 1515 gene locus_tag LOCUS_06040 2669 1515 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259083.1 protein_id gnl|my_center|LOCUS_06040 5896 2744 gene locus_tag LOCUS_06050 5896 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 >Feature sequence091 315 818 gene locus_tag LOCUS_06060 315 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2290 947 gene locus_tag LOCUS_06070 2290 947 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861407.1 protein_id gnl|my_center|LOCUS_06070 3233 2343 gene locus_tag LOCUS_06080 3233 2343 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004205409.1 protein_id gnl|my_center|LOCUS_06080 3442 4056 gene locus_tag LOCUS_06090 3442 4056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4119 5666 gene locus_tag LOCUS_06100 4119 5666 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405139.1 protein_id gnl|my_center|LOCUS_06100 >Feature sequence092 52 510 gene locus_tag LOCUS_06110 52 510 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356741.1 protein_id gnl|my_center|LOCUS_06110 673 2859 gene locus_tag LOCUS_06120 673 2859 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392131.1 protein_id gnl|my_center|LOCUS_06120 2879 3346 gene locus_tag LOCUS_06130 gene ybeY 2879 3346 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392132.1 protein_id gnl|my_center|LOCUS_06130 3606 3977 gene locus_tag LOCUS_06140 3606 3977 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256528.1 protein_id gnl|my_center|LOCUS_06140 3993 4760 gene locus_tag LOCUS_06150 3993 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5354 4806 gene locus_tag LOCUS_06160 gene rplI 5354 4806 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256838.1 protein_id gnl|my_center|LOCUS_06160 5434 5676 gene locus_tag LOCUS_06170 5434 5676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 >Feature sequence093 <1 1233 gene locus_tag LOCUS_06180 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010968113.1:BMP family protein 1610 3139 gene locus_tag LOCUS_06190 1610 3139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_06190 3579 4685 gene locus_tag LOCUS_06200 3579 4685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 4784 5431 gene locus_tag LOCUS_06210 4784 5431 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404017.1 protein_id gnl|my_center|LOCUS_06210 >Feature sequence094 788 1717 gene locus_tag LOCUS_06220 788 1717 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390629.1 protein_id gnl|my_center|LOCUS_06220 3096 1792 gene locus_tag LOCUS_06230 3096 1792 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143837.1 protein_id gnl|my_center|LOCUS_06230 5226 3151 gene locus_tag LOCUS_06240 5226 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5785 5264 gene locus_tag LOCUS_06250 5785 5264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence095 2303 885 gene locus_tag LOCUS_06260 gene sufB 2303 885 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329803.1 protein_id gnl|my_center|LOCUS_06260 3149 2325 gene locus_tag LOCUS_06270 gene sufC 3149 2325 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259318.1 protein_id gnl|my_center|LOCUS_06270 3906 3214 gene locus_tag LOCUS_06280 3906 3214 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257063.1 protein_id gnl|my_center|LOCUS_06280 4175 5860 gene locus_tag LOCUS_06290 4175 5860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence096 88 1173 gene locus_tag LOCUS_06300 88 1173 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972816.1 protein_id gnl|my_center|LOCUS_06300 1289 2665 gene locus_tag LOCUS_06310 gene malE 1289 2665 CDS product maltose/maltodextrin ABC transporter substrate-binding protein MalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103758.1 protein_id gnl|my_center|LOCUS_06310 3484 2843 gene locus_tag LOCUS_06320 3484 2843 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391353.1 protein_id gnl|my_center|LOCUS_06320 4900 3668 gene locus_tag LOCUS_06330 gene tyrS 4900 3668 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393211.1 protein_id gnl|my_center|LOCUS_06330 5559 5083 gene locus_tag LOCUS_06340 5559 5083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence097 1692 1225 gene locus_tag LOCUS_06350 gene bcp 1692 1225 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257872.1 protein_id gnl|my_center|LOCUS_06350 1885 2313 gene locus_tag LOCUS_06360 1885 2313 CDS product nucleoside 2-deoxyribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023482.1 protein_id gnl|my_center|LOCUS_06360 2414 2950 gene locus_tag LOCUS_06370 2414 2950 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257304.1 protein_id gnl|my_center|LOCUS_06370 3095 4438 gene locus_tag LOCUS_06380 gene dnaB 3095 4438 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226923.1 protein_id gnl|my_center|LOCUS_06380 4435 5286 gene locus_tag LOCUS_06390 4435 5286 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256954.1 protein_id gnl|my_center|LOCUS_06390 >Feature sequence098 1383 367 gene locus_tag LOCUS_06400 1383 367 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027683.1 protein_id gnl|my_center|LOCUS_06400 2316 1396 gene locus_tag LOCUS_06410 2316 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06410 3403 2327 gene locus_tag LOCUS_06420 3403 2327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 <5741 3963 gene locus_tag LOCUS_06430 <5741 3963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256833.1:nucleoside-diphosphate sugar epimerase/dehydratase >Feature sequence099 120 2669 gene locus_tag LOCUS_06440 gene mutS 120 2669 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942467.1 protein_id gnl|my_center|LOCUS_06440 2823 4247 gene locus_tag LOCUS_06450 2823 4247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4418 4855 gene locus_tag LOCUS_06460 4418 4855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 5156 5584 gene locus_tag LOCUS_06470 5156 5584 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256747.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence100 406 807 gene locus_tag LOCUS_06480 406 807 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272733.1 protein_id gnl|my_center|LOCUS_06480 1006 2523 gene locus_tag LOCUS_06490 1006 2523 CDS product tetrathionate reductase family octaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073841.1 protein_id gnl|my_center|LOCUS_06490 2520 5252 gene locus_tag LOCUS_06500 2520 5252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 >Feature sequence101 829 1095 gene locus_tag LOCUS_06510 829 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 <5678 1230 gene locus_tag LOCUS_06520 <5678 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257660.1:tetratricopeptide repeat protein >Feature sequence102 1004 630 gene locus_tag LOCUS_06530 1004 630 CDS product Asp23/Gls24 family envelope stress response protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583499.1 protein_id gnl|my_center|LOCUS_06530 1201 1386 gene locus_tag LOCUS_06540 gene rpmB 1201 1386 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_06540 1965 3554 gene locus_tag LOCUS_06550 1965 3554 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_06550 3625 4632 gene locus_tag LOCUS_06560 3625 4632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence103 3054 1174 gene locus_tag LOCUS_06570 3054 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 4489 3104 gene locus_tag LOCUS_06580 gene selA 4489 3104 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256909.1 protein_id gnl|my_center|LOCUS_06580 4658 4584 gene locus_tag LOCUS_t00070 4658 4584 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5010 4765 gene locus_tag LOCUS_06590 gene infA 5010 4765 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258253.1 protein_id gnl|my_center|LOCUS_06590 >Feature sequence104 1750 1094 gene locus_tag LOCUS_06600 1750 1094 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_06600 3254 1938 gene locus_tag LOCUS_06610 3254 1938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 3398 4228 gene locus_tag LOCUS_06620 gene surE 3398 4228 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250088.1 protein_id gnl|my_center|LOCUS_06620 4249 5589 gene locus_tag LOCUS_06630 4249 5589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 >Feature sequence105 686 973 gene locus_tag LOCUS_06640 686 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06640 992 1702 gene locus_tag LOCUS_06650 992 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06650 1704 2225 gene locus_tag LOCUS_06660 1704 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 2222 2671 gene locus_tag LOCUS_06670 2222 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3904 2666 gene locus_tag LOCUS_06680 3904 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3960 4133 gene locus_tag LOCUS_06690 3960 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence106 508 1209 gene locus_tag LOCUS_06700 508 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 1293 2930 gene locus_tag LOCUS_06710 1293 2930 CDS product multicopper oxidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256867.1 protein_id gnl|my_center|LOCUS_06710 3041 3400 gene locus_tag LOCUS_06720 3041 3400 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807906.1 protein_id gnl|my_center|LOCUS_06720 3477 4025 gene locus_tag LOCUS_06730 3477 4025 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402896.1 protein_id gnl|my_center|LOCUS_06730 >Feature sequence107 2065 1715 gene locus_tag LOCUS_06740 2065 1715 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256949.1 protein_id gnl|my_center|LOCUS_06740 3619 2096 gene locus_tag LOCUS_06750 3619 2096 CDS product O-antigen ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259158.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence108 263 1096 gene locus_tag LOCUS_06760 263 1096 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064968.1 protein_id gnl|my_center|LOCUS_06760 1122 2693 gene locus_tag LOCUS_06770 1122 2693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 3463 2711 gene locus_tag LOCUS_06780 3463 2711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 4169 3576 gene locus_tag LOCUS_06790 gene thpR 4169 3576 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392592.1 protein_id gnl|my_center|LOCUS_06790 <5536 4276 gene locus_tag LOCUS_06800 <5536 4276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249880.1:UbiD family decarboxylase >Feature sequence109 1062 2363 gene locus_tag LOCUS_06810 1062 2363 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012775668.1 protein_id gnl|my_center|LOCUS_06810 4265 2469 gene locus_tag LOCUS_06820 4265 2469 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257645.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence110 1433 636 gene locus_tag LOCUS_06830 1433 636 CDS product MIP/aquaporin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173668747.1 protein_id gnl|my_center|LOCUS_06830 2075 3304 gene locus_tag LOCUS_06840 2075 3304 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228625.1 protein_id gnl|my_center|LOCUS_06840 3301 3858 gene locus_tag LOCUS_06850 3301 3858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence111 <5519 3087 gene locus_tag LOCUS_06860 <5519 3087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_128975410.1:non-ribosomal peptide synthase/polyketide synthase note possible pseudo, internal stop codon, frameshifted >Feature sequence112 2196 709 gene locus_tag LOCUS_06870 2196 709 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393496.1 protein_id gnl|my_center|LOCUS_06870 2501 2289 gene locus_tag LOCUS_06880 2501 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 2804 2547 gene locus_tag LOCUS_06890 gene yoeB 2804 2547 CDS product type II toxin-antitoxin system mRNA interferase toxin YoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000767829.1 protein_id gnl|my_center|LOCUS_06890 3052 2801 gene locus_tag LOCUS_06900 gene yefM 3052 2801 CDS product YoeB-YefM toxin-antitoxin system antitoxin YefM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001259256.1 protein_id gnl|my_center|LOCUS_06900 4392 3139 gene locus_tag LOCUS_06910 4392 3139 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393494.1 protein_id gnl|my_center|LOCUS_06910 5351 4395 gene locus_tag LOCUS_06920 gene arcC 5351 4395 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393607.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence113 851 1516 gene locus_tag LOCUS_06930 851 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1536 2966 gene locus_tag LOCUS_06940 gene norB 1536 2966 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_06940 2959 3306 gene locus_tag LOCUS_06950 2959 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 3322 4062 gene locus_tag LOCUS_06960 3322 4062 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229026.1 protein_id gnl|my_center|LOCUS_06960 >Feature sequence114 319 1473 gene locus_tag LOCUS_06970 319 1473 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011815915.1 protein_id gnl|my_center|LOCUS_06970 1600 2313 gene locus_tag LOCUS_06980 1600 2313 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258299.1 protein_id gnl|my_center|LOCUS_06980 2310 3743 gene locus_tag LOCUS_06990 2310 3743 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258298.1 protein_id gnl|my_center|LOCUS_06990 4106 3702 gene locus_tag LOCUS_07000 4106 3702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808741.1 protein_id gnl|my_center|LOCUS_07000 4860 4168 gene locus_tag LOCUS_07010 4860 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence115 1594 1277 gene locus_tag LOCUS_07020 1594 1277 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940899.1 protein_id gnl|my_center|LOCUS_07020 1926 2471 gene locus_tag LOCUS_07030 1926 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 3015 2473 gene locus_tag LOCUS_07040 3015 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 4365 3088 gene locus_tag LOCUS_07050 4365 3088 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259028.1 protein_id gnl|my_center|LOCUS_07050 5357 4392 gene locus_tag LOCUS_07060 5357 4392 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence116 5136 733 gene locus_tag LOCUS_07070 5136 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence117 847 1476 gene locus_tag LOCUS_07080 847 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1528 2625 gene locus_tag LOCUS_07090 1528 2625 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943452.1 protein_id gnl|my_center|LOCUS_07090 2654 3772 gene locus_tag LOCUS_07100 2654 3772 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061625.1 protein_id gnl|my_center|LOCUS_07100 3769 4707 gene locus_tag LOCUS_07110 3769 4707 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943450.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence118 1293 43 gene locus_tag LOCUS_07120 gene fabF 1293 43 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_07120 1566 2126 gene locus_tag LOCUS_07130 1566 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2147 2998 gene locus_tag LOCUS_07140 2147 2998 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228320.1 protein_id gnl|my_center|LOCUS_07140 3016 3384 gene locus_tag LOCUS_07150 3016 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 3707 4942 gene locus_tag LOCUS_07160 3707 4942 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460503.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence119 623 1036 gene locus_tag LOCUS_07170 gene nrdR 623 1036 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259262.1 protein_id gnl|my_center|LOCUS_07170 1271 3823 gene locus_tag LOCUS_07180 1271 3823 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_07180 3893 4882 gene locus_tag LOCUS_07190 3893 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 4836 5009 gene locus_tag LOCUS_07200 4836 5009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence120 20 694 gene locus_tag LOCUS_07210 20 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 822 1664 gene locus_tag LOCUS_07220 822 1664 CDS product DegV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002288394.1 protein_id gnl|my_center|LOCUS_07220 1914 1708 gene locus_tag LOCUS_07230 1914 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 2087 3100 gene locus_tag LOCUS_07240 2087 3100 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963223.1 protein_id gnl|my_center|LOCUS_07240 3128 4051 gene locus_tag LOCUS_07250 3128 4051 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence121 <1 2494 gene locus_tag LOCUS_07260 <1 2494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074039.1:VWA domain-containing protein 3235 2564 gene locus_tag LOCUS_07270 3235 2564 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943465.1 protein_id gnl|my_center|LOCUS_07270 >Feature sequence122 801 415 gene locus_tag LOCUS_07280 801 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1186 782 gene locus_tag LOCUS_07290 1186 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 1296 2879 gene locus_tag LOCUS_07300 gene cimA 1296 2879 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393734.1 protein_id gnl|my_center|LOCUS_07300 3470 2892 gene locus_tag LOCUS_07310 gene cas4 3470 2892 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259413.1 protein_id gnl|my_center|LOCUS_07310 3864 3613 gene locus_tag LOCUS_07320 3864 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 4509 3874 gene locus_tag LOCUS_07330 4509 3874 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258353.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence123 533 2305 gene locus_tag LOCUS_07340 533 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 2390 2629 gene locus_tag LOCUS_07350 2390 2629 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391797.1 protein_id gnl|my_center|LOCUS_07350 2617 3078 gene locus_tag LOCUS_07360 2617 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3425 5185 gene locus_tag LOCUS_07370 3425 5185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 >Feature sequence124 194 1402 gene locus_tag LOCUS_07380 gene amrB 194 1402 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173000.1 protein_id gnl|my_center|LOCUS_07380 1506 3065 gene locus_tag LOCUS_07390 1506 3065 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257930.1 protein_id gnl|my_center|LOCUS_07390 4129 3068 gene locus_tag LOCUS_07400 4129 3068 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_07400 4521 4126 gene locus_tag LOCUS_07410 4521 4126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 4900 4508 gene locus_tag LOCUS_07420 4900 4508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence125 <1 2391 gene locus_tag LOCUS_07430 <1 2391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021839.1:PKD domain-containing protein 2597 3991 gene locus_tag LOCUS_07440 gene mazG 2597 3991 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000014253.1 protein_id gnl|my_center|LOCUS_07440 >Feature sequence126 128 1588 gene locus_tag LOCUS_07450 128 1588 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_07450 1581 2771 gene locus_tag LOCUS_07460 1581 2771 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767224.1 protein_id gnl|my_center|LOCUS_07460 2782 4167 gene locus_tag LOCUS_07470 2782 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence127 1020 241 gene locus_tag LOCUS_07480 1020 241 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338588.1 protein_id gnl|my_center|LOCUS_07480 1454 1813 gene locus_tag LOCUS_07490 1454 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2028 3137 gene locus_tag LOCUS_07500 gene ald 2028 3137 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227783.1 protein_id gnl|my_center|LOCUS_07500 <5208 3262 gene locus_tag LOCUS_07510 <5208 3262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942982.1:TIGR00341 family protein >Feature sequence128 339 1475 gene locus_tag LOCUS_07520 339 1475 CDS product D-alanyl-D-alanine carboxypeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_187296528.1 protein_id gnl|my_center|LOCUS_07520 2093 2977 gene locus_tag LOCUS_07530 2093 2977 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_07530 3030 3749 gene locus_tag LOCUS_07540 3030 3749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3746 4468 gene locus_tag LOCUS_07550 3746 4468 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392843.1 protein_id gnl|my_center|LOCUS_07550 >Feature sequence129 2425 1319 gene locus_tag LOCUS_07560 2425 1319 CDS product PIN/TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256354.1 protein_id gnl|my_center|LOCUS_07560 2735 3049 gene locus_tag LOCUS_07570 2735 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 3058 3864 gene locus_tag LOCUS_07580 3058 3864 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence130 641 2764 gene locus_tag LOCUS_07590 gene gyrA 641 2764 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257126.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07590 2769 3182 gene locus_tag LOCUS_07600 2769 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07600 3199 4587 gene locus_tag LOCUS_07610 3199 4587 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence131 1453 326 gene locus_tag LOCUS_07620 1453 326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393449.1 protein_id gnl|my_center|LOCUS_07620 3042 1450 gene locus_tag LOCUS_07630 3042 1450 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_07630 4498 3173 gene locus_tag LOCUS_07640 4498 3173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence132 347 3721 gene locus_tag LOCUS_07650 347 3721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3727 4734 gene locus_tag LOCUS_07660 3727 4734 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256508.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence133 2 1555 gene locus_tag LOCUS_07670 gene argS 2 1555 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001086456.1 protein_id gnl|my_center|LOCUS_07670 1569 3152 gene locus_tag LOCUS_07680 gene serA 1569 3152 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056180.1 protein_id gnl|my_center|LOCUS_07680 3562 4707 gene locus_tag LOCUS_07690 3562 4707 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_07690 >Feature sequence134 627 121 gene locus_tag LOCUS_07700 627 121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 1510 641 gene locus_tag LOCUS_07710 1510 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2212 1520 gene locus_tag LOCUS_07720 2212 1520 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000080028.1 protein_id gnl|my_center|LOCUS_07720 3426 2482 gene locus_tag LOCUS_07730 3426 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence135 2222 1179 gene locus_tag LOCUS_07740 2222 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 4101 2569 gene locus_tag LOCUS_07750 4101 2569 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence136 1688 2533 gene locus_tag LOCUS_07760 1688 2533 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256973.1 protein_id gnl|my_center|LOCUS_07760 2672 4564 gene locus_tag LOCUS_07770 2672 4564 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence137 3392 957 gene locus_tag LOCUS_07780 3392 957 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259065.1 protein_id gnl|my_center|LOCUS_07780 4098 3766 gene locus_tag LOCUS_07790 4098 3766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 4921 3995 gene locus_tag LOCUS_07800 4921 3995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence138 2286 772 gene locus_tag LOCUS_07810 2286 772 CDS product sugar ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816711.1 protein_id gnl|my_center|LOCUS_07810 3529 2390 gene locus_tag LOCUS_07820 3529 2390 CDS product sugar ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211975.1 protein_id gnl|my_center|LOCUS_07820 4658 3768 gene locus_tag LOCUS_07830 4658 3768 CDS product MurR/RpiR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969648.1 protein_id gnl|my_center|LOCUS_07830 >Feature sequence139 2517 526 gene locus_tag LOCUS_07840 2517 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 3466 2774 gene locus_tag LOCUS_07850 3466 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 3710 5017 gene locus_tag LOCUS_07860 3710 5017 CDS product pyrimidine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485262.1 protein_id gnl|my_center|LOCUS_07860 >Feature sequence140 1741 1667 gene locus_tag LOCUS_t00080 1741 1667 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 2571 1804 gene locus_tag LOCUS_07870 2571 1804 CDS product zf-HC2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256814.1 protein_id gnl|my_center|LOCUS_07870 3182 2568 gene locus_tag LOCUS_07880 3182 2568 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256813.1 protein_id gnl|my_center|LOCUS_07880 3282 3365 gene locus_tag LOCUS_t00090 3282 3365 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3494 4834 gene locus_tag LOCUS_07890 3494 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 >Feature sequence141 924 2282 gene locus_tag LOCUS_07900 924 2282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3593 2352 gene locus_tag LOCUS_07910 gene prf1 3593 2352 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876511.1 protein_id gnl|my_center|LOCUS_07910 4708 4235 gene locus_tag LOCUS_07920 4708 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence142 283 537 gene locus_tag LOCUS_07930 283 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 1184 579 gene locus_tag LOCUS_07940 1184 579 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815727.1 protein_id gnl|my_center|LOCUS_07940 1928 1239 gene locus_tag LOCUS_07950 1928 1239 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258285.1 protein_id gnl|my_center|LOCUS_07950 2739 2098 gene locus_tag LOCUS_07960 2739 2098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 3569 2739 gene locus_tag LOCUS_07970 gene xrt 3569 2739 CDS product exosortase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176633.1 protein_id gnl|my_center|LOCUS_07970 4229 3681 gene locus_tag LOCUS_07980 gene def 4229 3681 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258946.