>Feature sequence001 464 1516 gene locus_tag LOCUS_00010 gene recA 464 1516 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_00010 1517 2623 gene locus_tag LOCUS_00020 1517 2623 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_00020 2616 5288 gene locus_tag LOCUS_00030 gene alaS 2616 5288 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940824.1 protein_id gnl|my_center|LOCUS_00030 5505 6458 gene locus_tag LOCUS_00040 5505 6458 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_00040 6461 7105 gene locus_tag LOCUS_00050 6461 7105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024249.1 protein_id gnl|my_center|LOCUS_00050 7108 8451 gene locus_tag LOCUS_00060 7108 8451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 8462 9694 gene locus_tag LOCUS_00070 8462 9694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 9706 10170 gene locus_tag LOCUS_00080 9706 10170 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024252.1 protein_id gnl|my_center|LOCUS_00080 10414 12276 gene locus_tag LOCUS_00090 gene hyfB 10414 12276 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_00090 >Feature sequence002 <1 1768 gene locus_tag LOCUS_00100 <1 1768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391657.1:formate--tetrahydrofolate ligase 1873 3888 gene locus_tag LOCUS_00110 gene acsV 1873 3888 CDS product corrinoid activation/regeneration protein AcsV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436926.1 protein_id gnl|my_center|LOCUS_00110 3915 4670 gene locus_tag LOCUS_00120 3915 4670 CDS product carbon monoxide dehydrogenase accessory protein CooC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418348.1 protein_id gnl|my_center|LOCUS_00120 4690 5631 gene locus_tag LOCUS_00130 gene cdhD 4690 5631 CDS product CO dehydrogenase/acetyl-CoA synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392712.1 protein_id gnl|my_center|LOCUS_00130 5680 7899 gene locus_tag LOCUS_00140 gene acsB 5680 7899 CDS product acetyl-CoA decarbonylase/synthase complex subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392716.1 protein_id gnl|my_center|LOCUS_00140 7960 9309 gene locus_tag LOCUS_00150 gene acsC 7960 9309 CDS product acetyl-CoA decarbonylase/synthase complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545537.1 protein_id gnl|my_center|LOCUS_00150 9328 10320 gene locus_tag LOCUS_00160 9328 10320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 10472 10954 gene locus_tag LOCUS_00170 10472 10954 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_00170 10951 11508 gene locus_tag LOCUS_00180 10951 11508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 >Feature sequence003 867 1511 gene locus_tag LOCUS_00190 867 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 1617 3461 gene locus_tag LOCUS_00200 1617 3461 CDS product PEP-utilizing enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013724.1 protein_id gnl|my_center|LOCUS_00200 3480 4550 gene locus_tag LOCUS_00210 3480 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 4630 6069 gene locus_tag LOCUS_00220 4630 6069 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977989.1 protein_id gnl|my_center|LOCUS_00220 6056 6433 gene locus_tag LOCUS_00230 6056 6433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020757.1 protein_id gnl|my_center|LOCUS_00230 6490 7056 gene locus_tag LOCUS_00240 6490 7056 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098133.1 protein_id gnl|my_center|LOCUS_00240 7129 8103 gene locus_tag LOCUS_00250 7129 8103 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206215.1 protein_id gnl|my_center|LOCUS_00250 8476 10128 gene locus_tag LOCUS_00260 8476 10128 CDS product (2,3-dihydroxybenzoyl)adenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000960113.1 protein_id gnl|my_center|LOCUS_00260 >Feature sequence004 331 92 gene locus_tag LOCUS_00270 331 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 213 641 gene locus_tag LOCUS_00280 213 641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 893 1039 gene locus_tag LOCUS_00290 893 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 1345 1767 gene locus_tag LOCUS_00300 1345 1767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 1768 2469 gene locus_tag LOCUS_00310 1768 2469 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405201.1 protein_id gnl|my_center|LOCUS_00310 2487 2645 gene locus_tag LOCUS_00320 2487 2645 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_092374840.1 protein_id gnl|my_center|LOCUS_00320 2723 2959 gene locus_tag LOCUS_00330 2723 2959 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023834.1 protein_id gnl|my_center|LOCUS_00330 4097 4912 gene locus_tag LOCUS_00340 4097 4912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 4870 6249 gene locus_tag LOCUS_00350 4870 6249 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546691.1 protein_id gnl|my_center|LOCUS_00350 6943 7899 gene locus_tag LOCUS_00360 6943 7899 CDS product GSU2203 family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942843.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence005 2323 8 gene locus_tag LOCUS_00370 2323 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 4170 2326 gene locus_tag LOCUS_00380 4170 2326 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040066179.1 protein_id gnl|my_center|LOCUS_00380 5673 4468 gene locus_tag LOCUS_00390 5673 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 7731 5674 gene locus_tag LOCUS_00400 7731 5674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 8878 7724 gene locus_tag LOCUS_00410 8878 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 >Feature sequence006 1968 1666 gene locus_tag LOCUS_00420 gene nuoK 1968 1666 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003081840.1 protein_id gnl|my_center|LOCUS_00420 2510 1980 gene locus_tag LOCUS_00430 2510 1980 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_00430 3000 2521 gene locus_tag LOCUS_00440 gene nuoI 3000 2521 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017376.1 protein_id gnl|my_center|LOCUS_00440 4005 3016 gene locus_tag LOCUS_00450 gene nuoH 4005 3016 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941013.1 protein_id gnl|my_center|LOCUS_00450 6700 4016 gene locus_tag LOCUS_00460 gene fdhF 6700 4016 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080510933.1 transl_except (pos:complement(5648..5650),aa:Sec) note codon on position 351 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_00460 8666 6726 gene locus_tag LOCUS_00470 8666 6726 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088555170.1 protein_id gnl|my_center|LOCUS_00470 <9223 8696 gene locus_tag LOCUS_00480 <9223 8696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941009.1:NADH dehydrogenase (quinone) subunit D >Feature sequence007 1687 2637 gene locus_tag LOCUS_00490 1687 2637 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948817.1 protein_id gnl|my_center|LOCUS_00490 2687 3496 gene locus_tag LOCUS_00500 2687 3496 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_00500 3516 4385 gene locus_tag LOCUS_00510 3516 4385 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965995.1 protein_id gnl|my_center|LOCUS_00510 4402 5991 gene locus_tag LOCUS_00520 4402 5991 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_00520 6082 7830 gene locus_tag LOCUS_00530 gene iorA 6082 7830 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942384.1 protein_id gnl|my_center|LOCUS_00530 7979 8560 gene locus_tag LOCUS_00540 7979 8560 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942383.1 protein_id gnl|my_center|LOCUS_00540 >Feature sequence008 675 193 gene locus_tag LOCUS_00550 gene rpsE 675 193 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943469.1 protein_id gnl|my_center|LOCUS_00550 1058 690 gene locus_tag LOCUS_00560 gene rplR 1058 690 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081803.1 protein_id gnl|my_center|LOCUS_00560 1606 1070 gene locus_tag LOCUS_00570 gene rplF 1606 1070 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583360.1 protein_id gnl|my_center|LOCUS_00570 2016 1621 gene locus_tag LOCUS_00580 gene rpsH 2016 1621 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943472.1 protein_id gnl|my_center|LOCUS_00580 2212 2027 gene locus_tag LOCUS_00590 2212 2027 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002153498.1 protein_id gnl|my_center|LOCUS_00590 2764 2225 gene locus_tag LOCUS_00600 gene rplE 2764 2225 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_00600 3102 2788 gene locus_tag LOCUS_00610 gene rplX 3102 2788 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357467.1 protein_id gnl|my_center|LOCUS_00610 3481 3113 gene locus_tag LOCUS_00620 gene rplN 3481 3113 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_00620 3766 3497 gene locus_tag LOCUS_00630 gene rpsQ 3766 3497 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938607.1 protein_id gnl|my_center|LOCUS_00630 3966 3769 gene locus_tag LOCUS_00640 gene rpmC 3966 3769 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003495193.1 protein_id gnl|my_center|LOCUS_00640 4378 3968 gene locus_tag LOCUS_00650 gene rplP 4378 3968 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943479.1 protein_id gnl|my_center|LOCUS_00650 5041 4391 gene locus_tag LOCUS_00660 gene rpsC 5041 4391 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943480.1 protein_id gnl|my_center|LOCUS_00660 5388 5056 gene locus_tag LOCUS_00670 gene rplV 5388 5056 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148024.1 protein_id gnl|my_center|LOCUS_00670 5673 5398 gene locus_tag LOCUS_00680 gene rpsS 5673 5398 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_00680 6497 5676 gene locus_tag LOCUS_00690 gene rplB 6497 5676 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_00690 6795 6508 gene locus_tag LOCUS_00700 6795 6508 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_00700 7422 6805 gene locus_tag LOCUS_00710 gene rplD 7422 6805 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943485.1 protein_id gnl|my_center|LOCUS_00710 8058 7441 gene locus_tag LOCUS_00720 gene rplC 8058 7441 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943486.1 protein_id gnl|my_center|LOCUS_00720 8391 8083 gene locus_tag LOCUS_00730 gene rpsJ 8391 8083 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004563872.