>Feature sequence001 2236 3495 gene locus_tag LOCUS_00010 2236 3495 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888861.1 protein_id gnl|my_center|LOCUS_00010 3464 3916 gene locus_tag LOCUS_00020 gene smpB 3464 3916 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943280.1 protein_id gnl|my_center|LOCUS_00020 3916 4815 gene locus_tag LOCUS_00030 gene nadA 3916 4815 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066395.1 protein_id gnl|my_center|LOCUS_00030 4852 5151 gene locus_tag LOCUS_00040 4852 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 5186 6478 gene locus_tag LOCUS_00050 5186 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6519 7067 gene locus_tag LOCUS_00060 6519 7067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 7060 7323 gene locus_tag LOCUS_00070 7060 7323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7320 8720 gene locus_tag LOCUS_00080 gene gatA 7320 8720 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880108.1 protein_id gnl|my_center|LOCUS_00080 8724 9575 gene locus_tag LOCUS_00090 8724 9575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 9618 9692 gene locus_tag LOCUS_t00010 9618 9692 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 9697 9771 gene locus_tag LOCUS_t00020 9697 9771 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 9801 10187 gene locus_tag LOCUS_00100 9801 10187 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943207.1 protein_id gnl|my_center|LOCUS_00100 10184 11035 gene locus_tag LOCUS_00110 10184 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11028 11633 gene locus_tag LOCUS_00120 11028 11633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11623 12405 gene locus_tag LOCUS_00130 gene pssA 11623 12405 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546557.1 protein_id gnl|my_center|LOCUS_00130 12389 13336 gene locus_tag LOCUS_00140 12389 13336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13329 15092 gene locus_tag LOCUS_00150 13329 15092 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545590.1 protein_id gnl|my_center|LOCUS_00150 15093 15944 gene locus_tag LOCUS_00160 15093 15944 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625866.1 protein_id gnl|my_center|LOCUS_00160 15956 16198 gene locus_tag LOCUS_00170 15956 16198 CDS product DUF370 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925137.1 protein_id gnl|my_center|LOCUS_00170 16191 16796 gene locus_tag LOCUS_00180 gene gmk 16191 16796 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_00180 16784 17947 gene locus_tag LOCUS_00190 gene coaBC 16784 17947 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460556.1 protein_id gnl|my_center|LOCUS_00190 17944 19125 gene locus_tag LOCUS_00200 17944 19125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19290 19616 gene locus_tag LOCUS_00210 19290 19616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 19658 20032 gene locus_tag LOCUS_00220 19658 20032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 21213 20029 gene locus_tag LOCUS_00230 21213 20029 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256327.1 protein_id gnl|my_center|LOCUS_00230 22568 21261 gene locus_tag LOCUS_00240 22568 21261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 24052 22565 gene locus_tag LOCUS_00250 24052 22565 CDS product Gldg family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057315.1 protein_id gnl|my_center|LOCUS_00250 24824 24057 gene locus_tag LOCUS_00260 24824 24057 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_00260 25546 24821 gene locus_tag LOCUS_00270 25546 24821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 27421 25556 gene locus_tag LOCUS_00280 27421 25556 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250186.1 protein_id gnl|my_center|LOCUS_00280 >Feature sequence002 236 979 gene locus_tag LOCUS_00290 236 979 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881298.1 protein_id gnl|my_center|LOCUS_00290 1802 903 gene locus_tag LOCUS_00300 1802 903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 2802 1792 gene locus_tag LOCUS_00310 2802 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 3871 2816 gene locus_tag LOCUS_00320 3871 2816 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583463.1 protein_id gnl|my_center|LOCUS_00320 4767 3868 gene locus_tag LOCUS_00330 4767 3868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 4819 5049 gene locus_tag LOCUS_00340 4819 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 5021 5030 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5051 6601 gene locus_tag LOCUS_00350 gene ftsH 5051 6601 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00350 6601 7374 gene locus_tag LOCUS_00360 gene cdaA 6601 7374 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_00360 7442 8242 gene locus_tag LOCUS_00370 7442 8242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 7483 7492 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8239 9558 gene locus_tag LOCUS_00380 gene glmM 8239 9558 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228407.1 protein_id gnl|my_center|LOCUS_00380 9560 10288 gene locus_tag LOCUS_00390 9560 10288 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056682.1 protein_id gnl|my_center|LOCUS_00390 10293 11489 gene locus_tag LOCUS_00400 gene ackA 10293 11489 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082978.1 protein_id gnl|my_center|LOCUS_00400 13153 11486 gene locus_tag LOCUS_00410 gene ggt 13153 11486 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003086881.1 protein_id gnl|my_center|LOCUS_00410 13201 13878 gene locus_tag LOCUS_00420 13201 13878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 13862 14854 gene locus_tag LOCUS_00430 gene mtnA 13862 14854 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_00430 14838 15578 gene locus_tag LOCUS_00440 14838 15578 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_00440 15562 16116 gene locus_tag LOCUS_00450 15562 16116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 16129 17319 gene locus_tag LOCUS_00460 16129 17319 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583336.1 protein_id gnl|my_center|LOCUS_00460 17471 17543 gene locus_tag LOCUS_t00030 17471 17543 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 17554 18276 gene locus_tag LOCUS_00470 17554 18276 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009872628.1 protein_id gnl|my_center|LOCUS_00470 19307 18273 gene locus_tag LOCUS_00480 19307 18273 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005170771.1 protein_id gnl|my_center|LOCUS_00480 20371 19358 gene locus_tag LOCUS_00490 gene cydB 20371 19358 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_00490 21699 20383 gene locus_tag LOCUS_00500 21699 20383 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545853.1 protein_id gnl|my_center|LOCUS_00500 21942 21769 gene locus_tag LOCUS_00510 21942 21769 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869872.1 protein_id gnl|my_center|LOCUS_00510 22458 21955 gene locus_tag LOCUS_00520 22458 21955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00520 22880 22461 gene locus_tag LOCUS_00530 22880 22461 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582438.1 protein_id gnl|my_center|LOCUS_00530 23096 22896 gene locus_tag LOCUS_00540 23096 22896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 23572 23225 gene locus_tag LOCUS_00550 23572 23225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 23231 23240 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 23966 23583 gene locus_tag LOCUS_00560 23966 23583 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582816.1 protein_id gnl|my_center|LOCUS_00560 24489 23983 gene locus_tag LOCUS_00570 24489 23983 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146717.1 protein_id gnl|my_center|LOCUS_00570 25211 24549 gene locus_tag LOCUS_00580 25211 24549 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080855.1 protein_id gnl|my_center|LOCUS_00580 25845 25225 gene locus_tag LOCUS_00590 25845 25225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250948.1 protein_id gnl|my_center|LOCUS_00590 27038 25857 gene locus_tag LOCUS_00600 27038 25857 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_00600 >Feature sequence003 768 1202 gene locus_tag LOCUS_00610 gene tadA 768 1202 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003028727.1 protein_id gnl|my_center|LOCUS_00610 1204 2454 gene locus_tag LOCUS_00620 1204 2454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 2917 2447 gene locus_tag LOCUS_00630 2917 2447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 4616 2910 gene locus_tag LOCUS_00640 4616 2910 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065752.1 protein_id gnl|my_center|LOCUS_00640 6185 5289 gene locus_tag LOCUS_00650 6185 5289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 6242 6823 gene locus_tag LOCUS_00660 6242 6823 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933512.1 protein_id gnl|my_center|LOCUS_00660 6870 6796 gene locus_tag LOCUS_t00040 6870 6796 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6887 7486 gene locus_tag LOCUS_00670 6887 7486 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986274.1 protein_id gnl|my_center|LOCUS_00670 7487 8239 gene locus_tag LOCUS_00680 7487 8239 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005468574.1 protein_id gnl|my_center|LOCUS_00680 8209 8859 gene locus_tag LOCUS_00690 8209 8859 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001973894.1 protein_id gnl|my_center|LOCUS_00690 8846 9811 gene locus_tag LOCUS_00700 8846 9811 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081416.1 protein_id gnl|my_center|LOCUS_00700 9839 10333 gene locus_tag LOCUS_00710 9839 10333 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870109.1 protein_id gnl|my_center|LOCUS_00710 11169 10330 gene locus_tag LOCUS_00720 11169 10330 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479855.1 protein_id gnl|my_center|LOCUS_00720 11474 11166 gene locus_tag LOCUS_00730 11474 11166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00730 11825 11535 gene locus_tag LOCUS_00740 11825 11535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00740 12769 11825 gene locus_tag LOCUS_00750 12769 11825 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943549.1 protein_id gnl|my_center|LOCUS_00750 13610 12756 gene locus_tag LOCUS_00760 13610 12756 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177224003.1 protein_id gnl|my_center|LOCUS_00760 14829 13600 gene locus_tag LOCUS_00770 gene gatB 14829 13600 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_00770 14716 14946 gene locus_tag LOCUS_00780 14716 14946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 15055 16116 gene locus_tag LOCUS_00790 15055 16116 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978063.1 protein_id gnl|my_center|LOCUS_00790 16113 17078 gene locus_tag LOCUS_00800 16113 17078 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_00800 17078 18340 gene locus_tag LOCUS_00810 17078 18340 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545257.1 protein_id gnl|my_center|LOCUS_00810 18351 18767 gene locus_tag LOCUS_00820 gene ndk 18351 18767 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_00820 18760 19110 gene locus_tag LOCUS_00830 gene bldG 18760 19110 CDS product anti-sigma factor antagonist BldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975386.1 protein_id gnl|my_center|LOCUS_00830 19097 19507 gene locus_tag LOCUS_00840 19097 19507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 19477 20712 gene locus_tag LOCUS_00850 19477 20712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 20712 22790 gene locus_tag LOCUS_00860 20712 22790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 25829 22821 gene locus_tag LOCUS_00870 25829 22821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 26541 25840 gene locus_tag LOCUS_00880 26541 25840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 >Feature sequence004 <1 724 gene locus_tag LOCUS_00890 <1 724 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583633.1:glutamate--tRNA ligase 573 582 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 823 2379 gene locus_tag LOCUS_00900 823 2379 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391938.1 protein_id gnl|my_center|LOCUS_00900 2380 3288 gene locus_tag LOCUS_00910 2380 3288 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391940.1 protein_id gnl|my_center|LOCUS_00910 3281 3943 gene locus_tag LOCUS_00920 3281 3943 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392225.1 protein_id gnl|my_center|LOCUS_00920 3994 4569 gene locus_tag LOCUS_00930 3994 4569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 4520 4529 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4605 5267 gene locus_tag LOCUS_00940 4605 5267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 5264 6517 gene locus_tag LOCUS_00950 5264 6517 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583204.1 protein_id gnl|my_center|LOCUS_00950 6618 6881 gene locus_tag LOCUS_00960 6618 6881 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_00960 6939 7844 gene locus_tag LOCUS_00970 6939 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 8922 7774 gene locus_tag LOCUS_00980 gene lpxB 8922 7774 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_00980 9398 8910 gene locus_tag LOCUS_00990 9398 8910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 9799 9392 gene locus_tag LOCUS_01000 9799 9392 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942420.1 protein_id gnl|my_center|LOCUS_01000 10232 9774 gene locus_tag LOCUS_01010 10232 9774 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942421.1 protein_id gnl|my_center|LOCUS_01010 12399 10222 gene locus_tag LOCUS_01020 gene pnp 12399 10222 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_01020 12671 12402 gene locus_tag LOCUS_01030 gene rpsO 12671 12402 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_01030 12749 14725 gene locus_tag LOCUS_01040 12749 14725 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925700.1 protein_id gnl|my_center|LOCUS_01040 14761 14846 gene locus_tag LOCUS_t00050 14761 14846 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 14804 17449 gene locus_tag LOCUS_01050 14804 17449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 17424 18773 gene locus_tag LOCUS_01060 17424 18773 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_01060 19116 18766 gene locus_tag LOCUS_01070 19116 18766 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_01070 20447 19113 gene locus_tag LOCUS_01080 20447 19113 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861455.1 protein_id gnl|my_center|LOCUS_01080 >Feature sequence005 1201 1052 gene locus_tag LOCUS_01090 1201 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 1231 1608 gene locus_tag LOCUS_01100 1231 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 2001 1612 gene locus_tag LOCUS_01110 2001 1612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 3013 2003 gene locus_tag LOCUS_01120 3013 2003 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546042.1 protein_id gnl|my_center|LOCUS_01120 3658 3026 gene locus_tag LOCUS_01130 gene rpsD 3658 3026 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_01130 4062 3670 gene locus_tag LOCUS_01140 gene rpsK 4062 3670 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258256.1 protein_id gnl|my_center|LOCUS_01140 4444 4073 gene locus_tag LOCUS_01150 gene rpsM 4444 4073 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081785.1 protein_id gnl|my_center|LOCUS_01150 4802 4578 gene locus_tag LOCUS_01160 gene infA 4802 4578 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081789.1 protein_id gnl|my_center|LOCUS_01160 5572 4802 gene locus_tag LOCUS_01170 gene map 5572 4802 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_01170 6192 5569 gene locus_tag LOCUS_01180 6192 5569 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_01180 7559 6189 gene locus_tag LOCUS_01190 gene secY 7559 6189 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545307.1 protein_id gnl|my_center|LOCUS_01190 7845 7561 gene locus_tag LOCUS_01200 7845 7561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01200 8007 7846 gene locus_tag LOCUS_01210 8007 7846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01210 8201 8004 gene locus_tag LOCUS_01220 gene rpmD 8201 8004 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258249.1 protein_id gnl|my_center|LOCUS_01220 8677 8174 gene locus_tag LOCUS_01230 gene rpsE 8677 8174 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421138.1 protein_id gnl|my_center|LOCUS_01230 9062 8688 gene locus_tag LOCUS_01240 gene rplR 9062 8688 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_01240 9607 9062 gene locus_tag LOCUS_01250 gene rplF 9607 9062 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869914.1 protein_id gnl|my_center|LOCUS_01250 10014 9616 gene locus_tag LOCUS_01260 gene rpsH 10014 9616 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966398.1 protein_id gnl|my_center|LOCUS_01260 10210 10025 gene locus_tag LOCUS_01270 10210 10025 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_01270 10761 10213 gene locus_tag LOCUS_01280 gene rplE 10761 10213 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869917.1 protein_id gnl|my_center|LOCUS_01280 11105 10773 gene locus_tag LOCUS_01290 gene rplX 11105 10773 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938609.1 protein_id gnl|my_center|LOCUS_01290 11470 11102 gene locus_tag LOCUS_01300 gene rplN 11470 11102 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869919.1 protein_id gnl|my_center|LOCUS_01300 11741 11481 gene locus_tag LOCUS_01310 11741 11481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 11931 11734 gene locus_tag LOCUS_01320 gene rpmC 11931 11734 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393929.1 protein_id gnl|my_center|LOCUS_01320 12351 11935 gene locus_tag LOCUS_01330 gene rplP 12351 11935 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357619.1 protein_id gnl|my_center|LOCUS_01330 13062 12355 gene locus_tag LOCUS_01340 gene rpsC 13062 12355 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583351.1 protein_id gnl|my_center|LOCUS_01340 13409 13065 gene locus_tag LOCUS_01350 gene rplV 13409 13065 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567555.1 protein_id gnl|my_center|LOCUS_01350 13694 13419 gene locus_tag LOCUS_01360 gene rpsS 13694 13419 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173711.1 protein_id gnl|my_center|LOCUS_01360 14522 13698 gene locus_tag LOCUS_01370 gene rplB 14522 13698 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_01370 14820 14524 gene locus_tag LOCUS_01380 gene rplW 14820 14524 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546250.1 protein_id gnl|my_center|LOCUS_01380 15437 14817 gene locus_tag LOCUS_01390 gene rplD 15437 14817 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_01390 16108 15434 gene locus_tag LOCUS_01400 gene rplC 16108 15434 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545966.1 protein_id gnl|my_center|LOCUS_01400 16424 16110 gene locus_tag LOCUS_01410 gene rpsJ 16424 16110 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000918607.1 protein_id gnl|my_center|LOCUS_01410 17631 16429 gene locus_tag LOCUS_01420 gene tuf 17631 16429 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545401.1 protein_id gnl|my_center|LOCUS_01420 19718 17634 gene locus_tag LOCUS_01430 gene fusA 19718 17634 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393940.1 protein_id gnl|my_center|LOCUS_01430 20195 19725 gene locus_tag LOCUS_01440 gene rpsG 20195 19725 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_01440 20582 20205 gene locus_tag LOCUS_01450 gene rpsL 20582 20205 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880443.1 protein_id gnl|my_center|LOCUS_01450 >Feature sequence006 907 557 gene locus_tag LOCUS_01460 gene rplT 907 557 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880587.1 protein_id gnl|my_center|LOCUS_01460 1113 919 gene locus_tag LOCUS_01470 gene rpmI 1113 919 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357520.1 protein_id gnl|my_center|LOCUS_01470 1678 1094 gene locus_tag LOCUS_01480 gene infC 1678 1094 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881156.1 protein_id gnl|my_center|LOCUS_01480 3600 1690 gene locus_tag LOCUS_01490 gene thrS 3600 1690 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545243.1 protein_id gnl|my_center|LOCUS_01490 3686 3613 gene locus_tag LOCUS_t00060 3686 3613 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3959 3684 gene locus_tag LOCUS_01500 3959 3684 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938065.1 protein_id gnl|my_center|LOCUS_01500 4101 6746 gene locus_tag LOCUS_01510 4101 6746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 6819 8093 gene locus_tag LOCUS_01520 6819 8093 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_01520 8107 9417 gene locus_tag LOCUS_01530 8107 9417 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_01530 9430 10503 gene locus_tag LOCUS_01540 9430 10503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 10601 11176 gene locus_tag LOCUS_01550 10601 11176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 11173 12534 gene locus_tag LOCUS_01560 11173 12534 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_01560 12627 13394 gene locus_tag LOCUS_01570 12627 13394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 13309 13318 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13360 13638 gene locus_tag LOCUS_01580 13360 13638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 14741 14091 gene locus_tag LOCUS_01590 14741 14091 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880976.1 protein_id gnl|my_center|LOCUS_01590 16065 14752 gene locus_tag LOCUS_01600 16065 14752 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461353.1 protein_id gnl|my_center|LOCUS_01600 16553 16062 gene locus_tag LOCUS_01610 gene lepB 16553 16062 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870097.1 protein_id gnl|my_center|LOCUS_01610 16641 16564 gene locus_tag LOCUS_t00070 16641 16564 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 16721 16650 gene locus_tag LOCUS_t00080 16721 16650 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 17176 16784 gene locus_tag LOCUS_01620 17176 16784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 17798 17274 gene locus_tag LOCUS_01630 17798 17274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 18340 17816 gene locus_tag LOCUS_01640 18340 17816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 >Feature sequence007 <1 1788 gene locus_tag LOCUS_01650 <1 1788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392429.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1790 2812 gene locus_tag LOCUS_01660 gene recA 1790 2812 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390446.1 protein_id gnl|my_center|LOCUS_01660 3902 2775 gene locus_tag LOCUS_01670 3902 2775 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867904.1 protein_id gnl|my_center|LOCUS_01670 3961 4326 gene locus_tag LOCUS_01680 3961 4326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 4323 4493 gene locus_tag LOCUS_01690 4323 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 4490 6166 gene locus_tag LOCUS_01700 gene aspS 4490 6166 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172809.1 protein_id gnl|my_center|LOCUS_01700 6404 6156 gene locus_tag LOCUS_01710 6404 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 6822 6409 gene locus_tag LOCUS_01720 gene tsaE 6822 6409 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082108.1 protein_id gnl|my_center|LOCUS_01720 8359 6815 gene locus_tag LOCUS_01730 8359 6815 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942447.1 protein_id gnl|my_center|LOCUS_01730 8425 9270 gene locus_tag LOCUS_01740 8425 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 9634 9230 gene locus_tag LOCUS_01750 9634 9230 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869516.1 protein_id gnl|my_center|LOCUS_01750 10442 9621 gene locus_tag LOCUS_01760 gene galU 10442 9621 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_01760 10523 10450 gene locus_tag LOCUS_t00090 10523 10450 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 12260 10542 gene locus_tag LOCUS_01770 12260 10542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 13163 12261 gene locus_tag LOCUS_01780 gene argF 13163 12261 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_01780 14111 13167 gene locus_tag LOCUS_01790 gene arcC 14111 13167 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_01790 15424 14108 gene locus_tag LOCUS_01800 15424 14108 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_01800 15678 15466 gene locus_tag LOCUS_01810 15678 15466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 16382 15696 gene locus_tag LOCUS_01820 16382 15696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 16497 16616 gene locus_tag LOCUS_01830 16497 16616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 17590 16604 gene locus_tag LOCUS_01840 17590 16604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 >Feature sequence008 <1 851 gene locus_tag LOCUS_01850 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101478.1:Stk1 family PASTA domain-containing Ser/Thr kinase 861 2045 gene locus_tag LOCUS_01860 861 2045 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_01860 2026 2484 gene locus_tag LOCUS_01870 2026 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 2459 5041 gene locus_tag LOCUS_01880 gene alaS 2459 5041 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880825.1 protein_id gnl|my_center|LOCUS_01880 5038 5667 gene locus_tag LOCUS_01890 5038 5667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 5723 6364 gene locus_tag LOCUS_01900 5723 6364 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867285.1 protein_id gnl|my_center|LOCUS_01900 6684 6974 gene locus_tag LOCUS_01910 6684 6974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 6953 7747 gene locus_tag LOCUS_01920 gene ispE 6953 7747 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966185.1 protein_id gnl|my_center|LOCUS_01920 7738 7812 gene locus_tag LOCUS_t00100 7738 7812 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 7823 8755 gene locus_tag LOCUS_01930 7823 8755 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000107420.1 protein_id gnl|my_center|LOCUS_01930 8766 9431 gene locus_tag LOCUS_01940 8766 9431 CDS product 50S ribosomal protein L25 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546254.1 protein_id gnl|my_center|LOCUS_01940 9431 10027 gene locus_tag LOCUS_01950 gene pth 9431 10027 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022853109.1 protein_id gnl|my_center|LOCUS_01950 10030 10425 gene locus_tag LOCUS_01960 10030 10425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 10422 10667 gene locus_tag LOCUS_01970 gene rpsR 10422 10667 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583715.1 protein_id gnl|my_center|LOCUS_01970 10678 11133 gene locus_tag LOCUS_01980 gene rplI 10678 11133 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_01980 11135 12547 gene locus_tag LOCUS_01990 gene dnaB 11135 12547 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_01990 12544 13614 gene locus_tag LOCUS_02000 gene alr 12544 13614 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941268.1 protein_id gnl|my_center|LOCUS_02000 13607 14362 gene locus_tag LOCUS_02010 13607 14362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_02010 14344 15087 gene locus_tag LOCUS_02020 14344 15087 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_02020 15084 16337 gene locus_tag LOCUS_02030 15084 16337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 17695 16340 gene locus_tag LOCUS_02040 17695 16340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence009 <1 3706 gene locus_tag LOCUS_02050 <1 3706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' 3703 5010 gene locus_tag LOCUS_02060 3703 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 5204 6136 gene locus_tag LOCUS_02070 gene prfB 5204 6136 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082004.