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence143 618 1460 gene locus_tag LOCUS_07990 618 1460 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258662.1 protein_id gnl|my_center|LOCUS_07990 2108 1638 gene locus_tag LOCUS_08000 2108 1638 CDS product MaoC/PaaZ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318983.1 protein_id gnl|my_center|LOCUS_08000 2263 2469 gene locus_tag LOCUS_08010 2263 2469 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393002.1 protein_id gnl|my_center|LOCUS_08010 4170 2509 gene locus_tag LOCUS_08020 4170 2509 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_08020 <4991 4281 gene locus_tag LOCUS_08030 <4991 4281 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461354.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence144 1139 9 gene locus_tag LOCUS_08040 1139 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1924 2811 gene locus_tag LOCUS_08050 gene folD 1924 2811 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666926.1 protein_id gnl|my_center|LOCUS_08050 3929 3135 gene locus_tag LOCUS_08060 3929 3135 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262273.1 protein_id gnl|my_center|LOCUS_08060 4831 4022 gene locus_tag LOCUS_08070 4831 4022 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080494.1 protein_id gnl|my_center|LOCUS_08070 >Feature sequence145 2875 1676 gene locus_tag LOCUS_08080 2875 1676 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003089998.1 protein_id gnl|my_center|LOCUS_08080 3230 4159 gene locus_tag LOCUS_08090 3230 4159 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017870495.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence146 464 213 gene locus_tag LOCUS_08100 464 213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 1306 545 gene locus_tag LOCUS_08110 1306 545 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228133.1 protein_id gnl|my_center|LOCUS_08110 1730 2461 gene locus_tag LOCUS_08120 1730 2461 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258853.1 protein_id gnl|my_center|LOCUS_08120 2895 2458 gene locus_tag LOCUS_08130 gene arfB 2895 2458 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919096.1 protein_id gnl|my_center|LOCUS_08130 2991 4157 gene locus_tag LOCUS_08140 2991 4157 CDS product methionine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257764.1 protein_id gnl|my_center|LOCUS_08140 4162 4848 gene locus_tag LOCUS_08150 4162 4848 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889063.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence147 927 2240 gene locus_tag LOCUS_08160 927 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 2504 3700 gene locus_tag LOCUS_08170 2504 3700 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_08170 >Feature sequence148 578 2173 gene locus_tag LOCUS_08180 gene ctaD 578 2173 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258008.1 protein_id gnl|my_center|LOCUS_08180 2229 2900 gene locus_tag LOCUS_08190 2229 2900 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258004.1 protein_id gnl|my_center|LOCUS_08190 >Feature sequence149 >Feature sequence150 337 1122 gene locus_tag LOCUS_08200 337 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1666 1148 gene locus_tag LOCUS_08210 1666 1148 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080594.1 protein_id gnl|my_center|LOCUS_08210 2355 1813 gene locus_tag LOCUS_08220 2355 1813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 <4906 4078 gene locus_tag LOCUS_08230 <4906 4078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941167.1:M23 family metallopeptidase >Feature sequence151 <1 1250 gene locus_tag LOCUS_08240 <1 1250 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941000.1:leucyl aminopeptidase 2639 1416 gene locus_tag LOCUS_08250 2639 1416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259731.1 protein_id gnl|my_center|LOCUS_08250 4131 2794 gene locus_tag LOCUS_08260 4131 2794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 4770 4252 gene locus_tag LOCUS_08270 gene tpx 4770 4252 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263295.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence152 4089 1018 gene locus_tag LOCUS_08280 4089 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4688 4086 gene locus_tag LOCUS_08290 4688 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence153 1480 2409 gene locus_tag LOCUS_08300 1480 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 2409 3095 gene locus_tag LOCUS_08310 gene sfsA 2409 3095 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391969.1 protein_id gnl|my_center|LOCUS_08310 4208 3144 gene locus_tag LOCUS_08320 gene trpS 4208 3144 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889658.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence154 1821 463 gene locus_tag LOCUS_08330 1821 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 1970 3688 gene locus_tag LOCUS_08340 1970 3688 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_08340 3688 4590 gene locus_tag LOCUS_08350 3688 4590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence155 1 123 gene locus_tag LOCUS_08360 1 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 137 787 gene locus_tag LOCUS_08370 gene tsaB 137 787 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257859.1 protein_id gnl|my_center|LOCUS_08370 824 1822 gene locus_tag LOCUS_08380 824 1822 CDS product bile acid:sodium symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942059.1 protein_id gnl|my_center|LOCUS_08380 1826 2380 gene locus_tag LOCUS_08390 gene rimI 1826 2380 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393645.1 protein_id gnl|my_center|LOCUS_08390 2400 3020 gene locus_tag LOCUS_08400 2400 3020 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256875.1 protein_id gnl|my_center|LOCUS_08400 3226 4809 gene locus_tag LOCUS_08410 3226 4809 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392583.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence156 46 990 gene locus_tag LOCUS_08420 46 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 1000 1395 gene locus_tag LOCUS_08430 1000 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1498 2409 gene locus_tag LOCUS_08440 1498 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 2477 2980 gene locus_tag LOCUS_08450 2477 2980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3017 4252 gene locus_tag LOCUS_08460 3017 4252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence157 350 679 gene locus_tag LOCUS_08470 350 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 701 973 gene locus_tag LOCUS_08480 701 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1004 1384 gene locus_tag LOCUS_08490 1004 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 1421 2026 gene locus_tag LOCUS_08500 1421 2026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 2039 2587 gene locus_tag LOCUS_08510 2039 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2987 2733 gene locus_tag LOCUS_08520 2987 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 4328 3216 gene locus_tag LOCUS_08530 4328 3216 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258295.1 protein_id gnl|my_center|LOCUS_08530 <4853 4325 gene locus_tag LOCUS_08540 <4853 4325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256019.1:response regulator transcription factor >Feature sequence158 915 121 gene locus_tag LOCUS_08550 915 121 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_08550 2305 1100 gene locus_tag LOCUS_08560 2305 1100 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_08560 3132 2458 gene locus_tag LOCUS_08570 3132 2458 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257688.1 protein_id gnl|my_center|LOCUS_08570 4226 3177 gene locus_tag LOCUS_08580 4226 3177 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256970.1 protein_id gnl|my_center|LOCUS_08580 <4853 4338 gene locus_tag LOCUS_08590 <4853 4338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256971.1:branched-chain amino acid ABC transporter permease >Feature sequence159 172 1002 gene locus_tag LOCUS_08600 172 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 2824 1100 gene locus_tag LOCUS_08610 2824 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 3635 2847 gene locus_tag LOCUS_08620 3635 2847 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114813.1 protein_id gnl|my_center|LOCUS_08620 3977 3639 gene locus_tag LOCUS_08630 3977 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 4620 3985 gene locus_tag LOCUS_08640 4620 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 >Feature sequence160 765 85 gene locus_tag LOCUS_08650 gene rpe 765 85 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_08650 2889 895 gene locus_tag LOCUS_08660 gene tkt 2889 895 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301211.1 protein_id gnl|my_center|LOCUS_08660 3118 3612 gene locus_tag LOCUS_08670 3118 3612 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_08670 4479 3718 gene locus_tag LOCUS_08680 4479 3718 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392941.1 protein_id gnl|my_center|LOCUS_08680 >Feature sequence161 <1 1691 gene locus_tag LOCUS_08690 <1 1691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257113.1:DNA translocase FtsK 2460 1903 gene locus_tag LOCUS_08700 gene ycnK 2460 1903 CDS product copper uptake transcriptional regulator YcnK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003246724.1 protein_id gnl|my_center|LOCUS_08700 2800 3240 gene locus_tag LOCUS_08710 2800 3240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3274 4128 gene locus_tag LOCUS_08720 3274 4128 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_08720 4507 4220 gene locus_tag LOCUS_08730 4507 4220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 >Feature sequence162 4141 3275 gene locus_tag LOCUS_08740 gene mtnP 4141 3275 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_08740 >Feature sequence163 1400 840 gene locus_tag LOCUS_08750 gene rfaH 1400 840 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957829.1 protein_id gnl|my_center|LOCUS_08750 2520 1552 gene locus_tag LOCUS_08760 2520 1552 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000037020.1 protein_id gnl|my_center|LOCUS_08760 4230 2536 gene locus_tag LOCUS_08770 4230 2536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence164 232 564 gene locus_tag LOCUS_08780 232 564 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583568.1 protein_id gnl|my_center|LOCUS_08780 790 2817 gene locus_tag LOCUS_08790 790 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 2845 3234 gene locus_tag LOCUS_08800 gene rbfA 2845 3234 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216910.1 protein_id gnl|my_center|LOCUS_08800 3227 4213 gene locus_tag LOCUS_08810 3227 4213 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082036.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence165 2557 701 gene locus_tag LOCUS_08820 gene ftsH 2557 701 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257906.1 protein_id gnl|my_center|LOCUS_08820 2659 4167 gene locus_tag LOCUS_08830 2659 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence166 871 380 gene locus_tag LOCUS_08840 871 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 4198 884 gene locus_tag LOCUS_08850 4198 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence167 484 215 gene locus_tag LOCUS_08860 484 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 1381 611 gene locus_tag LOCUS_08870 1381 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 2002 1445 gene locus_tag LOCUS_08880 2002 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 2787 2014 gene locus_tag LOCUS_08890 2787 2014 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198410.1 protein_id gnl|my_center|LOCUS_08890 3878 3093 gene locus_tag LOCUS_08900 gene fabG 3878 3093 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_08900 <4695 3927 gene locus_tag LOCUS_08910 <4695 3927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393460.1:M20 family metallopeptidase >Feature sequence168 1300 320 gene locus_tag LOCUS_08920 1300 320 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259727.1 protein_id gnl|my_center|LOCUS_08920 1632 3233 gene locus_tag LOCUS_08930 1632 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 3311 3877 gene locus_tag LOCUS_08940 3311 3877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 <4666 3870 gene locus_tag LOCUS_08950 <4666 3870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257774.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence169 83 658 gene locus_tag LOCUS_08960 83 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 683 1312 gene locus_tag LOCUS_08970 683 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1357 2400 gene locus_tag LOCUS_08980 1357 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2771 4012 gene locus_tag LOCUS_08990 2771 4012 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429165.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence170 487 395 gene locus_tag LOCUS_t00100 487 395 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 606 518 gene locus_tag LOCUS_t00110 606 518 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1010 2548 gene locus_tag LOCUS_09000 1010 2548 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_09000 4286 2868 gene locus_tag LOCUS_09010 4286 2868 CDS product tyrosine phenol-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256475.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence171 <1 605 gene locus_tag LOCUS_09020 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_237703763.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 771 1418 gene locus_tag LOCUS_09030 771 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 1850 2662 gene locus_tag LOCUS_09040 1850 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2756 3499 gene locus_tag LOCUS_09050 2756 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 3509 3898 gene locus_tag LOCUS_09060 3509 3898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence172 42 248 gene locus_tag LOCUS_09070 42 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 835 320 gene locus_tag LOCUS_09080 835 320 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005111753.1 protein_id gnl|my_center|LOCUS_09080 2059 1022 gene locus_tag LOCUS_09090 2059 1022 CDS product histone deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256249.1 protein_id gnl|my_center|LOCUS_09090 3472 2285 gene locus_tag LOCUS_09100 3472 2285 CDS product spermidine/putrescine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895984.1 protein_id gnl|my_center|LOCUS_09100 4425 3529 gene locus_tag LOCUS_09110 4425 3529 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence173 1915 536 gene locus_tag LOCUS_09120 1915 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 2461 1928 gene locus_tag LOCUS_09130 2461 1928 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084789.1 protein_id gnl|my_center|LOCUS_09130 2671 3396 gene locus_tag LOCUS_09140 2671 3396 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028020226.1 protein_id gnl|my_center|LOCUS_09140 3463 4416 gene locus_tag LOCUS_09150 gene pyrB 3463 4416 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868442.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence174 <1 828 gene locus_tag LOCUS_09160 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108998.1:endo-alpha-mannosidase 1362 958 gene locus_tag LOCUS_09170 1362 958 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256912.1 protein_id gnl|my_center|LOCUS_09170 1918 1490 gene locus_tag LOCUS_09180 1918 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2870 1977 gene locus_tag LOCUS_09190 2870 1977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3886 2873 gene locus_tag LOCUS_09200 gene aroF 3886 2873 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460211.1 protein_id gnl|my_center|LOCUS_09200 <4634 3979 gene locus_tag LOCUS_09210 <4634 3979 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392848.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence175 32 2062 gene locus_tag LOCUS_09220 32 2062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3450 2392 gene locus_tag LOCUS_09230 3450 2392 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257004.1 protein_id gnl|my_center|LOCUS_09230 3613 4512 gene locus_tag LOCUS_09240 3613 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 >Feature sequence176 1601 366 gene locus_tag LOCUS_09250 gene argJ 1601 366 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259189.1 protein_id gnl|my_center|LOCUS_09250 2883 1615 gene locus_tag LOCUS_09260 2883 1615 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808619.1 protein_id gnl|my_center|LOCUS_09260 4141 3233 gene locus_tag LOCUS_09270 4141 3233 CDS product Rv2578c family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776854.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence177 3910 2786 gene locus_tag LOCUS_09280 3910 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 4295 3903 gene locus_tag LOCUS_09290 gene folX 4295 3903 CDS product dihydroneopterin triphosphate 2'-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379302.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence178 64 1326 gene locus_tag LOCUS_09300 64 1326 CDS product exonuclease SbcCD subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909096.1 protein_id gnl|my_center|LOCUS_09300 1396 2166 gene locus_tag LOCUS_09310 1396 2166 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228127.1 protein_id gnl|my_center|LOCUS_09310 2493 2903 gene locus_tag LOCUS_09320 2493 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3279 2992 gene locus_tag LOCUS_09330 3279 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 4518 3430 gene locus_tag LOCUS_09340 4518 3430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 >Feature sequence179 <1 3110 gene locus_tag LOCUS_09350 <1 3110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258948.1:transcription-repair coupling factor 3268 3504 gene locus_tag LOCUS_09360 3268 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 4020 3703 gene locus_tag LOCUS_09370 4020 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence180 1 615 gene locus_tag LOCUS_09380 1 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 652 1275 gene locus_tag LOCUS_09390 652 1275 CDS product DUF47 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966375.1 protein_id gnl|my_center|LOCUS_09390 1423 2712 gene locus_tag LOCUS_09400 1423 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3335 2742 gene locus_tag LOCUS_09410 3335 2742 CDS product serine acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942604.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence181 251 1924 gene locus_tag LOCUS_09420 gene araB 251 1924 CDS product ribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229500.1 protein_id gnl|my_center|LOCUS_09420 1956 2726 gene locus_tag LOCUS_09430 1956 2726 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258153.1 protein_id gnl|my_center|LOCUS_09430 2790 4232 gene locus_tag LOCUS_09440 2790 4232 CDS product rhamnulokinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582815.1 protein_id gnl|my_center|LOCUS_09440 >Feature sequence182 <1 1018 gene locus_tag LOCUS_09450 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003132060.1:DNA helicase PcrA 1044 2948 gene locus_tag LOCUS_09460 1044 2948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3127 4074 gene locus_tag LOCUS_09470 3127 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence183 569 2050 gene locus_tag LOCUS_09480 gene guaB 569 2050 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_09480 2478 2074 gene locus_tag LOCUS_09490 2478 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3100 2615 gene locus_tag LOCUS_09500 3100 2615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 3829 3143 gene locus_tag LOCUS_09510 gene larB 3829 3143 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011100884.1 protein_id gnl|my_center|LOCUS_09510 <4473 3826 gene locus_tag LOCUS_09520 <4473 3826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920840.1:ATP-dependent sacrificial sulfur transferase LarE >Feature sequence184 2 1702 gene locus_tag LOCUS_09530 2 1702 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931407.1 protein_id gnl|my_center|LOCUS_09530 2853 1699 gene locus_tag LOCUS_09540 2853 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 4334 3048 gene locus_tag LOCUS_09550 4334 3048 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933494.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence185 953 48 gene locus_tag LOCUS_09560 953 48 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1122 2369 gene locus_tag LOCUS_09570 1122 2369 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_09570 4002 2596 gene locus_tag LOCUS_09580 4002 2596 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081919.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence186 765 1634 gene locus_tag LOCUS_09590 765 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1638 2906 gene locus_tag LOCUS_09600 1638 2906 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_09600 3131 4024 gene locus_tag LOCUS_09610 3131 4024 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257269.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence187 <1 845 gene locus_tag LOCUS_09620 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142358.1:threonine synthase 850 1524 gene locus_tag LOCUS_09630 850 1524 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256116.1 protein_id gnl|my_center|LOCUS_09630 1944 3407 gene locus_tag LOCUS_09640 1944 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 3474 3926 gene locus_tag LOCUS_09650 gene smpB 3474 3926 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545050.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence188 <1 859 gene locus_tag LOCUS_09660 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816337.1:RNA polymerase sigma factor RpoD 883 1155 gene locus_tag LOCUS_09670 883 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3784 1226 gene locus_tag LOCUS_09680 3784 1226 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941039.