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence009 171 974 gene locus_tag LOCUS_00740 171 974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807268.1 protein_id gnl|my_center|LOCUS_00740 1001 2980 gene locus_tag LOCUS_00750 1001 2980 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_00750 2983 3867 gene locus_tag LOCUS_00760 2983 3867 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391255.1 protein_id gnl|my_center|LOCUS_00760 3929 4981 gene locus_tag LOCUS_00770 3929 4981 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391254.1 protein_id gnl|my_center|LOCUS_00770 5116 6312 gene locus_tag LOCUS_00780 5116 6312 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_00780 6414 7250 gene locus_tag LOCUS_00790 6414 7250 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256968.1 protein_id gnl|my_center|LOCUS_00790 7281 8552 gene locus_tag LOCUS_00800 7281 8552 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940511.1 protein_id gnl|my_center|LOCUS_00800 >Feature sequence010 1435 1118 gene locus_tag LOCUS_00810 1435 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 1832 1389 gene locus_tag LOCUS_00820 1832 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 2817 1984 gene locus_tag LOCUS_00830 2817 1984 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941065.1 protein_id gnl|my_center|LOCUS_00830 3871 3107 gene locus_tag LOCUS_00840 3871 3107 CDS product 3-hydroxybutyrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037396047.1 protein_id gnl|my_center|LOCUS_00840 4048 5187 gene locus_tag LOCUS_00850 4048 5187 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_00850 5205 6797 gene locus_tag LOCUS_00860 gene serA 5205 6797 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546680.1 protein_id gnl|my_center|LOCUS_00860 6866 8149 gene locus_tag LOCUS_00870 6866 8149 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943920.1 protein_id gnl|my_center|LOCUS_00870 >Feature sequence011 71 265 gene locus_tag LOCUS_00880 gene rpmB 71 265 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_00880 769 284 gene locus_tag LOCUS_00890 769 284 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582732.1 protein_id gnl|my_center|LOCUS_00890 1336 770 gene locus_tag LOCUS_00900 1336 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 1448 1359 gene locus_tag LOCUS_t00010 1448 1359 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2191 1430 gene locus_tag LOCUS_00910 2191 1430 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889670.1 protein_id gnl|my_center|LOCUS_00910 2595 2182 gene locus_tag LOCUS_00920 gene ybgC 2595 2182 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338403.1 protein_id gnl|my_center|LOCUS_00920 3911 2631 gene locus_tag LOCUS_00930 gene eno 3911 2631 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228333.1 protein_id gnl|my_center|LOCUS_00930 4078 3947 gene locus_tag LOCUS_00940 4078 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 4289 4071 gene locus_tag LOCUS_00950 4289 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00950 4523 4311 gene locus_tag LOCUS_00960 4523 4311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 5768 4536 gene locus_tag LOCUS_00970 gene glgC 5768 4536 CDS product glucose-1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001154339.1 protein_id gnl|my_center|LOCUS_00970 7195 5771 gene locus_tag LOCUS_00980 7195 5771 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546530.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence012 1606 1151 gene locus_tag LOCUS_00990 1606 1151 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815410.1 protein_id gnl|my_center|LOCUS_00990 2874 1606 gene locus_tag LOCUS_01000 2874 1606 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583175.1 protein_id gnl|my_center|LOCUS_01000 3323 2889 gene locus_tag LOCUS_01010 gene rpiB 3323 2889 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_01010 4567 3320 gene locus_tag LOCUS_01020 gene fabF 4567 3320 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_01020 4819 4580 gene locus_tag LOCUS_01030 gene acpP 4819 4580 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771263.1 protein_id gnl|my_center|LOCUS_01030 6885 4981 gene locus_tag LOCUS_01040 6885 4981 CDS product propionyl-CoA synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388801.1 protein_id gnl|my_center|LOCUS_01040 7046 7198 gene locus_tag LOCUS_01050 7046 7198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 >Feature sequence013 2453 1317 gene locus_tag LOCUS_01060 2453 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 3578 2484 gene locus_tag LOCUS_01070 3578 2484 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762093.1 protein_id gnl|my_center|LOCUS_01070 4379 3609 gene locus_tag LOCUS_01080 4379 3609 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_01080 4448 4642 gene locus_tag LOCUS_01090 4448 4642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 5549 4803 gene locus_tag LOCUS_01100 gene fabG 5549 4803 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966837.1 protein_id gnl|my_center|LOCUS_01100 6767 5574 gene locus_tag LOCUS_01110 6767 5574 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888868.1 protein_id gnl|my_center|LOCUS_01110 <7578 6992 gene locus_tag LOCUS_01120 <7578 6992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011085402.1:acyl-CoA dehydrogenase family protein >Feature sequence014 <1 1491 gene locus_tag LOCUS_01130 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462072.1:(Fe-S)-binding protein 1506 2186 gene locus_tag LOCUS_01140 1506 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 2189 3364 gene locus_tag LOCUS_01150 2189 3364 CDS product CaiB/BaiF CoA-transferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813988.1 protein_id gnl|my_center|LOCUS_01150 3365 3778 gene locus_tag LOCUS_01160 3365 3778 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878176.1 protein_id gnl|my_center|LOCUS_01160 4003 5184 gene locus_tag LOCUS_01170 4003 5184 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459196.1 protein_id gnl|my_center|LOCUS_01170 5307 6584 gene locus_tag LOCUS_01180 5307 6584 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878693.1 protein_id gnl|my_center|LOCUS_01180 6811 7422 gene locus_tag LOCUS_01190 6811 7422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 >Feature sequence015 2007 895 gene locus_tag LOCUS_01200 2007 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 2942 2010 gene locus_tag LOCUS_01210 2942 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 3119 2955 gene locus_tag LOCUS_01220 3119 2955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 4045 3131 gene locus_tag LOCUS_01230 4045 3131 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944005.1 protein_id gnl|my_center|LOCUS_01230 5701 4589 gene locus_tag LOCUS_01240 5701 4589 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_01240 5932 5723 gene locus_tag LOCUS_01250 gene rpoZ 5932 5723 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942877.1 protein_id gnl|my_center|LOCUS_01250 6579 5947 gene locus_tag LOCUS_01260 gene gmk 6579 5947 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771415.1 protein_id gnl|my_center|LOCUS_01260 <7401 6579 gene locus_tag LOCUS_01270 <7401 6579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416240.1:YicC family protein >Feature sequence016 2516 1179 gene locus_tag LOCUS_01280 2516 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 3946 2516 gene locus_tag LOCUS_01290 3946 2516 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_01290 5797 3947 gene locus_tag LOCUS_01300 gene nuoL 5797 3947 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_01300 6098 5790 gene locus_tag LOCUS_01310 6098 5790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 6565 6101 gene locus_tag LOCUS_01320 6565 6101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 7113 6562 gene locus_tag LOCUS_01330 7113 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 >Feature sequence017 448 65 gene locus_tag LOCUS_01340 448 65 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940441.1 protein_id gnl|my_center|LOCUS_01340 1171 467 gene locus_tag LOCUS_01350 gene prxU 1171 467 CDS product selenocysteine-containing peroxiredoxin PrxU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:UniprotKB:Q9L3Q5 transl_except (pos:complement(929..931),aa:Sec) note codon on position 81 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_01350 2290 1262 gene locus_tag LOCUS_01360 gene cydB 2290 1262 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_01360 3614 2310 gene locus_tag LOCUS_01370 3614 2310 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940529.1 protein_id gnl|my_center|LOCUS_01370 4058 3642 gene locus_tag LOCUS_01380 4058 3642 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393584.1 protein_id gnl|my_center|LOCUS_01380 4189 5832 gene locus_tag LOCUS_01390 4189 5832 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939515.1 protein_id gnl|my_center|LOCUS_01390 5825 6256 gene locus_tag LOCUS_01400 5825 6256 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546500.1 protein_id gnl|my_center|LOCUS_01400 6256 7302 gene locus_tag LOCUS_01410 gene ispG 6256 7302 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861462.1 protein_id gnl|my_center|LOCUS_01410 >Feature sequence018 832 1911 gene locus_tag LOCUS_01420 832 1911 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546440.1 protein_id gnl|my_center|LOCUS_01420 1908 5024 gene locus_tag LOCUS_01430 1908 5024 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937372.1 protein_id gnl|my_center|LOCUS_01430 5021 6388 gene locus_tag LOCUS_01440 gene cusC 5021 6388 CDS product Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000074237.1 protein_id gnl|my_center|LOCUS_01440 >Feature sequence019 140 1294 gene locus_tag LOCUS_01450 140 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 1536 2027 gene locus_tag LOCUS_01460 1536 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 2024 2764 gene locus_tag LOCUS_01470 2024 2764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 3023 3508 gene locus_tag LOCUS_01480 3023 3508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 3510 5894 gene locus_tag LOCUS_01490 3510 5894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 5896 6573 gene locus_tag LOCUS_01500 5896 6573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 >Feature sequence020 166 609 gene locus_tag LOCUS_01510 gene dut 166 609 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_01510 672 748 gene locus_tag LOCUS_t00020 672 748 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 843 1409 gene locus_tag LOCUS_01520 843 1409 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942957.1 protein_id gnl|my_center|LOCUS_01520 2594 1443 gene locus_tag LOCUS_01530 2594 1443 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903462.1 protein_id gnl|my_center|LOCUS_01530 3716 2739 gene locus_tag LOCUS_01540 3716 2739 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816053.1 protein_id gnl|my_center|LOCUS_01540 4529 3747 gene locus_tag LOCUS_01550 4529 3747 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_01550 5704 4559 gene locus_tag LOCUS_01560 5704 4559 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418888.1 protein_id gnl|my_center|LOCUS_01560 6580 5729 gene locus_tag LOCUS_01570 6580 5729 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000538874.