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02070 6152 6454 gene locus_tag LOCUS_02080 6152 6454 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001018860.1 protein_id gnl|my_center|LOCUS_02080 6451 6915 gene locus_tag LOCUS_02090 6451 6915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 8345 6912 gene locus_tag LOCUS_02100 8345 6912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 9101 8349 gene locus_tag LOCUS_02110 9101 8349 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673490.1 protein_id gnl|my_center|LOCUS_02110 11887 9098 gene locus_tag LOCUS_02120 11887 9098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 12483 11884 gene locus_tag LOCUS_02130 12483 11884 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_02130 12794 14355 gene locus_tag LOCUS_r00010 12794 14355 rRNA product 16S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 14422 14497 gene locus_tag LOCUS_t00110 14422 14497 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 14507 14580 gene locus_tag LOCUS_t00120 14507 14580 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence010 486 1847 gene locus_tag LOCUS_02140 486 1847 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544969.1 protein_id gnl|my_center|LOCUS_02140 1848 3008 gene locus_tag LOCUS_02150 1848 3008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 3561 3016 gene locus_tag LOCUS_02160 3561 3016 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081962.1 protein_id gnl|my_center|LOCUS_02160 3845 3570 gene locus_tag LOCUS_02170 3845 3570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 3929 3853 gene locus_tag LOCUS_t00130 3929 3853 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4527 3937 gene locus_tag LOCUS_02180 4527 3937 CDS product YqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161533195.1 protein_id gnl|my_center|LOCUS_02180 5257 4514 gene locus_tag LOCUS_02190 gene surE 5257 4514 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942170.1 protein_id gnl|my_center|LOCUS_02190 5346 5270 gene locus_tag LOCUS_t00140 5346 5270 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 5632 5351 gene locus_tag LOCUS_02200 5632 5351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 5654 6076 gene locus_tag LOCUS_02210 5654 6076 CDS product 6-pyruvoyl tetrahydropterin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004595914.1 protein_id gnl|my_center|LOCUS_02210 6063 6722 gene locus_tag LOCUS_02220 6063 6722 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_02220 6763 8052 gene locus_tag LOCUS_02230 gene hisS 6763 8052 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203280.1 protein_id gnl|my_center|LOCUS_02230 8070 8162 gene locus_tag LOCUS_t00150 8070 8162 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 8175 8831 gene locus_tag LOCUS_02240 8175 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 8874 10091 gene locus_tag LOCUS_02250 8874 10091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 10073 11275 gene locus_tag LOCUS_02260 10073 11275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 11275 12153 gene locus_tag LOCUS_02270 gene xerC 11275 12153 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007324269.1 protein_id gnl|my_center|LOCUS_02270 12150 13502 gene locus_tag LOCUS_02280 12150 13502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 14053 13490 gene locus_tag LOCUS_02290 14053 13490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 14646 14110 gene locus_tag LOCUS_02300 14646 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 15139 14624 gene locus_tag LOCUS_02310 15139 14624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 15764 15156 gene locus_tag LOCUS_02320 15764 15156 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268942.1 protein_id gnl|my_center|LOCUS_02320 16041 15739 gene locus_tag LOCUS_02330 16041 15739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 16847 16044 gene locus_tag LOCUS_02340 gene amrB 16847 16044 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545930.1 protein_id gnl|my_center|LOCUS_02340 >Feature sequence011 194 1333 gene locus_tag LOCUS_02350 194 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 1330 1698 gene locus_tag LOCUS_02360 1330 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 1716 2117 gene locus_tag LOCUS_02370 1716 2117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 2221 3528 gene locus_tag LOCUS_02380 2221 3528 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_02380 4115 3525 gene locus_tag LOCUS_02390 4115 3525 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_02390 4619 4131 gene locus_tag LOCUS_02400 4619 4131 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940775.1 protein_id gnl|my_center|LOCUS_02400 5584 4649 gene locus_tag LOCUS_02410 5584 4649 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582674.1 protein_id gnl|my_center|LOCUS_02410 6776 5595 gene locus_tag LOCUS_02420 6776 5595 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545720.1 protein_id gnl|my_center|LOCUS_02420 7084 6788 gene locus_tag LOCUS_02430 7084 6788 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546290.1 protein_id gnl|my_center|LOCUS_02430 7653 7081 gene locus_tag LOCUS_02440 7653 7081 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582671.1 protein_id gnl|my_center|LOCUS_02440 8269 7667 gene locus_tag LOCUS_02450 gene recR 8269 7667 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421618.1 protein_id gnl|my_center|LOCUS_02450 8559 8269 gene locus_tag LOCUS_02460 8559 8269 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001996460.1 protein_id gnl|my_center|LOCUS_02460 10046 8559 gene locus_tag LOCUS_02470 gene dnaX 10046 8559 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081077.1 protein_id gnl|my_center|LOCUS_02470 10304 10213 gene locus_tag LOCUS_t00160 10304 10213 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10421 10332 gene locus_tag LOCUS_t00170 10421 10332 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10472 11836 gene locus_tag LOCUS_02480 10472 11836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 11833 12729 gene locus_tag LOCUS_02490 11833 12729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 13709 12714 gene locus_tag LOCUS_02500 gene ruvB 13709 12714 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229718.1 protein_id gnl|my_center|LOCUS_02500 14257 13706 gene locus_tag LOCUS_02510 gene ruvA 14257 13706 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000580325.1 protein_id gnl|my_center|LOCUS_02510 14700 14254 gene locus_tag LOCUS_02520 gene ruvC 14700 14254 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810732.1 protein_id gnl|my_center|LOCUS_02520 15449 14697 gene locus_tag LOCUS_02530 15449 14697 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_02530 >Feature sequence012 1777 809 gene locus_tag LOCUS_02540 gene lpxD 1777 809 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_02540 2600 1767 gene locus_tag LOCUS_02550 2600 1767 CDS product virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000920757.1 protein_id gnl|my_center|LOCUS_02550 2944 2624 gene locus_tag LOCUS_02560 2944 2624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3685 2957 gene locus_tag LOCUS_02570 gene atpB 3685 2957 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938217.1 protein_id gnl|my_center|LOCUS_02570 4046 3657 gene locus_tag LOCUS_02580 4046 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4254 4030 gene locus_tag LOCUS_02590 4254 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 4538 4251 gene locus_tag LOCUS_02600 4538 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 7020 4582 gene locus_tag LOCUS_02610 gene mutS 7020 4582 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435264.1 protein_id gnl|my_center|LOCUS_02610 9068 7026 gene locus_tag LOCUS_02620 9068 7026 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964428.1 protein_id gnl|my_center|LOCUS_02620 9669 9079 gene locus_tag LOCUS_02630 9669 9079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 10836 9715 gene locus_tag LOCUS_02640 10836 9715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 9956 9965 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12310 10823 gene locus_tag LOCUS_02650 12310 10823 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121872.1 protein_id gnl|my_center|LOCUS_02650 12823 12314 gene locus_tag LOCUS_02660 12823 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 13501 12878 gene locus_tag LOCUS_02670 13501 12878 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081572.1 protein_id gnl|my_center|LOCUS_02670 13562 14764 gene locus_tag LOCUS_02680 13562 14764 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880177.1 protein_id gnl|my_center|LOCUS_02680 >Feature sequence013 <1 985 gene locus_tag LOCUS_02690 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393330.1:cytochrome c biogenesis protein CcdA 1416 982 gene locus_tag LOCUS_02700 1416 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 1460 2170 gene locus_tag LOCUS_02710 1460 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 2167 2820 gene locus_tag LOCUS_02720 gene rpe 2167 2820 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870387.1 protein_id gnl|my_center|LOCUS_02720 2817 3608 gene locus_tag LOCUS_02730 2817 3608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3586 3897 gene locus_tag LOCUS_02740 3586 3897 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784330.1 protein_id gnl|my_center|LOCUS_02740 3901 4692 gene locus_tag LOCUS_02750 3901 4692 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895823.1 protein_id gnl|my_center|LOCUS_02750 4658 6319 gene locus_tag LOCUS_02760 4658 6319 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228055.1 protein_id gnl|my_center|LOCUS_02760 6372 7652 gene locus_tag LOCUS_02770 6372 7652 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938840.1 protein_id gnl|my_center|LOCUS_02770 7664 8896 gene locus_tag LOCUS_02780 7664 8896 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404687.1 protein_id gnl|my_center|LOCUS_02780 8933 9673 gene locus_tag LOCUS_02790 8933 9673 CDS product NAD-dependent protein deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081476.1 protein_id gnl|my_center|LOCUS_02790 10561 9650 gene locus_tag LOCUS_02800 10561 9650 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926948.1 protein_id gnl|my_center|LOCUS_02800 11618 10545 gene locus_tag LOCUS_02810 gene ispG 11618 10545 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942105.1 protein_id gnl|my_center|LOCUS_02810 12907 11615 gene locus_tag LOCUS_02820 gene rseP 12907 11615 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881281.1 protein_id gnl|my_center|LOCUS_02820 14016 12904 gene locus_tag LOCUS_02830 14016 12904 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942560.1 protein_id gnl|my_center|LOCUS_02830 14789 14013 gene locus_tag LOCUS_02840 14789 14013 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460414.1 protein_id gnl|my_center|LOCUS_02840 15343 14786 gene locus_tag LOCUS_02850 15343 14786 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081614.1 protein_id gnl|my_center|LOCUS_02850 >Feature sequence014 542 258 gene locus_tag LOCUS_02860 542 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 666 2000 gene locus_tag LOCUS_02870 666 2000 CDS product multiheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052279209.1 protein_id gnl|my_center|LOCUS_02870 2012 3148 gene locus_tag LOCUS_02880 2012 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 3221 3847 gene locus_tag LOCUS_02890 3221 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 5262 3829 gene locus_tag LOCUS_02900 5262 3829 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943319.1 protein_id gnl|my_center|LOCUS_02900 6101 5259 gene locus_tag LOCUS_02910 6101 5259 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943320.1 protein_id gnl|my_center|LOCUS_02910 7222 6098 gene locus_tag LOCUS_02920 7222 6098 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545784.1 protein_id gnl|my_center|LOCUS_02920 9794 7212 gene locus_tag LOCUS_02930 9794 7212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 10705 9809 gene locus_tag LOCUS_02940 10705 9809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 11637 10702 gene locus_tag LOCUS_02950 11637 10702 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228049.1 protein_id gnl|my_center|LOCUS_02950 12626 11634 gene locus_tag LOCUS_02960 12626 11634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 13794 13024 gene locus_tag LOCUS_02970 13794 13024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 >Feature sequence015 <1 584 gene locus_tag LOCUS_02980 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080335.1:ribonuclease III 581 1750 gene locus_tag LOCUS_02990 gene megL 581 1750 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003400106.1 protein_id gnl|my_center|LOCUS_02990 1750 2718 gene locus_tag LOCUS_03000 1750 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2672 3823 gene locus_tag LOCUS_03010 gene galK 2672 3823 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228053.1 protein_id gnl|my_center|LOCUS_03010 4425 3808 gene locus_tag LOCUS_03020 4425 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 4942 4427 gene locus_tag LOCUS_03030 4942 4427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 6135 4954 gene locus_tag LOCUS_03040 6135 4954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 6542 6147 gene locus_tag LOCUS_03050 6542 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 7066 6554 gene locus_tag LOCUS_03060 7066 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 10274 7056 gene locus_tag LOCUS_03070 10274 7056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 12016 10400 gene locus_tag LOCUS_03080 gene groL 12016 10400 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881448.1 protein_id gnl|my_center|LOCUS_03080 12321 12031 gene locus_tag LOCUS_03090 gene groES 12321 12031 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583322.1 protein_id gnl|my_center|LOCUS_03090 12662 12438 gene locus_tag LOCUS_03100 12662 12438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 13117 12617 gene locus_tag LOCUS_03110 13117 12617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 13958 13107 gene locus_tag LOCUS_03120 13958 13107 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459951.1 protein_id gnl|my_center|LOCUS_03120 14823 13942 gene locus_tag LOCUS_03130 14823 13942 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545457.1 protein_id gnl|my_center|LOCUS_03130 >Feature sequence016 804 130 gene locus_tag LOCUS_03140 gene rlmB 804 130 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879886.1 protein_id gnl|my_center|LOCUS_03140 2171 786 gene locus_tag LOCUS_03150 gene gltX 2171 786 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583633.1 protein_id gnl|my_center|LOCUS_03150 2694 2158 gene locus_tag LOCUS_03160 gene ispF 2694 2158 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583827.1 protein_id gnl|my_center|LOCUS_03160 3982 2660 gene locus_tag LOCUS_03170 3982 2660 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785475.1 protein_id gnl|my_center|LOCUS_03170 5819 3993 gene locus_tag LOCUS_03180 gene glmS 5819 3993 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880146.1 protein_id gnl|my_center|LOCUS_03180 6201 5788 gene locus_tag LOCUS_03190 6201 5788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 6280 6519 gene locus_tag LOCUS_03200 6280 6519 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106007190.1 protein_id gnl|my_center|LOCUS_03200 7384 6545 gene locus_tag LOCUS_03210 7384 6545 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024135.1 protein_id gnl|my_center|LOCUS_03210 8075 7374 gene locus_tag LOCUS_03220 8075 7374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 8322 8600 gene locus_tag LOCUS_03230 8322 8600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 8597 9481 gene locus_tag LOCUS_03240 gene pdxA 8597 9481 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958579.1 protein_id gnl|my_center|LOCUS_03240 10169 9468 gene locus_tag LOCUS_03250 10169 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 12499 10166 gene locus_tag LOCUS_03260 12499 10166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 12579 14678 gene locus_tag LOCUS_03270 12579 14678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 >Feature sequence017 340 77 gene locus_tag LOCUS_03280 340 77 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334896.1 protein_id gnl|my_center|LOCUS_03280 2579 378 gene locus_tag LOCUS_03290 2579 378 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783961.1 protein_id gnl|my_center|LOCUS_03290 3434 2640 gene locus_tag LOCUS_03300 gene prmC 3434 2640 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462247.1 protein_id gnl|my_center|LOCUS_03300 4501 3431 gene locus_tag LOCUS_03310 gene prfA 4501 3431 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_03310 4713 4501 gene locus_tag LOCUS_03320 gene rpmE 4713 4501 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943728.1 protein_id gnl|my_center|LOCUS_03320 6511 4760 gene locus_tag LOCUS_03330 6511 4760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 6576 7520 gene locus_tag LOCUS_03340 gene ispB 6576 7520 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216396.1 protein_id gnl|my_center|LOCUS_03340 7510 8031 gene locus_tag LOCUS_03350 gene cyaB 7510 8031 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879480.1 protein_id gnl|my_center|LOCUS_03350 8031 8843 gene locus_tag LOCUS_03360 8031 8843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 8857 9717 gene locus_tag LOCUS_03370 8857 9717 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444878.1 protein_id gnl|my_center|LOCUS_03370 9873 9673 gene locus_tag LOCUS_03380 9873 9673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 9946 12063 gene locus_tag LOCUS_03390 9946 12063 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546134.1 protein_id gnl|my_center|LOCUS_03390 12083 12592 gene locus_tag LOCUS_03400 12083 12592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 12641 13414 gene locus_tag LOCUS_03410 12641 13414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 <14496 13404 gene locus_tag LOCUS_03420 <14496 13404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942706.1:DNA repair protein RecN >Feature sequence018 84 350 gene locus_tag LOCUS_03430 84 350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 341 1654 gene locus_tag LOCUS_03440 gene murD 341 1654 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392360.1 protein_id gnl|my_center|LOCUS_03440 1644 2741 gene locus_tag LOCUS_03450 gene ftsW 1644 2741 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_03450 2731 4098 gene locus_tag LOCUS_03460 gene murC 2731 4098 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880875.1 protein_id gnl|my_center|LOCUS_03460 4088 4756 gene locus_tag LOCUS_03470 4088 4756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 4548 4557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4753 5955 gene locus_tag LOCUS_03480 gene ftsA 4753 5955 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939770.1 protein_id gnl|my_center|LOCUS_03480 5965 7185 gene locus_tag LOCUS_03490 gene ftsZ 5965 7185 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880307.1 protein_id gnl|my_center|LOCUS_03490 7169 8410 gene locus_tag LOCUS_03500 gene hutI 7169 8410 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836513.1 protein_id gnl|my_center|LOCUS_03500 9260 8373 gene locus_tag LOCUS_03510 9260 8373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 9842 9276 gene locus_tag LOCUS_03520 gene efp 9842 9276 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082309.1 protein_id gnl|my_center|LOCUS_03520 10770 9802 gene locus_tag LOCUS_03530 10770 9802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 13381 10754 gene locus_tag LOCUS_03540 13381 10754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 14223 13378 gene locus_tag LOCUS_03550 14223 13378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 >Feature sequence019 1023 316 gene locus_tag LOCUS_03560 1023 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1515 1072 gene locus_tag LOCUS_03570 1515 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 2762 1512 gene locus_tag LOCUS_03580 2762 1512 CDS product aconitase/3-isopropylmalate dehydratase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870106.1 protein_id gnl|my_center|LOCUS_03580 2814 3659 gene locus_tag LOCUS_03590 2814 3659 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880542.1 protein_id gnl|my_center|LOCUS_03590 3662 4177 gene locus_tag LOCUS_03600 3662 4177 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966160.1 protein_id gnl|my_center|LOCUS_03600 4265 4819 gene locus_tag LOCUS_03610 4265 4819 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_03610 4821 5123 gene locus_tag LOCUS_03620 4821 5123 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250929.1 protein_id gnl|my_center|LOCUS_03620 5120 6274 gene locus_tag LOCUS_03630 gene porA 5120 6274 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_03630 6271 7173 gene locus_tag LOCUS_03640 6271 7173 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_03640 7183 8448 gene locus_tag LOCUS_03650 7183 8448 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880274.1 protein_id gnl|my_center|LOCUS_03650 8445 9371 gene locus_tag LOCUS_03660 8445 9371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 9368 10624 gene locus_tag LOCUS_03670 gene purD 9368 10624 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880448.1 protein_id gnl|my_center|LOCUS_03670 10624 11079 gene locus_tag LOCUS_03680 gene purE 10624 11079 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425290.1 protein_id gnl|my_center|LOCUS_03680 11042 12277 gene locus_tag LOCUS_03690 gene mtaB 11042 12277 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943204.1 protein_id gnl|my_center|LOCUS_03690 12344 13051 gene locus_tag LOCUS_03700 12344 13051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 13207 14070 gene locus_tag LOCUS_03710 13207 14070 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932161.1 protein_id gnl|my_center|LOCUS_03710 >Feature sequence020 937 242 gene locus_tag LOCUS_03720 gene lptB 937 242 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005647567.1 protein_id gnl|my_center|LOCUS_03720 2504 927 gene locus_tag LOCUS_03730 2504 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 4340 3000 gene locus_tag LOCUS_03740 4340 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 6011 4380 gene locus_tag LOCUS_03750 gene polX 6011 4380 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228471.1 protein_id gnl|my_center|LOCUS_03750 7583 6012 gene locus_tag LOCUS_03760 gene nadB 7583 6012 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939096.1 protein_id gnl|my_center|LOCUS_03760 8401 7580 gene locus_tag LOCUS_03770 gene nadC 8401 7580 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583119.1 protein_id gnl|my_center|LOCUS_03770 9198 8401 gene locus_tag LOCUS_03780 9198 8401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 9377 9198 gene locus_tag LOCUS_03790 9377 9198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11353 9386 gene locus_tag LOCUS_03800 11353 9386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 13428 11350 gene locus_tag LOCUS_03810 13428 11350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence021 <1 590 gene locus_tag LOCUS_03820 <1 590 