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence189 567 85 gene locus_tag LOCUS_09690 567 85 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_09690 1460 672 gene locus_tag LOCUS_09700 gene pstB 1460 672 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256172.1 protein_id gnl|my_center|LOCUS_09700 3075 1465 gene locus_tag LOCUS_09710 3075 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 4018 3134 gene locus_tag LOCUS_09720 gene pstC 4018 3134 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256174.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence190 2365 1826 gene locus_tag LOCUS_09730 2365 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 2654 2508 gene locus_tag LOCUS_09740 2654 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3479 3880 gene locus_tag LOCUS_09750 3479 3880 CDS product PPOX class F420-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228473.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence191 2 313 gene locus_tag LOCUS_09760 2 313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 409 1104 gene locus_tag LOCUS_09770 409 1104 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051618925.1 protein_id gnl|my_center|LOCUS_09770 1244 2248 gene locus_tag LOCUS_09780 1244 2248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2431 4191 gene locus_tag LOCUS_09790 gene aspS 2431 4191 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258183.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence192 3063 199 gene locus_tag LOCUS_09800 3063 199 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928965.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence193 <1 1112 gene locus_tag LOCUS_09810 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256126.1:aspartate-semialdehyde dehydrogenase 2006 1158 gene locus_tag LOCUS_09820 2006 1158 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439262.1 protein_id gnl|my_center|LOCUS_09820 <4387 2142 gene locus_tag LOCUS_09830 <4387 2142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660626.1:endonuclease MutS2 >Feature sequence194 184 654 gene locus_tag LOCUS_09840 gene rpsG 184 654 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393941.1 protein_id gnl|my_center|LOCUS_09840 783 2852 gene locus_tag LOCUS_09850 gene fusA 783 2852 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258228.1 protein_id gnl|my_center|LOCUS_09850 3159 4358 gene locus_tag LOCUS_09860 gene tuf 3159 4358 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence195 327 1805 gene locus_tag LOCUS_09870 327 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 3703 1850 gene locus_tag LOCUS_09880 3703 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence196 <1 1584 gene locus_tag LOCUS_09890 <1 1584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545932.1:molybdopterin biosynthesis protein 1636 1959 gene locus_tag LOCUS_09900 1636 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1959 2660 gene locus_tag LOCUS_09910 1959 2660 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142493.1 protein_id gnl|my_center|LOCUS_09910 2673 3920 gene locus_tag LOCUS_09920 gene recF 2673 3920 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259706.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence197 265 1848 gene locus_tag LOCUS_09930 gene murJ 265 1848 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256387.1 protein_id gnl|my_center|LOCUS_09930 1979 2272 gene locus_tag LOCUS_09940 1979 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 2608 2534 gene locus_tag LOCUS_t00120 2608 2534 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2710 2988 gene locus_tag LOCUS_09950 2710 2988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 3334 3624 gene locus_tag LOCUS_09960 3334 3624 CDS product EutN/CcmL family microcompartment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388667.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence198 234 1229 gene locus_tag LOCUS_09970 234 1229 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404488.1 protein_id gnl|my_center|LOCUS_09970 2921 3880 gene locus_tag LOCUS_09980 gene lipA 2921 3880 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061389.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence199 <4347 522 gene locus_tag LOCUS_09990 <4347 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224968.1:non-ribosomal peptide synthetase note possible pseudo, internal stop codon, frameshifted >Feature sequence200 <4346 1466 gene locus_tag LOCUS_10000 <4346 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169347939.1:non-ribosomal peptide synthase/polyketide synthase >Feature sequence201 1871 996 gene locus_tag LOCUS_10010 1871 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 1997 2818 gene locus_tag LOCUS_10020 gene ilvE 1997 2818 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393743.1 protein_id gnl|my_center|LOCUS_10020 3985 2822 gene locus_tag LOCUS_10030 3985 2822 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181452.1 protein_id gnl|my_center|LOCUS_10030 >Feature sequence202 2383 1673 gene locus_tag LOCUS_10040 2383 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3924 2485 gene locus_tag LOCUS_10050 3924 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence203 2031 1213 gene locus_tag LOCUS_10060 2031 1213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 2677 2288 gene locus_tag LOCUS_10070 2677 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 3460 2828 gene locus_tag LOCUS_10080 3460 2828 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence204 806 2170 gene locus_tag LOCUS_10090 806 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 3580 2984 gene locus_tag LOCUS_10100 3580 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 3824 3585 gene locus_tag LOCUS_10110 3824 3585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence205 590 1303 gene locus_tag LOCUS_10120 590 1303 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256816.1 protein_id gnl|my_center|LOCUS_10120 1368 2204 gene locus_tag LOCUS_10130 gene proC 1368 2204 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258104.1 protein_id gnl|my_center|LOCUS_10130 2248 2502 gene locus_tag LOCUS_10140 2248 2502 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392380.1 protein_id gnl|my_center|LOCUS_10140 3579 2746 gene locus_tag LOCUS_10150 3579 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 <4314 3632 gene locus_tag LOCUS_10160 <4314 3632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257799.1:DNA polymerase III subunit delta' >Feature sequence206 839 1702 gene locus_tag LOCUS_10170 839 1702 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969635.1 protein_id gnl|my_center|LOCUS_10170 1706 2173 gene locus_tag LOCUS_10180 1706 2173 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_10180 >Feature sequence207 1833 2219 gene locus_tag LOCUS_10190 1833 2219 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660364.1 protein_id gnl|my_center|LOCUS_10190 2249 2647 gene locus_tag LOCUS_10200 2249 2647 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930739.1 protein_id gnl|my_center|LOCUS_10200 2672 3424 gene locus_tag LOCUS_10210 2672 3424 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545035.1 protein_id gnl|my_center|LOCUS_10210 3463 4104 gene locus_tag LOCUS_10220 3463 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence208 2 430 gene locus_tag LOCUS_10230 2 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 427 1296 gene locus_tag LOCUS_10240 427 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 1467 2978 gene locus_tag LOCUS_10250 gene gltX 1467 2978 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257408.1 protein_id gnl|my_center|LOCUS_10250 3079 3843 gene locus_tag LOCUS_10260 3079 3843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence209 2802 1597 gene locus_tag LOCUS_10270 2802 1597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 <4289 3041 gene locus_tag LOCUS_10280 <4289 3041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257423.1:LCP family protein >Feature sequence210 <1 1479 gene locus_tag LOCUS_10290 <1 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256966.1:extracellular solute-binding protein 1797 2762 gene locus_tag LOCUS_10300 1797 2762 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256965.1 protein_id gnl|my_center|LOCUS_10300 2777 3847 gene locus_tag LOCUS_10310 2777 3847 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256964.1 protein_id gnl|my_center|LOCUS_10310 >Feature sequence211 1448 315 gene locus_tag LOCUS_10320 1448 315 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121221.1 protein_id gnl|my_center|LOCUS_10320 2293 1460 gene locus_tag LOCUS_10330 2293 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2954 2301 gene locus_tag LOCUS_10340 2954 2301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3990 3031 gene locus_tag LOCUS_10350 gene mvk 3990 3031 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_10350 >Feature sequence212 2599 1904 gene locus_tag LOCUS_10360 2599 1904 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227680.1 protein_id gnl|my_center|LOCUS_10360 3285 2854 gene locus_tag LOCUS_10370 gene moaC 3285 2854 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531740.1 protein_id gnl|my_center|LOCUS_10370 4187 3453 gene locus_tag LOCUS_10380 4187 3453 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227690.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence213 <1 644 gene locus_tag LOCUS_10390 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258288.1:b(o/a)3-type cytochrome-c oxidase subunit 1 737 3178 gene locus_tag LOCUS_10400 737 3178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3325 3705 gene locus_tag LOCUS_10410 3325 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence214 1663 1511 gene locus_tag LOCUS_10420 1663 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 1604 2602 gene locus_tag LOCUS_10430 1604 2602 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_10430 3087 2599 gene locus_tag LOCUS_10440 3087 2599 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256064.1 protein_id gnl|my_center|LOCUS_10440 3995 3096 gene locus_tag LOCUS_10450 gene ftcD 3995 3096 CDS product glutamate formimidoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791589.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence215 3319 566 gene locus_tag LOCUS_10460 3319 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 3969 3316 gene locus_tag LOCUS_10470 3969 3316 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257428.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence216 >Feature sequence217 2003 786 gene locus_tag LOCUS_10480 2003 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 2423 3322 gene locus_tag LOCUS_10490 2423 3322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10490 3315 3929 gene locus_tag LOCUS_10500 3315 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10500 >Feature sequence218 389 691 gene locus_tag LOCUS_10510 389 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 996 703 gene locus_tag LOCUS_10520 996 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1920 1132 gene locus_tag LOCUS_10530 1920 1132 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523383.1 protein_id gnl|my_center|LOCUS_10530 3721 2012 gene locus_tag LOCUS_10540 3721 2012 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392405.1 protein_id gnl|my_center|LOCUS_10540 >Feature sequence219 2476 3267 gene locus_tag LOCUS_10550 2476 3267 CDS product 1-acylglycerol-3-phosphate O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212177.1 protein_id gnl|my_center|LOCUS_10550 3245 3811 gene locus_tag LOCUS_10560 3245 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 >Feature sequence220 1274 306 gene locus_tag LOCUS_10570 1274 306 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259441.1 protein_id gnl|my_center|LOCUS_10570 2572 1544 gene locus_tag LOCUS_10580 gene meaB 2572 1544 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255953.1 protein_id gnl|my_center|LOCUS_10580 3055 2651 gene locus_tag LOCUS_10590 3055 2651 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_10590 3481 3059 gene locus_tag LOCUS_10600 3481 3059 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393269.1 protein_id gnl|my_center|LOCUS_10600 3774 3478 gene locus_tag LOCUS_10610 3774 3478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence221 <1 813 gene locus_tag LOCUS_10620 <1 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403060.1:glycosyltransferase family 4 protein 810 2447 gene locus_tag LOCUS_10630 810 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 3510 2473 gene locus_tag LOCUS_10640 3510 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 >Feature sequence222 <1 540 gene locus_tag LOCUS_10650 <1 540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259387.1:glycosyltransferase 685 1350 gene locus_tag LOCUS_10660 685 1350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 1547 2554 gene locus_tag LOCUS_10670 gene argC 1547 2554 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259290.1 protein_id gnl|my_center|LOCUS_10670 2599 3417 gene locus_tag LOCUS_10680 gene argB 2599 3417 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259245.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence223 <1 678 gene locus_tag LOCUS_10690 <1 678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005457553.1:His-Xaa-Ser system-associated MauG-like protein 1126 3714 gene locus_tag LOCUS_10700 gene extM 1126 3714 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence224 226 2076 gene locus_tag LOCUS_10710 226 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 3520 2270 gene locus_tag LOCUS_10720 3520 2270 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257936.1 protein_id gnl|my_center|LOCUS_10720 <4125 3591 gene locus_tag LOCUS_10730 <4125 3591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141081.1:bifunctional orotidine-5'-phosphate decarboxylase/orotate phosphoribosyltransferase >Feature sequence225 1998 31 gene locus_tag LOCUS_10740 1998 31 CDS product histidine kinase N-terminal 7TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258668.1 protein_id gnl|my_center|LOCUS_10740 2726 2812 gene locus_tag LOCUS_t00130 2726 2812 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2827 2900 gene locus_tag LOCUS_t00140 2827 2900 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2953 3025 gene locus_tag LOCUS_t00150 2953 3025 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3061 3135 gene locus_tag LOCUS_t00160 3061 3135 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3149 3223 gene locus_tag LOCUS_t00170 3149 3223 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3293 3367 gene locus_tag LOCUS_t00180 3293 3367 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3485 4000 gene locus_tag LOCUS_10750 3485 4000 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258555.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence226 1557 916 gene locus_tag LOCUS_10760 1557 916 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022229.1 protein_id gnl|my_center|LOCUS_10760 1995 4034 gene locus_tag LOCUS_10770 1995 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 >Feature sequence227 571 2136 gene locus_tag LOCUS_10780 571 2136 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942841.1 protein_id gnl|my_center|LOCUS_10780 2488 2213 gene locus_tag LOCUS_10790 2488 2213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 <4094 3148 gene locus_tag LOCUS_10800 <4094 3148 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909136.1:glycosyltransferase family 1 protein >Feature sequence228 148 354 gene locus_tag LOCUS_10810 148 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 405 1820 gene locus_tag LOCUS_10820 405 1820 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_10820 1824 3239 gene locus_tag LOCUS_10830 1824 3239 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence229 143 1159 gene locus_tag LOCUS_10840 gene hemB 143 1159 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258455.1 protein_id gnl|my_center|LOCUS_10840 1314 2477 gene locus_tag LOCUS_10850 1314 2477 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046898.1 protein_id gnl|my_center|LOCUS_10850 2911 2474 gene locus_tag LOCUS_10860 2911 2474 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680499.1 protein_id gnl|my_center|LOCUS_10860 3110 2895 gene locus_tag LOCUS_10870 3110 2895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 >Feature sequence230 629 2320 gene locus_tag LOCUS_10880 629 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2317 3849 gene locus_tag LOCUS_10890 2317 3849 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence231 284 1240 gene locus_tag LOCUS_10900 284 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1242 1790 gene locus_tag LOCUS_10910 1242 1790 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193484893.1 protein_id gnl|my_center|LOCUS_10910 1879 2763 gene locus_tag LOCUS_10920 1879 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence232 913 626 gene locus_tag LOCUS_10930 913 626 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631905.1 protein_id gnl|my_center|LOCUS_10930 1476 910 gene locus_tag LOCUS_10940 1476 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 2402 1479 gene locus_tag LOCUS_10950 2402 1479 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257625.1 protein_id gnl|my_center|LOCUS_10950 3457 2402 gene locus_tag LOCUS_10960 3457 2402 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258205.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence233 1150 1659 gene locus_tag LOCUS_10970 1150 1659 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065644.1 protein_id gnl|my_center|LOCUS_10970 3441 2095 gene locus_tag LOCUS_10980 gene ssnA 3441 2095 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence234 >Feature sequence235 <4053 3515 gene locus_tag LOCUS_10990 <4053 3515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000695789.1:response regulator transcription factor >Feature sequence236 1721 2287 gene locus_tag LOCUS_11000 1721 2287 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259761.1 protein_id gnl|my_center|LOCUS_11000 2299 2856 gene locus_tag LOCUS_11010 2299 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence237 1519 215 gene locus_tag LOCUS_11020 1519 215 CDS product acetyl-CoA hydrolase/transferase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228689.1 protein_id gnl|my_center|LOCUS_11020 2619 1516 gene locus_tag LOCUS_11030 gene ald 2619 1516 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583412.1 protein_id gnl|my_center|LOCUS_11030 3159 2644 gene locus_tag LOCUS_11040 3159 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3912 3247 gene locus_tag LOCUS_11050 3912 3247 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327495.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence238 1418 324 gene locus_tag LOCUS_11060 gene ftsZ 1418 324 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811376.1 protein_id gnl|my_center|LOCUS_11060 2785 1565 gene locus_tag LOCUS_11070 gene ftsA 2785 1565 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256643.1 protein_id gnl|my_center|LOCUS_11070 3682 2834 gene locus_tag LOCUS_11080 3682 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence239 <1 763 gene locus_tag LOCUS_11090 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258886.1:MFS transporter 815 2518 gene locus_tag LOCUS_11100 815 2518 CDS product thiamine pyrophosphate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879591.1 protein_id gnl|my_center|LOCUS_11100 2650 2889 gene locus_tag LOCUS_11110 2650 2889 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_11110 3036 3278 gene locus_tag LOCUS_11120 3036 3278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence240 1169 174 gene locus_tag LOCUS_11130 1169 174 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258330.1 protein_id gnl|my_center|LOCUS_11130 2103 1144 gene locus_tag LOCUS_11140 2103 1144 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258329.1 protein_id gnl|my_center|LOCUS_11140 3281 2121 gene locus_tag LOCUS_11150 3281 2121 CDS product NEW3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258328.1 protein_id gnl|my_center|LOCUS_11150 <3972 3408 gene locus_tag LOCUS_11160 <3972 3408 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256115.1:SURF1 family protein >Feature sequence241 195 401 gene locus_tag LOCUS_11170 195 401 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022120.1 protein_id gnl|my_center|LOCUS_11170 523 855 gene locus_tag LOCUS_11180 523 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1040 876 gene locus_tag LOCUS_11190 1040 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1245 2384 gene locus_tag LOCUS_11200 1245 2384 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868793.1 protein_id gnl|my_center|LOCUS_11200 2831 3058 gene locus_tag LOCUS_11210 2831 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3324 3707 gene locus_tag LOCUS_11220 3324 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence242 103 2169 gene locus_tag LOCUS_11230 103 2169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 2727 3017 gene locus_tag LOCUS_11240 gene cas2 2727 3017 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259224.1 protein_id gnl|my_center|LOCUS_11240 3597 3878 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcactatcgggccaaaacccttcggggtactgaaac >Feature sequence243 1507 881 gene locus_tag LOCUS_11250 1507 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3330 1597 gene locus_tag LOCUS_11260 3330 1597 CDS product bifunctional sulfate adenylyltransferase/adenylylsulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257979.1 protein_id gnl|my_center|LOCUS_11260 <3915 3396 gene locus_tag LOCUS_11270 <3915 3396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461043.1:nucleotide sugar dehydrogenase >Feature sequence244 1099 935 gene locus_tag LOCUS_11280 1099 935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 2719 1409 gene locus_tag LOCUS_11290 gene hemL 2719 1409 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207323.1 protein_id gnl|my_center|LOCUS_11290 <3888 2850 gene locus_tag LOCUS_11300 <3888 2850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000862165.1:saccharopine dehydrogenase C-terminal domain-containing protein >Feature sequence245 1726 1343 gene locus_tag LOCUS_11310 1726 1343 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393004.1 protein_id gnl|my_center|LOCUS_11310 2514 1765 gene locus_tag LOCUS_11320 2514 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 <3886 2507 gene locus_tag LOCUS_11330 <3886 2507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258188.1:CCA tRNA nucleotidyltransferase >Feature sequence246 408 2555 gene locus_tag LOCUS_11340 408 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 2637 3833 gene locus_tag LOCUS_11350 2637 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence247 1891 335 gene locus_tag LOCUS_11360 1891 335 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179944194.1 protein_id gnl|my_center|LOCUS_11360 2967 1915 gene locus_tag LOCUS_11370 2967 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 <3871 3060 gene locus_tag LOCUS_11380 <3871 3060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256434.1:ABC transporter permease >Feature sequence248 354 1241 gene locus_tag LOCUS_11390 354 1241 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014330131.1 protein_id gnl|my_center|LOCUS_11390 1440 1976 gene locus_tag LOCUS_11400 1440 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 2093 2626 gene locus_tag LOCUS_11410 2093 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 >Feature sequence249 1237 305 gene locus_tag LOCUS_11420 1237 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2418 1237 gene locus_tag LOCUS_11430 2418 1237 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936352.1 protein_id gnl|my_center|LOCUS_11430 3704 2415 gene locus_tag LOCUS_11440 3704 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 >Feature sequence250 2313 1561 gene locus_tag LOCUS_11450 2313 1561 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660871.