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence021 1289 516 gene locus_tag LOCUS_01580 1289 516 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_01580 5426 1311 gene locus_tag LOCUS_01590 gene rpoC 5426 1311 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943492.1 protein_id gnl|my_center|LOCUS_01590 <6616 5457 gene locus_tag LOCUS_01600 <6616 5457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943493.1:DNA-directed RNA polymerase subunit beta >Feature sequence022 74 3091 gene locus_tag LOCUS_01610 74 3091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3222 5030 gene locus_tag LOCUS_01620 gene typA 3222 5030 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_01620 >Feature sequence023 <1 2230 gene locus_tag LOCUS_01630 <1 2230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000252094.1:DUF1566 domain-containing protein 3675 2263 gene locus_tag LOCUS_01640 gene glnA 3675 2263 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_01640 4051 3707 gene locus_tag LOCUS_01650 4051 3707 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_01650 4261 5754 gene locus_tag LOCUS_01660 4261 5754 CDS product sigma-54-dependent Fis family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933195.1 protein_id gnl|my_center|LOCUS_01660 <6405 5751 gene locus_tag LOCUS_01670 <6405 5751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211328137.1:ABC transporter permease >Feature sequence024 2278 449 gene locus_tag LOCUS_01680 2278 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 3768 2527 gene locus_tag LOCUS_01690 3768 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 4412 3786 gene locus_tag LOCUS_01700 4412 3786 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811656.1 protein_id gnl|my_center|LOCUS_01700 5465 4551 gene locus_tag LOCUS_01710 5465 4551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 <6270 5469 gene locus_tag LOCUS_01720 <6270 5469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943710.1:RNA polymerase sigma factor RpoD >Feature sequence025 850 272 gene locus_tag LOCUS_01730 850 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 1074 847 gene locus_tag LOCUS_01740 1074 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 1211 1387 gene locus_tag LOCUS_01750 1211 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 2252 1362 gene locus_tag LOCUS_01760 2252 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 3417 2242 gene locus_tag LOCUS_01770 3417 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 3702 3475 gene locus_tag LOCUS_01780 3702 3475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 4278 4463 gene locus_tag LOCUS_01790 4278 4463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 4703 5593 gene locus_tag LOCUS_01800 4703 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence026 1245 256 gene locus_tag LOCUS_01810 gene hypE 1245 256 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964127.1 protein_id gnl|my_center|LOCUS_01810 1588 1238 gene locus_tag LOCUS_01820 1588 1238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 2054 1581 gene locus_tag LOCUS_01830 2054 1581 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842874.1 protein_id gnl|my_center|LOCUS_01830 3802 2108 gene locus_tag LOCUS_01840 3802 2108 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940798.1 protein_id gnl|my_center|LOCUS_01840 4685 3837 gene locus_tag LOCUS_01850 gene nrfD 4685 3837 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544981.1 protein_id gnl|my_center|LOCUS_01850 5562 4678 gene locus_tag LOCUS_01860 gene fdxH 5562 4678 CDS product formate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705521.1 protein_id gnl|my_center|LOCUS_01860 <6163 5575 gene locus_tag LOCUS_01870 <6163 5575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545343.1:hydrogenase small subunit >Feature sequence027 413 1279 gene locus_tag LOCUS_01880 413 1279 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002078886.1 protein_id gnl|my_center|LOCUS_01880 1257 1331 gene locus_tag LOCUS_t00030 1257 1331 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1754 1383 gene locus_tag LOCUS_01890 1754 1383 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546203.1 protein_id gnl|my_center|LOCUS_01890 3427 1754 gene locus_tag LOCUS_01900 3427 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01900 4037 5071 gene locus_tag LOCUS_01910 4037 5071 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence028 <1 738 gene locus_tag LOCUS_01920 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496444.1:pyruvate synthase subunit PorB 752 1198 gene locus_tag LOCUS_01930 gene nuoE 752 1198 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011343661.1 protein_id gnl|my_center|LOCUS_01930 1217 3067 gene locus_tag LOCUS_01940 gene nuoF 1217 3067 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817338.1 protein_id gnl|my_center|LOCUS_01940 3080 3778 gene locus_tag LOCUS_01950 3080 3778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 3904 4647 gene locus_tag LOCUS_01960 3904 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 4649 5329 gene locus_tag LOCUS_01970 4649 5329 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459260.1 protein_id gnl|my_center|LOCUS_01970 <6090 5515 gene locus_tag LOCUS_01980 <6090 5515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119216.1:integron integrase >Feature sequence029 <1 1126 gene locus_tag LOCUS_01990 <1 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940703.1:Tol-Pal system beta propeller repeat protein TolB 1113 1529 gene locus_tag LOCUS_02000 gene tsaE 1113 1529 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784762.1 protein_id gnl|my_center|LOCUS_02000 1542 2771 gene locus_tag LOCUS_02010 1542 2771 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942444.1 protein_id gnl|my_center|LOCUS_02010 2775 4370 gene locus_tag LOCUS_02020 gene cimA 2775 4370 CDS product citramalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942443.1 protein_id gnl|my_center|LOCUS_02020 4384 5328 gene locus_tag LOCUS_02030 gene mdh 4384 5328 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_02030 5869 5357 gene locus_tag LOCUS_02040 5869 5357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 >Feature sequence030 402 115 gene locus_tag LOCUS_02050 402 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 486 767 gene locus_tag LOCUS_02060 486 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02060 1069 1836 gene locus_tag LOCUS_02070 1069 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 2099 3691 gene locus_tag LOCUS_02080 2099 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 3691 5436 gene locus_tag LOCUS_02090 3691 5436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 >Feature sequence031 1834 476 gene locus_tag LOCUS_02100 gene ffh 1834 476 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941303.1 protein_id gnl|my_center|LOCUS_02100 2415 1843 gene locus_tag LOCUS_02110 2415 1843 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868100.1 protein_id gnl|my_center|LOCUS_02110 3777 2428 gene locus_tag LOCUS_02120 gene cdr 3777 2428 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068576671.1 protein_id gnl|my_center|LOCUS_02120 4915 3788 gene locus_tag LOCUS_02130 4915 3788 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_02130 5198 5440 gene locus_tag LOCUS_02140 5198 5440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 5433 5786 gene locus_tag LOCUS_02150 gene mazF9 5433 5786 CDS product type II toxin-antitoxin system toxin endoribonuclease MazF9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003414166.1 protein_id gnl|my_center|LOCUS_02150 >Feature sequence032 693 22 gene locus_tag LOCUS_02160 693 22 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 1577 990 gene locus_tag LOCUS_02170 1577 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 1941 1567 gene locus_tag LOCUS_02180 1941 1567 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867519.1 protein_id gnl|my_center|LOCUS_02180 2125 1919 gene locus_tag LOCUS_02190 2125 1919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 4267 2402 gene locus_tag LOCUS_02200 4267 2402 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391701.1 protein_id gnl|my_center|LOCUS_02200 4765 4319 gene locus_tag LOCUS_02210 4765 4319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 <5771 4758 gene locus_tag LOCUS_02220 <5771 4758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393752.1:Tm-1-like ATP-binding domain-containing protein >Feature sequence033 <1 903 gene locus_tag LOCUS_02230 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933671.1:mechanosensitive ion channel 2159 936 gene locus_tag LOCUS_02240 2159 936 CDS product iron-sulfur cluster carrier protein MrpORP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294665.1 protein_id gnl|my_center|LOCUS_02240 2600 2238 gene locus_tag LOCUS_02250 2600 2238 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939385.1 protein_id gnl|my_center|LOCUS_02250 3472 2597 gene locus_tag LOCUS_02260 3472 2597 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939380.1 