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878184.1:succinate dehydrogenase/fumarate reductase flavoprotein subunit 601 1302 gene locus_tag LOCUS_03830 601 1302 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546880.1 protein_id gnl|my_center|LOCUS_03830 1378 2010 gene locus_tag LOCUS_03840 1378 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 3079 1991 gene locus_tag LOCUS_03850 3079 1991 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_03850 3174 3647 gene locus_tag LOCUS_03860 3174 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3644 5053 gene locus_tag LOCUS_03870 gene cysS 3644 5053 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009873400.1 protein_id gnl|my_center|LOCUS_03870 5032 5394 gene locus_tag LOCUS_03880 5032 5394 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392503.1 protein_id gnl|my_center|LOCUS_03880 5391 6356 gene locus_tag LOCUS_03890 gene galT 5391 6356 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393433.1 protein_id gnl|my_center|LOCUS_03890 6353 7861 gene locus_tag LOCUS_03900 gene hutH 6353 7861 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143059.1 protein_id gnl|my_center|LOCUS_03900 7845 8594 gene locus_tag LOCUS_03910 gene thyX 7845 8594 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583167.1 protein_id gnl|my_center|LOCUS_03910 8591 9745 gene locus_tag LOCUS_03920 8591 9745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 9720 10829 gene locus_tag LOCUS_03930 9720 10829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 10826 11884 gene locus_tag LOCUS_03940 10826 11884 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228090.1 protein_id gnl|my_center|LOCUS_03940 11856 12701 gene locus_tag LOCUS_03950 11856 12701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence022 <1 1060 gene locus_tag LOCUS_03960 <1 1060 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403585.1:Mrp/NBP35 family ATP-binding protein 1044 1916 gene locus_tag LOCUS_03970 1044 1916 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545051.1 protein_id gnl|my_center|LOCUS_03970 2322 1885 gene locus_tag LOCUS_03980 2322 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 3476 2286 gene locus_tag LOCUS_03990 gene rocD 3476 2286 CDS product ornithine aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242970.1 protein_id gnl|my_center|LOCUS_03990 4093 3578 gene locus_tag LOCUS_04000 4093 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4638 4138 gene locus_tag LOCUS_04010 gene def 4638 4138 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_04010 4815 5033 gene locus_tag LOCUS_04020 gene tatA 4815 5033 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631606.1 protein_id gnl|my_center|LOCUS_04020 5011 5769 gene locus_tag LOCUS_04030 5011 5769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 5747 7135 gene locus_tag LOCUS_04040 5747 7135 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925421.1 protein_id gnl|my_center|LOCUS_04040 7132 8238 gene locus_tag LOCUS_04050 7132 8238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 8204 9313 gene locus_tag LOCUS_04060 gene hisC 8204 9313 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_04060 9285 9932 gene locus_tag LOCUS_04070 gene cmk 9285 9932 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943242.1 protein_id gnl|my_center|LOCUS_04070 9946 10332 gene locus_tag LOCUS_04080 9946 10332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 11360 10317 gene locus_tag LOCUS_04090 11360 10317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 11878 11357 gene locus_tag LOCUS_04100 11878 11357 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583110.1 protein_id gnl|my_center|LOCUS_04100 12998 11871 gene locus_tag LOCUS_04110 12998 11871 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584101.1 protein_id gnl|my_center|LOCUS_04110 <13887 13008 gene locus_tag LOCUS_04120 <13887 13008 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010927251.1:peptidase M14 >Feature sequence023 1335 208 gene locus_tag LOCUS_04130 1335 208 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_04130 1436 2854 gene locus_tag LOCUS_04140 1436 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 2878 3255 gene locus_tag LOCUS_04150 2878 3255 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_04150 3243 3722 gene locus_tag LOCUS_04160 3243 3722 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_04160 3704 4168 gene locus_tag LOCUS_04170 3704 4168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4168 5466 gene locus_tag LOCUS_04180 gene nuoD 4168 5466 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_04180 5463 5933 gene locus_tag LOCUS_04190 gene nuoE 5463 5933 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_04190 5930 7186 gene locus_tag LOCUS_04200 gene nuoF 5930 7186 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969255.1 protein_id gnl|my_center|LOCUS_04200 7165 8625 gene locus_tag LOCUS_04210 7165 8625 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_04210 8610 9683 gene locus_tag LOCUS_04220 gene nuoH 8610 9683 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944046.1 protein_id gnl|my_center|LOCUS_04220 9680 10141 gene locus_tag LOCUS_04230 gene nuoI 9680 10141 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_04230 10113 10841 gene locus_tag LOCUS_04240 10113 10841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 10831 11490 gene locus_tag LOCUS_04250 10831 11490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 12997 11483 gene locus_tag LOCUS_04260 gene sppA 12997 11483 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929471.1 protein_id gnl|my_center|LOCUS_04260 13218 13133 gene locus_tag LOCUS_t00180 13218 13133 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 13306 13233 gene locus_tag LOCUS_t00190 13306 13233 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence024 328 1563 gene locus_tag LOCUS_04270 328 1563 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948020.1 protein_id gnl|my_center|LOCUS_04270 1560 2117 gene locus_tag LOCUS_04280 gene thpR 1560 2117 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583814.1 protein_id gnl|my_center|LOCUS_04280 2114 2698 gene locus_tag LOCUS_04290 gene plsY 2114 2698 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064240750.1 protein_id gnl|my_center|LOCUS_04290 2680 3666 gene locus_tag LOCUS_04300 2680 3666 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940684.1 protein_id gnl|my_center|LOCUS_04300 3650 5167 gene locus_tag LOCUS_04310 3650 5167 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257013.1 protein_id gnl|my_center|LOCUS_04310 5164 5904 gene locus_tag LOCUS_04320 5164 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 5942 7804 gene locus_tag LOCUS_04330 5942 7804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 7835 9892 gene locus_tag LOCUS_04340 gene rnr 7835 9892 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942131.1 protein_id gnl|my_center|LOCUS_04340 9905 11113 gene locus_tag LOCUS_04350 9905 11113 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546494.1 protein_id gnl|my_center|LOCUS_04350 11110 12516 gene locus_tag LOCUS_04360 11110 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 12748 12757 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence025 1279 725 gene locus_tag LOCUS_04370 1279 725 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_04370 2520 1276 gene locus_tag LOCUS_04380 gene fabF 2520 1276 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942250.1 protein_id gnl|my_center|LOCUS_04380 2762 2517 gene locus_tag LOCUS_04390 2762 2517 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081111.1 protein_id gnl|my_center|LOCUS_04390 3509 2784 gene locus_tag LOCUS_04400 gene fabG 3509 2784 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082240.1 protein_id gnl|my_center|LOCUS_04400 4489 3506 gene locus_tag LOCUS_04410 4489 3506 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392461.1 protein_id gnl|my_center|LOCUS_04410 5510 4449 gene locus_tag LOCUS_04420 gene plsX 5510 4449 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545117.1 protein_id gnl|my_center|LOCUS_04420 5701 5507 gene locus_tag LOCUS_04430 gene rpmF 5701 5507 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_04430 6212 5688 gene locus_tag LOCUS_04440 6212 5688 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545391.1 protein_id gnl|my_center|LOCUS_04440 6994 6239 gene locus_tag LOCUS_04450 6994 6239 CDS product citryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880039.1 protein_id gnl|my_center|LOCUS_04450 8250 6994 gene locus_tag LOCUS_04460 gene ahcY 8250 6994 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_04460 9392 8247 gene locus_tag LOCUS_04470 gene metK 9392 8247 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence026 2307 973 gene locus_tag LOCUS_04480 gene gcvPA 2307 973 CDS product aminomethyl-transferring glycine dehydrogenase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000903240.1 protein_id gnl|my_center|LOCUS_04480 2681 2304 gene locus_tag LOCUS_04490 gene gcvH 2681 2304 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146698.1 protein_id gnl|my_center|LOCUS_04490 3308 2691 gene locus_tag LOCUS_04500 3308 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04500 3807 3292 gene locus_tag LOCUS_04510 3807 3292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04510 3403 3412 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4405 3845 gene locus_tag LOCUS_04520 4405 3845 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545428.1 protein_id gnl|my_center|LOCUS_04520 5532 4402 gene locus_tag LOCUS_04530 5532 4402 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083611.1 protein_id gnl|my_center|LOCUS_04530 6365 5502 gene locus_tag LOCUS_04540 6365 5502 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257102.1 protein_id gnl|my_center|LOCUS_04540 6549 8507 gene locus_tag LOCUS_04550 6549 8507 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250730.1 protein_id gnl|my_center|LOCUS_04550 8491 8820 gene locus_tag LOCUS_04560 8491 8820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 8876 11629 gene locus_tag LOCUS_04570 gene ppdK 8876 11629 CDS product pyruvate, phosphate dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082976.1 protein_id gnl|my_center|LOCUS_04570 11711 11989 gene locus_tag LOCUS_04580 11711 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 11986 12279 gene locus_tag LOCUS_04590 11986 12279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence027 390 19 gene locus_tag LOCUS_04600 390 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 1136 417 gene locus_tag LOCUS_04610 1136 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2405 1146 gene locus_tag LOCUS_04620 gene tyrS 2405 1146 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_04620 3301 2402 gene locus_tag LOCUS_04630 3301 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 4181 3312 gene locus_tag LOCUS_04640 4181 3312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 5142 4192 gene locus_tag LOCUS_04650 5142 4192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 5494 5156 gene locus_tag LOCUS_04660 5494 5156 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880034.1 protein_id gnl|my_center|LOCUS_04660 6734 5496 gene locus_tag LOCUS_04670 gene murA 6734 5496 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946583.1 protein_id gnl|my_center|LOCUS_04670 7723 6731 gene locus_tag LOCUS_04680 gene mltG 7723 6731 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545006.1 protein_id gnl|my_center|LOCUS_04680 8112 7720 gene locus_tag LOCUS_04690 gene ruvX 8112 7720 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880972.1 protein_id gnl|my_center|LOCUS_04690 9110 8112 gene locus_tag LOCUS_04700 9110 8112 CDS product D-alanine--D-alanine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056373.1 protein_id gnl|my_center|LOCUS_04700 10776 9031 gene locus_tag LOCUS_04710 10776 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 12104 10773 gene locus_tag LOCUS_04720 12104 10773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence028 2077 611 gene locus_tag LOCUS_04730 2077 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2148 2987 gene locus_tag LOCUS_04740 gene ispH 2148 2987 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881128.1 protein_id gnl|my_center|LOCUS_04740 2980 4632 gene locus_tag LOCUS_04750 2980 4632 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546647.1 protein_id gnl|my_center|LOCUS_04750 4629 5015 gene locus_tag LOCUS_04760 4629 5015 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04760 5216 7129 gene locus_tag LOCUS_04770 gene dnaK 5216 7129 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_04770 7385 7152 gene locus_tag LOCUS_04780 7385 7152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 7583 8029 gene locus_tag LOCUS_04790 7583 8029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 8202 9188 gene locus_tag LOCUS_04800 8202 9188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 9178 10002 gene locus_tag LOCUS_04810 9178 10002 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176616.1 protein_id gnl|my_center|LOCUS_04810 10012 12141 gene locus_tag LOCUS_04820 gene vpsO 10012 12141 CDS product exopolysaccharide regulatory tyrosine autokinase VpsO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000147064.1 protein_id gnl|my_center|LOCUS_04820 >Feature sequence029 <1 705 gene locus_tag LOCUS_04830 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869947.1:rod shape-determining protein RodA 696 3047 gene locus_tag LOCUS_04840 696 3047 CDS product TIGR03960 family B12-binding radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943854.1 protein_id gnl|my_center|LOCUS_04840 4109 3024 gene locus_tag LOCUS_04850 4109 3024 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_04850 4202 5566 gene locus_tag LOCUS_04860 gene mgtE 4202 5566 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392647.1 protein_id gnl|my_center|LOCUS_04860 5566 6177 gene locus_tag LOCUS_04870 5566 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 6636 6142 gene locus_tag LOCUS_04880 6636 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 6751 8106 gene locus_tag LOCUS_04890 6751 8106 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108072.1 protein_id gnl|my_center|LOCUS_04890 8187 9383 gene locus_tag LOCUS_04900 8187 9383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 9470 10747 gene locus_tag LOCUS_04910 9470 10747 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941675.1 protein_id gnl|my_center|LOCUS_04910 10744 12240 gene locus_tag LOCUS_04920 10744 12240 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941157.1 protein_id gnl|my_center|LOCUS_04920 >Feature sequence030 2893 1574 gene locus_tag LOCUS_04930 2893 1574 CDS product YjiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001289401.1 protein_id gnl|my_center|LOCUS_04930 3084 4319 gene locus_tag LOCUS_04940 3084 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 4316 5365 gene locus_tag LOCUS_04950 4316 5365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 5340 7379 gene locus_tag LOCUS_04960 gene ligA 5340 7379 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082648.1 protein_id gnl|my_center|LOCUS_04960 7442 11434 gene locus_tag LOCUS_04970 7442 11434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence031 <1 705 gene locus_tag LOCUS_04980 <1 705 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084205626.1:pyridoxal phosphate-dependent aminotransferase family protein 734 2953 gene locus_tag LOCUS_04990 734 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 3504 2938 gene locus_tag LOCUS_05000 3504 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 4537 3485 gene locus_tag LOCUS_05010 4537 3485 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256870.1 protein_id gnl|my_center|LOCUS_05010 5046 4537 gene locus_tag LOCUS_05020 5046 4537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 5111 5980 gene locus_tag LOCUS_05030 5111 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 5970 6557 gene locus_tag LOCUS_05040 5970 6557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 6586 6930 gene locus_tag LOCUS_05050 6586 6930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 6970 8169 gene locus_tag LOCUS_05060 6970 8169 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358889.1 protein_id gnl|my_center|LOCUS_05060 8194 10143 gene locus_tag LOCUS_05070 8194 10143 CDS product glycoside hydrolase family 127 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767027.1 protein_id gnl|my_center|LOCUS_05070 10178 10104 gene locus_tag LOCUS_t00200 10178 10104 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10258 10184 gene locus_tag LOCUS_t00210 10258 10184 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 10378 11643 gene locus_tag LOCUS_05080 10378 11643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 11640 11792 gene locus_tag LOCUS_05090 11640 11792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence032 840 346 gene locus_tag LOCUS_05100 840 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 901 3501 gene locus_tag LOCUS_05110 901 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3517 5670 gene locus_tag LOCUS_05120 3517 5670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 5667 8120 gene locus_tag LOCUS_05130 5667 8120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 8167 8727 gene locus_tag LOCUS_05140 8167 8727 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583987.1 protein_id gnl|my_center|LOCUS_05140 8798 9229 gene locus_tag LOCUS_05150 gene tolR 8798 9229 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_05150 9229 9639 gene locus_tag LOCUS_05160 9229 9639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 10401 9568 gene locus_tag LOCUS_05170 10401 9568 CDS product YitT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391779.1 protein_id gnl|my_center|LOCUS_05170 9596 9605 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10487 10415 gene locus_tag LOCUS_t00220 10487 10415 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 11827 10508 gene locus_tag LOCUS_05180 11827 10508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 >Feature sequence033 233 1096 gene locus_tag LOCUS_05190 233 1096 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965124.1 protein_id gnl|my_center|LOCUS_05190 1090 1809 gene locus_tag LOCUS_05200 1090 1809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 1810 2049 gene locus_tag LOCUS_05210 gene xseB 1810 2049 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008503331.1 protein_id gnl|my_center|LOCUS_05210 2039 2821 gene locus_tag LOCUS_05220 2039 2821 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880451.1 protein_id gnl|my_center|LOCUS_05220 2776 4674 gene locus_tag LOCUS_05230 gene dxs 2776 4674 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_05230 4655 5452 gene locus_tag LOCUS_05240 4655 5452 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081998.1 protein_id gnl|my_center|LOCUS_05240 5418 6251 gene locus_tag LOCUS_05250 5418 6251 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942707.1 protein_id gnl|my_center|LOCUS_05250 6307 8769 gene locus_tag LOCUS_05260 gene leuS 6307 8769 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082796.1 protein_id gnl|my_center|LOCUS_05260 8766 9275 gene locus_tag LOCUS_05270 8766 9275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 9262 10062 gene locus_tag LOCUS_05280 9262 10062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 10138 10665 gene locus_tag LOCUS_05290 10138 10665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence034 1938 1204 gene locus_tag LOCUS_05300 1938 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3155 1947 gene locus_tag LOCUS_05310 gene icd 3155 1947 CDS product isocitrate dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878150.1 protein_id gnl|my_center|LOCUS_05310 3666 3166 gene locus_tag LOCUS_05320 3666 3166 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083008.1 protein_id gnl|my_center|LOCUS_05320 4930 3677 gene locus_tag LOCUS_05330 4930 3677 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083007.1 protein_id gnl|my_center|LOCUS_05330 6082 4934 gene locus_tag LOCUS_05340 6082 4934 CDS product citrate synthase/methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978565.1 protein_id gnl|my_center|LOCUS_05340 6483 6142 gene locus_tag LOCUS_05350 6483 6142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 8230 6452 gene locus_tag LOCUS_05360 gene ptsP 8230 6452 CDS product phosphoenolpyruvate--protein phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152804487.1 protein_id gnl|my_center|LOCUS_05360 8496 8227 gene locus_tag LOCUS_05370 8496 8227 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198013.1 protein_id gnl|my_center|LOCUS_05370 8900 8496 gene locus_tag LOCUS_05380 8900 8496 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_05380 9754 8897 gene locus_tag LOCUS_05390 gene rapZ 9754 8897 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243903.1 protein_id gnl|my_center|LOCUS_05390 10653 9751 gene locus_tag LOCUS_05400 gene hprK 10653 9751 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001127250.1 protein_id gnl|my_center|LOCUS_05400 11122 10643 gene locus_tag LOCUS_05410 11122 10643 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_05410 >Feature sequence035 2218 905 gene locus_tag LOCUS_05420 2218 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 2623 2246 gene locus_tag LOCUS_05430 2623 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3212 2631 gene locus_tag LOCUS_05440 3212 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05440 2682 2691 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3292 4281 gene locus_tag LOCUS_05450 3292 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4292 5332 gene locus_tag LOCUS_05460 gene pstS 4292 5332 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479753.1 protein_id gnl|my_center|LOCUS_05460 5335 6201 gene locus_tag LOCUS_05470 gene pstC 5335 6201 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005656744.1 protein_id gnl|my_center|LOCUS_05470 6198 7031 gene locus_tag LOCUS_05480 gene pstA 6198 7031 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140450.1 protein_id gnl|my_center|LOCUS_05480 7013 7771 gene locus_tag LOCUS_05490 gene pstB 7013 7771 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582862.1 protein_id gnl|my_center|LOCUS_05490 7781 8476 gene locus_tag LOCUS_05500 7781 8476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05500 8404 8413 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8572 9255 gene locus_tag LOCUS_05510 8572 9255 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930584.1 protein_id gnl|my_center|LOCUS_05510 9252 10970 gene locus_tag LOCUS_05520 9252 10970 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722633.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence036 <1 844 gene locus_tag LOCUS_05530 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010989915.1:sigma-54-dependent Fis family transcriptional regulator 841 1770 gene locus_tag LOCUS_05540 841 1770 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049743977.1 protein_id gnl|my_center|LOCUS_05540 1757 2548 gene locus_tag LOCUS_05550 1757 2548 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_05550 2569 3753 gene locus_tag LOCUS_05560 2569 3753 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_05560 3757 4428 gene locus_tag LOCUS_05570 3757 4428 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173387053.1 protein_id gnl|my_center|LOCUS_05570 4421 5095 gene locus_tag LOCUS_05580 4421 5095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 5114 5188 gene locus_tag LOCUS_t00230 5114 5188 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 5196 6023 gene locus_tag LOCUS_05590 5196 6023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 7257 5986 gene locus_tag LOCUS_05600 7257 5986 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_05600 7814 7230 gene locus_tag LOCUS_05610 gene tmk 7814 7230 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039005.1 protein_id gnl|my_center|LOCUS_05610 8842 7814 gene locus_tag LOCUS_05620 gene dnaN 8842 7814 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940679.1 protein_id gnl|my_center|LOCUS_05620 10331 9024 gene locus_tag LOCUS_05630 gene dnaA 10331 9024 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence037 77 823 gene locus_tag LOCUS_05640 77 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 827 2095 gene locus_tag LOCUS_05650 827 2095 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812206.1 protein_id gnl|my_center|LOCUS_05650 2581 2096 gene locus_tag LOCUS_05660 2581 2096 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_05660 2904 2593 gene locus_tag LOCUS_05670 2904 2593 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_05670 3788 2961 gene locus_tag LOCUS_05680 3788 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 3828 4283 gene locus_tag LOCUS_05690 gene dut 3828 4283 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338344.1 protein_id gnl|my_center|LOCUS_05690 6398 4284 gene locus_tag LOCUS_05700 6398 4284 CDS product M3 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765304.1 protein_id gnl|my_center|LOCUS_05700 8656 6395 gene locus_tag LOCUS_05710 8656 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 9744 8653 gene locus_tag LOCUS_05720 9744 8653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 9852 10367 gene locus_tag LOCUS_05730 9852 10367 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869756.1 protein_id gnl|my_center|LOCUS_05730 10364 10921 gene locus_tag LOCUS_05740 10364 10921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence038 1101 2627 gene locus_tag LOCUS_05750 gene guaA 1101 2627 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_05750 2618 3052 gene locus_tag LOCUS_05760 gene nikR 2618 3052 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868557.1 protein_id gnl|my_center|LOCUS_05760 3743 3045 gene locus_tag LOCUS_05770 3743 3045 CDS product WbqC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390554.1 protein_id gnl|my_center|LOCUS_05770 4642 3740 gene locus_tag LOCUS_05780 4642 3740 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546739.1 protein_id gnl|my_center|LOCUS_05780 5581 4643 gene locus_tag LOCUS_05790 5581 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 7321 5585 gene locus_tag LOCUS_05800 7321 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 7560 7318 gene locus_tag LOCUS_05810 7560 7318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 7622 8350 gene locus_tag LOCUS_05820 gene mazG 7622 8350 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545835.1 protein_id gnl|my_center|LOCUS_05820 8347 8556 gene locus_tag LOCUS_05830 8347 8556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 8553 10979 gene locus_tag LOCUS_05840 gene uvrA 8553 10979 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546498.1 protein_id gnl|my_center|LOCUS_05840 >Feature sequence039 240 905 gene locus_tag LOCUS_05850 240 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 980 1816 gene locus_tag LOCUS_05860 980 1816 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081951.1 protein_id gnl|my_center|LOCUS_05860 2043 2297 gene locus_tag LOCUS_05870 2043 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 2294 2737 gene locus_tag LOCUS_05880 2294 2737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 2694 3569 gene locus_tag LOCUS_05890 2694 3569 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_05890 3566 4708 gene locus_tag LOCUS_05900 3566 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4721 6460 gene locus_tag LOCUS_05910 4721 6460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 6462 8102 gene locus_tag LOCUS_05920 6462 8102 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_238581565.1 protein_id gnl|my_center|LOCUS_05920 8131 9234 gene locus_tag LOCUS_05930 8131 9234 CDS product type III PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329265.1 protein_id gnl|my_center|LOCUS_05930 9215 10075 gene locus_tag LOCUS_05940 gene speE 9215 10075 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081139.