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence251 921 541 gene locus_tag LOCUS_11460 921 541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1511 1035 gene locus_tag LOCUS_11470 1511 1035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 1828 2445 gene locus_tag LOCUS_11480 1828 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 >Feature sequence252 2914 1532 gene locus_tag LOCUS_11490 2914 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence253 <1 1649 gene locus_tag LOCUS_11500 <1 1649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261112.1:glucose-6-phosphate isomerase 3026 2757 gene locus_tag LOCUS_11510 3026 2757 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932501.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence254 <1 571 gene locus_tag LOCUS_11520 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257493.1:helicase C-terminal domain-containing protein 679 1236 gene locus_tag LOCUS_11530 gene efp 679 1236 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_11530 1452 2195 gene locus_tag LOCUS_11540 1452 2195 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763553.1 protein_id gnl|my_center|LOCUS_11540 2245 3198 gene locus_tag LOCUS_11550 2245 3198 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907983.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence255 <1 1090 gene locus_tag LOCUS_11560 <1 1090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259263.1:Ppx/GppA phosphatase family protein 1112 1885 gene locus_tag LOCUS_11570 1112 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1885 2385 gene locus_tag LOCUS_11580 1885 2385 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036612.1 protein_id gnl|my_center|LOCUS_11580 2475 3188 gene locus_tag LOCUS_11590 2475 3188 CDS product zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932468.1 protein_id gnl|my_center|LOCUS_11590 >Feature sequence256 3228 622 gene locus_tag LOCUS_11600 3228 622 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546426.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence257 825 124 gene locus_tag LOCUS_11610 825 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator transl_except (pos:complement(571..573),aa:Sec) note codon on position 85 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_11610 1049 2761 gene locus_tag LOCUS_11620 1049 2761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3606 2809 gene locus_tag LOCUS_11630 3606 2809 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174123.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence258 218 700 gene locus_tag LOCUS_11640 218 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence259 303 1364 gene locus_tag LOCUS_11650 gene tdh 303 1364 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868502.1 protein_id gnl|my_center|LOCUS_11650 1407 2591 gene locus_tag LOCUS_11660 1407 2591 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870375.1 protein_id gnl|my_center|LOCUS_11660 2684 3673 gene locus_tag LOCUS_11670 gene glpX 2684 3673 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973930.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence260 1227 292 gene locus_tag LOCUS_11680 1227 292 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257736.1 protein_id gnl|my_center|LOCUS_11680 1318 2139 gene locus_tag LOCUS_11690 1318 2139 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974406.1 protein_id gnl|my_center|LOCUS_11690 3394 2519 gene locus_tag LOCUS_11700 3394 2519 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942660.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence261 914 2053 gene locus_tag LOCUS_11710 gene hrcA 914 2053 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257942.1 protein_id gnl|my_center|LOCUS_11710 2050 3123 gene locus_tag LOCUS_11720 gene cax 2050 3123 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057620.1 protein_id gnl|my_center|LOCUS_11720 3166 3705 gene locus_tag LOCUS_11730 3166 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 >Feature sequence262 952 2139 gene locus_tag LOCUS_11740 952 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 2167 3534 gene locus_tag LOCUS_11750 2167 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 >Feature sequence263 1621 1196 gene locus_tag LOCUS_11760 gene mce 1621 1196 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879707.1 protein_id gnl|my_center|LOCUS_11760 1840 1676 gene locus_tag LOCUS_11770 1840 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 2361 1843 gene locus_tag LOCUS_11780 2361 1843 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437086.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence264 77 865 gene locus_tag LOCUS_11790 77 865 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405168.1 protein_id gnl|my_center|LOCUS_11790 3277 872 gene locus_tag LOCUS_11800 3277 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 >Feature sequence265 500 1633 gene locus_tag LOCUS_11810 500 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_11810 2984 1677 gene locus_tag LOCUS_11820 2984 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 <3696 3114 gene locus_tag LOCUS_11830 <3696 3114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942986.1:plasma-membrane proton-efflux P-type ATPase >Feature sequence266 470 1999 gene locus_tag LOCUS_11840 470 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 <3686 2291 gene locus_tag LOCUS_11850 <3686 2291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012660601.1:long-chain fatty acid--CoA ligase >Feature sequence267 2 847 gene locus_tag LOCUS_11860 2 847 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256245.1 protein_id gnl|my_center|LOCUS_11860 1212 853 gene locus_tag LOCUS_11870 1212 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 1341 2597 gene locus_tag LOCUS_11880 gene megL 1341 2597 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_11880 2625 3554 gene locus_tag LOCUS_11890 2625 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence268 <1 1161 gene locus_tag LOCUS_11900 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927834.1:DNA repair protein RadA 1765 1328 gene locus_tag LOCUS_11910 1765 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 2739 1780 gene locus_tag LOCUS_11920 2739 1780 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773653.1 protein_id gnl|my_center|LOCUS_11920 <3680 2861 gene locus_tag LOCUS_11930 <3680 2861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224902.1:ATP-binding protein >Feature sequence269 <1 565 gene locus_tag LOCUS_11940 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002116438.1:bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH 1122 769 gene locus_tag LOCUS_11950 1122 769 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975010.1 protein_id gnl|my_center|LOCUS_11950 2371 1379 gene locus_tag LOCUS_11960 2371 1379 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172623.1 protein_id gnl|my_center|LOCUS_11960 3410 2463 gene locus_tag LOCUS_11970 3410 2463 CDS product DUF1385 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943726.1 protein_id gnl|my_center|LOCUS_11970 >Feature sequence270 672 2297 gene locus_tag LOCUS_11980 672 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence271 >Feature sequence272 <1 630 gene locus_tag LOCUS_11990 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257950.1:aspartate aminotransferase family protein 1140 1499 gene locus_tag LOCUS_12000 1140 1499 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401238.1 protein_id gnl|my_center|LOCUS_12000 1752 2708 gene locus_tag LOCUS_12010 1752 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 3074 3451 gene locus_tag LOCUS_12020 3074 3451 CDS product SPW repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969441.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence273 259 519 gene locus_tag LOCUS_12030 259 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 495 923 gene locus_tag LOCUS_12040 gene vapC26 495 923 CDS product type II toxin-antitoxin system toxin ribonuclease C26 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403047.1 protein_id gnl|my_center|LOCUS_12040 3238 1412 gene locus_tag LOCUS_12050 3238 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 >Feature sequence274 1429 956 gene locus_tag LOCUS_12060 1429 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 3006 1645 gene locus_tag LOCUS_12070 3006 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence275 720 13 gene locus_tag LOCUS_12080 gene rnc 720 13 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_12080 1768 701 gene locus_tag LOCUS_12090 1768 701 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135177497.1 protein_id gnl|my_center|LOCUS_12090 2078 2698 gene locus_tag LOCUS_12100 2078 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 2709 3317 gene locus_tag LOCUS_12110 2709 3317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 >Feature sequence276 1467 718 gene locus_tag LOCUS_12120 1467 718 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256032.1 protein_id gnl|my_center|LOCUS_12120 2537 1506 gene locus_tag LOCUS_12130 gene yidC 2537 1506 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723726.1 protein_id gnl|my_center|LOCUS_12130 2837 2586 gene locus_tag LOCUS_12140 gene yidD 2837 2586 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256304.1 protein_id gnl|my_center|LOCUS_12140 3198 2815 gene locus_tag LOCUS_12150 gene rnpA 3198 2815 CDS product ribonuclease P protein component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429302.1 protein_id gnl|my_center|LOCUS_12150 3351 3214 gene locus_tag LOCUS_12160 3351 3214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence277 1160 705 gene locus_tag LOCUS_12170 1160 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2119 1397 gene locus_tag LOCUS_12180 2119 1397 CDS product PaeR7I family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176598.1 protein_id gnl|my_center|LOCUS_12180 3129 2116 gene locus_tag LOCUS_12190 3129 2116 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227916.1 protein_id gnl|my_center|LOCUS_12190 <3630 3129 gene locus_tag LOCUS_12200 <3630 3129 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057930.1:DUF87 domain-containing protein >Feature sequence278 688 470 gene locus_tag LOCUS_12210 688 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1140 781 gene locus_tag LOCUS_12220 1140 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 1702 1301 gene locus_tag LOCUS_12230 gene sdhC 1702 1301 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010907882.1 protein_id gnl|my_center|LOCUS_12230 2697 1957 gene locus_tag LOCUS_12240 2697 1957 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939943.1 protein_id gnl|my_center|LOCUS_12240 <3616 2758 gene locus_tag LOCUS_12250 <3616 2758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002211491.1:anaerobic glycerol-3-phosphate dehydrogenase subunit A >Feature sequence279 417 1115 gene locus_tag LOCUS_12260 417 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1112 2587 gene locus_tag LOCUS_12270 1112 2587 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141779.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence280 1264 119 gene locus_tag LOCUS_12280 1264 119 CDS product major facilitator superfamily domain-containing protein 6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242781.1 protein_id gnl|my_center|LOCUS_12280 1377 2210 gene locus_tag LOCUS_12290 1377 2210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2217 3458 gene locus_tag LOCUS_12300 2217 3458 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence281 3070 1451 gene locus_tag LOCUS_12310 gene pckA 3070 1451 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_12310 >Feature sequence282 2627 201 gene locus_tag LOCUS_12320 2627 201 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256479.1 protein_id gnl|my_center|LOCUS_12320 2980 2777 gene locus_tag LOCUS_12330 2980 2777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 3307 3026 gene locus_tag LOCUS_12340 3307 3026 CDS product metal-sensitive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660478.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence283 531 1337 gene locus_tag LOCUS_12350 531 1337 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436783.1 protein_id gnl|my_center|LOCUS_12350 2464 1658 gene locus_tag LOCUS_12360 2464 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence284 1477 626 gene locus_tag LOCUS_12370 1477 626 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258574.1 protein_id gnl|my_center|LOCUS_12370 2733 1534 gene locus_tag LOCUS_12380 gene mqnE 2733 1534 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941110.1 protein_id gnl|my_center|LOCUS_12380 3562 2783 gene locus_tag LOCUS_12390 gene ubiA 3562 2783 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479699.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence285 <1 916 gene locus_tag LOCUS_12400 <1 916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969389.1:iron ABC transporter permease 1218 2306 gene locus_tag LOCUS_12410 1218 2306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_12410 2413 2715 gene locus_tag LOCUS_12420 2413 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 2829 3098 gene locus_tag LOCUS_12430 2829 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 3079 3534 gene locus_tag LOCUS_12440 3079 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence286 <1 1142 gene locus_tag LOCUS_12450 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460641.1:reductive dehalogenase 1504 3333 gene locus_tag LOCUS_12460 1504 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence287 328 2559 gene locus_tag LOCUS_12470 328 2559 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421549.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence288 2119 1439 gene locus_tag LOCUS_12480 2119 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence289 3280 599 gene locus_tag LOCUS_12490 3280 599 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258507.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence290 <1 1447 gene locus_tag LOCUS_12500 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227710.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase 1603 3036 gene locus_tag LOCUS_12510 1603 3036 CDS product sulfide:quinone reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931811.1 protein_id gnl|my_center|LOCUS_12510 3087 3209 gene locus_tag LOCUS_12520 3087 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence291 <1 517 gene locus_tag LOCUS_12530 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839229.1:UvrD-helicase domain-containing protein 1719 745 gene locus_tag LOCUS_12540 1719 745 CDS product D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001046594.1 protein_id gnl|my_center|LOCUS_12540 2007 3215 gene locus_tag LOCUS_12550 2007 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence292 745 77 gene locus_tag LOCUS_12560 745 77 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090825.1 protein_id gnl|my_center|LOCUS_12560 744 2654 gene locus_tag LOCUS_12570 gene mutL 744 2654 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257019.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence293 3469 2735 gene locus_tag LOCUS_12580 3469 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12580 >Feature sequence294 >Feature sequence295 987 457 gene locus_tag LOCUS_12590 987 457 CDS product DUF3341 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256520.1 protein_id gnl|my_center|LOCUS_12590 2361 991 gene locus_tag LOCUS_12600 gene nrfD 2361 991 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256519.1 protein_id gnl|my_center|LOCUS_12600 <3502 2366 gene locus_tag LOCUS_12610 <3502 2366 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258002.1:TAT-variant-translocated molybdopterin oxidoreductase >Feature sequence296 2279 825 gene locus_tag LOCUS_12620 gene fabF 2279 825 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583310.1 protein_id gnl|my_center|LOCUS_12620 3301 2276 gene locus_tag LOCUS_12630 gene plsX 3301 2276 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence297 >Feature sequence298 1315 1043 gene locus_tag LOCUS_12640 gene rpsT 1315 1043 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_12640 1884 2786 gene locus_tag LOCUS_12650 1884 2786 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313706.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence299 1273 401 gene locus_tag LOCUS_12660 1273 401 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_12660 3099 1741 gene locus_tag LOCUS_12670 3099 1741 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258886.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence300 2043 1510 gene locus_tag LOCUS_12680 2043 1510 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066367.1 protein_id gnl|my_center|LOCUS_12680 2824 2899 gene locus_tag LOCUS_t00190 2824 2899 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2996 3421 gene locus_tag LOCUS_12690 2996 3421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 >Feature sequence301 >Feature sequence302 514 1200 gene locus_tag LOCUS_12700 514 1200 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880279.1 protein_id gnl|my_center|LOCUS_12700 1327 1983 gene locus_tag LOCUS_12710 1327 1983 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393618.1 protein_id gnl|my_center|LOCUS_12710 2024 2857 gene locus_tag LOCUS_12720 2024 2857 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007332287.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence303 1555 914 gene locus_tag LOCUS_12730 1555 914 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056493.1 protein_id gnl|my_center|LOCUS_12730 2945 1578 gene locus_tag LOCUS_12740 gene mgtE 2945 1578 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence304 1380 445 gene locus_tag LOCUS_12750 1380 445 CDS product Dam family site-specific DNA-(adenine-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142703.1 protein_id gnl|my_center|LOCUS_12750 2000 1389 gene locus_tag LOCUS_12760 2000 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 3004 1997 gene locus_tag LOCUS_12770 3004 1997 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015940983.1 protein_id gnl|my_center|LOCUS_12770 3408 3217 gene locus_tag LOCUS_12780 3408 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence305 <1 913 gene locus_tag LOCUS_12790 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392432.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD 948 1460 gene locus_tag LOCUS_12800 948 1460 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258548.1 protein_id gnl|my_center|LOCUS_12800 2234 1731 gene locus_tag LOCUS_12810 2234 1731 CDS product nitroreductase family deazaflavin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005090395.1 protein_id gnl|my_center|LOCUS_12810 3142 2246 gene locus_tag LOCUS_12820 3142 2246 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258100.1 protein_id gnl|my_center|LOCUS_12820 >Feature sequence306 1218 1643 gene locus_tag LOCUS_12830 1218 1643 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876928.1 protein_id gnl|my_center|LOCUS_12830 2473 1970 gene locus_tag LOCUS_12840 2473 1970 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence307 2648 1386 gene locus_tag LOCUS_12850 2648 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 <3392 2662 gene locus_tag LOCUS_12860 <3392 2662 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943647.1:NeuD/PglB/VioB family sugar acetyltransferase >Feature sequence308 774 1265 gene locus_tag LOCUS_12870 gene folK 774 1265 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262835.1 protein_id gnl|my_center|LOCUS_12870 1314 2408 gene locus_tag LOCUS_12880 gene ychF 1314 2408 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256516.1 protein_id gnl|my_center|LOCUS_12880 2432 2653 gene locus_tag LOCUS_12890 2432 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 <3375 2714 gene locus_tag LOCUS_12900 <3375 2714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257089.1:[LysW]-lysine hydrolase >Feature sequence309 915 1808 gene locus_tag LOCUS_12910 915 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12910 2205 2279 gene locus_tag LOCUS_t00200 2205 2279 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2313 2388 gene locus_tag LOCUS_t00210 2313 2388 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence310 1918 548 gene locus_tag LOCUS_12920 1918 548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 2191 2589 gene locus_tag LOCUS_12930 2191 2589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 <3344 2698 gene locus_tag LOCUS_12940 <3344 2698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259174.1:radical SAM protein >Feature sequence311 1969 1670 gene locus_tag LOCUS_12950 1969 1670 CDS product putative addiction module antidote protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942189.1 protein_id gnl|my_center|LOCUS_12950 2270 1980 gene locus_tag LOCUS_12960 2270 1980 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_214300674.1 protein_id gnl|my_center|LOCUS_12960 2855 2370 gene locus_tag LOCUS_12970 2855 2370 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730866.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence312 1185 673 gene locus_tag LOCUS_12980 1185 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1878 2993 gene locus_tag LOCUS_12990 1878 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12990 >Feature sequence313 1014 1322 gene locus_tag LOCUS_13000 1014 1322 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259549.1 protein_id gnl|my_center|LOCUS_13000 2889 1336 gene locus_tag LOCUS_13010 gene murJ 2889 1336 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460880.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence314 <1 845 gene locus_tag LOCUS_13020 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012804186.1:AAA family ATPase 845 2065 gene locus_tag LOCUS_13030 845 2065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 3010 2108 gene locus_tag LOCUS_13040 3010 2108 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481519.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence315 1365 1742 gene locus_tag LOCUS_13050 1365 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1795 1923 gene locus_tag LOCUS_13060 1795 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 2878 3009 gene locus_tag LOCUS_13070 2878 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence316 1286 828 gene locus_tag LOCUS_13080 1286 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 1574 2410 gene locus_tag LOCUS_13090 1574 2410 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194053.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence317 270 464 gene locus_tag LOCUS_13100 270 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 1081 542 gene locus_tag LOCUS_13110 1081 542 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020684771.1 protein_id gnl|my_center|LOCUS_13110 1301 3190 gene locus_tag LOCUS_13120 1301 3190 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542552.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence318 1136 210 gene locus_tag LOCUS_13130 1136 210 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940211.1 protein_id gnl|my_center|LOCUS_13130 1718 1248 gene locus_tag LOCUS_13140 1718 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence319 974 327 gene locus_tag LOCUS_13150 974 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1305 3077 gene locus_tag LOCUS_13160 1305 3077 CDS product VanW family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257185.