protein_id gnl|my_center|LOCUS_02260 4334 3465 gene locus_tag LOCUS_02270 4334 3465 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392922.1 protein_id gnl|my_center|LOCUS_02270 4676 4395 gene locus_tag LOCUS_02280 4676 4395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 4926 4711 gene locus_tag LOCUS_02290 4926 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 5294 4845 gene locus_tag LOCUS_02300 5294 4845 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_02300 >Feature sequence034 <1 1562 gene locus_tag LOCUS_02310 <1 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003401468.1:excinuclease ABC subunit UvrA 1604 4381 gene locus_tag LOCUS_02320 1604 4381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 4500 5708 gene locus_tag LOCUS_02330 4500 5708 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence035 614 75 gene locus_tag LOCUS_02340 614 75 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940603.1 protein_id gnl|my_center|LOCUS_02340 1387 635 gene locus_tag LOCUS_02350 1387 635 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942505.1 protein_id gnl|my_center|LOCUS_02350 2448 1399 gene locus_tag LOCUS_02360 2448 1399 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942506.1 protein_id gnl|my_center|LOCUS_02360 2664 2461 gene locus_tag LOCUS_02370 2664 2461 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869340.1 protein_id gnl|my_center|LOCUS_02370 4525 2657 gene locus_tag LOCUS_02380 gene dxs 4525 2657 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_02380 5421 4525 gene locus_tag LOCUS_02390 5421 4525 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545645.1 protein_id gnl|my_center|LOCUS_02390 5608 5414 gene locus_tag LOCUS_02400 5608 5414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 >Feature sequence036 4374 2353 gene locus_tag LOCUS_02410 4374 2353 CDS product adenylate/guanylate cyclase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924872.1 protein_id gnl|my_center|LOCUS_02410 4678 5274 gene locus_tag LOCUS_02420 4678 5274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence037 1217 381 gene locus_tag LOCUS_02430 gene speB 1217 381 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009888724.1 protein_id gnl|my_center|LOCUS_02430 2056 1214 gene locus_tag LOCUS_02440 gene speE 2056 1214 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808145.1 protein_id gnl|my_center|LOCUS_02440 2533 2066 gene locus_tag LOCUS_02450 2533 2066 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869814.1 protein_id gnl|my_center|LOCUS_02450 3017 2571 gene locus_tag LOCUS_02460 gene speD 3017 2571 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081137.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence038 401 96 gene locus_tag LOCUS_02470 401 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 613 398 gene locus_tag LOCUS_02480 613 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 1315 734 gene locus_tag LOCUS_02490 1315 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 1687 1451 gene locus_tag LOCUS_02500 1687 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 1962 1705 gene locus_tag LOCUS_02510 1962 1705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 2400 1990 gene locus_tag LOCUS_02520 2400 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 3633 2479 gene locus_tag LOCUS_02530 3633 2479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02530 >Feature sequence039 1306 110 gene locus_tag LOCUS_02540 1306 110 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000552081.1 protein_id gnl|my_center|LOCUS_02540 2479 1322 gene locus_tag LOCUS_02550 2479 1322 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546471.1 protein_id gnl|my_center|LOCUS_02550 3347 2469 gene locus_tag LOCUS_02560 gene ispH 3347 2469 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544912.1 protein_id gnl|my_center|LOCUS_02560 4012 3344 gene locus_tag LOCUS_02570 gene cmk 4012 3344 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358949.1 protein_id gnl|my_center|LOCUS_02570 5112 4009 gene locus_tag LOCUS_02580 gene hisC 5112 4009 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_02580 >Feature sequence040 1230 553 gene locus_tag LOCUS_02590 1230 553 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941118.1 protein_id gnl|my_center|LOCUS_02590 1389 1598 gene locus_tag LOCUS_02600 1389 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 1672 3030 gene locus_tag LOCUS_02610 gene oadA 1672 3030 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870743.1 protein_id gnl|my_center|LOCUS_02610 3030 3851 gene locus_tag LOCUS_02620 3030 3851 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869940.1 protein_id gnl|my_center|LOCUS_02620 4081 3881 gene locus_tag LOCUS_02630 gene cspD 4081 3881 CDS product cold-shock protein CspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001193054.1 protein_id gnl|my_center|LOCUS_02630 4836 4195 gene locus_tag LOCUS_02640 4836 4195 CDS product precorrin-8X methylmutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201626283.1 protein_id gnl|my_center|LOCUS_02640 5359 4838 gene locus_tag LOCUS_02650 gene def 5359 4838 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence041 1216 320 gene locus_tag LOCUS_02660 gene nrfD 1216 320 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070834.1 protein_id gnl|my_center|LOCUS_02660 2091 1300 gene locus_tag LOCUS_02670 2091 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5168 2106 gene locus_tag LOCUS_02680 gene fdnG 5168 2106 CDS product formate dehydrogenase-N subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546362.1 transl_except (pos:complement(4596..4598),aa:Sec) note codon on position 191 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_02680 >Feature sequence042 866 426 gene locus_tag LOCUS_02690 866 426 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_02690 1843 1019 gene locus_tag LOCUS_02700 1843 1019 CDS product 3-keto-5-aminohexanoate cleavage protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490830.1 protein_id gnl|my_center|LOCUS_02700 4098 1954 gene locus_tag LOCUS_02710 4098 1954 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870094.1 protein_id gnl|my_center|LOCUS_02710 5127 4318 gene locus_tag LOCUS_02720 5127 4318 CDS product short-chain-enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048188.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence043 119 541 gene locus_tag LOCUS_02730 gene mce 119 541 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867372.1 protein_id gnl|my_center|LOCUS_02730 828 1229 gene locus_tag LOCUS_02740 828 1229 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888664.1 protein_id gnl|my_center|LOCUS_02740 1400 3037 gene locus_tag LOCUS_02750 1400 3037 CDS product methylmalonyl-CoA mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879704.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence044 227 2509 gene locus_tag LOCUS_02760 227 2509 CDS product xanthine dehydrogenase family protein molybdopterin-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975050.1 protein_id gnl|my_center|LOCUS_02760 4449 2596 gene locus_tag LOCUS_02770 4449 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 >Feature sequence045 663 1454 gene locus_tag LOCUS_02780 663 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 1466 3262 gene locus_tag LOCUS_02790 1466 3262 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942696.1 protein_id gnl|my_center|LOCUS_02790 3386 4306 gene locus_tag LOCUS_02800 3386 4306 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938734.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence046 97 1650 gene locus_tag LOCUS_02810 97 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 1661 3970 gene locus_tag LOCUS_02820 1661 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 4400 4005 gene locus_tag LOCUS_02830 4400 4005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5223 4411 gene locus_tag LOCUS_02840 5223 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 >Feature sequence047 1850 1062 gene locus_tag LOCUS_02850 gene cdsA 1850 1062 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231924.1 protein_id gnl|my_center|LOCUS_02850 2547 1840 gene locus_tag LOCUS_02860 2547 1840 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_02860 2765 2598 gene locus_tag LOCUS_02870 2765 2598 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392551.1 protein_id gnl|my_center|LOCUS_02870 3350 2784 gene locus_tag LOCUS_02880 gene frr 3350 2784 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938169.1 protein_id gnl|my_center|LOCUS_02880 4063 3347 gene locus_tag LOCUS_02890 gene pyrH 4063 3347 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546671.1 protein_id gnl|my_center|LOCUS_02890 4713 4063 gene locus_tag LOCUS_02900 gene tsf 4713 4063 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942565.1 protein_id gnl|my_center|LOCUS_02900 <5369 4735 gene locus_tag LOCUS_02910 <5369 4735 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392546.1:30S ribosomal protein S2 >Feature sequence048 81 761 gene locus_tag LOCUS_02920 gene queC 81 761 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390955.1 protein_id gnl|my_center|LOCUS_02920 827 3340 gene locus_tag LOCUS_02930 827 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 3425 3769 gene locus_tag LOCUS_02940 3425 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 3782 5188 gene locus_tag LOCUS_02950 3782 5188 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582491.1 protein_id gnl|my_center|LOCUS_02950 >Feature sequence049 3355 56 gene locus_tag LOCUS_02960 3355 56 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 4892 3366 gene locus_tag LOCUS_02970 4892 3366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142959.1 protein_id gnl|my_center|LOCUS_02970 >Feature sequence050 674 1441 gene locus_tag LOCUS_02980 674 1441 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392520.1 protein_id gnl|my_center|LOCUS_02980 2041 1448 gene locus_tag LOCUS_02990 2041 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 2760 2053 gene locus_tag LOCUS_03000 2760 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2924 3199 gene locus_tag LOCUS_03010 2924 3199 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_03010 3132 3800 gene locus_tag LOCUS_03020 3132 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 3784 4329 gene locus_tag LOCUS_03030 gene pgsA 3784 4329 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939132.1 protein_id gnl|my_center|LOCUS_03030 4329 5165 gene locus_tag LOCUS_03040 4329 5165 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_03040 >Feature sequence051 190 783 gene locus_tag LOCUS_03050 190 783 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940756.1 protein_id gnl|my_center|LOCUS_03050 798 1361 gene locus_tag LOCUS_03060 798 1361 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_03060 1348 2973 gene locus_tag LOCUS_03070 1348 2973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 3120 4262 gene locus_tag LOCUS_03080 gene porA 3120 4262 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877345.