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence040 865 269 gene locus_tag LOCUS_05950 gene pgsA 865 269 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942469.1 protein_id gnl|my_center|LOCUS_05950 1683 850 gene locus_tag LOCUS_05960 gene dapF 1683 850 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583145.1 protein_id gnl|my_center|LOCUS_05960 3102 1684 gene locus_tag LOCUS_05970 3102 1684 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_05970 3927 3127 gene locus_tag LOCUS_05980 gene murI 3927 3127 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_05980 4348 3914 gene locus_tag LOCUS_05990 4348 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 5613 4474 gene locus_tag LOCUS_06000 5613 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 5882 5535 gene locus_tag LOCUS_tm00010 5882 5535 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 6625 5894 gene locus_tag LOCUS_06010 6625 5894 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880947.1 protein_id gnl|my_center|LOCUS_06010 7124 6612 gene locus_tag LOCUS_06020 gene scpB 7124 6612 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842431.1 protein_id gnl|my_center|LOCUS_06020 7800 7105 gene locus_tag LOCUS_06030 7800 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 8773 7784 gene locus_tag LOCUS_06040 gene trpS 8773 7784 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_06040 9461 8784 gene locus_tag LOCUS_06050 9461 8784 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930880.1 protein_id gnl|my_center|LOCUS_06050 10725 9481 gene locus_tag LOCUS_06060 10725 9481 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867316.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence041 1762 602 gene locus_tag LOCUS_06070 1762 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 3045 1759 gene locus_tag LOCUS_06080 gene gabT 3045 1759 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_06080 6030 3055 gene locus_tag LOCUS_06090 6030 3055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 6248 6027 gene locus_tag LOCUS_06100 6248 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 7735 6245 gene locus_tag LOCUS_06110 7735 6245 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017626175.1 protein_id gnl|my_center|LOCUS_06110 8519 7743 gene locus_tag LOCUS_06120 8519 7743 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529089.1 protein_id gnl|my_center|LOCUS_06120 10714 8621 gene locus_tag LOCUS_06130 10714 8621 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545329.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence042 2093 354 gene locus_tag LOCUS_06140 gene mrdA 2093 354 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_06140 2502 2068 gene locus_tag LOCUS_06150 2502 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 3272 2496 gene locus_tag LOCUS_06160 gene mreC 3272 2496 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228502.1 protein_id gnl|my_center|LOCUS_06160 4309 3275 gene locus_tag LOCUS_06170 4309 3275 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880512.1 protein_id gnl|my_center|LOCUS_06170 5249 4302 gene locus_tag LOCUS_06180 5249 4302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 5730 5350 gene locus_tag LOCUS_06190 5730 5350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 6748 5765 gene locus_tag LOCUS_06200 6748 5765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 6830 7516 gene locus_tag LOCUS_06210 6830 7516 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_06210 7569 8948 gene locus_tag LOCUS_06220 7569 8948 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975035.1 protein_id gnl|my_center|LOCUS_06220 8948 10180 gene locus_tag LOCUS_06230 8948 10180 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence043 1248 889 gene locus_tag LOCUS_06240 1248 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 1703 1251 gene locus_tag LOCUS_06250 gene nrdR 1703 1251 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003399430.1 protein_id gnl|my_center|LOCUS_06250 2688 1675 gene locus_tag LOCUS_06260 2688 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 3380 2685 gene locus_tag LOCUS_06270 3380 2685 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_177221433.1 protein_id gnl|my_center|LOCUS_06270 3416 4756 gene locus_tag LOCUS_06280 3416 4756 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583255.1 protein_id gnl|my_center|LOCUS_06280 4795 5811 gene locus_tag LOCUS_06290 4795 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 5801 7036 gene locus_tag LOCUS_06300 5801 7036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 8100 7033 gene locus_tag LOCUS_06310 gene buk 8100 7033 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966356.1 protein_id gnl|my_center|LOCUS_06310 9188 8124 gene locus_tag LOCUS_06320 gene menC 9188 8124 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228259.1 protein_id gnl|my_center|LOCUS_06320 9943 9197 gene locus_tag LOCUS_06330 9943 9197 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228258.1 protein_id gnl|my_center|LOCUS_06330 10433 9918 gene locus_tag LOCUS_06340 10433 9918 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878317.1 protein_id gnl|my_center|LOCUS_06340 10513 10442 gene locus_tag LOCUS_t00240 10513 10442 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10593 10521 gene locus_tag LOCUS_t00250 10593 10521 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence044 735 52 gene locus_tag LOCUS_06350 gene purQ 735 52 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583773.1 protein_id gnl|my_center|LOCUS_06350 950 717 gene locus_tag LOCUS_06360 gene purS 950 717 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393546.1 protein_id gnl|my_center|LOCUS_06360 1965 934 gene locus_tag LOCUS_06370 1965 934 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942278.1 protein_id gnl|my_center|LOCUS_06370 2078 1992 gene locus_tag LOCUS_t00260 2078 1992 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2372 2085 gene locus_tag LOCUS_06380 2372 2085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 3104 2373 gene locus_tag LOCUS_06390 gene tpiA 3104 2373 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942272.1 protein_id gnl|my_center|LOCUS_06390 4273 3101 gene locus_tag LOCUS_06400 4273 3101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06400 5271 4270 gene locus_tag LOCUS_06410 gene gap 5271 4270 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880662.1 protein_id gnl|my_center|LOCUS_06410 5373 6149 gene locus_tag LOCUS_06420 5373 6149 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_06420 6152 7114 gene locus_tag LOCUS_06430 6152 7114 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546641.1 protein_id gnl|my_center|LOCUS_06430 7095 9413 gene locus_tag LOCUS_06440 7095 9413 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082420.1 protein_id gnl|my_center|LOCUS_06440 9529 10269 gene locus_tag LOCUS_06450 9529 10269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence045 <1 1348 gene locus_tag LOCUS_06460 <1 1348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202231.1:bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase 1345 1983 gene locus_tag LOCUS_06470 1345 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1992 3866 gene locus_tag LOCUS_06480 1992 3866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 5129 3828 gene locus_tag LOCUS_06490 gene purB 5129 3828 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545083.1 protein_id gnl|my_center|LOCUS_06490 5872 5126 gene locus_tag LOCUS_06500 gene trmI 5872 5126 CDS product tRNA (adenine(57)-N(1)/adenine(58)-N(1))-methyltransferase TrmI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867553.1 protein_id gnl|my_center|LOCUS_06500 5958 8396 gene locus_tag LOCUS_06510 gene gyrA 5958 8396 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545423.1 protein_id gnl|my_center|LOCUS_06510 8362 8811 gene locus_tag LOCUS_06520 8362 8811 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939520.1 protein_id gnl|my_center|LOCUS_06520 8913 10442 gene locus_tag LOCUS_06530 8913 10442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence046 1292 249 gene locus_tag LOCUS_06540 gene dnaJ 1292 249 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880419.1 protein_id gnl|my_center|LOCUS_06540 3115 1289 gene locus_tag LOCUS_06550 gene dnaK 3115 1289 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545409.1 protein_id gnl|my_center|LOCUS_06550 3674 3093 gene locus_tag LOCUS_06560 3674 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 4662 3664 gene locus_tag LOCUS_06570 gene hrcA 4662 3664 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_06570 5887 4682 gene locus_tag LOCUS_06580 5887 4682 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880318.1 protein_id gnl|my_center|LOCUS_06580 5923 6870 gene locus_tag LOCUS_06590 gene rfaE1 5923 6870 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057610.1 protein_id gnl|my_center|LOCUS_06590 6852 7328 gene locus_tag LOCUS_06600 gene rfaE2 6852 7328 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_06600 7344 7796 gene locus_tag LOCUS_06610 gene rpiB 7344 7796 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_06610 7797 8270 gene locus_tag LOCUS_06620 gene bcp 7797 8270 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_06620 8260 10371 gene locus_tag LOCUS_06630 8260 10371 CDS product ATP-dependent RecD-like DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938194.1 protein_id gnl|my_center|LOCUS_06630 >Feature sequence047 1069 65 gene locus_tag LOCUS_06640 1069 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1985 1062 gene locus_tag LOCUS_06650 gene trxB 1985 1062 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229015.1 protein_id gnl|my_center|LOCUS_06650 2299 1982 gene locus_tag LOCUS_06660 gene trxA 2299 1982 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878779.1 protein_id gnl|my_center|LOCUS_06660 2409 3026 gene locus_tag LOCUS_06670 2409 3026 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_06670 3023 4081 gene locus_tag LOCUS_06680 gene pilM 3023 4081 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_06680 4084 4704 gene locus_tag LOCUS_06690 4084 4704 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_06690 4701 5309 gene locus_tag LOCUS_06700 4701 5309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 5306 5746 gene locus_tag LOCUS_06710 5306 5746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5749 7938 gene locus_tag LOCUS_06720 5749 7938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 7949 8557 gene locus_tag LOCUS_06730 7949 8557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 8578 9171 gene locus_tag LOCUS_06740 8578 9171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 9172 9903 gene locus_tag LOCUS_06750 9172 9903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9869 10198 gene locus_tag LOCUS_06760 9869 10198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence048 1043 177 gene locus_tag LOCUS_06770 1043 177 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_06770 1520 1053 gene locus_tag LOCUS_06780 1520 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06780 1596 1605 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1870 2886 gene locus_tag LOCUS_06790 1870 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2950 4449 gene locus_tag LOCUS_06800 2950 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 4460 5437 gene locus_tag LOCUS_06810 4460 5437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 5460 6332 gene locus_tag LOCUS_06820 gene cyoE 5460 6332 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879528.1 protein_id gnl|my_center|LOCUS_06820 6329 6925 gene locus_tag LOCUS_06830 6329 6925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 6954 7568 gene locus_tag LOCUS_06840 6954 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 7669 8733 gene locus_tag LOCUS_06850 7669 8733 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146519.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence049 2204 216 gene locus_tag LOCUS_06860 gene recG 2204 216 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545417.1 protein_id gnl|my_center|LOCUS_06860 2761 2204 gene locus_tag LOCUS_06870 2761 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 3627 2758 gene locus_tag LOCUS_06880 gene htpX 3627 2758 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_06880 3681 5285 gene locus_tag LOCUS_06890 3681 5285 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_06890 6624 5287 gene locus_tag LOCUS_06900 6624 5287 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546417.1 protein_id gnl|my_center|LOCUS_06900 7925 6621 gene locus_tag LOCUS_06910 7925 6621 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545053.1 protein_id gnl|my_center|LOCUS_06910 9157 8015 gene locus_tag LOCUS_06920 gene sat 9157 8015 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_06920 9889 9161 gene locus_tag LOCUS_06930 9889 9161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 >Feature sequence050 <1 2435 gene locus_tag LOCUS_06940 <1 2435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase note possible pseudo, frameshifted 2432 4144 gene locus_tag LOCUS_06950 2432 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06950 4141 4374 gene locus_tag LOCUS_06960 4141 4374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4371 5450 gene locus_tag LOCUS_06970 gene qmoC 4371 5450 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878164.1 protein_id gnl|my_center|LOCUS_06970 5479 5943 gene locus_tag LOCUS_06980 5479 5943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 5989 7227 gene locus_tag LOCUS_06990 5989 7227 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919955.1 protein_id gnl|my_center|LOCUS_06990 7229 10009 gene locus_tag LOCUS_07000 7229 10009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 >Feature sequence051 5302 2114 gene locus_tag LOCUS_07010 gene smc 5302 2114 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232028.1 protein_id gnl|my_center|LOCUS_07010 6449 5322 gene locus_tag LOCUS_07020 6449 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 7068 6514 gene locus_tag LOCUS_07030 7068 6514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 10037 7080 gene locus_tag LOCUS_07040 10037 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 >Feature sequence052 <1 883 gene locus_tag LOCUS_07050 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839665.1:S41 family peptidase 1062 1301 gene locus_tag LOCUS_07060 1062 1301 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_07060 1371 1793 gene locus_tag LOCUS_07070 1371 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 1751 2305 gene locus_tag LOCUS_07080 gene atpF 1751 2305 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545851.1 protein_id gnl|my_center|LOCUS_07080 2302 2841 gene locus_tag LOCUS_07090 gene atpH 2302 2841 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940786.1 protein_id gnl|my_center|LOCUS_07090 2842 4374 gene locus_tag LOCUS_07100 gene atpA 2842 4374 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545369.1 protein_id gnl|my_center|LOCUS_07100 4371 5219 gene locus_tag LOCUS_07110 gene atpG 4371 5219 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_07110 5228 6655 gene locus_tag LOCUS_07120 gene atpD 5228 6655 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940789.1 protein_id gnl|my_center|LOCUS_07120 6652 7035 gene locus_tag LOCUS_07130 6652 7035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 7786 7025 gene locus_tag LOCUS_07140 gene larE 7786 7025 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 protein_id gnl|my_center|LOCUS_07140 8294 7824 gene locus_tag LOCUS_07150 8294 7824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 9045 8305 gene locus_tag LOCUS_07160 9045 8305 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082259.1 protein_id gnl|my_center|LOCUS_07160 9974 9042 gene locus_tag LOCUS_07170 9974 9042 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337624.1 protein_id gnl|my_center|LOCUS_07170 9051 9060 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence053 860 396 gene locus_tag LOCUS_07180 860 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 1601 870 gene locus_tag LOCUS_07190 1601 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2831 1680 gene locus_tag LOCUS_07200 2831 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_07200 3592 2828 gene locus_tag LOCUS_07210 3592 2828 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681563.1 protein_id gnl|my_center|LOCUS_07210 5913 3589 gene locus_tag LOCUS_07220 5913 3589 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020948722.1 protein_id gnl|my_center|LOCUS_07220 6449 5910 gene locus_tag LOCUS_07230 6449 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 6147 6156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7183 6560 gene locus_tag LOCUS_07240 7183 6560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 7785 7180 gene locus_tag LOCUS_07250 7785 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 8720 7773 gene locus_tag LOCUS_07260 8720 7773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 9978 8695 gene locus_tag LOCUS_07270 9978 8695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence054 2127 4 gene locus_tag LOCUS_07280 gene priA 2127 4 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922147.1 protein_id gnl|my_center|LOCUS_07280 2576 2124 gene locus_tag LOCUS_07290 2576 2124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 4659 2587 gene locus_tag LOCUS_07300 gene fusA 4659 2587 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546422.1 protein_id gnl|my_center|LOCUS_07300 5181 4669 gene locus_tag LOCUS_07310 gene apt 5181 4669 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081583.1 protein_id gnl|my_center|LOCUS_07310 7225 5183 gene locus_tag LOCUS_07320 7225 5183 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123734.1 protein_id gnl|my_center|LOCUS_07320 8247 7243 gene locus_tag LOCUS_07330 8247 7243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 8269 9870 gene locus_tag LOCUS_07340 gene mutL 8269 9870 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583440.1 protein_id gnl|my_center|LOCUS_07340 >Feature sequence055 343 1182 gene locus_tag LOCUS_07350 343 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 1308 1763 gene locus_tag LOCUS_07360 1308 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1880 4039 gene locus_tag LOCUS_07370 1880 4039 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071328.1 protein_id gnl|my_center|LOCUS_07370 4885 4040 gene locus_tag LOCUS_07380 4885 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 5614 4898 gene locus_tag LOCUS_07390 5614 4898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5649 6686 gene locus_tag LOCUS_07400 5649 6686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 6686 7180 gene locus_tag LOCUS_07410 6686 7180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 7180 7743 gene locus_tag LOCUS_07420 7180 7743 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459288.1 protein_id gnl|my_center|LOCUS_07420 7730 8200 gene locus_tag LOCUS_07430 7730 8200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 8197 9045 gene locus_tag LOCUS_07440 8197 9045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 <9999 9037 gene locus_tag LOCUS_07450 <9999 9037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_148882924.1:flippase >Feature sequence056 630 1949 gene locus_tag LOCUS_07460 630 1949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1912 2928 gene locus_tag LOCUS_07470 gene dprA 1912 2928 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583877.1 protein_id gnl|my_center|LOCUS_07470 2921 5086 gene locus_tag LOCUS_07480 gene topA 2921 5086 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940644.1 protein_id gnl|my_center|LOCUS_07480 5076 6383 gene locus_tag LOCUS_07490 gene trmFO 5076 6383 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880411.1 protein_id gnl|my_center|LOCUS_07490 6353 7993 gene locus_tag LOCUS_07500 6353 7993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 7990 9252 gene locus_tag LOCUS_07510 7990 9252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence057 <1 650 gene locus_tag LOCUS_07520 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143485759.1:endonuclease III 2901 586 gene locus_tag LOCUS_07530 2901 586 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932772.1 protein_id gnl|my_center|LOCUS_07530 5064 2911 gene locus_tag LOCUS_07540 5064 2911 CDS product DNA internalization-related competence protein ComEC/Rec2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009967776.1 protein_id gnl|my_center|LOCUS_07540 5435 5061 gene locus_tag LOCUS_07550 gene mutT 5435 5061 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681243.1 protein_id gnl|my_center|LOCUS_07550 5971 5432 gene locus_tag LOCUS_07560 5971 5432 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864641.1 protein_id gnl|my_center|LOCUS_07560 6783 5968 gene locus_tag LOCUS_07570 6783 5968 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_07570 7907 6780 gene locus_tag LOCUS_07580 7907 6780 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_07580 8188 7904 gene locus_tag LOCUS_07590 8188 7904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 8323 8754 gene locus_tag LOCUS_07600 8323 8754 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_07600 9389 8796 gene locus_tag LOCUS_07610 9389 8796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 9649 9395 gene locus_tag LOCUS_07620 9649 9395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence058 <1 1464 gene locus_tag LOCUS_07630 <1 1464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460521.1:Stk1 family PASTA domain-containing Ser/Thr kinase 1497 1579 gene locus_tag LOCUS_t00270 1497 1579 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1588 2874 gene locus_tag LOCUS_07640 gene tig 1588 2874 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930702.1 protein_id gnl|my_center|LOCUS_07640 2871 3461 gene locus_tag LOCUS_07650 gene clpP 2871 3461 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_07650 3458 4681 gene locus_tag LOCUS_07660 gene clpX 3458 4681 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583451.1 protein_id gnl|my_center|LOCUS_07660 3884 3893 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4678 6945 gene locus_tag LOCUS_07670 gene lon 4678 6945 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943811.1 protein_id gnl|my_center|LOCUS_07670 7047 7538 gene locus_tag LOCUS_07680 gene yihA 7047 7538 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081764.1 protein_id gnl|my_center|LOCUS_07680 7526 8788 gene locus_tag LOCUS_07690 gene rho 7526 8788 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_07690 <9775 8785 gene locus_tag LOCUS_07700 <9775 8785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880638.1:DNA topoisomerase (ATP-hydrolyzing) subunit B >Feature sequence059 1629 2477 gene locus_tag LOCUS_07710 1629 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 2458 3666 gene locus_tag LOCUS_07720 2458 3666 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066055.1 protein_id gnl|my_center|LOCUS_07720 4260 3634 gene locus_tag LOCUS_07730 4260 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5582 4257 gene locus_tag LOCUS_07740 5582 4257 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_07740 5695 5621 gene locus_tag LOCUS_t00280 5695 5621 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 <9678 5730 gene locus_tag LOCUS_07750 <9678 