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence320 1376 1582 gene locus_tag LOCUS_13170 1376 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence321 280 2250 gene locus_tag LOCUS_13180 280 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence322 <3243 337 gene locus_tag LOCUS_13190 <3243 337 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037079.1:ligand-binding sensor domain-containing diguanylate cyclase >Feature sequence323 698 1792 gene locus_tag LOCUS_13200 698 1792 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000368910.1 protein_id gnl|my_center|LOCUS_13200 2714 2028 gene locus_tag LOCUS_13210 2714 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence324 445 837 gene locus_tag LOCUS_13220 445 837 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888350.1 protein_id gnl|my_center|LOCUS_13220 1437 1063 gene locus_tag LOCUS_13230 1437 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719490.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence325 723 2015 gene locus_tag LOCUS_13240 723 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 2043 3203 gene locus_tag LOCUS_13250 2043 3203 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941902.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence326 1551 727 gene locus_tag LOCUS_13260 1551 727 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259198.1 protein_id gnl|my_center|LOCUS_13260 1932 2810 gene locus_tag LOCUS_13270 1932 2810 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257864.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence327 469 1500 gene locus_tag LOCUS_13280 469 1500 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257726.1 protein_id gnl|my_center|LOCUS_13280 2215 1592 gene locus_tag LOCUS_13290 2215 1592 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391626.1 protein_id gnl|my_center|LOCUS_13290 2792 2304 gene locus_tag LOCUS_13300 2792 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence328 466 900 gene locus_tag LOCUS_13310 466 900 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887820.1 protein_id gnl|my_center|LOCUS_13310 1676 1551 gene locus_tag LOCUS_13320 1676 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 >Feature sequence329 2380 152 gene locus_tag LOCUS_13330 2380 152 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460388.1 protein_id gnl|my_center|LOCUS_13330 2950 2681 gene locus_tag LOCUS_13340 gene rpsO 2950 2681 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257912.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence330 1755 580 gene locus_tag LOCUS_13350 1755 580 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257466.1 protein_id gnl|my_center|LOCUS_13350 1970 1761 gene locus_tag LOCUS_13360 1970 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 2464 2246 gene locus_tag LOCUS_13370 2464 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 <3154 2563 gene locus_tag LOCUS_13380 <3154 2563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259392.1:glycosyltransferase family 2 protein >Feature sequence331 818 1294 gene locus_tag LOCUS_13390 818 1294 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973369.1 protein_id gnl|my_center|LOCUS_13390 1291 2394 gene locus_tag LOCUS_13400 1291 2394 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257553.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence332 <1 637 gene locus_tag LOCUS_13410 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034349591.1:glycoside hydrolase family 13 protein 2031 1372 gene locus_tag LOCUS_13420 2031 1372 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence333 1610 1380 gene locus_tag LOCUS_13430 1610 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13430 1766 1629 gene locus_tag LOCUS_13440 1766 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13440 2860 1829 gene locus_tag LOCUS_13450 gene pheS 2860 1829 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256292.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence334 398 1621 gene locus_tag LOCUS_13460 gene trpB 398 1621 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258563.1 protein_id gnl|my_center|LOCUS_13460 1618 2400 gene locus_tag LOCUS_13470 gene trpA 1618 2400 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256579.1 protein_id gnl|my_center|LOCUS_13470 2903 2424 gene locus_tag LOCUS_13480 2903 2424 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001135782.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence335 2585 1224 gene locus_tag LOCUS_13490 2585 1224 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257229.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence336 >Feature sequence337 <3133 1041 gene locus_tag LOCUS_13500 <3133 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255996.1:endopeptidase La >Feature sequence338 518 1579 gene locus_tag LOCUS_13510 518 1579 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030362.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence339 >Feature sequence340 <1 1493 gene locus_tag LOCUS_13520 <1 1493 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257660.1:tetratricopeptide repeat protein 1493 2500 gene locus_tag LOCUS_13530 1493 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13530 >Feature sequence341 231 710 gene locus_tag LOCUS_13540 231 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 898 1308 gene locus_tag LOCUS_13550 898 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1305 2249 gene locus_tag LOCUS_13560 1305 2249 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_13560 2249 2944 gene locus_tag LOCUS_13570 2249 2944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence342 1747 248 gene locus_tag LOCUS_13580 1747 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2973 2215 gene locus_tag LOCUS_13590 2973 2215 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083189.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence343 <1 752 gene locus_tag LOCUS_13600 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525206.1:sugar ABC transporter permease 749 1594 gene locus_tag LOCUS_13610 749 1594 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525205.1 protein_id gnl|my_center|LOCUS_13610 1604 2818 gene locus_tag LOCUS_13620 1604 2818 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031746.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence344 2716 1457 gene locus_tag LOCUS_13630 2716 1457 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887268.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence345 <1 791 gene locus_tag LOCUS_13640 <1 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004563822.1:ornithine cyclodeaminase family protein 958 2199 gene locus_tag LOCUS_13650 958 2199 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943341.1 protein_id gnl|my_center|LOCUS_13650 2935 2243 gene locus_tag LOCUS_13660 2935 2243 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660625.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence346 496 1842 gene locus_tag LOCUS_13670 496 1842 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258382.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence347 1114 896 gene locus_tag LOCUS_13680 1114 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2774 1140 gene locus_tag LOCUS_13690 2774 1140 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258936.1 protein_id gnl|my_center|LOCUS_13690 >Feature sequence348 <1 622 gene locus_tag LOCUS_13700 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010918674.1:glycoside hydrolase family 31 protein 770 1045 gene locus_tag LOCUS_13710 770 1045 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008630832.1 protein_id gnl|my_center|LOCUS_13710 1769 1128 gene locus_tag LOCUS_13720 1769 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence349 1572 727 gene locus_tag LOCUS_13730 gene cysQ 1572 727 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_13730 2906 1698 gene locus_tag LOCUS_13740 2906 1698 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258522.1 protein_id gnl|my_center|LOCUS_13740 >Feature sequence350 >Feature sequence351 <3055 1922 gene locus_tag LOCUS_13750 <3055 1922 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393104.1:tetratricopeptide repeat protein >Feature sequence352 1170 2150 gene locus_tag LOCUS_13760 1170 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence353 <1 734 gene locus_tag LOCUS_13770 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_006523900.1:mannose-1-phosphate guanylyltransferase 739 1956 gene locus_tag LOCUS_13780 739 1956 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256214.1 protein_id gnl|my_center|LOCUS_13780 1953 2462 gene locus_tag LOCUS_13790 1953 2462 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459074.1 protein_id gnl|my_center|LOCUS_13790 2528 2797 gene locus_tag LOCUS_13800 2528 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence354 2676 1504 gene locus_tag LOCUS_13810 2676 1504 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021990.1 protein_id gnl|my_center|LOCUS_13810 3048 2686 gene locus_tag LOCUS_13820 3048 2686 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143863.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence355 <1 533 gene locus_tag LOCUS_13830 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258683.1:peptidylprolyl isomerase 684 1166 gene locus_tag LOCUS_13840 684 1166 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258683.1 protein_id gnl|my_center|LOCUS_13840 1185 1739 gene locus_tag LOCUS_13850 1185 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2237 1743 gene locus_tag LOCUS_13860 2237 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence356 225 1019 gene locus_tag LOCUS_13870 225 1019 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972454.1 protein_id gnl|my_center|LOCUS_13870 2692 977 gene locus_tag LOCUS_13880 2692 977 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943687.1 protein_id gnl|my_center|LOCUS_13880 2831 2907 gene locus_tag LOCUS_t00220 2831 2907 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence357 <1 776 gene locus_tag LOCUS_13890 <1 776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258461.1:amidohydrolase 1190 783 gene locus_tag LOCUS_13900 1190 783 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393562.1 protein_id gnl|my_center|LOCUS_13900 1467 1183 gene locus_tag LOCUS_13910 1467 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1540 2349 gene locus_tag LOCUS_13920 1540 2349 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387954.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence358 1253 1011 gene locus_tag LOCUS_13930 1253 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1537 1250 gene locus_tag LOCUS_13940 1537 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 2032 1634 gene locus_tag LOCUS_13950 2032 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 2899 2393 gene locus_tag LOCUS_13960 2899 2393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence359 >Feature sequence360 1720 1334 gene locus_tag LOCUS_13970 1720 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 1943 1848 gene locus_tag LOCUS_t00230 1943 1848 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 2053 2775 gene locus_tag LOCUS_13980 2053 2775 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258717.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence361 2900 558 gene locus_tag LOCUS_13990 2900 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence362 <1 612 gene locus_tag LOCUS_14000 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000869148.1:(Fe-S)-binding protein 1041 682 gene locus_tag LOCUS_14010 1041 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1274 1558 gene locus_tag LOCUS_14020 1274 1558 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080491.1 protein_id gnl|my_center|LOCUS_14020 1663 1941 gene locus_tag LOCUS_14030 gene groES 1663 1941 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103730.1 protein_id gnl|my_center|LOCUS_14030 2048 2431 gene locus_tag LOCUS_14040 2048 2431 CDS product metallopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233882.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence363 359 2539 gene locus_tag LOCUS_14050 gene nirS 359 2539 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence364 470 814 gene locus_tag LOCUS_14060 470 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 1235 2599 gene locus_tag LOCUS_14070 1235 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 2986 2696 gene locus_tag LOCUS_14080 2986 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence365 2280 1225 gene locus_tag LOCUS_14090 2280 1225 CDS product zinc-dependent dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392012.1 protein_id gnl|my_center|LOCUS_14090 <2984 2286 gene locus_tag LOCUS_14100 <2984 2286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064253348.1:carbohydrate ABC transporter permease >Feature sequence366 679 2193 gene locus_tag LOCUS_14110 679 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 <2981 2197 gene locus_tag LOCUS_14120 <2981 2197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258562.1:diacylglycerol kinase family lipid kinase >Feature sequence367 873 277 gene locus_tag LOCUS_14130 873 277 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966171.1 protein_id gnl|my_center|LOCUS_14130 1869 1525 gene locus_tag LOCUS_14140 gene rpmE 1869 1525 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258179.1 protein_id gnl|my_center|LOCUS_14140 2156 1893 gene locus_tag LOCUS_14150 gene rpmA 2156 1893 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816541.1 protein_id gnl|my_center|LOCUS_14150 2523 2209 gene locus_tag LOCUS_14160 gene rplU 2523 2209 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_14160 >Feature sequence368 990 1709 gene locus_tag LOCUS_14170 990 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 2092 1715 gene locus_tag LOCUS_14180 2092 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 >Feature sequence369 202 888 gene locus_tag LOCUS_14190 202 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 1153 2034 gene locus_tag LOCUS_14200 gene rarD 1153 2034 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256111.1 protein_id gnl|my_center|LOCUS_14200 2261 2749 gene locus_tag LOCUS_14210 2261 2749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence370 2195 1038 gene locus_tag LOCUS_14220 2195 1038 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391433.1 protein_id gnl|my_center|LOCUS_14220 <2958 2255 gene locus_tag LOCUS_14230 <2958 2255 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403708.1:SDR family oxidoreductase >Feature sequence371 1372 461 gene locus_tag LOCUS_14240 1372 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1709 2794 gene locus_tag LOCUS_14250 1709 2794 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943872.1 protein_id gnl|my_center|LOCUS_14250 2954 2805 gene locus_tag LOCUS_14260 2954 2805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence372 2650 521 gene locus_tag LOCUS_14270 2650 521 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082373898.1 protein_id gnl|my_center|LOCUS_14270 >Feature sequence373 253 178 gene locus_tag LOCUS_t00240 253 178 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 557 483 gene locus_tag LOCUS_t00250 557 483 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 858 646 gene locus_tag LOCUS_14280 858 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1258 851 gene locus_tag LOCUS_14290 1258 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1560 1297 gene locus_tag LOCUS_14300 1560 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2606 1557 gene locus_tag LOCUS_14310 gene mnmA 2606 1557 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393152.1 protein_id gnl|my_center|LOCUS_14310 >Feature sequence374 1628 960 gene locus_tag LOCUS_14320 gene nth 1628 960 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057478.1 protein_id gnl|my_center|LOCUS_14320 <2939 1934 gene locus_tag LOCUS_14330 <2939 1934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393885.1:peptidoglycan bridge formation glycyltransferase FemA/FemB family protein >Feature sequence375 2362 1178 gene locus_tag LOCUS_14340 2362 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2892 2371 gene locus_tag LOCUS_14350 2892 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence376 320 2587 gene locus_tag LOCUS_14360 gene ppk1 320 2587 CDS product polyphosphate kinase 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233899.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence377 1880 1203 gene locus_tag LOCUS_14370 1880 1203 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258365.1 protein_id gnl|my_center|LOCUS_14370 <2911 1957 gene locus_tag LOCUS_14380 <2911 1957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083156.1:threonine ammonia-lyase >Feature sequence378 1260 703 gene locus_tag LOCUS_14390 gene msrA 1260 703 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence379 1526 2218 gene locus_tag LOCUS_14400 1526 2218 CDS product cobalamin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719277.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence380 968 2026 gene locus_tag LOCUS_14410 gene coxFIC1 968 2026 CDS product Dot/Icm type IV secretion system effector CoxFIC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769896.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence381 >Feature sequence382 74 1270 gene locus_tag LOCUS_14420 74 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1493 2440 gene locus_tag LOCUS_14430 1493 2440 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255971.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence383 585 869 gene locus_tag LOCUS_14440 gene hisE 585 869 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003642719.1 protein_id gnl|my_center|LOCUS_14440 1719 1396 gene locus_tag LOCUS_14450 gene sdhD 1719 1396 CDS product succinate dehydrogenase membrane anchor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254356.1 protein_id gnl|my_center|LOCUS_14450 2152 1802 gene locus_tag LOCUS_14460 gene sdhC 2152 1802 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289306.1 protein_id gnl|my_center|LOCUS_14460 <2865 2235 gene locus_tag LOCUS_14470 <2865 2235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546880.1:succinate dehydrogenase iron-sulfur subunit >Feature sequence384 1470 694 gene locus_tag LOCUS_14480 1470 694 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878806.1 protein_id gnl|my_center|LOCUS_14480 2362 1544 gene locus_tag LOCUS_14490 2362 1544 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 >Feature sequence385 245 1294 gene locus_tag LOCUS_14500 gene tsaD 245 1294 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256815.1 protein_id gnl|my_center|LOCUS_14500 2230 1349 gene locus_tag LOCUS_14510 2230 1349 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256314.1 protein_id gnl|my_center|LOCUS_14510 2591 2352 gene locus_tag LOCUS_14520 2591 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2819 2592 gene locus_tag LOCUS_14530 2819 2592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 >Feature sequence386 <2860 1141 gene locus_tag LOCUS_14540 <2860 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257962.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence387 1178 2230 gene locus_tag LOCUS_14550 1178 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 >Feature sequence388 230 1360 gene locus_tag LOCUS_14560 230 1360 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392647.1 protein_id gnl|my_center|LOCUS_14560 1357 2568 gene locus_tag LOCUS_14570 1357 2568 CDS product CinA family nicotinamide mononucleotide deamidase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257079.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence389 258 73 gene locus_tag LOCUS_14580 258 73 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1016 255 gene locus_tag LOCUS_14590 gene gpmA 1016 255 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932091.1 protein_id gnl|my_center|LOCUS_14590 1224 2084 gene locus_tag LOCUS_14600 1224 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 >Feature sequence390 >Feature sequence391 >Feature sequence392 400 894 gene locus_tag LOCUS_14610 gene lepB 400 894 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142021.1 protein_id gnl|my_center|LOCUS_14610 915 2687 gene locus_tag LOCUS_14620 915 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 >Feature sequence393 95 1759 gene locus_tag LOCUS_14630 95 1759 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066549.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence394 1798 1283 gene locus_tag LOCUS_14640 1798 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <2804 1940 gene locus_tag LOCUS_14650 <2804 1940 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256318.1:SdrD B-like domain-containing protein >Feature sequence395 >Feature sequence396 352 1932 gene locus_tag LOCUS_14660 gene gltA 352 1932 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082125.1 protein_id gnl|my_center|LOCUS_14660 2474 2235 gene locus_tag LOCUS_14670 2474 2235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence397 2733 31 gene locus_tag LOCUS_14680 gene ppdK 2733 31 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258815.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence398 1089 853 gene locus_tag LOCUS_14690 1089 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1769 1161 gene locus_tag LOCUS_14700 1769 1161 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259729.1 protein_id gnl|my_center|LOCUS_14700 <2786 1988 gene locus_tag LOCUS_14710 <2786 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940289.1:acetate kinase >Feature sequence399 597 2393 gene locus_tag LOCUS_14720 597 2393 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142981.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence400 15 2012 gene locus_tag LOCUS_14730 15 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence401 <1 898 gene locus_tag LOCUS_14740 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257111.1:lysine--tRNA ligase >Feature sequence402 1352 300 gene locus_tag LOCUS_14750 1352 300 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_14750 1457 2644 gene locus_tag LOCUS_14760 1457 2644 CDS product M24 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228823.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence403 <1 960 gene locus_tag LOCUS_14770 <1 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582870.1:extracellular solute-binding protein 1653 2582 gene locus_tag LOCUS_14780 1653 2582 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584089.1 protein_id gnl|my_center|LOCUS_14780 >Feature sequence404 285 473 gene locus_tag LOCUS_14790 gene rpmF 285 473 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545520.1 protein_id gnl|my_center|LOCUS_14790 603 2126 gene locus_tag LOCUS_14800 603 2126 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080686.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence405 1958 666 gene locus_tag LOCUS_14810 gene mrfB 1958 666 CDS product metal-dependent exonucleaseMrfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004398813.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence406 2417 1368 gene locus_tag LOCUS_14820 2417 1368 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969388.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence407 543 331 gene locus_tag LOCUS_14830 543 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 824 2218 gene locus_tag LOCUS_14840 824 2218 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404453.1 protein_id gnl|my_center|LOCUS_14840 2298 2504 gene locus_tag LOCUS_14850 2298 2504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence408 750 328 gene locus_tag LOCUS_14860 750 328 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_14860 1268 753 gene locus_tag LOCUS_14870 1268 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1717 1265 gene locus_tag LOCUS_14880 1717 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 >Feature sequence409 6 425 gene locus_tag LOCUS_14890 6 425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 452 1450 gene locus_tag LOCUS_14900 gene holA 452 1450 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392113.1 protein_id gnl|my_center|LOCUS_14900 2047 1700 gene locus_tag LOCUS_14910 2047 1700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14910 >Feature sequence410 1193 2173 gene locus_tag LOCUS_14920 1193 2173 CDS product sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257220.