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence052 421 1647 gene locus_tag LOCUS_03090 421 1647 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_03090 1650 2510 gene locus_tag LOCUS_03100 1650 2510 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085968.1 protein_id gnl|my_center|LOCUS_03100 2511 3482 gene locus_tag LOCUS_03110 2511 3482 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088974.1 protein_id gnl|my_center|LOCUS_03110 3460 4491 gene locus_tag LOCUS_03120 gene dctP 3460 4491 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063711.1 protein_id gnl|my_center|LOCUS_03120 4554 5039 gene locus_tag LOCUS_03130 4554 5039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 >Feature sequence053 1264 341 gene locus_tag LOCUS_03140 1264 341 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096914.1 protein_id gnl|my_center|LOCUS_03140 2489 1257 gene locus_tag LOCUS_03150 2489 1257 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270475.1 protein_id gnl|my_center|LOCUS_03150 2626 3453 gene locus_tag LOCUS_03160 gene mscS 2626 3453 CDS product small-conductance mechanosensitive channel MscS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011091515.1 protein_id gnl|my_center|LOCUS_03160 4249 3836 gene locus_tag LOCUS_03170 4249 3836 CDS product hydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876762.1 protein_id gnl|my_center|LOCUS_03170 4501 4334 gene locus_tag LOCUS_03180 4501 4334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03180 <5192 4471 gene locus_tag LOCUS_03190 <5192 4471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061038.1:H(2):CoB-CoM heterodisulfide ferredoxin reductase subunit HdrA note possible pseudo, frameshifted 4522 4531 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence054 874 1434 gene locus_tag LOCUS_03200 874 1434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3001 1541 gene locus_tag LOCUS_03210 3001 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 >Feature sequence055 422 1222 gene locus_tag LOCUS_03220 422 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 1222 2526 gene locus_tag LOCUS_03230 gene der 1222 2526 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016201.1 protein_id gnl|my_center|LOCUS_03230 2523 4691 gene locus_tag LOCUS_03240 gene glgB 2523 4691 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_03240 5130 4684 gene locus_tag LOCUS_03250 5130 4684 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941206.1 protein_id gnl|my_center|LOCUS_03250 >Feature sequence056 1102 17 gene locus_tag LOCUS_03260 gene dctP 1102 17 CDS product TRAP transporter substrate-binding protein DctP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071344.1 protein_id gnl|my_center|LOCUS_03260 1723 1235 gene locus_tag LOCUS_03270 1723 1235 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461828.1 protein_id gnl|my_center|LOCUS_03270 2915 1704 gene locus_tag LOCUS_03280 2915 1704 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808330.1 protein_id gnl|my_center|LOCUS_03280 4819 2918 gene locus_tag LOCUS_03290 gene cooS 4819 2918 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942742.1 protein_id gnl|my_center|LOCUS_03290 >Feature sequence057 319 146 gene locus_tag LOCUS_03300 319 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 544 1128 gene locus_tag LOCUS_03310 544 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 1125 1439 gene locus_tag LOCUS_03320 1125 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 1439 1645 gene locus_tag LOCUS_03330 1439 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1635 2054 gene locus_tag LOCUS_03340 1635 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 2051 2413 gene locus_tag LOCUS_03350 2051 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2416 3114 gene locus_tag LOCUS_03360 2416 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 3135 3848 gene locus_tag LOCUS_03370 3135 3848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 3890 4240 gene locus_tag LOCUS_03380 3890 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 4237 4548 gene locus_tag LOCUS_03390 4237 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence058 125 1444 gene locus_tag LOCUS_03400 gene secY 125 1444 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938618.1 protein_id gnl|my_center|LOCUS_03400 1466 2116 gene locus_tag LOCUS_03410 1466 2116 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878179.1 protein_id gnl|my_center|LOCUS_03410 2116 2862 gene locus_tag LOCUS_03420 gene map 2116 2862 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545375.1 protein_id gnl|my_center|LOCUS_03420 2876 3118 gene locus_tag LOCUS_03430 gene infA 2876 3118 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_03430 3244 3618 gene locus_tag LOCUS_03440 gene rpsM 3244 3618 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943462.1 protein_id gnl|my_center|LOCUS_03440 3641 4027 gene locus_tag LOCUS_03450 gene rpsK 3641 4027 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869904.1 protein_id gnl|my_center|LOCUS_03450 4058 4684 gene locus_tag LOCUS_03460 gene rpsD 4058 4684 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence059 2 430 gene locus_tag LOCUS_03470 2 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 448 1461 gene locus_tag LOCUS_03480 gene gap 448 1461 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942274.1 protein_id gnl|my_center|LOCUS_03480 1471 2688 gene locus_tag LOCUS_03490 gene pgk 1471 2688 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_03490 2708 3463 gene locus_tag LOCUS_03500 gene tpiA 2708 3463 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545593.1 protein_id gnl|my_center|LOCUS_03500 3466 3777 gene locus_tag LOCUS_03510 3466 3777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 3950 4102 gene locus_tag LOCUS_03520 3950 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 >Feature sequence060 1092 460 gene locus_tag LOCUS_03530 1092 460 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545638.1 protein_id gnl|my_center|LOCUS_03530 1976 1089 gene locus_tag LOCUS_03540 gene secF 1976 1089 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_03540 3579 1993 gene locus_tag LOCUS_03550 gene secD 3579 1993 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_03550 3910 3602 gene locus_tag LOCUS_03560 3910 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 <5024 4015 gene locus_tag LOCUS_03570 <5024 4015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938193.1:chorismate synthase >Feature sequence061 <1 1083 gene locus_tag LOCUS_03580 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000202845.1:response regulator 1819 1085 gene locus_tag LOCUS_03590 1819 1085 CDS product DUF4197 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964041.1 protein_id gnl|my_center|LOCUS_03590 2158 3537 gene locus_tag LOCUS_03600 2158 3537 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250831.1 protein_id gnl|my_center|LOCUS_03600 3527 4207 gene locus_tag LOCUS_03610 3527 4207 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_03610 4324 4249 gene locus_tag LOCUS_t00040 4324 4249 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4646 4455 gene locus_tag LOCUS_03620 4646 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence062 145 2550 gene locus_tag LOCUS_03630 145 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 2606 3031 gene locus_tag LOCUS_03640 gene fliS 2606 3031 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392287.1 protein_id gnl|my_center|LOCUS_03640 3474 3046 gene locus_tag LOCUS_03650 3474 3046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 <4866 3478 gene locus_tag LOCUS_03660 <4866 3478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080294.1:flagellar filament capping protein FliD >Feature sequence063 224 832 gene locus_tag LOCUS_03670 224 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 886 1158 gene locus_tag LOCUS_03680 886 1158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 1653 1345 gene locus_tag LOCUS_03690 1653 1345 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869995.1 protein_id gnl|my_center|LOCUS_03690 1823 1638 gene locus_tag LOCUS_03700 1823 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3116 2937 gene locus_tag LOCUS_03710 3116 2937 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061317.1 protein_id gnl|my_center|LOCUS_03710 3331 3113 gene locus_tag LOCUS_03720 3331 3113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 3577 3852 gene locus_tag LOCUS_03730 3577 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03730 3985 4512 gene locus_tag LOCUS_03740 3985 4512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 >Feature sequence064 826 128 gene locus_tag LOCUS_03750 826 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 1053 829 gene locus_tag LOCUS_03760 1053 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03760 866 875 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2191 1046 gene locus_tag LOCUS_03770 gene pseC 2191 1046 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_03770 2744 2211 gene locus_tag LOCUS_03780 2744 2211 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167727.1 protein_id gnl|my_center|LOCUS_03780 3428 2745 gene locus_tag LOCUS_03790 3428 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 4737 3421 gene locus_tag LOCUS_03800 gene rfbH 4737 3421 CDS product lipopolysaccharide biosynthesis protein RfbH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208596.1 protein_id gnl|my_center|LOCUS_03800 >Feature sequence065 1524 505 gene locus_tag LOCUS_03810 gene fliG 1524 505 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082903.1 protein_id gnl|my_center|LOCUS_03810 3162 1525 gene locus_tag LOCUS_03820 gene fliF 3162 1525 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_03820 3471 3181 gene locus_tag LOCUS_03830 3471 3181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 3925 3488 gene locus_tag LOCUS_03840 gene flgC 3925 3488 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_03840 4344 3925 gene locus_tag LOCUS_03850 gene flgB 4344 3925 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392289.1 protein_id gnl|my_center|LOCUS_03850 >Feature sequence066 429 1628 gene locus_tag LOCUS_03860 429 1628 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788709.1 protein_id gnl|my_center|LOCUS_03860 1700 2557 gene locus_tag LOCUS_03870 1700 2557 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544937.1 protein_id gnl|my_center|LOCUS_03870 2561 3520 gene locus_tag LOCUS_03880 2561 3520 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809683.1 protein_id gnl|my_center|LOCUS_03880 3532 4290 gene locus_tag LOCUS_03890 3532 4290 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545387.