5730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_105217514.1:T9SS type A sorting domain-containing protein >Feature sequence060 2053 1256 gene locus_tag LOCUS_07760 2053 1256 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000455757.1 protein_id gnl|my_center|LOCUS_07760 2156 2494 gene locus_tag LOCUS_07770 2156 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 2491 3330 gene locus_tag LOCUS_07780 2491 3330 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_07780 3327 4217 gene locus_tag LOCUS_07790 3327 4217 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_07790 4207 4506 gene locus_tag LOCUS_07800 4207 4506 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583113.1 protein_id gnl|my_center|LOCUS_07800 4519 5463 gene locus_tag LOCUS_07810 4519 5463 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929014.1 protein_id gnl|my_center|LOCUS_07810 5464 6318 gene locus_tag LOCUS_07820 5464 6318 CDS product DUF1848 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814288.1 protein_id gnl|my_center|LOCUS_07820 6491 9199 gene locus_tag LOCUS_07830 6491 9199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 9514 9221 gene locus_tag LOCUS_07840 gene hupN 9514 9221 CDS product HU-related DNA-binding protein HupN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399274.1 protein_id gnl|my_center|LOCUS_07840 >Feature sequence061 3623 4069 gene locus_tag LOCUS_07850 3623 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 4066 5151 gene locus_tag LOCUS_07860 4066 5151 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941162.1 protein_id gnl|my_center|LOCUS_07860 5631 6132 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcttgagcctacctaagaggatttgagacc 6312 6491 gene locus_tag LOCUS_07870 6312 6491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 6638 6874 gene locus_tag LOCUS_07880 6638 6874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 6909 7112 gene locus_tag LOCUS_07890 6909 7112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 7211 7963 gene locus_tag LOCUS_07900 gene cas6 7211 7963 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_07900 8134 8313 gene locus_tag LOCUS_07910 8134 8313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 8364 9215 gene locus_tag LOCUS_07920 8364 9215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 >Feature sequence062 2159 792 gene locus_tag LOCUS_07930 2159 792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3298 2150 gene locus_tag LOCUS_07940 3298 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4352 3309 gene locus_tag LOCUS_07950 4352 3309 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868306.1 protein_id gnl|my_center|LOCUS_07950 5391 4330 gene locus_tag LOCUS_07960 5391 4330 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875982.1 protein_id gnl|my_center|LOCUS_07960 6563 5388 gene locus_tag LOCUS_07970 gene glf 6563 5388 CDS product UDP-galactopyranose mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228271.1 protein_id gnl|my_center|LOCUS_07970 7995 6565 gene locus_tag LOCUS_07980 7995 6565 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_07980 9058 7976 gene locus_tag LOCUS_07990 9058 7976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 >Feature sequence063 337 8 gene locus_tag LOCUS_08000 337 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 789 334 gene locus_tag LOCUS_08010 gene ptsN 789 334 CDS product PTS IIA-like nitrogen regulatory protein PtsN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766506.1 protein_id gnl|my_center|LOCUS_08010 845 2710 gene locus_tag LOCUS_08020 845 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2707 3408 gene locus_tag LOCUS_08030 2707 3408 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544927.1 protein_id gnl|my_center|LOCUS_08030 4478 3660 gene locus_tag LOCUS_08040 4478 3660 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941799.1 protein_id gnl|my_center|LOCUS_08040 6039 4462 gene locus_tag LOCUS_08050 gene rny 6039 4462 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546866.1 protein_id gnl|my_center|LOCUS_08050 6519 6250 gene locus_tag LOCUS_08060 6519 6250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 6706 6512 gene locus_tag LOCUS_08070 6706 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 8706 6703 gene locus_tag LOCUS_08080 gene pheT 8706 6703 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545282.1 protein_id gnl|my_center|LOCUS_08080 <9342 8703 gene locus_tag LOCUS_08090 <9342 8703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393252.1:phenylalanine--tRNA ligase subunit alpha >Feature sequence064 524 991 gene locus_tag LOCUS_08100 524 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 988 1284 gene locus_tag LOCUS_08110 988 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1281 3104 gene locus_tag LOCUS_08120 gene nuoL 1281 3104 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_08120 3101 4597 gene locus_tag LOCUS_08130 3101 4597 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_08130 4597 5949 gene locus_tag LOCUS_08140 4597 5949 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_08140 5949 7193 gene locus_tag LOCUS_08150 5949 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 8307 7201 gene locus_tag LOCUS_08160 8307 7201 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_08160 <9107 8354 gene locus_tag LOCUS_08170 <9107 8354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546417.1:pitrilysin family protein >Feature sequence065 211 1164 gene locus_tag LOCUS_08180 211 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 1212 2972 gene locus_tag LOCUS_08190 1212 2972 CDS product DUF505 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080521.1 protein_id gnl|my_center|LOCUS_08190 2992 3528 gene locus_tag LOCUS_08200 2992 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 3528 4280 gene locus_tag LOCUS_08210 3528 4280 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249790.1 protein_id gnl|my_center|LOCUS_08210 4298 5251 gene locus_tag LOCUS_08220 4298 5251 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867984.1 protein_id gnl|my_center|LOCUS_08220 5248 5724 gene locus_tag LOCUS_08230 5248 5724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 5721 5960 gene locus_tag LOCUS_08240 5721 5960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6094 6327 gene locus_tag LOCUS_08250 6094 6327 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973433.1 protein_id gnl|my_center|LOCUS_08250 6328 7299 gene locus_tag LOCUS_08260 6328 7299 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545286.1 protein_id gnl|my_center|LOCUS_08260 7286 8749 gene locus_tag LOCUS_08270 7286 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence066 1726 257 gene locus_tag LOCUS_08280 1726 257 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939361.1 protein_id gnl|my_center|LOCUS_08280 4008 1723 gene locus_tag LOCUS_08290 4008 1723 CDS product PBP1A family penicillin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546286.1 protein_id gnl|my_center|LOCUS_08290 4091 5806 gene locus_tag LOCUS_08300 4091 5806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 5812 7086 gene locus_tag LOCUS_08310 gene serS 5812 7086 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545752.1 protein_id gnl|my_center|LOCUS_08310 7102 7190 gene locus_tag LOCUS_t00290 7102 7190 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 7275 8564 gene locus_tag LOCUS_08320 7275 8564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 8861 8565 gene locus_tag LOCUS_08330 8861 8565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence067 1787 486 gene locus_tag LOCUS_08340 gene der 1787 486 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 protein_id gnl|my_center|LOCUS_08340 2670 1789 gene locus_tag LOCUS_08350 gene fabD 2670 1789 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516948.1 protein_id gnl|my_center|LOCUS_08350 4034 2667 gene locus_tag LOCUS_08360 gene purF 4034 2667 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546301.1 protein_id gnl|my_center|LOCUS_08360 4439 4035 gene locus_tag LOCUS_08370 4439 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 5638 4421 gene locus_tag LOCUS_08380 5638 4421 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244912.1 protein_id gnl|my_center|LOCUS_08380 6521 5616 gene locus_tag LOCUS_08390 6521 5616 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233262.1 protein_id gnl|my_center|LOCUS_08390 6734 8125 gene locus_tag LOCUS_08400 gene pyk 6734 8125 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227631.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence068 183 872 gene locus_tag LOCUS_08410 183 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 850 1842 gene locus_tag LOCUS_08420 850 1842 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_08420 1839 2696 gene locus_tag LOCUS_08430 1839 2696 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330235.1 protein_id gnl|my_center|LOCUS_08430 2693 3397 gene locus_tag LOCUS_08440 2693 3397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 3378 4352 gene locus_tag LOCUS_08450 3378 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 4352 5284 gene locus_tag LOCUS_08460 4352 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5281 5814 gene locus_tag LOCUS_08470 5281 5814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 5775 6848 gene locus_tag LOCUS_08480 5775 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 6845 7435 gene locus_tag LOCUS_08490 6845 7435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 7440 7901 gene locus_tag LOCUS_08500 7440 7901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 >Feature sequence069 741 148 gene locus_tag LOCUS_08510 741 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 1722 826 gene locus_tag LOCUS_08520 1722 826 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868388.1 protein_id gnl|my_center|LOCUS_08520 2456 1719 gene locus_tag LOCUS_08530 2456 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 3171 2386 gene locus_tag LOCUS_08540 3171 2386 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868387.1 protein_id gnl|my_center|LOCUS_08540 4991 3171 gene locus_tag LOCUS_08550 gene btuB 4991 3171 CDS product TonB-dependent vitamin B12 receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001172310.1 protein_id gnl|my_center|LOCUS_08550 5292 6599 gene locus_tag LOCUS_08560 5292 6599 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879940.1 protein_id gnl|my_center|LOCUS_08560 6592 8016 gene locus_tag LOCUS_08570 gene rsmF 6592 8016 CDS product 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457106.1 protein_id gnl|my_center|LOCUS_08570 8214 8017 gene locus_tag LOCUS_08580 8214 8017 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879942.1 protein_id gnl|my_center|LOCUS_08580 >Feature sequence070 198 818 gene locus_tag LOCUS_08590 198 818 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000432936.1 protein_id gnl|my_center|LOCUS_08590 811 2154 gene locus_tag LOCUS_08600 gene mnmE 811 2154 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880529.1 protein_id gnl|my_center|LOCUS_08600 2151 3974 gene locus_tag LOCUS_08610 gene mnmG 2151 3974 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226825.1 protein_id gnl|my_center|LOCUS_08610 3941 4507 gene locus_tag LOCUS_08620 gene rsmG 3941 4507 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081032.1 protein_id gnl|my_center|LOCUS_08620 4492 5250 gene locus_tag LOCUS_08630 4492 5250 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_08630 5247 6038 gene locus_tag LOCUS_08640 5247 6038 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_08640 6031 6396 gene locus_tag LOCUS_08650 6031 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 6387 7088 gene locus_tag LOCUS_08660 gene kdsB 6387 7088 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882887.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence071 1055 642 gene locus_tag LOCUS_08670 gene rpsI 1055 642 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098810.1 protein_id gnl|my_center|LOCUS_08670 1521 1060 gene locus_tag LOCUS_08680 gene rplM 1521 1060 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881226.1 protein_id gnl|my_center|LOCUS_08680 1592 2113 gene locus_tag LOCUS_08690 1592 2113 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393343.1 protein_id gnl|my_center|LOCUS_08690 2097 2513 gene locus_tag LOCUS_08700 2097 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 2517 3086 gene locus_tag LOCUS_08710 2517 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 3234 4238 gene locus_tag LOCUS_08720 3234 4238 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 protein_id gnl|my_center|LOCUS_08720 4281 4490 gene locus_tag LOCUS_08730 gene rpsU 4281 4490 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673965.1 protein_id gnl|my_center|LOCUS_08730 4492 5352 gene locus_tag LOCUS_08740 gene lipA 4492 5352 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_08740 5330 6079 gene locus_tag LOCUS_08750 5330 6079 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496661.1 protein_id gnl|my_center|LOCUS_08750 6732 6076 gene locus_tag LOCUS_08760 6732 6076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 6861 8336 gene locus_tag LOCUS_08770 6861 8336 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921199.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence072 1450 131 gene locus_tag LOCUS_08780 1450 131 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107468.1 protein_id gnl|my_center|LOCUS_08780 2591 1461 gene locus_tag LOCUS_08790 gene thiI 2591 1461 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249323.1 protein_id gnl|my_center|LOCUS_08790 4072 2591 gene locus_tag LOCUS_08800 4072 2591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5004 4069 gene locus_tag LOCUS_08810 5004 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 5927 5001 gene locus_tag LOCUS_08820 5927 5001 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889131.1 protein_id gnl|my_center|LOCUS_08820 6056 5980 gene locus_tag LOCUS_t00300 6056 5980 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7137 6088 gene locus_tag LOCUS_08830 7137 6088 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868908.1 protein_id gnl|my_center|LOCUS_08830 8301 7360 gene locus_tag LOCUS_08840 8301 7360 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence073 501 1151 gene locus_tag LOCUS_08850 501 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_08850 1148 2158 gene locus_tag LOCUS_08860 1148 2158 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117960.1 protein_id gnl|my_center|LOCUS_08860 2155 3624 gene locus_tag LOCUS_08870 2155 3624 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228818.1 protein_id gnl|my_center|LOCUS_08870 3621 3947 gene locus_tag LOCUS_08880 3621 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 3878 3887 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4251 4970 gene locus_tag LOCUS_08890 4251 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6435 5017 gene locus_tag LOCUS_08900 gene xseA 6435 5017 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942411.1 protein_id gnl|my_center|LOCUS_08900 7337 6435 gene locus_tag LOCUS_08910 7337 6435 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948783.1 protein_id gnl|my_center|LOCUS_08910 <8180 7328 gene locus_tag LOCUS_08920 <8180 7328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081619.1:serine-pyruvate aminotransferase >Feature sequence074 320 2320 gene locus_tag LOCUS_08930 320 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 2320 4167 gene locus_tag LOCUS_08940 2320 4167 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942732.1 protein_id gnl|my_center|LOCUS_08940 4167 6146 gene locus_tag LOCUS_08950 4167 6146 CDS product oligopeptide transporter, OPT family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787253.1 protein_id gnl|my_center|LOCUS_08950 6143 7324 gene locus_tag LOCUS_08960 6143 7324 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257115.1 protein_id gnl|my_center|LOCUS_08960 7542 7805 gene locus_tag LOCUS_08970 7542 7805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 >Feature sequence075 2195 1557 gene locus_tag LOCUS_08980 2195 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2278 3078 gene locus_tag LOCUS_08990 2278 3078 CDS product IclR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393281.1 protein_id gnl|my_center|LOCUS_08990 3075 3896 gene locus_tag LOCUS_09000 3075 3896 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528424.1 protein_id gnl|my_center|LOCUS_09000 3923 5236 gene locus_tag LOCUS_09010 3923 5236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 5299 6297 gene locus_tag LOCUS_09020 5299 6297 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402005.1 protein_id gnl|my_center|LOCUS_09020 6314 7723 gene locus_tag LOCUS_09030 6314 7723 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_09030 >Feature sequence076 1227 1078 gene locus_tag LOCUS_09040 1227 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1202 1211 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3259 1265 gene locus_tag LOCUS_09050 3259 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 6181 3344 gene locus_tag LOCUS_09060 6181 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 6616 7506 gene locus_tag LOCUS_09070 6616 7506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 >Feature sequence077 <1 876 gene locus_tag LOCUS_09080 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230581.1:carbamoyltransferase C-terminal domain-containing protein 2271 922 gene locus_tag LOCUS_09090 2271 922 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064444.1 protein_id gnl|my_center|LOCUS_09090 2409 3473 gene locus_tag LOCUS_09100 gene buk 2409 3473 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_09100 3493 4395 gene locus_tag LOCUS_09110 gene ptb 3493 4395 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357252.1 protein_id gnl|my_center|LOCUS_09110 4405 6225 gene locus_tag LOCUS_09120 gene iorA 4405 6225 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965301.1 protein_id gnl|my_center|LOCUS_09120 6201 6800 gene locus_tag LOCUS_09130 6201 6800 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_09130 6815 7711 gene locus_tag LOCUS_09140 6815 7711 CDS product bifunctional enoyl-CoA hydratase/phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869129.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence078 3 278 gene locus_tag LOCUS_09150 3 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 289 1119 gene locus_tag LOCUS_09160 289 1119 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228704.1 protein_id gnl|my_center|LOCUS_09160 1316 3283 gene locus_tag LOCUS_09170 1316 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3786 3301 gene locus_tag LOCUS_09180 3786 3301 CDS product L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957994.1 protein_id gnl|my_center|LOCUS_09180 5009 3828 gene locus_tag LOCUS_09190 5009 3828 CDS product TIGR00529 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867137.1 protein_id gnl|my_center|LOCUS_09190 5656 5006 gene locus_tag LOCUS_09200 gene rsmI 5656 5006 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_09200 6452 5643 gene locus_tag LOCUS_09210 6452 5643 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_09210 7278 6442 gene locus_tag LOCUS_09220 7278 6442 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence079 951 1727 gene locus_tag LOCUS_09230 951 1727 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949043.1 protein_id gnl|my_center|LOCUS_09230 1746 4535 gene locus_tag LOCUS_09240 1746 4535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5773 4532 gene locus_tag LOCUS_09250 gene orpR 5773 4532 CDS product sigma 54-interacting transcriptional regulator OrpR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939383.1 protein_id gnl|my_center|LOCUS_09250 5950 6306 gene locus_tag LOCUS_09260 5950 6306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 6310 6546 gene locus_tag LOCUS_09270 6310 6546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 6543 6986 gene locus_tag LOCUS_09280 6543 6986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence080 1536 286 gene locus_tag LOCUS_09290 1536 286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1909 1547 gene locus_tag LOCUS_09300 gene sdhD 1909 1547 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545668.1 protein_id gnl|my_center|LOCUS_09300 2283 1921 gene locus_tag LOCUS_09310 gene sdhC 2283 1921 CDS product succinate dehydrogenase, cytochrome b556 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085323186.1 protein_id gnl|my_center|LOCUS_09310 2373 3242 gene locus_tag LOCUS_09320 2373 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 3239 4126 gene locus_tag LOCUS_09330 gene miaA 3239 4126 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942643.1 protein_id gnl|my_center|LOCUS_09330 4123 5343 gene locus_tag LOCUS_09340 gene hflX 4123 5343 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009895824.1 protein_id gnl|my_center|LOCUS_09340 5340 6506 gene locus_tag LOCUS_09350 5340 6506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 6503 7045 gene locus_tag LOCUS_09360 6503 7045 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence081 38 580 gene locus_tag LOCUS_09370 gene pal 38 580 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940702.1 protein_id gnl|my_center|LOCUS_09370 577 1284 gene locus_tag LOCUS_09380 577 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1281 1697 gene locus_tag LOCUS_09390 1281 1697 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_09390 1704 4721 gene locus_tag LOCUS_09400 1704 4721 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546637.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence082 803 1792 gene locus_tag LOCUS_09410 803 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1805 2623 gene locus_tag LOCUS_09420 1805 2623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2620 3723 gene locus_tag LOCUS_09430 gene amrS 2620 3723 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249844.1 protein_id gnl|my_center|LOCUS_09430 3674 5629 gene locus_tag LOCUS_09440 3674 5629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 <7204 5609 gene locus_tag LOCUS_09450 <7204 5609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083104.1:esterase EstD >Feature sequence083 1844 471 gene locus_tag LOCUS_09460 1844 471 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942141.1 protein_id gnl|my_center|LOCUS_09460 3088 1829 gene locus_tag LOCUS_09470 3088 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4287 3088 gene locus_tag LOCUS_09480 4287 3088 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_09480 5439 4297 gene locus_tag LOCUS_09490 5439 4297 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_09490 <7204 5450 gene locus_tag LOCUS_09500 <7204 5450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942137.1:type IV-A pilus assembly ATPase PilB >Feature sequence084 2 385 gene locus_tag LOCUS_09510 2 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 382 1485 gene locus_tag LOCUS_09520 382 1485 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_09520 1814 1467 gene locus_tag LOCUS_09530 1814 1467 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082088.1 protein_id gnl|my_center|LOCUS_09530 3520 1826 gene locus_tag LOCUS_09540 3520 1826 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_09540 7029 3604 gene locus_tag LOCUS_09550 7029 3604 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583743.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence085 435 3284 gene locus_tag LOCUS_09560 435 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3340 3265 gene locus_tag LOCUS_t00310 3340 3265 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4568 3342 gene locus_tag LOCUS_09570 gene pepT 4568 3342 CDS product peptidase T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087691.1 protein_id gnl|my_center|LOCUS_09570 5769 4582 gene locus_tag LOCUS_09580 5769 4582 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037198907.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence086 150 1469 gene locus_tag LOCUS_09590 gene glnA 150 1469 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545065.1 protein_id gnl|my_center|LOCUS_09590 1587 3869 gene locus_tag LOCUS_09600 1587 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2693 2702 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3940 4164 gene locus_tag LOCUS_09610 3940 4164 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_09610 5038 4166 gene locus_tag LOCUS_09620 5038 4166 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868710.1 protein_id gnl|my_center|LOCUS_09620 5451 5017 gene locus_tag LOCUS_09630 5451 5017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 5810 6058 gene locus_tag LOCUS_09640 5810 6058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 6021 6356 gene locus_tag LOCUS_09650 6021 6356 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence087 1474 122 gene locus_tag LOCUS_09660 1474 122 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943908.1 protein_id gnl|my_center|LOCUS_09660 1697 1464 gene locus_tag LOCUS_09670 1697 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09670 1946 1719 gene locus_tag LOCUS_09680 1946 1719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_09680 3591 1915 gene locus_tag LOCUS_09690 3591 1915 CDS product helicase-associated domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393418.1 protein_id gnl|my_center|LOCUS_09690 4387 3560 gene locus_tag LOCUS_09700 4387 3560 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460266.1 protein_id gnl|my_center|LOCUS_09700 4468 6048 gene locus_tag LOCUS_09710 4468 6048 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140378.1 protein_id gnl|my_center|LOCUS_09710 6728 6045 gene locus_tag LOCUS_09720 6728 6045 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546862.