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence411 <1 991 gene locus_tag LOCUS_14930 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012255915.1:chromosomal replication initiator protein DnaA 1260 1655 gene locus_tag LOCUS_14940 1260 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence412 2329 620 gene locus_tag LOCUS_14950 2329 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence413 1542 400 gene locus_tag LOCUS_14960 1542 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 <2727 1619 gene locus_tag LOCUS_14970 <2727 1619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530099.1:amidohydrolase >Feature sequence414 >Feature sequence415 1160 2563 gene locus_tag LOCUS_14980 1160 2563 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162015845.1 protein_id gnl|my_center|LOCUS_14980 >Feature sequence416 <1 670 gene locus_tag LOCUS_14990 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108171.1:DUF58 domain-containing protein 1576 674 gene locus_tag LOCUS_15000 1576 674 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256411.1 protein_id gnl|my_center|LOCUS_15000 1658 2596 gene locus_tag LOCUS_15010 1658 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence417 428 2140 gene locus_tag LOCUS_15020 gene sulP 428 2140 CDS product sulfate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931031.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence418 >Feature sequence419 80 751 gene locus_tag LOCUS_15030 80 751 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259017.1 protein_id gnl|my_center|LOCUS_15030 870 1403 gene locus_tag LOCUS_15040 870 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 1406 2158 gene locus_tag LOCUS_15050 1406 2158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 >Feature sequence420 1907 939 gene locus_tag LOCUS_15060 1907 939 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence421 701 210 gene locus_tag LOCUS_15070 701 210 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000446112.1 protein_id gnl|my_center|LOCUS_15070 1035 1808 gene locus_tag LOCUS_15080 1035 1808 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_15080 2421 2008 gene locus_tag LOCUS_15090 2421 2008 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545852.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence422 263 862 gene locus_tag LOCUS_15100 263 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 887 1264 gene locus_tag LOCUS_15110 887 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence423 <1 901 gene locus_tag LOCUS_15120 <1 901 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258680.1:formylglycine-generating enzyme family protein 1010 1447 gene locus_tag LOCUS_15130 gene tnpA 1010 1447 CDS product IS200/IS605 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120397.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence424 1842 658 gene locus_tag LOCUS_15140 1842 658 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583069.1 protein_id gnl|my_center|LOCUS_15140 2614 1916 gene locus_tag LOCUS_15150 2614 1916 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257870.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence425 751 194 gene locus_tag LOCUS_15160 751 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence426 1128 601 gene locus_tag LOCUS_15170 1128 601 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_15170 1657 2655 gene locus_tag LOCUS_15180 gene mer 1657 2655 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence427 <1 2026 gene locus_tag LOCUS_15190 <1 2026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541498.1:type I DNA topoisomerase >Feature sequence428 >Feature sequence429 832 161 gene locus_tag LOCUS_15200 832 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1668 904 gene locus_tag LOCUS_15210 gene hisF 1668 904 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404312.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence430 <1 634 gene locus_tag LOCUS_15220 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140056.1:ATP-binding cassette domain-containing protein 624 1439 gene locus_tag LOCUS_15230 624 1439 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846403.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence431 2093 1131 gene locus_tag LOCUS_15240 2093 1131 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797516.1 protein_id gnl|my_center|LOCUS_15240 <2643 2097 gene locus_tag LOCUS_15250 <2643 2097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392835.1:ribosome biogenesis GTPase Der >Feature sequence432 >Feature sequence433 347 69 gene locus_tag LOCUS_15260 347 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence434 219 836 gene locus_tag LOCUS_15270 219 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 833 1738 gene locus_tag LOCUS_15280 833 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 1731 2177 gene locus_tag LOCUS_15290 1731 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 >Feature sequence435 1532 948 gene locus_tag LOCUS_15300 1532 948 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080265.1 protein_id gnl|my_center|LOCUS_15300 2455 1562 gene locus_tag LOCUS_15310 2455 1562 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000757575.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence436 >Feature sequence437 1643 360 gene locus_tag LOCUS_15320 1643 360 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546148.1 protein_id gnl|my_center|LOCUS_15320 2534 1671 gene locus_tag LOCUS_15330 2534 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence438 311 1405 gene locus_tag LOCUS_15340 gene tal 311 1405 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence439 >Feature sequence440 1 822 gene locus_tag LOCUS_15350 1 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 1098 2105 gene locus_tag LOCUS_15360 1098 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 >Feature sequence441 760 92 gene locus_tag LOCUS_15370 760 92 CDS product DUF2085 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871015.1 protein_id gnl|my_center|LOCUS_15370 1444 791 gene locus_tag LOCUS_15380 1444 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 2539 1502 gene locus_tag LOCUS_15390 2539 1502 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880440.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence442 2 448 gene locus_tag LOCUS_15400 2 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence443 1190 264 gene locus_tag LOCUS_15410 1190 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence444 1 366 gene locus_tag LOCUS_15420 1 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15420 382 936 gene locus_tag LOCUS_15430 382 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15430 >Feature sequence445 <1 571 gene locus_tag LOCUS_15440 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257573.1:uridine kinase 1961 1179 gene locus_tag LOCUS_15450 gene pgeF 1961 1179 CDS product peptidoglycan editing factor PgeF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931720.1 protein_id gnl|my_center|LOCUS_15450 <2584 2012 gene locus_tag LOCUS_15460 <2584 2012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002293897.1:UDP-glucose 4-epimerase GalE >Feature sequence446 <1 589 gene locus_tag LOCUS_15470 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103038499.1:ArgE/DapE family deacylase >Feature sequence447 603 1754 gene locus_tag LOCUS_15480 603 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 1768 1965 gene locus_tag LOCUS_15490 1768 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence448 >Feature sequence449 >Feature sequence450 1503 1066 gene locus_tag LOCUS_15500 1503 1066 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846615.1 protein_id gnl|my_center|LOCUS_15500 1742 1500 gene locus_tag LOCUS_15510 1742 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2319 1924 gene locus_tag LOCUS_15520 gene rbsD 2319 1924 CDS product D-ribose pyranase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693672.1 protein_id gnl|my_center|LOCUS_15520 >Feature sequence451 >Feature sequence452 601 389 gene locus_tag LOCUS_15530 601 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 1040 699 gene locus_tag LOCUS_15540 1040 699 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338257.1 protein_id gnl|my_center|LOCUS_15540 1387 1082 gene locus_tag LOCUS_15550 1387 1082 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259346.1 protein_id gnl|my_center|LOCUS_15550 2289 1384 gene locus_tag LOCUS_15560 2289 1384 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256392.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence453 2 994 gene locus_tag LOCUS_15570 gene ahcY 2 994 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258873.1 protein_id gnl|my_center|LOCUS_15570 1123 2361 gene locus_tag LOCUS_15580 gene metK 1123 2361 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258872.1 protein_id gnl|my_center|LOCUS_15580 >Feature sequence454 >Feature sequence455 656 90 gene locus_tag LOCUS_15590 656 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 995 726 gene locus_tag LOCUS_15600 995 726 CDS product DUF5683 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023253.1 protein_id gnl|my_center|LOCUS_15600 2230 1094 gene locus_tag LOCUS_15610 2230 1094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15610 >Feature sequence456 466 11 gene locus_tag LOCUS_15620 466 11 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887547.1 protein_id gnl|my_center|LOCUS_15620 692 1435 gene locus_tag LOCUS_15630 692 1435 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776439.1 protein_id gnl|my_center|LOCUS_15630 1734 2291 gene locus_tag LOCUS_15640 1734 2291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 >Feature sequence457 1049 300 gene locus_tag LOCUS_15650 1049 300 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258224.1 protein_id gnl|my_center|LOCUS_15650 2212 1163 gene locus_tag LOCUS_15660 2212 1163 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887591.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence458 1960 383 gene locus_tag LOCUS_15670 1960 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence459 467 2530 gene locus_tag LOCUS_15680 467 2530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence460 1105 2184 gene locus_tag LOCUS_15690 gene xerC 1105 2184 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392542.1 protein_id gnl|my_center|LOCUS_15690 >Feature sequence461 <1 1198 gene locus_tag LOCUS_15700 <1 1198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868830.1:acetaldehyde dehydrogenase (acetylating) 1459 1217 gene locus_tag LOCUS_15710 1459 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1668 1456 gene locus_tag LOCUS_15720 1668 1456 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393634.1 protein_id gnl|my_center|LOCUS_15720 2013 2303 gene locus_tag LOCUS_15730 2013 2303 CDS product BMC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836567.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence462 1934 195 gene locus_tag LOCUS_15740 1934 195 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256503.1 protein_id gnl|my_center|LOCUS_15740 2529 2020 gene locus_tag LOCUS_15750 2529 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence463 324 202 gene locus_tag LOCUS_15760 324 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 367 636 gene locus_tag LOCUS_15770 367 636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 654 1184 gene locus_tag LOCUS_15780 gene lspA 654 1184 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256792.1 protein_id gnl|my_center|LOCUS_15780 1198 1662 gene locus_tag LOCUS_15790 1198 1662 CDS product methylglyoxal synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583226.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence464 1629 847 gene locus_tag LOCUS_15800 1629 847 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256276.1 protein_id gnl|my_center|LOCUS_15800 2057 1626 gene locus_tag LOCUS_15810 2057 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence465 424 1515 gene locus_tag LOCUS_15820 gene tal 424 1515 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143366.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence466 1169 153 gene locus_tag LOCUS_15830 1169 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393763.1 protein_id gnl|my_center|LOCUS_15830 2403 1153 gene locus_tag LOCUS_15840 2403 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 >Feature sequence467 <1 879 gene locus_tag LOCUS_15850 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259097.1:O-antigen ligase family protein 925 1527 gene locus_tag LOCUS_15860 gene grpE 925 1527 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230005.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence468 <1 556 gene locus_tag LOCUS_15870 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257179.1:DUF92 domain-containing protein 553 1347 gene locus_tag LOCUS_15880 553 1347 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256313.1 protein_id gnl|my_center|LOCUS_15880 1340 2185 gene locus_tag LOCUS_15890 1340 2185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence469 1962 700 gene locus_tag LOCUS_15900 1962 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence470 <1 2296 gene locus_tag LOCUS_15910 <1 2296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148213300.1:PAS domain S-box protein >Feature sequence471 <1 1289 gene locus_tag LOCUS_15920 <1 1289 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113783.1:acyl-CoA synthetase 2502 1330 gene locus_tag LOCUS_15930 2502 1330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 >Feature sequence472 556 1026 gene locus_tag LOCUS_15940 556 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 1061 1984 gene locus_tag LOCUS_15950 1061 1984 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080738.1 protein_id gnl|my_center|LOCUS_15950 2099 2464 gene locus_tag LOCUS_15960 2099 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence473 >Feature sequence474 52 1524 gene locus_tag LOCUS_15970 52 1524 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944025.1 protein_id gnl|my_center|LOCUS_15970 >Feature sequence475 <1 1986 gene locus_tag LOCUS_15980 <1 1986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142856.1:SMC family ATPase >Feature sequence476 2309 75 gene locus_tag LOCUS_15990 2309 75 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928938.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence477 385 101 gene locus_tag LOCUS_16000 385 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 1464 622 gene locus_tag LOCUS_16010 1464 622 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259435.1 protein_id gnl|my_center|LOCUS_16010 <2484 1981 gene locus_tag LOCUS_16020 <2484 1981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011140391.1:phosphoglucomutase/phosphomannomutase family protein >Feature sequence478 <1 1881 gene locus_tag LOCUS_16030 <1 1881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929065.1:DNA helicase RecQ 2154 1927 gene locus_tag LOCUS_16040 2154 1927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 >Feature sequence479 <1 845 gene locus_tag LOCUS_16050 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460322.1:alanine--tRNA ligase >Feature sequence480 1163 678 gene locus_tag LOCUS_16060 1163 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1933 1205 gene locus_tag LOCUS_16070 1933 1205 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583981.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence481 1059 703 gene locus_tag LOCUS_16080 1059 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2269 1049 gene locus_tag LOCUS_16090 2269 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256522.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence482 2272 359 gene locus_tag LOCUS_16100 2272 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence483 109 1224 gene locus_tag LOCUS_16110 gene mtnA 109 1224 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence484 3 311 gene locus_tag LOCUS_16120 3 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1056 346 gene locus_tag LOCUS_16130 1056 346 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583597.1 protein_id gnl|my_center|LOCUS_16130 <2443 1708 gene locus_tag LOCUS_16140 <2443 1708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_086395912.1:DUF6359 domain-containing protein >Feature sequence485 1130 603 gene locus_tag LOCUS_16150 1130 603 CDS product cytochrome c-type biogenesis protein CcmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228652.1 protein_id gnl|my_center|LOCUS_16150 <2434 1301 gene locus_tag LOCUS_16160 <2434 1301 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258322.1:O-antigen ligase family protein >Feature sequence486 525 2342 gene locus_tag LOCUS_16170 gene thrS 525 2342 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002665762.1 protein_id gnl|my_center|LOCUS_16170 >Feature sequence487 >Feature sequence488 >Feature sequence489 594 49 gene locus_tag LOCUS_16180 gene hpt 594 49 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359412.1 protein_id gnl|my_center|LOCUS_16180 <2411 699 gene locus_tag LOCUS_16190 <2411 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228233.1:MBL fold hydrolase >Feature sequence490 <1 1664 gene locus_tag LOCUS_16200 <1 1664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 >Feature sequence491 287 844 gene locus_tag LOCUS_16210 gene frr 287 844 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000531503.1 protein_id gnl|my_center|LOCUS_16210 854 1618 gene locus_tag LOCUS_16220 854 1618 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259406.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence492 <1 1521 gene locus_tag LOCUS_16230 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066597.1:lipopolysaccharide biosynthesis protein 1518 2063 gene locus_tag LOCUS_16240 1518 2063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence493 >Feature sequence494 2309 861 gene locus_tag LOCUS_16250 2309 861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence495 1271 2128 gene locus_tag LOCUS_16260 1271 2128 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_16260 >Feature sequence496 <1 1354 gene locus_tag LOCUS_16270 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162015845.1:M1 family metallopeptidase 1420 2280 gene locus_tag LOCUS_16280 1420 2280 CDS product YhfC family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233198.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence497 2072 195 gene locus_tag LOCUS_16290 gene htpG 2072 195 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257066.1 protein_id gnl|my_center|LOCUS_16290 >Feature sequence498 1723 284 gene locus_tag LOCUS_16300 1723 284 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257931.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence499 1122 334 gene locus_tag LOCUS_16310 1122 334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2334 1126 gene locus_tag LOCUS_16320 2334 1126 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029846.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence500 183 665 gene locus_tag LOCUS_16330 183 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence501 <1 889 gene locus_tag LOCUS_16340 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257055.1:ABC transporter permease >Feature sequence502 1577 249 gene locus_tag LOCUS_16350 1577 249 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393402.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence503 1088 387 gene locus_tag LOCUS_16360 1088 387 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080184.1 protein_id gnl|my_center|LOCUS_16360 1921 1085 gene locus_tag LOCUS_16370 1921 1085 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101356.1 protein_id gnl|my_center|LOCUS_16370 >Feature sequence504 <1 688 gene locus_tag LOCUS_16380 <1 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein 837 1130 gene locus_tag LOCUS_16390 gene groES 837 1130 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918572.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence505 1385 2134 gene locus_tag LOCUS_16400 1385 2134 CDS product exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257359.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence506 <1 663 gene locus_tag LOCUS_16410 <1 663 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706159.1:substrate-binding domain-containing protein 748 1893 gene locus_tag LOCUS_16420 748 1893 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969517.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence507 1735 1040 gene locus_tag LOCUS_16430 1735 1040 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256116.1 protein_id gnl|my_center|LOCUS_16430 <2343 1749 gene locus_tag LOCUS_16440 <2343 1749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062283476.1:TrkH family potassium uptake protein >Feature sequence508 >Feature sequence509 344 901 gene locus_tag LOCUS_16450 344 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16450 1864 890 gene locus_tag LOCUS_16460 1864 890 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404767.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence510 920 558 gene locus_tag LOCUS_16470 920 558 CDS product VanZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227905.1 protein_id gnl|my_center|LOCUS_16470 2152 980 gene locus_tag LOCUS_16480 2152 980 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003897686.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence511 625 2127 gene locus_tag LOCUS_16490 625 2127 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_16490 >Feature sequence512 1083 436 gene locus_tag LOCUS_16500 gene grpE 1083 436 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444334.1 protein_id gnl|my_center|LOCUS_16500 <2338 1299 gene locus_tag LOCUS_16510 <2338 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258113.1:molecular chaperone DnaK >Feature sequence513 400 1740 gene locus_tag LOCUS_16520 400 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence514 970 317 gene locus_tag LOCUS_16530 970 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 2226 1291 gene locus_tag LOCUS_16540 2226 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence515 1049 1972 gene locus_tag LOCUS_16550 gene rbsK 1049 1972 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence516 319 1380 gene locus_tag LOCUS_16560 319 1380 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207301207.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence517 >Feature sequence518 659 1672 gene locus_tag LOCUS_16570 659 1672 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256709.1 protein_id gnl|my_center|LOCUS_16570 >Feature sequence519 139 681 gene locus_tag LOCUS_16580 139 681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 609 1736 gene locus_tag LOCUS_16590 609 1736 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228739.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence520 <1 1360 gene locus_tag LOCUS_16600 <1 1360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061214.1:excinuclease ABC subunit UvrA 2317 1445 gene locus_tag LOCUS_16610 2317 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence521 714 1454 gene locus_tag LOCUS_16620 714 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence522 >Feature sequence523 1354 437 gene locus_tag LOCUS_16630 1354 437 CDS product CHAD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141082.1 protein_id gnl|my_center|LOCUS_16630 >Feature sequence524 >Feature sequence525 1374 406 gene locus_tag LOCUS_16640 gene prfB 1374 406 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083772533.1 protein_id gnl|my_center|LOCUS_16640 <2289 1576 gene locus_tag LOCUS_16650 <2289 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941793.1:signal recognition particle-docking protein FtsY >Feature sequence526 2244 40 gene locus_tag LOCUS_16660 2244 40 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence527 166 1296 gene locus_tag LOCUS_16670 166 1296 CDS product M50 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259411.