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence067 1495 710 gene locus_tag LOCUS_03900 gene cdaA 1495 710 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545037.1 protein_id gnl|my_center|LOCUS_03900 2722 1502 gene locus_tag LOCUS_03910 gene folP 2722 1502 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948526.1 protein_id gnl|my_center|LOCUS_03910 4466 2709 gene locus_tag LOCUS_03920 gene ftsH 4466 2709 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200858940.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence068 907 137 gene locus_tag LOCUS_03930 907 137 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947941.1 protein_id gnl|my_center|LOCUS_03930 1533 904 gene locus_tag LOCUS_03940 1533 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 2448 1534 gene locus_tag LOCUS_03950 gene lpxC 2448 1534 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555040.1 protein_id gnl|my_center|LOCUS_03950 3242 2697 gene locus_tag LOCUS_03960 gene pyrE 3242 2697 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942282.1 protein_id gnl|my_center|LOCUS_03960 3804 3361 gene locus_tag LOCUS_03970 gene wrbA 3804 3361 CDS product NAD(P)H:quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090297.1 protein_id gnl|my_center|LOCUS_03970 3971 3807 gene locus_tag LOCUS_03980 3971 3807 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670545.1 protein_id gnl|my_center|LOCUS_03980 4316 4047 gene locus_tag LOCUS_03990 4316 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 4512 4300 gene locus_tag LOCUS_04000 4512 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 >Feature sequence069 1601 627 gene locus_tag LOCUS_04010 1601 627 CDS product 3-dehydroquinate synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881255.1 protein_id gnl|my_center|LOCUS_04010 2440 1637 gene locus_tag LOCUS_04020 2440 1637 CDS product 2-amino-3,7-dideoxy-D-threo-hept-6-ulosonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881009.1 protein_id gnl|my_center|LOCUS_04020 2703 2632 gene locus_tag LOCUS_t00050 2703 2632 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2782 2710 gene locus_tag LOCUS_t00060 2782 2710 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 4560 2857 gene locus_tag LOCUS_04030 gene pilB 4560 2857 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence070 116 721 gene locus_tag LOCUS_04040 116 721 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_04040 1758 718 gene locus_tag LOCUS_04050 gene argC 1758 718 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_04050 2195 1806 gene locus_tag LOCUS_04060 gene rpsI 2195 1806 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004624294.1 protein_id gnl|my_center|LOCUS_04060 2637 2209 gene locus_tag LOCUS_04070 gene rplM 2637 2209 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943505.1 protein_id gnl|my_center|LOCUS_04070 3389 2844 gene locus_tag LOCUS_04080 3389 2844 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986716.1 protein_id gnl|my_center|LOCUS_04080 4528 3392 gene locus_tag LOCUS_04090 4528 3392 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942829.1 protein_id gnl|my_center|LOCUS_04090 >Feature sequence071 1208 1519 gene locus_tag LOCUS_04100 gene rplU 1208 1519 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_04100 1530 1790 gene locus_tag LOCUS_04110 gene rpmA 1530 1790 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_04110 1857 2858 gene locus_tag LOCUS_04120 gene obgE 1857 2858 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_04120 3300 2863 gene locus_tag LOCUS_04130 3300 2863 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941789.1 protein_id gnl|my_center|LOCUS_04130 4058 3300 gene locus_tag LOCUS_04140 4058 3300 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392303.1 protein_id gnl|my_center|LOCUS_04140 <4620 4058 gene locus_tag LOCUS_04150 <4620 4058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937943.1:MotA/TolQ/ExbB proton channel family protein >Feature sequence072 109 840 gene locus_tag LOCUS_04160 gene cysE 109 840 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_207285050.1 protein_id gnl|my_center|LOCUS_04160 833 1537 gene locus_tag LOCUS_04170 833 1537 CDS product UPF0280 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583102.1 protein_id gnl|my_center|LOCUS_04170 1550 1975 gene locus_tag LOCUS_04180 1550 1975 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_04180 1980 2585 gene locus_tag LOCUS_04190 1980 2585 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401864.1 protein_id gnl|my_center|LOCUS_04190 2679 3053 gene locus_tag LOCUS_04200 gene rpsL 2679 3053 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_04200 3070 3540 gene locus_tag LOCUS_04210 gene rpsG 3070 3540 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938594.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence073 1 138 gene locus_tag LOCUS_04220 1 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 138 647 gene locus_tag LOCUS_04230 138 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 674 799 gene locus_tag LOCUS_04240 674 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 833 2674 gene locus_tag LOCUS_04250 833 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 2674 2907 gene locus_tag LOCUS_04260 2674 2907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2908 4110 gene locus_tag LOCUS_04270 2908 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence074 610 89 gene locus_tag LOCUS_04280 610 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 4351 626 gene locus_tag LOCUS_04290 4351 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence075 535 176 gene locus_tag LOCUS_04300 535 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 954 526 gene locus_tag LOCUS_04310 954 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 1489 1235 gene locus_tag LOCUS_04320 1489 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 1795 1490 gene locus_tag LOCUS_04330 1795 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 2489 1941 gene locus_tag LOCUS_04340 2489 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 4308 2656 gene locus_tag LOCUS_04350 4308 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence076 1672 548 gene locus_tag LOCUS_04360 gene carA 1672 548 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941928.1 protein_id gnl|my_center|LOCUS_04360 2955 1669 gene locus_tag LOCUS_04370 2955 1669 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583923.1 protein_id gnl|my_center|LOCUS_04370 3862 2957 gene locus_tag LOCUS_04380 3862 2957 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_04380 4394 3855 gene locus_tag LOCUS_04390 gene pyrR 4394 3855 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583925.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence077 47 712 gene locus_tag LOCUS_04400 47 712 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815172.1 protein_id gnl|my_center|LOCUS_04400 730 1530 gene locus_tag LOCUS_04410 730 1530 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546717.1 protein_id gnl|my_center|LOCUS_04410 1523 2359 gene locus_tag LOCUS_04420 1523 2359 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545130.1 protein_id gnl|my_center|LOCUS_04420 4470 2659 gene locus_tag LOCUS_04430 4470 2659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence078 431 2596 gene locus_tag LOCUS_04440 431 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2601 3092 gene locus_tag LOCUS_04450 gene cas4 2601 3092 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546197.1 protein_id gnl|my_center|LOCUS_04450 3096 4091 gene locus_tag LOCUS_04460 gene cas1b 3096 4091 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817555.1 protein_id gnl|my_center|LOCUS_04460 4091 4357 gene locus_tag LOCUS_04470 gene cas2 4091 4357 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_04470 >Feature sequence079 1357 485 gene locus_tag LOCUS_04480 1357 485 CDS product tetrahydrofolate dehydrogenase/cyclohydrolase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460266.1 protein_id gnl|my_center|LOCUS_04480 3849 1711 gene locus_tag LOCUS_04490 3849 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence080 >Feature sequence081 439 14 gene locus_tag LOCUS_04500 gene gspG 439 14 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940994.1 protein_id gnl|my_center|LOCUS_04500 3564 823 gene locus_tag LOCUS_04510 3564 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4019 3726 gene locus_tag LOCUS_04520 4019 3726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 >Feature sequence082 57 992 gene locus_tag LOCUS_04530 57 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 1002 2315 gene locus_tag LOCUS_04540 1002 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 2312 3601 gene locus_tag LOCUS_04550 2312 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence083 1802 930 gene locus_tag LOCUS_04560 1802 930 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_04560 2241 1831 gene locus_tag LOCUS_04570 2241 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2818 2261 gene locus_tag LOCUS_04580 2818 2261 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966371.1 protein_id gnl|my_center|LOCUS_04580 3703 2864 gene locus_tag LOCUS_04590 3703 2864 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437062.1 protein_id gnl|my_center|LOCUS_04590 4361 3807 gene locus_tag LOCUS_04600 4361 3807 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006313108.1 protein_id gnl|my_center|LOCUS_04600 >Feature sequence084 2578 164 gene locus_tag LOCUS_04610 2578 164 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243831.1 protein_id gnl|my_center|LOCUS_04610 3224 2634 gene locus_tag LOCUS_04620 gene fadR 3224 2634 CDS product fatty acid metabolism transcriptional regulator FadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229547.1 protein_id gnl|my_center|LOCUS_04620 <4357 3226 gene locus_tag LOCUS_04630 <4357 3226 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926994.1:AMP-dependent synthetase/ligase >Feature sequence085 1446 4052 gene locus_tag LOCUS_04640 gene clpB 1446 4052 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365367.