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence088 214 891 gene locus_tag LOCUS_09730 214 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 888 1607 gene locus_tag LOCUS_09740 888 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 1618 2841 gene locus_tag LOCUS_09750 1618 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 2933 4813 gene locus_tag LOCUS_09760 gene uvrB 2933 4813 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583249.1 protein_id gnl|my_center|LOCUS_09760 4962 4762 gene locus_tag LOCUS_09770 4962 4762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 5008 6690 gene locus_tag LOCUS_09780 5008 6690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001225813.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence089 202 1713 gene locus_tag LOCUS_09790 202 1713 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942427.1 protein_id gnl|my_center|LOCUS_09790 1710 2471 gene locus_tag LOCUS_09800 1710 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2468 3007 gene locus_tag LOCUS_09810 2468 3007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 3087 3518 gene locus_tag LOCUS_09820 3087 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 3508 3879 gene locus_tag LOCUS_09830 3508 3879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 3880 5967 gene locus_tag LOCUS_09840 3880 5967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 5964 6710 gene locus_tag LOCUS_09850 5964 6710 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765719.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence090 <1 1230 gene locus_tag LOCUS_09860 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949155.1:homocysteine S-methyltransferase family protein 1220 3034 gene locus_tag LOCUS_09870 1220 3034 CDS product bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943603.1 protein_id gnl|my_center|LOCUS_09870 3053 4165 gene locus_tag LOCUS_09880 3053 4165 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_09880 4285 5220 gene locus_tag LOCUS_09890 4285 5220 CDS product glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869354.1 protein_id gnl|my_center|LOCUS_09890 5776 5222 gene locus_tag LOCUS_09900 gene frr 5776 5222 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_09900 6497 5778 gene locus_tag LOCUS_09910 gene pyrH 6497 5778 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence091 5888 684 gene locus_tag LOCUS_09920 5888 684 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_074257047.1 protein_id gnl|my_center|LOCUS_09920 6350 5904 gene locus_tag LOCUS_09930 6350 5904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence092 <1 985 gene locus_tag LOCUS_09940 <1 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680329.1:L-threonine 3-dehydrogenase 2505 982 gene locus_tag LOCUS_09950 gene rpoD 2505 982 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429410.1 protein_id gnl|my_center|LOCUS_09950 4153 2507 gene locus_tag LOCUS_09960 gene dnaG 4153 2507 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943711.1 protein_id gnl|my_center|LOCUS_09960 5460 4150 gene locus_tag LOCUS_09970 5460 4150 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888818.1 protein_id gnl|my_center|LOCUS_09970 5905 5426 gene locus_tag LOCUS_09980 5905 5426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 <6726 5886 gene locus_tag LOCUS_09990 <6726 5886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108998.1:endo-alpha-mannosidase >Feature sequence093 1497 250 gene locus_tag LOCUS_10000 gene rsmB 1497 250 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_10000 2417 1494 gene locus_tag LOCUS_10010 gene fmt 2417 1494 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_10010 2479 2820 gene locus_tag LOCUS_10020 2479 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 2817 4262 gene locus_tag LOCUS_10030 2817 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 4250 5128 gene locus_tag LOCUS_10040 4250 5128 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201850.1 protein_id gnl|my_center|LOCUS_10040 5103 5996 gene locus_tag LOCUS_10050 5103 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 6515 5985 gene locus_tag LOCUS_10060 6515 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 >Feature sequence094 3 794 gene locus_tag LOCUS_10070 3 794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1667 771 gene locus_tag LOCUS_10080 1667 771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 2338 1664 gene locus_tag LOCUS_10090 gene ubiE 2338 1664 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228961.1 protein_id gnl|my_center|LOCUS_10090 3092 2328 gene locus_tag LOCUS_10100 3092 2328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4125 3082 gene locus_tag LOCUS_10110 4125 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4728 4129 gene locus_tag LOCUS_10120 4728 4129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 5249 4716 gene locus_tag LOCUS_10130 5249 4716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 6096 5224 gene locus_tag LOCUS_10140 6096 5224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 6141 6539 gene locus_tag LOCUS_10150 6141 6539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence095 726 3314 gene locus_tag LOCUS_10160 726 3314 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082363.1 protein_id gnl|my_center|LOCUS_10160 3311 3814 gene locus_tag LOCUS_10170 3311 3814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 3823 4029 gene locus_tag LOCUS_10180 3823 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 4007 5125 gene locus_tag LOCUS_10190 4007 5125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 5135 6310 gene locus_tag LOCUS_10200 5135 6310 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147155.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence096 <1 1397 gene locus_tag LOCUS_10210 <1 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583645.1:Ig-like domain-containing protein 1512 4670 gene locus_tag LOCUS_10220 1512 4670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 6144 4777 gene locus_tag LOCUS_10230 6144 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 >Feature sequence097 125 2173 gene locus_tag LOCUS_10240 125 2173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2195 4648 gene locus_tag LOCUS_10250 2195 4648 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918869.1 protein_id gnl|my_center|LOCUS_10250 4642 5625 gene locus_tag LOCUS_10260 gene purM 4642 5625 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545739.1 protein_id gnl|my_center|LOCUS_10260 >Feature sequence098 804 277 gene locus_tag LOCUS_10270 804 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3107 819 gene locus_tag LOCUS_10280 gene bamA 3107 819 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942908.1 protein_id gnl|my_center|LOCUS_10280 5283 3028 gene locus_tag LOCUS_10290 5283 3028 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172629.1 protein_id gnl|my_center|LOCUS_10290 5942 5268 gene locus_tag LOCUS_10300 5942 5268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_10300 <6485 5935 gene locus_tag LOCUS_10310 <6485 5935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939648.1:lipoprotein-releasing ABC transporter permease subunit >Feature sequence099 <1 1910 gene locus_tag LOCUS_10320 <1 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250170.1:proton-conducting transporter membrane subunit 1907 2818 gene locus_tag LOCUS_10330 1907 2818 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080087.1 protein_id gnl|my_center|LOCUS_10330 2822 3400 gene locus_tag LOCUS_10340 2822 3400 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080086.1 protein_id gnl|my_center|LOCUS_10340 3409 3939 gene locus_tag LOCUS_10350 3409 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 3924 5039 gene locus_tag LOCUS_10360 3924 5039 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080082.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence100 1465 137 gene locus_tag LOCUS_10370 1465 137 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267599.1 protein_id gnl|my_center|LOCUS_10370 1640 1452 gene locus_tag LOCUS_10380 1640 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1831 2997 gene locus_tag LOCUS_10390 gene sucC 1831 2997 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932072.1 protein_id gnl|my_center|LOCUS_10390 2994 3869 gene locus_tag LOCUS_10400 gene sucD 2994 3869 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000279904.1 protein_id gnl|my_center|LOCUS_10400 3859 4398 gene locus_tag LOCUS_10410 gene cobO 3859 4398 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_10410 4408 5901 gene locus_tag LOCUS_10420 4408 5901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence101 1757 378 gene locus_tag LOCUS_10430 1757 378 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808616.1 protein_id gnl|my_center|LOCUS_10430 2328 1750 gene locus_tag LOCUS_10440 2328 1750 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880618.1 protein_id gnl|my_center|LOCUS_10440 2482 3528 gene locus_tag LOCUS_10450 gene shyB 2482 3528 CDS product NAD(P)-dependent hydrogenase/sulfhydrogenase 2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868069.1 protein_id gnl|my_center|LOCUS_10450 3521 4378 gene locus_tag LOCUS_10460 gene hydG 3521 4378 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867990.1 protein_id gnl|my_center|LOCUS_10460 4389 5171 gene locus_tag LOCUS_10470 gene hydD 4389 5171 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867989.1 protein_id gnl|my_center|LOCUS_10470 >Feature sequence102 450 662 gene locus_tag LOCUS_10480 450 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 676 1458 gene locus_tag LOCUS_10490 gene accD 676 1458 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545653.1 protein_id gnl|my_center|LOCUS_10490 1455 2717 gene locus_tag LOCUS_10500 1455 2717 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943004.1 protein_id gnl|my_center|LOCUS_10500 2714 3748 gene locus_tag LOCUS_10510 gene rlmN 2714 3748 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546659.1 protein_id gnl|my_center|LOCUS_10510 3678 6329 gene locus_tag LOCUS_10520 gene uvrA 3678 6329 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061214.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence103 4920 622 gene locus_tag LOCUS_10530 gene rpoB 4920 622 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546627.1 protein_id gnl|my_center|LOCUS_10530 5328 4942 gene locus_tag LOCUS_10540 gene rplL 5328 4942 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881266.1 protein_id gnl|my_center|LOCUS_10540 5864 5343 gene locus_tag LOCUS_10550 gene rplJ 5864 5343 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence104 137 943 gene locus_tag LOCUS_10560 gene lpxA 137 943 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_10560 940 1728 gene locus_tag LOCUS_10570 gene lpxI 940 1728 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930695.1 protein_id gnl|my_center|LOCUS_10570 1710 2621 gene locus_tag LOCUS_10580 1710 2621 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_10580 2602 3576 gene locus_tag LOCUS_10590 2602 3576 CDS product serine hydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118454.1 protein_id gnl|my_center|LOCUS_10590 3606 5390 gene locus_tag LOCUS_10600 3606 5390 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_123042767.1 protein_id gnl|my_center|LOCUS_10600 5400 6197 gene locus_tag LOCUS_10610 5400 6197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 >Feature sequence105 1303 62 gene locus_tag LOCUS_10620 1303 62 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_10620 2173 1313 gene locus_tag LOCUS_10630 2173 1313 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942741.1 protein_id gnl|my_center|LOCUS_10630 2121 2130 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4065 2173 gene locus_tag LOCUS_10640 gene cooS 4065 2173 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_10640 4687 4076 gene locus_tag LOCUS_10650 4687 4076 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942740.1 protein_id gnl|my_center|LOCUS_10650 4817 5902 gene locus_tag LOCUS_10660 4817 5902 CDS product anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704825.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence106 463 26 gene locus_tag LOCUS_10670 463 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1568 483 gene locus_tag LOCUS_10680 1568 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10680 555 564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2538 1642 gene locus_tag LOCUS_10690 2538 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 3286 5019 gene locus_tag LOCUS_10700 3286 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 <6118 5071 gene locus_tag LOCUS_10710 <6118 5071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963042.1:S41 family peptidase >Feature sequence107 <1 2696 gene locus_tag LOCUS_10720 <1 2696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase 5355 2728 gene locus_tag LOCUS_10730 5355 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence108 417 878 gene locus_tag LOCUS_10740 417 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 875 2020 gene locus_tag LOCUS_10750 875 2020 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021204.1 protein_id gnl|my_center|LOCUS_10750 2017 3075 gene locus_tag LOCUS_10760 2017 3075 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_10760 3072 4142 gene locus_tag LOCUS_10770 3072 4142 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000658622.1 protein_id gnl|my_center|LOCUS_10770 4699 4139 gene locus_tag LOCUS_10780 4699 4139 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940800.1 protein_id gnl|my_center|LOCUS_10780 5201 4827 gene locus_tag LOCUS_10790 5201 4827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 5628 5212 gene locus_tag LOCUS_10800 5628 5212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence109 3584 486 gene locus_tag LOCUS_10810 3584 486 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_10810 4657 3581 gene locus_tag LOCUS_10820 gene vmeY 4657 3581 CDS product multidrug efflux RND transporter periplasmic adaptor subunit VmeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477351.1 protein_id gnl|my_center|LOCUS_10820 <5947 4654 gene locus_tag LOCUS_10830 <5947 4654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545697.1:TolC family protein >Feature sequence110 1888 1679 gene locus_tag LOCUS_10840 1888 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 2813 2187 gene locus_tag LOCUS_10850 2813 2187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2894 4516 gene locus_tag LOCUS_10860 gene pckA 2894 4516 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478630.1 protein_id gnl|my_center|LOCUS_10860 >Feature sequence111 195 1007 gene locus_tag LOCUS_10870 195 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 991 1896 gene locus_tag LOCUS_10880 gene menA 991 1896 CDS product 1,4-dihydroxy-2-naphthoate octaprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081897.1 protein_id gnl|my_center|LOCUS_10880 1893 3605 gene locus_tag LOCUS_10890 gene uvrC 1893 3605 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583837.1 protein_id gnl|my_center|LOCUS_10890 3589 3918 gene locus_tag LOCUS_10900 gene acpS 3589 3918 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583384.1 protein_id gnl|my_center|LOCUS_10900 4181 5737 gene locus_tag LOCUS_10910 4181 5737 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680484.1 protein_id gnl|my_center|LOCUS_10910 >Feature sequence112 2118 1066 gene locus_tag LOCUS_10920 2118 1066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2660 2118 gene locus_tag LOCUS_10930 2660 2118 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_10930 3549 2662 gene locus_tag LOCUS_10940 3549 2662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3648 4976 gene locus_tag LOCUS_10950 3648 4976 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_10950 <5864 4969 gene locus_tag LOCUS_10960 <5864 4969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460876.1:radical SAM family heme chaperone HemW >Feature sequence113 357 1262 gene locus_tag LOCUS_10970 357 1262 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880854.1 protein_id gnl|my_center|LOCUS_10970 1853 1239 gene locus_tag LOCUS_10980 gene nfi 1853 1239 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082416.1 protein_id gnl|my_center|LOCUS_10980 3483 1816 gene locus_tag LOCUS_10990 3483 1816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 3722 4261 gene locus_tag LOCUS_11000 3722 4261 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_11000 4275 4688 gene locus_tag LOCUS_11010 4275 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 4700 4954 gene locus_tag LOCUS_11020 4700 4954 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256473.1 protein_id gnl|my_center|LOCUS_11020 4956 5405 gene locus_tag LOCUS_11030 4956 5405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence114 3147 2680 gene locus_tag LOCUS_11040 3147 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 3323 3144 gene locus_tag LOCUS_11050 3323 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 3535 3332 gene locus_tag LOCUS_11060 3535 3332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 5045 3528 gene locus_tag LOCUS_11070 5045 3528 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003975674.1 protein_id gnl|my_center|LOCUS_11070 <5777 5042 gene locus_tag LOCUS_11080 <5777 5042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582708.1:M24 family metallopeptidase >Feature sequence115 <1 1102 gene locus_tag LOCUS_11090 <1 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990858.1:SBBP repeat-containing protein 1147 2292 gene locus_tag LOCUS_11100 1147 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2557 2357 gene locus_tag LOCUS_11110 2557 2357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2984 2532 gene locus_tag LOCUS_11120 2984 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11120 3569 3042 gene locus_tag LOCUS_11130 3569 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11130 3765 3920 gene locus_tag LOCUS_11140 gene rpmB 3765 3920 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392437.1 protein_id gnl|my_center|LOCUS_11140 4021 4422 gene locus_tag LOCUS_11150 gene speD 4021 4422 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_11150 4419 5327 gene locus_tag LOCUS_11160 gene speE 4419 5327 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583812.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence116 432 1118 gene locus_tag LOCUS_11170 432 1118 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002655975.1 protein_id gnl|my_center|LOCUS_11170 1115 1738 gene locus_tag LOCUS_11180 1115 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1735 2718 gene locus_tag LOCUS_11190 1735 2718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 3029 3724 gene locus_tag LOCUS_11200 3029 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3733 4002 gene locus_tag LOCUS_11210 3733 4002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4047 5177 gene locus_tag LOCUS_11220 4047 5177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence117 521 276 gene locus_tag LOCUS_11230 521 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 864 511 gene locus_tag LOCUS_11240 gene mnhG 864 511 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867826.1 protein_id gnl|my_center|LOCUS_11240 1121 864 gene locus_tag LOCUS_11250 1121 864 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250176.1 protein_id gnl|my_center|LOCUS_11250 1599 1114 gene locus_tag LOCUS_11260 1599 1114 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_11260 2225 1596 gene locus_tag LOCUS_11270 2225 1596 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_11270 2353 3327 gene locus_tag LOCUS_11280 2353 3327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 3324 4685 gene locus_tag LOCUS_11290 3324 4685 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546691.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence118 25 423 gene locus_tag LOCUS_11300 25 423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 404 1363 gene locus_tag LOCUS_11310 404 1363 CDS product IS110-like element IS1663 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930320.1 protein_id gnl|my_center|LOCUS_11310 1504 2925 gene locus_tag LOCUS_11320 1504 2925 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461538.1 protein_id gnl|my_center|LOCUS_11320 3840 2929 gene locus_tag LOCUS_11330 gene amrS 3840 2929 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942373.1 protein_id gnl|my_center|LOCUS_11330 4544 3942 gene locus_tag LOCUS_11340 4544 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 <5550 4507 gene locus_tag LOCUS_11350 <5550 4507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123487.1:transglutaminase-like domain-containing protein >Feature sequence119 2 1270 gene locus_tag LOCUS_11360 2 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1272 4487 gene locus_tag LOCUS_11370 1272 4487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 >Feature sequence120 2059 134 gene locus_tag LOCUS_11380 2059 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3984 2056 gene locus_tag LOCUS_11390 3984 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 5236 4133 gene locus_tag LOCUS_11400 5236 4133 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584063.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence121 1558 95 gene locus_tag LOCUS_11410 1558 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 2505 2104 gene locus_tag LOCUS_11420 2505 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 5033 2502 gene locus_tag LOCUS_11430 5033 2502 CDS product outer membrane protein assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546673.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence122 159 1748 gene locus_tag LOCUS_11440 159 1748 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937466.1 protein_id gnl|my_center|LOCUS_11440 2633 3154 gene locus_tag LOCUS_11450 2633 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 3188 3712 gene locus_tag LOCUS_11460 3188 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 3685 3694 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence123 2031 1 gene locus_tag LOCUS_11470 2031 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2611 2033 gene locus_tag LOCUS_11480 gene rnhB 2611 2033 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113866.1 protein_id gnl|my_center|LOCUS_11480 2942 2592 gene locus_tag LOCUS_11490 gene rplS 2942 2592 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_11490 3618 2920 gene locus_tag LOCUS_11500 gene trmD 3618 2920 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_11500 4022 3615 gene locus_tag LOCUS_11510 4022 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 4300 4067 gene locus_tag LOCUS_11520 4300 4067 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_11520 4566 4312 gene locus_tag LOCUS_11530 gene rpsP 4566 4312 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004451027.1 protein_id gnl|my_center|LOCUS_11530 <5319 4609 gene locus_tag LOCUS_11540 <5319 4609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546620.1:signal recognition particle protein >Feature sequence124 <1 826 gene locus_tag LOCUS_11550 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938027.1:tRNA guanosine(34) transglycosylase Tgt 823 1131 gene locus_tag LOCUS_11560 gene yajC 823 1131 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080747.1 protein_id gnl|my_center|LOCUS_11560 1136 2677 gene locus_tag LOCUS_11570 gene secD 1136 2677 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_11570 2689 3834 gene locus_tag LOCUS_11580 2689 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence125 465 1649 gene locus_tag LOCUS_11590 465 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 1677 2228 gene locus_tag LOCUS_11600 gene pyrR 1677 2228 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_11600 2229 3140 gene locus_tag LOCUS_11610 2229 3140 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_11610 3137 4411 gene locus_tag LOCUS_11620 3137 4411 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941927.1 protein_id gnl|my_center|LOCUS_11620 >Feature sequence126 305 1315 gene locus_tag LOCUS_11630 gene tsaD 305 1315 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943403.1 protein_id gnl|my_center|LOCUS_11630 1312 2610 gene locus_tag LOCUS_11640 gene miaB 1312 2610 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545886.1 protein_id gnl|my_center|LOCUS_11640 2600 3151 gene locus_tag LOCUS_11650 2600 3151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 3084 3093 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3161 3676 gene locus_tag LOCUS_11660 3161 3676 CDS product DUF4416 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544933.1 protein_id gnl|my_center|LOCUS_11660 3649 4104 gene locus_tag LOCUS_11670 3649 4104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 <5171 4101 gene locus_tag LOCUS_11680 <5171 4101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838696.1:Na+/H+ antiporter NhaC family protein >Feature sequence127 <1 1132 gene locus_tag LOCUS_11690 <1 1132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257638.1:aldehyde dehydrogenase family protein 1136 1909 gene locus_tag LOCUS_11700 1136 1909 CDS product lipoate--protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393437.1 protein_id gnl|my_center|LOCUS_11700 1936 2010 gene locus_tag LOCUS_t00320 1936 2010 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2025 2801 gene locus_tag LOCUS_11710 gene folE2 2025 2801 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_11710 2791 3954 gene locus_tag LOCUS_11720 gene folP 2791 3954 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582989.1 protein_id gnl|my_center|LOCUS_11720 3951 4436 gene locus_tag LOCUS_11730 gene folK 3951 4436 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420858.1 protein_id gnl|my_center|LOCUS_11730 4465 4947 gene locus_tag LOCUS_11740 4465 4947 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880135.