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence528 1066 572 gene locus_tag LOCUS_16680 1066 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256022.1 protein_id gnl|my_center|LOCUS_16680 2267 1236 gene locus_tag LOCUS_16690 2267 1236 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061730.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence529 238 960 gene locus_tag LOCUS_16700 238 960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1031 1528 gene locus_tag LOCUS_16710 1031 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 >Feature sequence530 <1 694 gene locus_tag LOCUS_16720 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460698.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 691 1884 gene locus_tag LOCUS_16730 gene ftsW 691 1884 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392361.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence531 >Feature sequence532 1084 485 gene locus_tag LOCUS_16740 1084 485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 1676 1601 gene locus_tag LOCUS_t00260 1676 1601 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence533 1000 92 gene locus_tag LOCUS_16750 1000 92 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence534 <1 1210 gene locus_tag LOCUS_16760 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256762.1:DNA-directed RNA polymerase subunit beta' 1463 1882 gene locus_tag LOCUS_16770 gene rpsL 1463 1882 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258226.1 protein_id gnl|my_center|LOCUS_16770 >Feature sequence535 1200 19 gene locus_tag LOCUS_16780 gene gguB 1200 19 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257795.1 protein_id gnl|my_center|LOCUS_16780 2013 1216 gene locus_tag LOCUS_16790 2013 1216 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392147.1 protein_id gnl|my_center|LOCUS_16790 >Feature sequence536 113 922 gene locus_tag LOCUS_16800 113 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1792 983 gene locus_tag LOCUS_16810 1792 983 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259072.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence537 474 980 gene locus_tag LOCUS_16820 474 980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 1485 1126 gene locus_tag LOCUS_16830 1485 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence538 375 1112 gene locus_tag LOCUS_16840 375 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 1195 1917 gene locus_tag LOCUS_16850 1195 1917 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257202.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence539 362 141 gene locus_tag LOCUS_16860 362 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 >Feature sequence540 >Feature sequence541 221 1942 gene locus_tag LOCUS_16870 gene recN 221 1942 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256506.1 protein_id gnl|my_center|LOCUS_16870 >Feature sequence542 1464 799 gene locus_tag LOCUS_16880 1464 799 CDS product HTH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012805063.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence543 461 844 gene locus_tag LOCUS_16890 461 844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1085 1438 gene locus_tag LOCUS_16900 1085 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 1735 1451 gene locus_tag LOCUS_16910 1735 1451 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379963.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence544 >Feature sequence545 <1 1532 gene locus_tag LOCUS_16920 <1 1532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000614258.1:L-fucose isomerase >Feature sequence546 1987 302 gene locus_tag LOCUS_16930 1987 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence547 250 567 gene locus_tag LOCUS_16940 250 567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1403 555 gene locus_tag LOCUS_16950 1403 555 CDS product DUF3473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390862.1 protein_id gnl|my_center|LOCUS_16950 2146 1403 gene locus_tag LOCUS_16960 2146 1403 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002985169.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence548 <1 610 gene locus_tag LOCUS_16970 <1 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258345.1:diacylglycerol kinase family lipid kinase 703 1914 gene locus_tag LOCUS_16980 gene xseA 703 1914 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259569.1 protein_id gnl|my_center|LOCUS_16980 2114 1935 gene locus_tag LOCUS_16990 2114 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence549 599 219 gene locus_tag LOCUS_17000 599 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 973 683 gene locus_tag LOCUS_17010 gene rpsF 973 683 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966984.1 protein_id gnl|my_center|LOCUS_17010 1233 1307 gene locus_tag LOCUS_t00270 1233 1307 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence550 196 1452 gene locus_tag LOCUS_17020 196 1452 CDS product valine--pyruvate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458682.1 protein_id gnl|my_center|LOCUS_17020 <2244 1465 gene locus_tag LOCUS_17030 <2244 1465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256898.1:COX15/CtaA family protein >Feature sequence551 1185 1655 gene locus_tag LOCUS_17040 1185 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 >Feature sequence552 231 1817 gene locus_tag LOCUS_17050 231 1817 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257797.1 protein_id gnl|my_center|LOCUS_17050 1886 2050 gene locus_tag LOCUS_17060 1886 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence553 1332 835 gene locus_tag LOCUS_17070 1332 835 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259271.1 protein_id gnl|my_center|LOCUS_17070 1676 1329 gene locus_tag LOCUS_17080 1676 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence554 >Feature sequence555 >Feature sequence556 <1 777 gene locus_tag LOCUS_17090 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258803.1:CRISPR-associated endonuclease Cas1 975 1256 gene locus_tag LOCUS_17100 gene cas2 975 1256 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258804.1 protein_id gnl|my_center|LOCUS_17100 1253 1834 gene locus_tag LOCUS_17110 gene cas4 1253 1834 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258805.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence557 >Feature sequence558 217 1869 gene locus_tag LOCUS_17120 217 1869 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057237.1 protein_id gnl|my_center|LOCUS_17120 >Feature sequence559 139 813 gene locus_tag LOCUS_17130 139 813 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964265.1 protein_id gnl|my_center|LOCUS_17130 974 1375 gene locus_tag LOCUS_17140 974 1375 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249134.1 protein_id gnl|my_center|LOCUS_17140 2014 1463 gene locus_tag LOCUS_17150 2014 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17150 >Feature sequence560 1412 57 gene locus_tag LOCUS_17160 1412 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 2118 1384 gene locus_tag LOCUS_17170 2118 1384 CDS product DnaD domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257454.1 protein_id gnl|my_center|LOCUS_17170 >Feature sequence561 136 1530 gene locus_tag LOCUS_17180 136 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence562 <1 955 gene locus_tag LOCUS_17190 <1 955 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257169.1:GTPase ObgE 995 1606 gene locus_tag LOCUS_17200 gene nadD 995 1606 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460892.1 protein_id gnl|my_center|LOCUS_17200 <2204 1603 gene locus_tag LOCUS_17210 <2204 1603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002289709.1:aldo/keto reductase >Feature sequence563 1206 460 gene locus_tag LOCUS_17220 1206 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 1639 1199 gene locus_tag LOCUS_17230 1639 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17230 <2200 1652 gene locus_tag LOCUS_17240 <2200 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000825700.1:flavin prenyltransferase UbiX >Feature sequence564 >Feature sequence565 >Feature sequence566 792 232 gene locus_tag LOCUS_17250 792 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1176 1832 gene locus_tag LOCUS_17260 gene lexA 1176 1832 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256381.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence567 697 1674 gene locus_tag LOCUS_17270 gene argF 697 1674 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence568 1990 278 gene locus_tag LOCUS_17280 1990 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 >Feature sequence569 458 1462 gene locus_tag LOCUS_17290 458 1462 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258891.1 protein_id gnl|my_center|LOCUS_17290 >Feature sequence570 <1 806 gene locus_tag LOCUS_17300 <1 806 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869993.1:LysM peptidoglycan-binding domain-containing M23 family metallopeptidase 2163 1024 gene locus_tag LOCUS_17310 2163 1024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 >Feature sequence571 134 1627 gene locus_tag LOCUS_17320 gene glpK 134 1627 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259133.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence572 283 594 gene locus_tag LOCUS_17330 283 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 854 994 gene locus_tag LOCUS_17340 854 994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1789 998 gene locus_tag LOCUS_17350 1789 998 CDS product heparan-alpha-glucosaminide N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065998.1 protein_id gnl|my_center|LOCUS_17350 >Feature sequence573 <2175 900 gene locus_tag LOCUS_17360 <2175 900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_141609734.1:interleukin-like EMT inducer domain-containing protein >Feature sequence574 <1 549 gene locus_tag LOCUS_17370 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256663.1:XdhC/CoxI family protein >Feature sequence575 1852 221 gene locus_tag LOCUS_17380 1852 221 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257530.1 protein_id gnl|my_center|LOCUS_17380 >Feature sequence576 2160 448 gene locus_tag LOCUS_17390 2160 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 >Feature sequence577 2 403 gene locus_tag LOCUS_17400 2 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 856 431 gene locus_tag LOCUS_17410 856 431 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035435.1 protein_id gnl|my_center|LOCUS_17410 1867 923 gene locus_tag LOCUS_17420 1867 923 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence578 <1 565 gene locus_tag LOCUS_17430 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966455.1:proline--tRNA ligase 782 1378 gene locus_tag LOCUS_17440 782 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 1902 1582 gene locus_tag LOCUS_17450 1902 1582 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232998.1 protein_id gnl|my_center|LOCUS_17450 >Feature sequence579 602 321 gene locus_tag LOCUS_17460 602 321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 1271 2071 gene locus_tag LOCUS_17470 1271 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 >Feature sequence580 <1 1116 gene locus_tag LOCUS_17480 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_102756879.1:BspA family leucine-rich repeat surface protein <2153 1396 gene locus_tag LOCUS_17490 <2153 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404984.1:amino acid permease >Feature sequence581 >Feature sequence582 253 927 gene locus_tag LOCUS_17500 253 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17500 >Feature sequence583 <2146 1298 gene locus_tag LOCUS_17510 <2146 1298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256215.1:DnaJ C-terminal domain-containing protein >Feature sequence584 <1 828 gene locus_tag LOCUS_17520 <1 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764573.1:xylulokinase 839 1789 gene locus_tag LOCUS_17530 839 1789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256034.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence585 >Feature sequence586 1173 1466 gene locus_tag LOCUS_17540 1173 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1459 2112 gene locus_tag LOCUS_17550 1459 2112 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037459.1 protein_id gnl|my_center|LOCUS_17550 >Feature sequence587 359 1081 gene locus_tag LOCUS_17560 359 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 1084 1632 gene locus_tag LOCUS_17570 1084 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 >Feature sequence588 >Feature sequence589 <1 870 gene locus_tag LOCUS_17580 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257837.1:glucose-1-phosphate thymidylyltransferase 899 1099 gene locus_tag LOCUS_17590 899 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 1099 1485 gene locus_tag LOCUS_17600 1099 1485 CDS product type II toxin-antitoxin system death-on-curing family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808288.1 protein_id gnl|my_center|LOCUS_17600 1499 1624 gene locus_tag LOCUS_17610 1499 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence590 2068 224 gene locus_tag LOCUS_17620 2068 224 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227739.1 protein_id gnl|my_center|LOCUS_17620 >Feature sequence591 1 144 gene locus_tag LOCUS_17630 1 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1578 973 gene locus_tag LOCUS_17640 1578 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 1841 1575 gene locus_tag LOCUS_17650 1841 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence592 549 1676 gene locus_tag LOCUS_17660 549 1676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17660 >Feature sequence593 466 1161 gene locus_tag LOCUS_17670 466 1161 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257105.1 protein_id gnl|my_center|LOCUS_17670 >Feature sequence594 >Feature sequence595 >Feature sequence596 <1 819 gene locus_tag LOCUS_17680 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258527.1:alkaline phosphatase family protein 853 1221 gene locus_tag LOCUS_17690 853 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 >Feature sequence597 1262 189 gene locus_tag LOCUS_17700 1262 189 CDS product CehA/McbA family metallohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255993.1 protein_id gnl|my_center|LOCUS_17700 <2090 1265 gene locus_tag LOCUS_17710 <2090 1265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940312.1:tRNA (adenine-N1)-methyltransferase >Feature sequence598 <2089 105 gene locus_tag LOCUS_17720 <2089 105 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268592.1:GTP diphosphokinase >Feature sequence599 225 620 gene locus_tag LOCUS_17730 gene dtd 225 620 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256355.1 protein_id gnl|my_center|LOCUS_17730 633 1196 gene locus_tag LOCUS_17740 633 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17740 1224 1787 gene locus_tag LOCUS_17750 1224 1787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 >Feature sequence600 756 121 gene locus_tag LOCUS_17760 756 121 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943014.1 protein_id gnl|my_center|LOCUS_17760 1560 763 gene locus_tag LOCUS_17770 gene trpC 1560 763 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392852.1 protein_id gnl|my_center|LOCUS_17770 <2085 1557 gene locus_tag LOCUS_17780 <2085 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257622.1:anthranilate phosphoribosyltransferase >Feature sequence601 967 359 gene locus_tag LOCUS_17790 967 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 2020 1172 gene locus_tag LOCUS_17800 2020 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence602 >Feature sequence603 225 67 gene locus_tag LOCUS_17810 225 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 1263 238 gene locus_tag LOCUS_17820 gene mer 1263 238 CDS product 5,10-methylenetetrahydromethanopterin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878566.1 protein_id gnl|my_center|LOCUS_17820 2071 1331 gene locus_tag LOCUS_17830 2071 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence604 <1 835 gene locus_tag LOCUS_17840 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256597.1:succinate--CoA ligase subunit alpha >Feature sequence605 1490 534 gene locus_tag LOCUS_17850 gene fmt 1490 534 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460526.1 protein_id gnl|my_center|LOCUS_17850 1695 1468 gene locus_tag LOCUS_17860 1695 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence606 592 1275 gene locus_tag LOCUS_17870 592 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 1446 1652 gene locus_tag LOCUS_17880 1446 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17880 >Feature sequence607 >Feature sequence608 >Feature sequence609 1723 725 gene locus_tag LOCUS_17890 1723 725 CDS product fructose-bisphosphatase class II family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257119.1 protein_id gnl|my_center|LOCUS_17890 >Feature sequence610 <1 675 gene locus_tag LOCUS_17900 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010887862.1:ferrous iron transport protein B 697 978 gene locus_tag LOCUS_17910 697 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 1014 1349 gene locus_tag LOCUS_17920 1014 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17920 >Feature sequence611 332 640 gene locus_tag LOCUS_17930 332 640 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259540.1 protein_id gnl|my_center|LOCUS_17930 878 1135 gene locus_tag LOCUS_17940 878 1135 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020108.1 protein_id gnl|my_center|LOCUS_17940 1132 1533 gene locus_tag LOCUS_17950 1132 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 >Feature sequence612 <2052 1036 gene locus_tag LOCUS_17960 <2052 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020870.1:tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 >Feature sequence613 1907 1308 gene locus_tag LOCUS_17970 1907 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence614 267 1583 gene locus_tag LOCUS_17980 267 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17980 >Feature sequence615 249 461 gene locus_tag LOCUS_17990 249 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 1050 568 gene locus_tag LOCUS_18000 1050 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18000 1621 1139 gene locus_tag LOCUS_18010 1621 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence616 1186 1725 gene locus_tag LOCUS_18020 1186 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 >Feature sequence617 <1 836 gene locus_tag LOCUS_18030 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941347.1:NAD-dependent epimerase/dehydratase family protein 841 1530 gene locus_tag LOCUS_18040 841 1530 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257981.1 protein_id gnl|my_center|LOCUS_18040 >Feature sequence618 1523 531 gene locus_tag LOCUS_18050 gene cas1 1523 531 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256457.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence619 1647 1042 gene locus_tag LOCUS_18060 1647 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18060 >Feature sequence620 >Feature sequence621 1366 1133 gene locus_tag LOCUS_18070 1366 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 >Feature sequence622 110 334 gene locus_tag LOCUS_18080 110 334 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525381.1 protein_id gnl|my_center|LOCUS_18080 399 695 gene locus_tag LOCUS_18090 399 695 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196984.1 protein_id gnl|my_center|LOCUS_18090 708 1784 gene locus_tag LOCUS_18100 708 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence623 124 1002 gene locus_tag LOCUS_18110 124 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18110 >Feature sequence624 >Feature sequence625 272 199 gene locus_tag LOCUS_t00280 272 199 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 867 397 gene locus_tag LOCUS_18120 867 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 <2013 1288 gene locus_tag LOCUS_18130 <2013 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584148.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence626 <1 581 gene locus_tag LOCUS_18140 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878895.1:PKD domain-containing protein >Feature sequence627 802 1575 gene locus_tag LOCUS_18150 802 1575 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_18150 >Feature sequence628 >Feature sequence629 1209 634 gene locus_tag LOCUS_18160 1209 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18160 >Feature sequence630 >Feature sequence631 >Feature sequence632 217 1476 gene locus_tag LOCUS_18170 217 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 >Feature sequence633 >Feature sequence634 52 642 gene locus_tag LOCUS_18180 gene leuD 52 642 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256079.1 protein_id gnl|my_center|LOCUS_18180 698 907 gene locus_tag LOCUS_18190 698 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18190 >Feature sequence635 <1967 1156 gene locus_tag LOCUS_18200 <1967 1156 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793101.1:cation diffusion facilitator family transporter >Feature sequence636 <1964 675 gene locus_tag LOCUS_18210 <1964 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895613.1:non-ribosomal peptide synthetase >Feature sequence637 >Feature sequence638 1431 253 gene locus_tag LOCUS_18220 1431 253 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036700.1 protein_id gnl|my_center|LOCUS_18220 >Feature sequence639 >Feature sequence640 >Feature sequence641 <1945 465 gene locus_tag LOCUS_18230 <1945 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763594.1:nucleoside kinase >Feature sequence642 589 1689 gene locus_tag LOCUS_18240 589 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence643 1309 581 gene locus_tag LOCUS_18250 1309 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 1651 1322 gene locus_tag LOCUS_18260 1651 1322 CDS product DUF971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000057944.1 protein_id gnl|my_center|LOCUS_18260 >Feature sequence644 <1 1133 gene locus_tag LOCUS_18270 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224376.1:alpha/beta hydrolase 1502 1810 gene locus_tag LOCUS_18280 1502 1810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence645 1763 621 gene locus_tag LOCUS_18290 1763 621 CDS product vitamin K epoxide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256200.1 protein_id gnl|my_center|LOCUS_18290 >Feature sequence646 348 620 gene locus_tag LOCUS_18300 348 620 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772089.1 protein_id gnl|my_center|LOCUS_18300 818 1501 gene locus_tag LOCUS_18310 818 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18310 >Feature sequence647 1393 14 gene locus_tag LOCUS_18320 1393 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18320 >Feature sequence648 1374 847 gene locus_tag LOCUS_18330 1374 847 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404467.