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence086 598 1776 gene locus_tag LOCUS_04650 gene nrfD 598 1776 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933893.1 protein_id gnl|my_center|LOCUS_04650 1906 4293 gene locus_tag LOCUS_04660 gene extM 1906 4293 CDS product selenite/tellurite reduction operon c-type cytochrome ExtM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943566.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence087 2818 335 gene locus_tag LOCUS_04670 2818 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 3723 2827 gene locus_tag LOCUS_04680 3723 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence088 1217 159 gene locus_tag LOCUS_04690 1217 159 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145958.1 protein_id gnl|my_center|LOCUS_04690 2962 1229 gene locus_tag LOCUS_04700 2962 1229 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_04700 3918 2974 gene locus_tag LOCUS_04710 3918 2974 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_04710 >Feature sequence089 1221 64 gene locus_tag LOCUS_04720 1221 64 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_04720 2234 1236 gene locus_tag LOCUS_04730 gene ruvB 2234 1236 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546115.1 protein_id gnl|my_center|LOCUS_04730 2814 2227 gene locus_tag LOCUS_04740 gene ruvA 2814 2227 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941737.1 protein_id gnl|my_center|LOCUS_04740 3314 2814 gene locus_tag LOCUS_04750 gene ruvC 3314 2814 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941736.1 protein_id gnl|my_center|LOCUS_04750 4066 3314 gene locus_tag LOCUS_04760 4066 3314 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941735.1 protein_id gnl|my_center|LOCUS_04760 >Feature sequence090 2299 2066 gene locus_tag LOCUS_04770 2299 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3502 2312 gene locus_tag LOCUS_04780 3502 2312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 4124 3732 gene locus_tag LOCUS_04790 4124 3732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 >Feature sequence091 1025 1645 gene locus_tag LOCUS_04800 1025 1645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 >Feature sequence092 <1 949 gene locus_tag LOCUS_04810 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881258.1:hydantoinase B/oxoprolinase family protein 984 1961 gene locus_tag LOCUS_04820 984 1961 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724273.1 protein_id gnl|my_center|LOCUS_04820 2017 2496 gene locus_tag LOCUS_04830 2017 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 2538 3827 gene locus_tag LOCUS_04840 2538 3827 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089911.1 protein_id gnl|my_center|LOCUS_04840 >Feature sequence093 943 437 gene locus_tag LOCUS_04850 943 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1184 933 gene locus_tag LOCUS_04860 1184 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 1767 1997 gene locus_tag LOCUS_04870 1767 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 1990 2241 gene locus_tag LOCUS_04880 1990 2241 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007281268.1 protein_id gnl|my_center|LOCUS_04880 2655 2302 gene locus_tag LOCUS_04890 2655 2302 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035765.1 protein_id gnl|my_center|LOCUS_04890 3087 3699 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tgtcgcaattcccttctaattcgggaagtttctaac >Feature sequence094 2952 850 gene locus_tag LOCUS_04900 2952 850 CDS product TRAP transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228476.1 protein_id gnl|my_center|LOCUS_04900 4154 3159 gene locus_tag LOCUS_04910 4154 3159 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000056629.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence095 433 176 gene locus_tag LOCUS_04920 gene rpsR 433 176 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_04920 743 426 gene locus_tag LOCUS_04930 743 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 1054 743 gene locus_tag LOCUS_04940 1054 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 2105 1152 gene locus_tag LOCUS_04950 2105 1152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 2314 3420 gene locus_tag LOCUS_04960 2314 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 >Feature sequence096 1649 888 gene locus_tag LOCUS_04970 1649 888 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940747.1 protein_id gnl|my_center|LOCUS_04970 2192 1650 gene locus_tag LOCUS_04980 2192 1650 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940746.1 protein_id gnl|my_center|LOCUS_04980 2429 3913 gene locus_tag LOCUS_04990 2429 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 >Feature sequence097 2329 71 gene locus_tag LOCUS_05000 2329 71 CDS product vitamin B12-dependent ribonucleotide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879160.1 protein_id gnl|my_center|LOCUS_05000 3177 2341 gene locus_tag LOCUS_05010 3177 2341 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000395995.1 protein_id gnl|my_center|LOCUS_05010 <4127 3179 gene locus_tag LOCUS_05020 <4127 3179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941835.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence098 129 797 gene locus_tag LOCUS_05030 129 797 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883319.1 protein_id gnl|my_center|LOCUS_05030 797 2230 gene locus_tag LOCUS_05040 797 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2363 2599 gene locus_tag LOCUS_05050 gene rpmE 2363 2599 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003355803.1 protein_id gnl|my_center|LOCUS_05050 2583 3275 gene locus_tag LOCUS_05060 gene thyX 2583 3275 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546288.1 protein_id gnl|my_center|LOCUS_05060 >Feature sequence099 <1 1610 gene locus_tag LOCUS_05070 <1 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545499.1:type IV secretion system DNA-binding domain-containing protein 1967 2380 gene locus_tag LOCUS_05080 1967 2380 CDS product DUF3232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940738.1 protein_id gnl|my_center|LOCUS_05080 3933 2563 gene locus_tag LOCUS_05090 3933 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096324.1 protein_id gnl|my_center|LOCUS_05090 >Feature sequence100 1205 531 gene locus_tag LOCUS_05100 1205 531 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939817.1 protein_id gnl|my_center|LOCUS_05100 2413 1208 gene locus_tag LOCUS_05110 2413 1208 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002673537.1 protein_id gnl|my_center|LOCUS_05110 3665 2406 gene locus_tag LOCUS_05120 gene murA 3665 2406 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943723.1 protein_id gnl|my_center|LOCUS_05120 >Feature sequence101 3847 443 gene locus_tag LOCUS_05130 3847 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence102 <1 535 gene locus_tag LOCUS_05140 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_037394575.1:type II secretion system secretin GspD 516 1265 gene locus_tag LOCUS_05150 516 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1400 3487 gene locus_tag LOCUS_05160 gene fusA 1400 3487 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942578.1 protein_id gnl|my_center|LOCUS_05160 >Feature sequence103 1086 568 gene locus_tag LOCUS_05170 gene cobO 1086 568 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165442279.1 protein_id gnl|my_center|LOCUS_05170 2748 1102 gene locus_tag LOCUS_05180 2748 1102 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938901.1 protein_id gnl|my_center|LOCUS_05180 3110 2751 gene locus_tag LOCUS_05190 3110 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3755 3120 gene locus_tag LOCUS_05200 3755 3120 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941787.1 protein_id gnl|my_center|LOCUS_05200 >Feature sequence104 1968 238 gene locus_tag LOCUS_05210 1968 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 3768 1984 gene locus_tag LOCUS_05220 3768 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence105 <1 808 gene locus_tag LOCUS_05230 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583399.1:Xaa-Pro peptidase family protein 793 1437 gene locus_tag LOCUS_05240 793 1437 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009889593.1 protein_id gnl|my_center|LOCUS_05240 1461 2678 gene locus_tag LOCUS_05250 1461 2678 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942333.1 protein_id gnl|my_center|LOCUS_05250 2675 3466 gene locus_tag LOCUS_05260 2675 3466 CDS product acyl-CoA dehydratase activase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966886.1 protein_id gnl|my_center|LOCUS_05260 <4010 3431 gene locus_tag LOCUS_05270 <4010 3431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767925.1:ferrous iron transport protein B >Feature sequence106 375 34 gene locus_tag LOCUS_05280 375 34 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261014.1 protein_id gnl|my_center|LOCUS_05280 1434 472 gene locus_tag LOCUS_05290 gene cysD 1434 472 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000140408.1 protein_id gnl|my_center|LOCUS_05290 1822 1421 gene locus_tag LOCUS_05300 1822 1421 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003340660.1 protein_id gnl|my_center|LOCUS_05300 2528 1893 gene locus_tag LOCUS_05310 gene cysC 2528 1893 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963430.1 protein_id gnl|my_center|LOCUS_05310 3395 2667 gene locus_tag LOCUS_05320 3395 2667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 3571 3386 gene locus_tag LOCUS_05330 3571 3386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 >Feature sequence107 3197 6 gene locus_tag LOCUS_05340 3197 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence108 2210 558 gene locus_tag LOCUS_05350 2210 558 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920320.1 protein_id gnl|my_center|LOCUS_05350 >Feature sequence109 52 1401 gene locus_tag LOCUS_05360 52 1401 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258044.