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence128 104 979 gene locus_tag LOCUS_11750 104 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 991 1992 gene locus_tag LOCUS_11760 991 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 2128 4890 gene locus_tag LOCUS_11770 2128 4890 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918809.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence129 200 2251 gene locus_tag LOCUS_11780 200 2251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 2348 2767 gene locus_tag LOCUS_11790 2348 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 2785 3606 gene locus_tag LOCUS_11800 gene rsmH 2785 3606 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080729.1 protein_id gnl|my_center|LOCUS_11800 3603 3914 gene locus_tag LOCUS_11810 3603 3914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence130 473 1255 gene locus_tag LOCUS_11820 473 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1252 2307 gene locus_tag LOCUS_11830 1252 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2336 3571 gene locus_tag LOCUS_11840 2336 3571 CDS product DUF1015 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942916.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence131 310 2352 gene locus_tag LOCUS_11850 310 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 2362 2964 gene locus_tag LOCUS_11860 2362 2964 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545712.1 protein_id gnl|my_center|LOCUS_11860 2977 4365 gene locus_tag LOCUS_11870 2977 4365 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_11870 4558 4631 gene locus_tag LOCUS_t00330 4558 4631 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 466 1140 gene locus_tag LOCUS_11880 gene tolQ 466 1140 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003527594.1 protein_id gnl|my_center|LOCUS_11880 1152 1589 gene locus_tag LOCUS_11890 gene tolR 1152 1589 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940359.1 protein_id gnl|my_center|LOCUS_11890 2418 1591 gene locus_tag LOCUS_11900 2418 1591 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761539.1 protein_id gnl|my_center|LOCUS_11900 >Feature sequence133 2140 845 gene locus_tag LOCUS_11910 gene asnS 2140 845 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583296.1 protein_id gnl|my_center|LOCUS_11910 2204 4426 gene locus_tag LOCUS_11920 2204 4426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 <4951 4397 gene locus_tag LOCUS_11930 <4951 4397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583117.1:TIGR04013 family B12-binding domain/radical SAM domain-containing protein >Feature sequence134 1749 952 gene locus_tag LOCUS_11940 1749 952 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391458.1 protein_id gnl|my_center|LOCUS_11940 3056 1749 gene locus_tag LOCUS_11950 gene thiC 3056 1749 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_11950 3128 4039 gene locus_tag LOCUS_11960 3128 4039 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791421.1 protein_id gnl|my_center|LOCUS_11960 <4906 4040 gene locus_tag LOCUS_11970 <4906 4040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766268.1:arylsulfatase >Feature sequence135 324 1367 gene locus_tag LOCUS_11980 324 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1364 3946 gene locus_tag LOCUS_11990 gene clpB 1364 3946 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546043.1 protein_id gnl|my_center|LOCUS_11990 4731 3943 gene locus_tag LOCUS_12000 4731 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence136 <1 643 gene locus_tag LOCUS_12010 <1 643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010992445.1:penicillin-binding protein 1C 665 1549 gene locus_tag LOCUS_12020 665 1549 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175852.1 protein_id gnl|my_center|LOCUS_12020 1563 2345 gene locus_tag LOCUS_12030 1563 2345 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388167.1 protein_id gnl|my_center|LOCUS_12030 2342 3070 gene locus_tag LOCUS_12040 2342 3070 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_12040 3060 3932 gene locus_tag LOCUS_12050 3060 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3932 4786 gene locus_tag LOCUS_12060 gene xerD 3932 4786 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723602.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence137 28 1623 gene locus_tag LOCUS_12070 28 1623 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786228.1 protein_id gnl|my_center|LOCUS_12070 1649 2482 gene locus_tag LOCUS_12080 1649 2482 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528668.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence138 316 519 gene locus_tag LOCUS_12090 316 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 473 1444 gene locus_tag LOCUS_12100 gene rfaQ 473 1444 CDS product putative lipopolysaccharide heptosyltransferase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703803.1 protein_id gnl|my_center|LOCUS_12100 2369 1413 gene locus_tag LOCUS_12110 2369 1413 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584039.1 protein_id gnl|my_center|LOCUS_12110 2430 2636 gene locus_tag LOCUS_12120 2430 2636 CDS product dodecin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531476.1 protein_id gnl|my_center|LOCUS_12120 3054 2638 gene locus_tag LOCUS_12130 3054 2638 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_12130 3097 3888 gene locus_tag LOCUS_12140 3097 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 3924 4655 gene locus_tag LOCUS_12150 3924 4655 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544934.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence139 446 1201 gene locus_tag LOCUS_12160 446 1201 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925142.1 protein_id gnl|my_center|LOCUS_12160 1231 1992 gene locus_tag LOCUS_12170 1231 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 3425 1989 gene locus_tag LOCUS_12180 gene rtcB 3425 1989 CDS product RNA ligase RtcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228915.1 protein_id gnl|my_center|LOCUS_12180 4524 3454 gene locus_tag LOCUS_12190 4524 3454 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545054.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence140 423 863 gene locus_tag LOCUS_12200 423 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 1878 850 gene locus_tag LOCUS_12210 1878 850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 3316 1820 gene locus_tag LOCUS_12220 3316 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3968 3381 gene locus_tag LOCUS_12230 3968 3381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 <4682 4026 gene locus_tag LOCUS_12240 <4682 4026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881144.1:inositol-3-phosphate synthase >Feature sequence141 106 552 gene locus_tag LOCUS_12250 106 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 549 1088 gene locus_tag LOCUS_12260 gene pyrE 549 1088 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929494.1 protein_id gnl|my_center|LOCUS_12260 1075 1920 gene locus_tag LOCUS_12270 1075 1920 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887127.1 protein_id gnl|my_center|LOCUS_12270 1895 2482 gene locus_tag LOCUS_12280 1895 2482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 3101 2445 gene locus_tag LOCUS_12290 3101 2445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence142 1629 928 gene locus_tag LOCUS_12300 1629 928 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262551.1 protein_id gnl|my_center|LOCUS_12300 2183 1626 gene locus_tag LOCUS_12310 2183 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 2219 4267 gene locus_tag LOCUS_12320 2219 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence143 <1 1232 gene locus_tag LOCUS_12330 <1 1232 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258088.1:SpoIIE family protein phosphatase 1219 2343 gene locus_tag LOCUS_12340 1219 2343 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_12340 2824 2366 gene locus_tag LOCUS_12350 2824 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 4465 2870 gene locus_tag LOCUS_12360 4465 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence144 663 672 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2030 1671 gene locus_tag LOCUS_12370 2030 1671 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546573.1 protein_id gnl|my_center|LOCUS_12370 2876 2031 gene locus_tag LOCUS_12380 gene panC 2876 2031 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_12380 3696 2827 gene locus_tag LOCUS_12390 gene panB 3696 2827 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867972.1 protein_id gnl|my_center|LOCUS_12390 3775 4437 gene locus_tag LOCUS_12400 gene hypB 3775 4437 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880399.1 protein_id gnl|my_center|LOCUS_12400 >Feature sequence145 917 126 gene locus_tag LOCUS_12410 917 126 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869100.1 protein_id gnl|my_center|LOCUS_12410 1498 926 gene locus_tag LOCUS_12420 gene rsxA 1498 926 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082952.1 protein_id gnl|my_center|LOCUS_12420 2098 1502 gene locus_tag LOCUS_12430 2098 1502 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419045.1 protein_id gnl|my_center|LOCUS_12430 2664 2095 gene locus_tag LOCUS_12440 2664 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 3605 2661 gene locus_tag LOCUS_12450 3605 2661 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_12450 <4526 3602 gene locus_tag LOCUS_12460 <4526 3602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583453.1:electron transport complex subunit RsxC >Feature sequence146 1416 271 gene locus_tag LOCUS_12470 1416 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 1649 2821 gene locus_tag LOCUS_12480 1649 2821 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583929.1 protein_id gnl|my_center|LOCUS_12480 >Feature sequence147 2149 1649 gene locus_tag LOCUS_12490 gene tsaA 2149 1649 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041917352.1 protein_id gnl|my_center|LOCUS_12490 2769 2119 gene locus_tag LOCUS_12500 gene lepB 2769 2119 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_12500 3568 2879 gene locus_tag LOCUS_12510 3568 2879 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence148 1178 264 gene locus_tag LOCUS_12520 gene truB 1178 264 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546120.1 protein_id gnl|my_center|LOCUS_12520 2143 1157 gene locus_tag LOCUS_12530 2143 1157 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808862.1 protein_id gnl|my_center|LOCUS_12530 2444 2097 gene locus_tag LOCUS_12540 2444 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 2719 2441 gene locus_tag LOCUS_12550 2719 2441 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_12550 4194 2725 gene locus_tag LOCUS_12560 4194 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12560 >Feature sequence149 5 2287 gene locus_tag LOCUS_12570 5 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12570 2284 3072 gene locus_tag LOCUS_12580 2284 3072 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_12580 3069 4130 gene locus_tag LOCUS_12590 3069 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 4106 4115 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence150 447 2126 gene locus_tag LOCUS_12600 447 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2130 3164 gene locus_tag LOCUS_12610 2130 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3146 3155 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3226 3816 gene locus_tag LOCUS_12620 3226 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3813 4331 gene locus_tag LOCUS_12630 3813 4331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence151 971 1486 gene locus_tag LOCUS_12640 971 1486 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146494.1 protein_id gnl|my_center|LOCUS_12640 1973 1581 gene locus_tag LOCUS_12650 1973 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12650 <4349 2146 gene locus_tag LOCUS_12660 <4349 2146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072023.1:efflux RND transporter permease subunit >Feature sequence152 84 587 gene locus_tag LOCUS_12670 84 587 CDS product DivIVA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545060.1 protein_id gnl|my_center|LOCUS_12670 529 747 gene locus_tag LOCUS_12680 529 747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 740 2056 gene locus_tag LOCUS_12690 740 2056 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496463.1 protein_id gnl|my_center|LOCUS_12690 2066 2971 gene locus_tag LOCUS_12700 2066 2971 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144194.1 protein_id gnl|my_center|LOCUS_12700 2955 3716 gene locus_tag LOCUS_12710 2955 3716 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142866.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence153 1749 274 gene locus_tag LOCUS_12720 1749 274 CDS product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211308.1 protein_id gnl|my_center|LOCUS_12720 2693 1797 gene locus_tag LOCUS_12730 gene thiL 2693 1797 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881388.1 protein_id gnl|my_center|LOCUS_12730 <4170 2683 gene locus_tag LOCUS_12740 <4170 2683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545466.1:endopeptidase La >Feature sequence154 3174 10 gene locus_tag LOCUS_12750 3174 10 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793715.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence155 <1 905 gene locus_tag LOCUS_12760 <1 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583893.1:nickel pincer cofactor biosynthesis protein LarC 902 2761 gene locus_tag LOCUS_12770 gene metG 902 2761 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930950.1 protein_id gnl|my_center|LOCUS_12770 2758 3726 gene locus_tag LOCUS_12780 gene ychF 2758 3726 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090173.1 protein_id gnl|my_center|LOCUS_12780 >Feature sequence156 812 300 gene locus_tag LOCUS_12790 812 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 1552 797 gene locus_tag LOCUS_12800 1552 797 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231291.1 protein_id gnl|my_center|LOCUS_12800 2012 1536 gene locus_tag LOCUS_12810 2012 1536 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881425.1 protein_id gnl|my_center|LOCUS_12810 2971 2012 gene locus_tag LOCUS_12820 2971 2012 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881003.1 protein_id gnl|my_center|LOCUS_12820 3777 2968 gene locus_tag LOCUS_12830 gene kdsA 3777 2968 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938915.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence157 192 1388 gene locus_tag LOCUS_12840 192 1388 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879947.1 protein_id gnl|my_center|LOCUS_12840 1430 2815 gene locus_tag LOCUS_12850 1430 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3503 2769 gene locus_tag LOCUS_12860 gene truA 3503 2769 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943506.1 protein_id gnl|my_center|LOCUS_12860 <4102 3490 gene locus_tag LOCUS_12870 <4102 3490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942870.1:DNA polymerase III subunit delta' >Feature sequence158 635 2224 gene locus_tag LOCUS_12880 635 2224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 >Feature sequence159 1631 717 gene locus_tag LOCUS_12890 1631 717 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_12890 2584 1628 gene locus_tag LOCUS_12900 2584 1628 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257839.1 protein_id gnl|my_center|LOCUS_12900 3576 2581 gene locus_tag LOCUS_12910 gene rfbB 3576 2581 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023679.1 protein_id gnl|my_center|LOCUS_12910 3933 3583 gene locus_tag LOCUS_12920 3933 3583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12920 >Feature sequence160 689 195 gene locus_tag LOCUS_12930 689 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 2853 679 gene locus_tag LOCUS_12940 2853 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 3662 2850 gene locus_tag LOCUS_12950 3662 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence161 2 331 gene locus_tag LOCUS_12960 2 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 328 561 gene locus_tag LOCUS_12970 328 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 528 1091 gene locus_tag LOCUS_12980 528 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12980 1060 1069 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1333 1770 gene locus_tag LOCUS_12990 1333 1770 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_12990 3736 1802 gene locus_tag LOCUS_13000 3736 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 >Feature sequence162 <1 986 gene locus_tag LOCUS_13010 <1 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177221404.1:preprotein translocase subunit SecA 983 2461 gene locus_tag LOCUS_13020 gene guaB 983 2461 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881325.1 protein_id gnl|my_center|LOCUS_13020 2458 3261 gene locus_tag LOCUS_13030 2458 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence163 977 135 gene locus_tag LOCUS_13040 977 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 1531 974 gene locus_tag LOCUS_13050 gene trmH 1531 974 CDS product tRNA (guanosine(18)-2'-O)-methyltransferase TrmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011174221.1 protein_id gnl|my_center|LOCUS_13050 2196 1528 gene locus_tag LOCUS_13060 2196 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 3151 2207 gene locus_tag LOCUS_13070 3151 2207 CDS product Na/Pi symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123063.1 protein_id gnl|my_center|LOCUS_13070 3228 3237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence164 3329 2919 gene locus_tag LOCUS_13080 3329 2919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence165 <1 859 gene locus_tag LOCUS_13090 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421588.1:cystathionine beta-synthase 1347 856 gene locus_tag LOCUS_13100 1347 856 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000578443.1 protein_id gnl|my_center|LOCUS_13100 1799 1344 gene locus_tag LOCUS_13110 1799 1344 CDS product UDP-N-acetylglucosamine--LPS N-acetylglucosamine transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686635.1 protein_id gnl|my_center|LOCUS_13110 1875 2546 gene locus_tag LOCUS_13120 1875 2546 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261734.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13120 2598 3806 gene locus_tag LOCUS_13130 2598 3806 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence166 196 1272 gene locus_tag LOCUS_13140 196 1272 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929836.1 protein_id gnl|my_center|LOCUS_13140 1275 2141 gene locus_tag LOCUS_13150 gene rfbD 1275 2141 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_13150 2143 3180 gene locus_tag LOCUS_13160 2143 3180 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546066.1 protein_id gnl|my_center|LOCUS_13160 3177 3614 gene locus_tag LOCUS_13170 3177 3614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence167 2004 547 gene locus_tag LOCUS_13180 gene lysS 2004 547 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082221.1 protein_id gnl|my_center|LOCUS_13180 2401 1946 gene locus_tag LOCUS_13190 gene nusB 2401 1946 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000235740.1 protein_id gnl|my_center|LOCUS_13190 2871 2398 gene locus_tag LOCUS_13200 gene ribE 2871 2398 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545200.1 protein_id gnl|my_center|LOCUS_13200 2974 3405 gene locus_tag LOCUS_13210 2974 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence168 1091 2533 gene locus_tag LOCUS_13220 gene proS 1091 2533 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583195.1 protein_id gnl|my_center|LOCUS_13220 2538 3170 gene locus_tag LOCUS_13230 2538 3170 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141698.1 protein_id gnl|my_center|LOCUS_13230 3167 3574 gene locus_tag LOCUS_13240 3167 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence169 2043 1075 gene locus_tag LOCUS_13250 2043 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2357 2040 gene locus_tag LOCUS_13260 2357 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2954 2361 gene locus_tag LOCUS_13270 2954 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence170 946 35 gene locus_tag LOCUS_13280 946 35 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943100.1 protein_id gnl|my_center|LOCUS_13280 1721 915 gene locus_tag LOCUS_13290 gene lgt 1721 915 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880125.1 protein_id gnl|my_center|LOCUS_13290 2184 1702 gene locus_tag LOCUS_13300 gene lspA 2184 1702 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014705.1 protein_id gnl|my_center|LOCUS_13300 <3745 2181 gene locus_tag LOCUS_13310 <3745 2181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392382.1:isoleucine--tRNA ligase >Feature sequence171 1 1935 gene locus_tag LOCUS_13320 gene glyS 1 1935 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941242.1 protein_id gnl|my_center|LOCUS_13320 1932 2675 gene locus_tag LOCUS_13330 1932 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence172 1362 967 gene locus_tag LOCUS_13340 1362 967 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_13340 2369 1365 gene locus_tag LOCUS_13350 gene fbp 2369 1365 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932050.1 protein_id gnl|my_center|LOCUS_13350 3384 2407 gene locus_tag LOCUS_13360 3384 2407 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868286.1 protein_id gnl|my_center|LOCUS_13360 >Feature sequence173 2686 1136 gene locus_tag LOCUS_13370 2686 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 >Feature sequence174 226 298 gene locus_tag LOCUS_t00340 226 298 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 307 1152 gene locus_tag LOCUS_13380 307 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 1145 2188 gene locus_tag LOCUS_13390 gene ribD 1145 2188 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392432.1 protein_id gnl|my_center|LOCUS_13390 2178 3473 gene locus_tag LOCUS_13400 2178 3473 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence175 388 720 gene locus_tag LOCUS_13410 388 720 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583889.1 protein_id gnl|my_center|LOCUS_13410 1998 745 gene locus_tag LOCUS_13420 1998 745 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870108.1 protein_id gnl|my_center|LOCUS_13420 2530 2000 gene locus_tag LOCUS_13430 2530 2000 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_13430 2711 3529 gene locus_tag LOCUS_13440 2711 3529 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023359.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence176 1554 607 gene locus_tag LOCUS_13450 1554 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2442 1564 gene locus_tag LOCUS_13460 2442 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 >Feature sequence177 <1 734 gene locus_tag LOCUS_13470 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393197.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA 1495 731 gene locus_tag LOCUS_13480 1495 731 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_13480 2826 1495 gene locus_tag LOCUS_13490 2826 1495 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459325.1 protein_id gnl|my_center|LOCUS_13490 3487 2873 gene locus_tag LOCUS_13500 3487 2873 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence178 2481 379 gene locus_tag LOCUS_13510 2481 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 <3640 2478 gene locus_tag LOCUS_13520 <3640 2478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015370099.1:ABC transporter substrate-binding protein >Feature sequence179 508 1107 gene locus_tag LOCUS_13530 508 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 1656 1291 gene locus_tag LOCUS_13540 1656 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3416 1992 gene locus_tag LOCUS_13550 3416 1992 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence180 873 199 gene locus_tag LOCUS_13560 873 199 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880129.1 protein_id gnl|my_center|LOCUS_13560 1326 916 gene locus_tag LOCUS_13570 1326 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 1368 2366 gene locus_tag LOCUS_13580 1368 2366 CDS product acetoin utilization protein AcuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846769.1 protein_id gnl|my_center|LOCUS_13580 2394 3428 gene locus_tag LOCUS_13590 gene ltaE 2394 3428 CDS product low-specificity L-threonine aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082276.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence181 1263 1823 gene locus_tag LOCUS_13600 1263 1823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 2482 1862 gene locus_tag LOCUS_13610 2482 1862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881344.1 protein_id gnl|my_center|LOCUS_13610 3352 2498 gene locus_tag LOCUS_13620 3352 2498 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880080.