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence649 <1920 862 gene locus_tag LOCUS_18340 <1920 862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_141484866.1:DUF2804 domain-containing protein >Feature sequence650 228 800 gene locus_tag LOCUS_18350 228 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 1035 1910 gene locus_tag LOCUS_18360 1035 1910 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence651 <1912 600 gene locus_tag LOCUS_18370 <1912 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002399797.1:acyl-CoA synthetase FdrA >Feature sequence652 >Feature sequence653 129 1247 gene locus_tag LOCUS_18380 129 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence654 >Feature sequence655 1422 520 gene locus_tag LOCUS_18390 gene xerD 1422 520 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_18390 >Feature sequence656 750 193 gene locus_tag LOCUS_18400 750 193 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876297.1 protein_id gnl|my_center|LOCUS_18400 1018 1584 gene locus_tag LOCUS_18410 1018 1584 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_18410 >Feature sequence657 <1905 853 gene locus_tag LOCUS_18420 <1905 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein >Feature sequence658 >Feature sequence659 <1 765 gene locus_tag LOCUS_18430 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005764153.1:MBOAT family protein >Feature sequence660 301 1593 gene locus_tag LOCUS_18440 gene clpX 301 1593 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_18440 >Feature sequence661 304 1365 gene locus_tag LOCUS_18450 304 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18450 >Feature sequence662 >Feature sequence663 1216 452 gene locus_tag LOCUS_18460 1216 452 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010890439.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence664 431 1381 gene locus_tag LOCUS_18470 gene rbsK 431 1381 CDS product ribokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257591.1 protein_id gnl|my_center|LOCUS_18470 >Feature sequence665 42 1265 gene locus_tag LOCUS_18480 42 1265 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048108.1 protein_id gnl|my_center|LOCUS_18480 >Feature sequence666 >Feature sequence667 <1889 725 gene locus_tag LOCUS_18490 <1889 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922235.1:VWA domain-containing protein >Feature sequence668 >Feature sequence669 161 1198 gene locus_tag LOCUS_18500 161 1198 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014331878.1 protein_id gnl|my_center|LOCUS_18500 >Feature sequence670 1532 99 gene locus_tag LOCUS_18510 1532 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence671 >Feature sequence672 2 616 gene locus_tag LOCUS_18520 2 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18520 669 1586 gene locus_tag LOCUS_18530 669 1586 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975922.1 protein_id gnl|my_center|LOCUS_18530 >Feature sequence673 319 1872 gene locus_tag LOCUS_18540 319 1872 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_18540 >Feature sequence674 >Feature sequence675 >Feature sequence676 1310 744 gene locus_tag LOCUS_18550 1310 744 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208430.1 protein_id gnl|my_center|LOCUS_18550 >Feature sequence677 >Feature sequence678 961 446 gene locus_tag LOCUS_18560 961 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1573 1100 gene locus_tag LOCUS_18570 1573 1100 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258972.1 protein_id gnl|my_center|LOCUS_18570 >Feature sequence679 <1 543 gene locus_tag LOCUS_18580 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_170213355.1:BTAD domain-containing putative transcriptional regulator 806 1726 gene locus_tag LOCUS_18590 806 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence680 <1863 323 gene locus_tag LOCUS_18600 <1863 323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256598.1:GAF domain-containing sensor histidine kinase >Feature sequence681 >Feature sequence682 <1 544 gene locus_tag LOCUS_18610 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975045.1:ABC transporter permease 541 1491 gene locus_tag LOCUS_18620 541 1491 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528958.1 protein_id gnl|my_center|LOCUS_18620 >Feature sequence683 <1 836 gene locus_tag LOCUS_18630 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_035380749.1:bifunctional acetaldehyde-CoA/alcohol dehydrogenase 967 1629 gene locus_tag LOCUS_18640 967 1629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255961.1 protein_id gnl|my_center|LOCUS_18640 >Feature sequence684 1330 797 gene locus_tag LOCUS_18650 1330 797 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800553.1 protein_id gnl|my_center|LOCUS_18650 >Feature sequence685 1169 513 gene locus_tag LOCUS_18660 1169 513 CDS product CpsD/CapB family tyrosine-protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256018.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence686 595 104 gene locus_tag LOCUS_18670 595 104 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_18670 1471 599 gene locus_tag LOCUS_18680 1471 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18680 >Feature sequence687 >Feature sequence688 >Feature sequence689 >Feature sequence690 >Feature sequence691 1519 1079 gene locus_tag LOCUS_18690 1519 1079 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963175.1 protein_id gnl|my_center|LOCUS_18690 1831 1547 gene locus_tag LOCUS_18700 1831 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18700 >Feature sequence692 <1 1706 gene locus_tag LOCUS_18710 <1 1706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228149.1:aconitate hydratase AcnA >Feature sequence693 184 603 gene locus_tag LOCUS_18720 184 603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 >Feature sequence694 >Feature sequence695 813 1130 gene locus_tag LOCUS_18730 813 1130 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000389622.1 protein_id gnl|my_center|LOCUS_18730 >Feature sequence696 583 738 gene locus_tag LOCUS_18740 583 738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence697 <1 682 gene locus_tag LOCUS_18750 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015909314.1:ATP-binding protein 1457 768 gene locus_tag LOCUS_18760 gene phoU 1457 768 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391663.1 protein_id gnl|my_center|LOCUS_18760 1763 1518 gene locus_tag LOCUS_18770 1763 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 >Feature sequence698 225 470 gene locus_tag LOCUS_18780 225 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18780 501 896 gene locus_tag LOCUS_18790 501 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 >Feature sequence699 <1 655 gene locus_tag LOCUS_18800 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258554.1:fused MFS/spermidine synthase 668 1219 gene locus_tag LOCUS_18810 668 1219 CDS product 2'-5' RNA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003407809.1 protein_id gnl|my_center|LOCUS_18810 <1811 1297 gene locus_tag LOCUS_18820 <1811 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039175.1:glycoside hydrolase family 3 protein >Feature sequence700 <1 568 gene locus_tag LOCUS_18830 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002357486.1:FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO 579 1304 gene locus_tag LOCUS_18840 579 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 >Feature sequence701 286 1725 gene locus_tag LOCUS_18850 286 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 >Feature sequence702 638 519 gene locus_tag LOCUS_18860 638 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 1477 671 gene locus_tag LOCUS_18870 1477 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18870 >Feature sequence703 1667 558 gene locus_tag LOCUS_18880 gene tgt 1667 558 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897970.1 protein_id gnl|my_center|LOCUS_18880 >Feature sequence704 >Feature sequence705 1048 335 gene locus_tag LOCUS_18890 1048 335 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181587.1 protein_id gnl|my_center|LOCUS_18890 >Feature sequence706 281 964 gene locus_tag LOCUS_18900 281 964 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259716.1 protein_id gnl|my_center|LOCUS_18900 >Feature sequence707 2 937 gene locus_tag LOCUS_18910 gene hisC 2 937 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257801.1 protein_id gnl|my_center|LOCUS_18910 >Feature sequence708 >Feature sequence709 940 1689 gene locus_tag LOCUS_18920 gene truC 940 1689 CDS product tRNA pseudouridine(65) synthase TruC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705086.1 protein_id gnl|my_center|LOCUS_18920 >Feature sequence710 776 207 gene locus_tag LOCUS_18930 776 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18930 <1781 859 gene locus_tag LOCUS_18940 <1781 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259579.1:penicillin acylase family protein >Feature sequence711 1467 715 gene locus_tag LOCUS_18950 1467 715 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257316.1 protein_id gnl|my_center|LOCUS_18950 >Feature sequence712 332 1570 gene locus_tag LOCUS_18960 332 1570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 >Feature sequence713 33 1628 gene locus_tag LOCUS_18970 33 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18970 >Feature sequence714 >Feature sequence715 216 1208 gene locus_tag LOCUS_18980 216 1208 CDS product homoisocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173431.1 protein_id gnl|my_center|LOCUS_18980 >Feature sequence716 1 459 gene locus_tag LOCUS_18990 1 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18990 631 1458 gene locus_tag LOCUS_19000 631 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 >Feature sequence717 484 1383 gene locus_tag LOCUS_19010 484 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19010 >Feature sequence718 <1 789 gene locus_tag LOCUS_19020 <1 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083755909.1:RHS repeat-associated core domain-containing protein 1336 1214 gene locus_tag LOCUS_19030 1336 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 >Feature sequence719 >Feature sequence720 208 465 gene locus_tag LOCUS_19040 208 465 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142654.1 protein_id gnl|my_center|LOCUS_19040 1430 963 gene locus_tag LOCUS_19050 1430 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19050 >Feature sequence721 454 1230 gene locus_tag LOCUS_19060 454 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 >Feature sequence722 >Feature sequence723 >Feature sequence724 1408 827 gene locus_tag LOCUS_19070 1408 827 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228644.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence725 <1730 1034 gene locus_tag LOCUS_19080 <1730 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256941.1:glycosyltransferase family 2 protein >Feature sequence726 >Feature sequence727 467 1669 gene locus_tag LOCUS_19090 467 1669 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229596.1 protein_id gnl|my_center|LOCUS_19090 >Feature sequence728 758 408 gene locus_tag LOCUS_19100 gene rplS 758 408 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068669.1 protein_id gnl|my_center|LOCUS_19100 >Feature sequence729 >Feature sequence730 >Feature sequence731 121 1524 gene locus_tag LOCUS_19110 121 1524 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909443.1 protein_id gnl|my_center|LOCUS_19110 >Feature sequence732 >Feature sequence733 243 908 gene locus_tag LOCUS_19120 243 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_19120 <1707 898 gene locus_tag LOCUS_19130 <1707 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141040.1:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence734 933 184 gene locus_tag LOCUS_19140 933 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 >Feature sequence735 >Feature sequence736 >Feature sequence737 >Feature sequence738 998 204 gene locus_tag LOCUS_19150 gene srlD 998 204 CDS product sorbitol-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582810.1 protein_id gnl|my_center|LOCUS_19150 >Feature sequence739 65 730 gene locus_tag LOCUS_19160 65 730 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255947.1 protein_id gnl|my_center|LOCUS_19160 723 1208 gene locus_tag LOCUS_19170 723 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence740 1173 616 gene locus_tag LOCUS_19180 1173 616 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228180.1 protein_id gnl|my_center|LOCUS_19180 <1682 1166 gene locus_tag LOCUS_19190 <1682 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259615.1:glycosyltransferase family 4 protein >Feature sequence741 484 1548 gene locus_tag LOCUS_19200 gene gutB 484 1548 CDS product sorbitol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244156.1 protein_id gnl|my_center|LOCUS_19200 >Feature sequence742 417 1571 gene locus_tag LOCUS_19210 417 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19210 >Feature sequence743 195 1529 gene locus_tag LOCUS_19220 195 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 >Feature sequence744 992 57 gene locus_tag LOCUS_19230 992 57 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19230 <1677 1007 gene locus_tag LOCUS_19240 <1677 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009873593.1:SUMF1/EgtB/PvdO family nonheme iron enzyme >Feature sequence745 <1677 1041 gene locus_tag LOCUS_19250 <1677 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257167.1:glycosyltransferase family 1 protein >Feature sequence746 <1674 1019 gene locus_tag LOCUS_19260 <1674 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011174518.1:carbohydrate ABC transporter permease >Feature sequence747 1157 753 gene locus_tag LOCUS_19270 1157 753 CDS product heme-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963868.1 protein_id gnl|my_center|LOCUS_19270 >Feature sequence748 393 94 gene locus_tag LOCUS_19280 393 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 1173 1039 gene locus_tag LOCUS_19290 1173 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19290 >Feature sequence749 520 1311 gene locus_tag LOCUS_19300 520 1311 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005113846.1 protein_id gnl|my_center|LOCUS_19300 >Feature sequence750 >Feature sequence751 <1658 1113 gene locus_tag LOCUS_19310 <1658 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257580.1:ABC transporter ATP-binding protein >Feature sequence752 >Feature sequence753 >Feature sequence754 286 945 gene locus_tag LOCUS_19320 286 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 >Feature sequence755 <1 907 gene locus_tag LOCUS_19330 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257413.1:acetyl-CoA C-acetyltransferase >Feature sequence756 <1648 767 gene locus_tag LOCUS_19340 <1648 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258007.1:cytochrome c oxidase subunit II >Feature sequence757 >Feature sequence758 632 498 gene locus_tag LOCUS_19350 632 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19350 <1647 750 gene locus_tag LOCUS_19360 <1647 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933215.1:SAM-dependent chlorinase/fluorinase >Feature sequence759 1521 730 gene locus_tag LOCUS_19370 1521 730 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909158.1 protein_id gnl|my_center|LOCUS_19370 >Feature sequence760 <1 1107 gene locus_tag LOCUS_19380 <1 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_141612405.1:DUF2298 domain-containing protein >Feature sequence761 >Feature sequence762 669 346 gene locus_tag LOCUS_19390 669 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 1528 1058 gene locus_tag LOCUS_19400 1528 1058 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_19400 >Feature sequence763 616 957 gene locus_tag LOCUS_19410 616 957 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_19410 1090 1437 gene locus_tag LOCUS_19420 1090 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 >Feature sequence764 >Feature sequence765 >Feature sequence766 <1 625 gene locus_tag LOCUS_19430 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969219.1:hydroxyacid dehydrogenase 670 1443 gene locus_tag LOCUS_19440 670 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680928.1 protein_id gnl|my_center|LOCUS_19440 >Feature sequence767 217 984 gene locus_tag LOCUS_19450 217 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19450 1077 1151 gene locus_tag LOCUS_t00290 1077 1151 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence768 <1 742 gene locus_tag LOCUS_19460 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258088.1:SpoIIE family protein phosphatase <1636 759 gene locus_tag LOCUS_19470 <1636 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053651.1:RtcB family protein >Feature sequence769 68 487 gene locus_tag LOCUS_19480 gene ruvX 68 487 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058162.1 protein_id gnl|my_center|LOCUS_19480 >Feature sequence770 >Feature sequence771 >Feature sequence772 >Feature sequence773 814 206 gene locus_tag LOCUS_19490 814 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 777 1025 gene locus_tag LOCUS_19500 777 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19500 >Feature sequence774 878 6 gene locus_tag LOCUS_19510 878 6 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080497.1 protein_id gnl|my_center|LOCUS_19510 1551 931 gene locus_tag LOCUS_19520 1551 931 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462142.1 protein_id gnl|my_center|LOCUS_19520 >Feature sequence775 >Feature sequence776 <1625 857 gene locus_tag LOCUS_19530 <1625 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256708.1:ABC transporter permease >Feature sequence777 59 1273 gene locus_tag LOCUS_19540 59 1273 CDS product serine-tRNA(Ala) deacylase AlaX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435901.1 protein_id gnl|my_center|LOCUS_19540 1291 1455 gene locus_tag LOCUS_19550 1291 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19550 >Feature sequence778 444 1499 gene locus_tag LOCUS_19560 gene fbaB 444 1499 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365768.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence779 469 1308 gene locus_tag LOCUS_19570 gene proC 469 1308 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_171512658.1 protein_id gnl|my_center|LOCUS_19570 >Feature sequence780 >Feature sequence781 >Feature sequence782 >Feature sequence783 1354 824 gene locus_tag LOCUS_19580 1354 824 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003977514.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence784 1361 18 gene locus_tag LOCUS_19590 gene asnS 1361 18 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257312.1 protein_id gnl|my_center|LOCUS_19590 >Feature sequence785 >Feature sequence786 <1592 893 gene locus_tag LOCUS_19600 <1592 893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256145.1:hydroxymethylglutaryl-CoA reductase, degradative >Feature sequence787 >Feature sequence788 >Feature sequence789 1422 721 gene locus_tag LOCUS_19610 gene nagR 1422 721 CDS product transcriptional regulator NagR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228089.1 protein_id gnl|my_center|LOCUS_19610 >Feature sequence790 202 810 gene locus_tag LOCUS_19620 202 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 <1584 816 gene locus_tag LOCUS_19630 <1584 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392762.1:uroporphyrinogen-III C-methyltransferase >Feature sequence791 895 263 gene locus_tag LOCUS_19640 gene dhaL 895 263 CDS product dihydroxyacetone kinase subunit DhaL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257203.1 protein_id gnl|my_center|LOCUS_19640 1581 946 gene locus_tag LOCUS_19650 1581 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19650 >Feature sequence792 >Feature sequence793 105 794 gene locus_tag LOCUS_19660 105 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19660 <1571 813 gene locus_tag LOCUS_19670 <1571 813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966829.1:Ig domain-containing protein >Feature sequence794 631 191 gene locus_tag LOCUS_19680 631 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 1385 968 gene locus_tag LOCUS_tm00010 1385 968 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence795 99 1043 gene locus_tag LOCUS_19690 99 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19690 >Feature sequence796 >Feature sequence797 <1 792 gene locus_tag LOCUS_19700 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392141.1:glycine--tRNA ligase subunit beta >Feature sequence798 >Feature sequence799 888 724 gene locus_tag LOCUS_19710 888 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19710 <1563 909 gene locus_tag LOCUS_19720 <1563 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942433.1:polyprenol monophosphomannose synthase >Feature sequence800 <1563 241 gene locus_tag LOCUS_19730 <1563 241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144150.1:YvcK family protein >Feature sequence801 781 377 gene locus_tag LOCUS_19740 781 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 <1561 877 gene locus_tag LOCUS_19750 <1561 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000153584.1:NUDIX hydrolase >Feature sequence802 >Feature sequence803 <1560 927 gene locus_tag LOCUS_19760 <1560 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_157860163.1:aminotransferase class V-fold PLP-dependent enzyme >Feature sequence804 2 157 gene locus_tag LOCUS_19770 2 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1014 202 gene locus_tag LOCUS_19780 1014 202 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957337.1 protein_id gnl|my_center|LOCUS_19780 >Feature sequence805 1481 171 gene locus_tag LOCUS_19790 1481 171 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256439.1 protein_id gnl|my_center|LOCUS_19790 >Feature sequence806 >Feature sequence807 1242 79 gene locus_tag LOCUS_19800 1242 79 CDS product PatB family C-S lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257518.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence808 485 1201 gene locus_tag LOCUS_19810 gene rplA 485 1201 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_19810 >Feature sequence809 >Feature sequence810 100 324 gene locus_tag LOCUS_19820 100 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19820 311 688 gene locus_tag LOCUS_19830 311 688 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014857681.1 protein_id gnl|my_center|LOCUS_19830 749 1390 gene locus_tag LOCUS_19840 749 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 >Feature sequence811 1143 238 gene locus_tag LOCUS_19850 1143 238 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257710.1 protein_id gnl|my_center|LOCUS_19850 >Feature sequence812 >Feature sequence813 <1538 249 gene locus_tag LOCUS_19860 <1538 249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393179.1:histidine--tRNA ligase >Feature sequence814 68 1237 gene locus_tag LOCUS_19870 gene hemW 68 1237 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392119.1 protein_id gnl|my_center|LOCUS_19870 >Feature sequence815 >Feature sequence816 >Feature sequence817 632 3 gene locus_tag LOCUS_19880 632 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19880 1440 823 gene locus_tag LOCUS_19890 1440 823 CDS product xanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000770415.1 protein_id gnl|my_center|LOCUS_19890 >Feature sequence818 >Feature sequence819 <1 697 gene locus_tag LOCUS_19900 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393148.1:YgeY family selenium metabolism-linked hydrolase >Feature sequence820 >Feature sequence821 <1 643 gene locus_tag LOCUS_19910 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257833.1:aspartate kinase >Feature sequence822 >Feature sequence823 >Feature sequence824 154 786 gene locus_tag LOCUS_19920 gene hisG 154 786 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009968235.1 protein_id gnl|my_center|LOCUS_19920 >Feature sequence825 1056 301 gene locus_tag LOCUS_19930 1056 301 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904156.1 protein_id gnl|my_center|LOCUS_19930 >Feature sequence826 371 1459 gene locus_tag LOCUS_19940 371 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19940 >Feature sequence827 <1513 744 gene locus_tag LOCUS_19950 <1513 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228126.1:thiolase family protein >Feature sequence828 >Feature sequence829 >Feature sequence830 >Feature sequence831 >Feature sequence832 >Feature sequence833 88 1272 gene locus_tag LOCUS_19960 88 1272 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038780.1 protein_id gnl|my_center|LOCUS_19960 >Feature sequence834 >Feature sequence835 >Feature sequence836 184 1302 gene locus_tag LOCUS_19970 184 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256950.1 protein_id gnl|my_center|LOCUS_19970