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence182 472 759 gene locus_tag LOCUS_13630 472 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 893 1105 gene locus_tag LOCUS_13640 893 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1077 1580 gene locus_tag LOCUS_13650 1077 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1577 2422 gene locus_tag LOCUS_13660 1577 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 2419 2802 gene locus_tag LOCUS_13670 2419 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 >Feature sequence183 132 908 gene locus_tag LOCUS_13680 132 908 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881445.1 protein_id gnl|my_center|LOCUS_13680 1982 894 gene locus_tag LOCUS_13690 1982 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 2575 1982 gene locus_tag LOCUS_13700 2575 1982 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008631587.1 protein_id gnl|my_center|LOCUS_13700 2619 3458 gene locus_tag LOCUS_13710 2619 3458 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242338.1 protein_id gnl|my_center|LOCUS_13710 >Feature sequence184 1805 450 gene locus_tag LOCUS_13720 gene tilS 1805 450 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546068.1 protein_id gnl|my_center|LOCUS_13720 1889 1814 gene locus_tag LOCUS_t00350 1889 1814 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 1947 2327 gene locus_tag LOCUS_13730 1947 2327 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546602.1 protein_id gnl|my_center|LOCUS_13730 2456 3028 gene locus_tag LOCUS_13740 2456 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence185 23 1600 gene locus_tag LOCUS_13750 23 1600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1597 2367 gene locus_tag LOCUS_13760 1597 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2395 3219 gene locus_tag LOCUS_13770 2395 3219 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_13770 >Feature sequence186 3261 1945 gene locus_tag LOCUS_13780 3261 1945 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197525141.1 protein_id gnl|my_center|LOCUS_13780 >Feature sequence187 594 322 gene locus_tag LOCUS_13790 594 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 548 2575 gene locus_tag LOCUS_13800 548 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 >Feature sequence188 1391 294 gene locus_tag LOCUS_13810 1391 294 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096393.1 protein_id gnl|my_center|LOCUS_13810 2104 1370 gene locus_tag LOCUS_13820 2104 1370 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024285.1 protein_id gnl|my_center|LOCUS_13820 2558 2091 gene locus_tag LOCUS_13830 2558 2091 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_13830 2971 2555 gene locus_tag LOCUS_13840 2971 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 >Feature sequence189 192 1541 gene locus_tag LOCUS_13850 192 1541 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546410.1 protein_id gnl|my_center|LOCUS_13850 2701 1562 gene locus_tag LOCUS_13860 2701 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3203 2637 gene locus_tag LOCUS_13870 3203 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence190 1710 2795 gene locus_tag LOCUS_13880 1710 2795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence191 988 386 gene locus_tag LOCUS_13890 gene coaE 988 386 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081589.1 protein_id gnl|my_center|LOCUS_13890 2052 985 gene locus_tag LOCUS_13900 2052 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2816 2049 gene locus_tag LOCUS_13910 2816 2049 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence192 <1 951 gene locus_tag LOCUS_13920 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763503.1:oligopeptide transporter, OPT family 1048 1887 gene locus_tag LOCUS_13930 1048 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 1877 3136 gene locus_tag LOCUS_13940 1877 3136 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence193 48 1580 gene locus_tag LOCUS_13950 48 1580 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249942.1 protein_id gnl|my_center|LOCUS_13950 1568 1837 gene locus_tag LOCUS_13960 1568 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 1834 2658 gene locus_tag LOCUS_13970 1834 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 >Feature sequence194 <1 1032 gene locus_tag LOCUS_13980 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000846383.1:DUF2779 domain-containing protein 2531 2337 gene locus_tag LOCUS_13990 2531 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence195 <1 1043 gene locus_tag LOCUS_14000 <1 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928424.1:alpha-mannosidase 1053 2627 gene locus_tag LOCUS_14010 1053 2627 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143441.1 protein_id gnl|my_center|LOCUS_14010 2629 2922 gene locus_tag LOCUS_14020 2629 2922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence196 1755 319 gene locus_tag LOCUS_14030 gene amrB 1755 319 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_14030 2708 1758 gene locus_tag LOCUS_14040 2708 1758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 2785 2997 gene locus_tag LOCUS_14050 2785 2997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence197 860 2206 gene locus_tag LOCUS_14060 gene glnA 860 2206 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393782.1 protein_id gnl|my_center|LOCUS_14060 2907 2203 gene locus_tag LOCUS_14070 2907 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence198 <1 624 gene locus_tag LOCUS_14080 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080731.1:penicillin-binding protein 621 2060 gene locus_tag LOCUS_14090 621 2060 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392357.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence199 1329 91 gene locus_tag LOCUS_14100 1329 91 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_14100 2234 1326 gene locus_tag LOCUS_14110 2234 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence200 1181 426 gene locus_tag LOCUS_14120 gene rsmA 1181 426 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814989.1 protein_id gnl|my_center|LOCUS_14120 2746 1178 gene locus_tag LOCUS_14130 2746 1178 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545033.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence201 <1 856 gene locus_tag LOCUS_14140 <1 856 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880700.1:sigma-54 dependent transcriptional regulator 890 2305 gene locus_tag LOCUS_14150 890 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence202 1003 320 gene locus_tag LOCUS_14160 1003 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 1669 1013 gene locus_tag LOCUS_14170 1669 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14170 2667 1663 gene locus_tag LOCUS_14180 gene hypE 2667 1663 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_14180 >Feature sequence203 <1 2447 gene locus_tag LOCUS_14190 <1 2447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082086.1:DNA polymerase I >Feature sequence204 2414 156 gene locus_tag LOCUS_14200 2414 156 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926008.1 protein_id gnl|my_center|LOCUS_14200 >Feature sequence205 149 634 gene locus_tag LOCUS_14210 149 634 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876257.1 protein_id gnl|my_center|LOCUS_14210 663 1409 gene locus_tag LOCUS_14220 663 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1399 1926 gene locus_tag LOCUS_14230 1399 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 1913 2797 gene locus_tag LOCUS_14240 1913 2797 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079210.1 protein_id gnl|my_center|LOCUS_14240 >Feature sequence206 721 128 gene locus_tag LOCUS_14250 721 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 778 1431 gene locus_tag LOCUS_14260 778 1431 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867624.1 protein_id gnl|my_center|LOCUS_14260 1431 1880 gene locus_tag LOCUS_14270 1431 1880 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544998.1 protein_id gnl|my_center|LOCUS_14270 1880 2647 gene locus_tag LOCUS_14280 1880 2647 CDS product Rossmann-like and DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391687.1 protein_id gnl|my_center|LOCUS_14280 >Feature sequence207 535 92 gene locus_tag LOCUS_14290 535 92 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868968.1 protein_id gnl|my_center|LOCUS_14290 776 1972 gene locus_tag LOCUS_14300 776 1972 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003119637.1 protein_id gnl|my_center|LOCUS_14300 >Feature sequence208 405 812 gene locus_tag LOCUS_14310 405 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 769 1476 gene locus_tag LOCUS_14320 769 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence209 <1 682 gene locus_tag LOCUS_14330 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584114.1:cobalt transporter CbiM 666 944 gene locus_tag LOCUS_14340 666 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14340 1064 1073 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1149 1472 gene locus_tag LOCUS_14350 1149 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1459 2226 gene locus_tag LOCUS_14360 1459 2226 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584111.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence210 2175 529 gene locus_tag LOCUS_14370 2175 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 <2796 2268 gene locus_tag LOCUS_14380 <2796 2268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011475776.1:HD domain-containing protein >Feature sequence211 99 2231 gene locus_tag LOCUS_14390 99 2231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 <2764 2221 gene locus_tag LOCUS_14400 <2764 2221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877131.1:DNA/RNA nuclease SfsA >Feature sequence212 2090 90 gene locus_tag LOCUS_14410 2090 90 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944022.1 protein_id gnl|my_center|LOCUS_14410 <2746 2066 gene locus_tag LOCUS_14420 <2746 2066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966498.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence213 2 400 gene locus_tag LOCUS_14430 2 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 397 1689 gene locus_tag LOCUS_14440 397 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 1689 2459 gene locus_tag LOCUS_14450 1689 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 2411 2420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence214 1277 135 gene locus_tag LOCUS_14460 1277 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 <2699 1351 gene locus_tag LOCUS_14470 <2699 1351 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107468.1:peptide MFS transporter >Feature sequence215 17 586 gene locus_tag LOCUS_14480 17 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 1259 603 gene locus_tag LOCUS_14490 1259 603 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392445.1 protein_id gnl|my_center|LOCUS_14490 1295 1304 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2141 1371 gene locus_tag LOCUS_14500 2141 1371 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020083.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence216 297 175 gene locus_tag LOCUS_14510 297 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 2402 474 gene locus_tag LOCUS_14520 2402 474 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878757.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence217 1134 55 gene locus_tag LOCUS_14530 1134 55 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458380.1 protein_id gnl|my_center|LOCUS_14530 2540 1260 gene locus_tag LOCUS_14540 gene eno 2540 1260 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880276.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence218 401 144 gene locus_tag LOCUS_14550 401 144 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947205.1 protein_id gnl|my_center|LOCUS_14550 478 552 gene locus_tag LOCUS_t00360 478 552 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 944 552 gene locus_tag LOCUS_14560 944 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2431 941 gene locus_tag LOCUS_14570 2431 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence219 178 1815 gene locus_tag LOCUS_14580 178 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 <2538 1805 gene locus_tag LOCUS_14590 <2538 1805 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943205.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence220 2064 211 gene locus_tag LOCUS_14600 gene feoB 2064 211 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545132.1 protein_id gnl|my_center|LOCUS_14600 2298 2068 gene locus_tag LOCUS_14610 2298 2068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence221 928 404 gene locus_tag LOCUS_14620 928 404 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870107.1 protein_id gnl|my_center|LOCUS_14620 975 1493 gene locus_tag LOCUS_14630 975 1493 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence222 21 431 gene locus_tag LOCUS_14640 21 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546344.1 protein_id gnl|my_center|LOCUS_14640 441 1325 gene locus_tag LOCUS_14650 441 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545127.1 protein_id gnl|my_center|LOCUS_14650 1470 1661 gene locus_tag LOCUS_14660 1470 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence223 700 209 gene locus_tag LOCUS_14670 700 209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence224 81 725 gene locus_tag LOCUS_14680 81 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 728 1285 gene locus_tag LOCUS_14690 gene rfbC 728 1285 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_14690 2354 1275 gene locus_tag LOCUS_14700 2354 1275 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880856.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence225 <2392 853 gene locus_tag LOCUS_14710 <2392 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963828.1:penicillin-binding protein 2 >Feature sequence226 517 116 gene locus_tag LOCUS_14720 517 116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1622 576 gene locus_tag LOCUS_14730 1622 576 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_14730 <2384 1600 gene locus_tag LOCUS_14740 <2384 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812203.1:nickel pincer cofactor biosynthesis protein LarB >Feature sequence227 576 1442 gene locus_tag LOCUS_14750 gene mtnP 576 1442 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941773.1 protein_id gnl|my_center|LOCUS_14750 1439 2326 gene locus_tag LOCUS_14760 1439 2326 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932656.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence228 2363 423 gene locus_tag LOCUS_14770 gene purL 2363 423 CDS product phosphoribosylformylglycinamidine synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055546.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence229 725 734 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1245 775 gene locus_tag LOCUS_14780 1245 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence230 <1 623 gene locus_tag LOCUS_14790 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082346.1:CRISPR-associated helicase/endonuclease Cas3 620 1111 gene locus_tag LOCUS_14800 gene cas4 620 1111 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582993.1 protein_id gnl|my_center|LOCUS_14800 1182 2180 gene locus_tag LOCUS_14810 gene cas1b 1182 2180 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_14810 >Feature sequence231 1482 247 gene locus_tag LOCUS_14820 1482 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 <2314 1479 gene locus_tag LOCUS_14830 <2314 1479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037226281.1:glycosyltransferase family 4 protein >Feature sequence232 <1 531 gene locus_tag LOCUS_14840 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880325.1:DNA repair protein RadA 528 1478 gene locus_tag LOCUS_14850 528 1478 CDS product PIN domain nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048364.1 protein_id gnl|my_center|LOCUS_14850 2171 1479 gene locus_tag LOCUS_14860 2171 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 >Feature sequence233 >Feature sequence234 159 836 gene locus_tag LOCUS_14870 159 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 905 1267 gene locus_tag LOCUS_14880 905 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14880 1327 1725 gene locus_tag LOCUS_14890 1327 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14890 >Feature sequence235 <1 772 gene locus_tag LOCUS_14900 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001080230.1:GTPase Era 783 1097 gene locus_tag LOCUS_14910 gene cutA 783 1097 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545706.1 protein_id gnl|my_center|LOCUS_14910 2074 1094 gene locus_tag LOCUS_14920 gene corA 2074 1094 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence236 1825 29 gene locus_tag LOCUS_14930 gene lepA 1825 29 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392118.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence237 <2230 215 gene locus_tag LOCUS_14940 <2230 215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393846.1:efflux RND transporter permease subunit >Feature sequence238 <1 766 gene locus_tag LOCUS_14950 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080592.1:GGDEF domain-containing protein 787 2061 gene locus_tag LOCUS_14960 787 2061 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546843.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence239 1981 1595 gene locus_tag LOCUS_14970 1981 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 >Feature sequence240 548 1717 gene locus_tag LOCUS_14980 548 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence241 <2196 169 gene locus_tag LOCUS_14990 <2196 169 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925700.1:S9 family peptidase >Feature sequence242 >Feature sequence243 1958 423 gene locus_tag LOCUS_15000 gene nagZ 1958 423 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963506.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence244 175 1539 gene locus_tag LOCUS_15010 175 1539 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546604.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence245 354 1574 gene locus_tag LOCUS_15020 354 1574 CDS product DUF4143 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545533.1 protein_id gnl|my_center|LOCUS_15020 1812 1606 gene locus_tag LOCUS_15030 1812 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 2018 1809 gene locus_tag LOCUS_15040 2018 1809 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878572.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence246 >Feature sequence247 401 1210 gene locus_tag LOCUS_15050 gene lpxC 401 1210 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859351.1 protein_id gnl|my_center|LOCUS_15050 1289 1756 gene locus_tag LOCUS_15060 1289 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence248 1596 730 gene locus_tag LOCUS_15070 1596 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 >Feature sequence249 1836 694 gene locus_tag LOCUS_15080 1836 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023363.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence250 >Feature sequence251 794 156 gene locus_tag LOCUS_15090 794 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 905 1288 gene locus_tag LOCUS_15100 905 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 >Feature sequence252 <1 553 gene locus_tag LOCUS_15110 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053840.1:Na(+)/H(+) antiporter subunit B 553 903 gene locus_tag LOCUS_15120 553 903 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence253 401 1507 gene locus_tag LOCUS_15130 401 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence254 <1 865 gene locus_tag LOCUS_15140 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930680.1:reverse gyrase <2062 859 gene locus_tag LOCUS_15150 <2062 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765769.1:polysaccharide lyase >Feature sequence255 450 1370 gene locus_tag LOCUS_15160 450 1370 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080275.1 protein_id gnl|my_center|LOCUS_15160 <2050 1353 gene locus_tag LOCUS_15170 <2050 1353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250519.1:sodium/proline symporter >Feature sequence256 <1998 636 gene locus_tag LOCUS_15180 <1998 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_055229518.1:S9 family peptidase >Feature sequence257 337 990 gene locus_tag LOCUS_15190 gene tsaB 337 990 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262633.1 protein_id gnl|my_center|LOCUS_15190 1011 1403 gene locus_tag LOCUS_15200 gene rimI 1011 1403 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966125.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence258 209 460 gene locus_tag LOCUS_15210 gene rpmA 209 460 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002656482.1 protein_id gnl|my_center|LOCUS_15210 465 1460 gene locus_tag LOCUS_15220 gene obgE 465 1460 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881354.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence259 1728 31 gene locus_tag LOCUS_15230 1728 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1943 1725 gene locus_tag LOCUS_15240 1943 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 >Feature sequence260 157 1188 gene locus_tag LOCUS_15250 157 1188 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388502.1 protein_id gnl|my_center|LOCUS_15250 >Feature sequence261 1799 615 gene locus_tag LOCUS_15260 1799 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 >Feature sequence262 1188 109 gene locus_tag LOCUS_15270 1188 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence263 <1932 519 gene locus_tag LOCUS_15280 <1932 519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011837125.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence264 >Feature sequence265 146 364 gene locus_tag LOCUS_15290 146 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 364 1572 gene locus_tag LOCUS_15300 364 1572 CDS product cell wall biogenesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008659403.1 protein_id gnl|my_center|LOCUS_15300 >Feature sequence266 >Feature sequence267 <1 895 gene locus_tag LOCUS_15310 <1 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095211.1:molecular chaperone DnaJ 892 1275 gene locus_tag LOCUS_15320 892 1275 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence268 989 237 gene locus_tag LOCUS_15330 989 237 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869232.1 protein_id gnl|my_center|LOCUS_15330 <1858 1047 gene locus_tag LOCUS_15340 <1858 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141615.1:ribonuclease R >Feature sequence269 >Feature sequence270 1109 1118 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence271 717 73 gene locus_tag LOCUS_15350 gene fsa 717 73 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880018.1 protein_id gnl|my_center|LOCUS_15350 1480 701 gene locus_tag LOCUS_15360 1480 701 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172903.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence272 <1 595 gene locus_tag LOCUS_15370 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041271909.1:4Fe-4S binding protein >Feature sequence273 <1 727 gene locus_tag LOCUS_15380 <1 727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002680921.1:M20 family metallo-hydrolase 1396 728 gene locus_tag LOCUS_15390 1396 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1591 1509 gene locus_tag LOCUS_t00370 1591 1509 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence274 745 86 gene locus_tag LOCUS_15400 745 86 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071541103.1 protein_id gnl|my_center|LOCUS_15400 1073 1336 gene locus_tag LOCUS_15410 1073 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 >Feature sequence275 1251 718 gene locus_tag LOCUS_15420 gene hslV 1251 718 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence276 282 356 gene locus_tag LOCUS_t00380 282 356 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 406 636 gene locus_tag LOCUS_15430 gene secE 406 636 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_15430 643 1182 gene locus_tag LOCUS_15440 gene nusG 643 1182 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546677.1 protein_id gnl|my_center|LOCUS_15440 1195 1647 gene locus_tag LOCUS_15450 gene rplK 1195 1647 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393949.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence277 90 671 gene locus_tag LOCUS_15460 90 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15460 616 1398 gene locus_tag LOCUS_15470 616 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1400 1741 gene locus_tag LOCUS_15480 1400 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence278 1605 19 gene locus_tag LOCUS_15490 1605 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence279 <1781 145 gene locus_tag LOCUS_15500 <1781 145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809743.1:formate--tetrahydrofolate ligase >Feature sequence280 1499 162 gene locus_tag LOCUS_15510 gene accC 1499 162 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546633.1 protein_id gnl|my_center|LOCUS_15510 >Feature sequence281 >Feature sequence282 >Feature sequence283 >Feature sequence284 >Feature sequence285 398 1324 gene locus_tag LOCUS_15520 398 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence286 219 611 gene locus_tag LOCUS_15530 219 611 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172543.1 protein_id gnl|my_center|LOCUS_15530 615 1055 gene locus_tag LOCUS_15540 615 1055 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583632.1 protein_id gnl|my_center|LOCUS_15540 1030 1452 gene locus_tag LOCUS_15550 1030 1452 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence287 <1 1234 gene locus_tag LOCUS_15560 <1 1234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041443404.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence288 309 1508 gene locus_tag LOCUS_15570 309 1508 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence289 820 521 gene locus_tag LOCUS_15580 820 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 <1517 817 gene locus_tag LOCUS_15590 <1517 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403544.1:S41 family peptidase >Feature sequence290 1022 660 gene locus_tag LOCUS_15600 1022 660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600