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence110 372 1655 gene locus_tag LOCUS_05370 gene trmD 372 1655 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938137.1 protein_id gnl|my_center|LOCUS_05370 1668 2009 gene locus_tag LOCUS_05380 gene rplS 1668 2009 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392486.1 protein_id gnl|my_center|LOCUS_05380 2018 2614 gene locus_tag LOCUS_05390 2018 2614 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438239.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence111 1278 553 gene locus_tag LOCUS_05400 1278 553 CDS product protein jag inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398827.1 protein_id gnl|my_center|LOCUS_05400 2924 1293 gene locus_tag LOCUS_05410 gene yidC 2924 1293 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_05410 3376 3131 gene locus_tag LOCUS_05420 3376 3131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3630 3496 gene locus_tag LOCUS_05430 gene rpmH 3630 3496 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003816025.1 protein_id gnl|my_center|LOCUS_05430 >Feature sequence112 2112 565 gene locus_tag LOCUS_05440 2112 565 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000076961.1 protein_id gnl|my_center|LOCUS_05440 3206 2115 gene locus_tag LOCUS_05450 3206 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence113 595 254 gene locus_tag LOCUS_05460 gene rbfA 595 254 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460392.1 protein_id gnl|my_center|LOCUS_05460 901 614 gene locus_tag LOCUS_05470 901 614 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583570.1 protein_id gnl|my_center|LOCUS_05470 3430 905 gene locus_tag LOCUS_05480 3430 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 >Feature sequence114 1841 306 gene locus_tag LOCUS_05490 1841 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 1949 2221 gene locus_tag LOCUS_05500 1949 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2218 3606 gene locus_tag LOCUS_05510 gene glmU 2218 3606 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015965.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence115 2471 1464 gene locus_tag LOCUS_05520 2471 1464 CDS product GSU2203 family decaheme c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942843.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence116 <1 908 gene locus_tag LOCUS_05530 <1 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965030.1:methionyl-tRNA formyltransferase 905 1666 gene locus_tag LOCUS_05540 905 1666 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940807.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence117 136 876 gene locus_tag LOCUS_05550 gene murI 136 876 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851499.1 protein_id gnl|my_center|LOCUS_05550 >Feature sequence118 512 234 gene locus_tag LOCUS_05560 512 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 930 523 gene locus_tag LOCUS_05570 930 523 CDS product glycoside hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957963.1 protein_id gnl|my_center|LOCUS_05570 2296 941 gene locus_tag LOCUS_05580 2296 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2846 2397 gene locus_tag LOCUS_05590 2846 2397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 3015 2824 gene locus_tag LOCUS_05600 3015 2824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 <3732 3015 gene locus_tag LOCUS_05610 <3732 3015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222496.1:IS110-like element ISNgo3 family transposase >Feature sequence119 >Feature sequence120 1717 704 gene locus_tag LOCUS_05620 1717 704 CDS product DctP family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812403.1 protein_id gnl|my_center|LOCUS_05620 2159 2614 gene locus_tag LOCUS_05630 2159 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence121 2035 875 gene locus_tag LOCUS_05640 gene metK 2035 875 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942525.1 protein_id gnl|my_center|LOCUS_05640 <3707 2057 gene locus_tag LOCUS_05650 <3707 2057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152804487.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence122 2666 1401 gene locus_tag LOCUS_05660 2666 1401 CDS product PD-(D/E)XK nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891827.1 protein_id gnl|my_center|LOCUS_05660 3332 2697 gene locus_tag LOCUS_05670 3332 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence123 400 1683 gene locus_tag LOCUS_05680 400 1683 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938006.1 protein_id gnl|my_center|LOCUS_05680 2786 1680 gene locus_tag LOCUS_05690 2786 1680 CDS product DUF362 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460725.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence124 1839 769 gene locus_tag LOCUS_05700 1839 769 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861645.1 protein_id gnl|my_center|LOCUS_05700 1929 3593 gene locus_tag LOCUS_05710 1929 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 >Feature sequence125 >Feature sequence126 3005 1413 gene locus_tag LOCUS_05720 3005 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 3454 3056 gene locus_tag LOCUS_05730 3454 3056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence127 1707 2066 gene locus_tag LOCUS_05740 1707 2066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2079 2753 gene locus_tag LOCUS_05750 2079 2753 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946786.1 protein_id gnl|my_center|LOCUS_05750 2757 3485 gene locus_tag LOCUS_05760 2757 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 >Feature sequence128 <1 927 gene locus_tag LOCUS_05770 <1 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029491570.1:C4-dicarboxylate TRAP transporter substrate-binding protein 1007 1501 gene locus_tag LOCUS_05780 1007 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 1523 2824 gene locus_tag LOCUS_05790 1523 2824 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391423.1 protein_id gnl|my_center|LOCUS_05790 2843 3274 gene locus_tag LOCUS_05800 2843 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 >Feature sequence129 2210 1359 gene locus_tag LOCUS_05810 gene xerD 2210 1359 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700300.1 protein_id gnl|my_center|LOCUS_05810 <3608 2213 gene locus_tag LOCUS_05820 <3608 2213 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583501.1:ATP-dependent DNA helicase RecG >Feature sequence130 <1 786 gene locus_tag LOCUS_05830 <1 786 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012707773.1:DNA-directed RNA polymerase subunit alpha 776 1282 gene locus_tag LOCUS_05840 776 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 1492 1956 gene locus_tag LOCUS_05850 1492 1956 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583566.1 protein_id gnl|my_center|LOCUS_05850 1967 3232 gene locus_tag LOCUS_05860 gene nusA 1967 3232 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942231.1 protein_id gnl|my_center|LOCUS_05860 3234 3437 gene locus_tag LOCUS_05870 3234 3437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 >Feature sequence131 170 1024 gene locus_tag LOCUS_05880 170 1024 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000787928.1 protein_id gnl|my_center|LOCUS_05880 1035 2582 gene locus_tag LOCUS_05890 1035 2582 CDS product Na+/H+ antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878349.1 protein_id gnl|my_center|LOCUS_05890 3092 2577 gene locus_tag LOCUS_05900 3092 2577 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence132 151 843 gene locus_tag LOCUS_05910 151 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 2287 878 gene locus_tag LOCUS_05920 gene gltA 2287 878 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023687.1 protein_id gnl|my_center|LOCUS_05920 3171 2314 gene locus_tag LOCUS_05930 3171 2314 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868068.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence133 1835 1005 gene locus_tag LOCUS_05940 gene dapF 1835 1005 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_05940 3103 1850 gene locus_tag LOCUS_05950 gene lysA 3103 1850 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence134 1689 211 gene locus_tag LOCUS_05960 1689 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 3270 1765 gene locus_tag LOCUS_05970 3270 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 1787 1796 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence135 1327 599 gene locus_tag LOCUS_05980 gene hisA 1327 599 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207860.1 protein_id gnl|my_center|LOCUS_05980 2123 1296 gene locus_tag LOCUS_05990 2123 1296 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_05990 2500 2099 gene locus_tag LOCUS_06000 2500 2099 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463606.1 protein_id gnl|my_center|LOCUS_06000 2600 3028 gene locus_tag LOCUS_06010 2600 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3031 3450 gene locus_tag LOCUS_06020 3031 3450 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933604.1 protein_id gnl|my_center|LOCUS_06020 >Feature sequence136 3068 3077 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence137 330 1625 gene locus_tag LOCUS_06030 330 1625 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941684.1 protein_id gnl|my_center|LOCUS_06030 1697 3241 gene locus_tag LOCUS_06040 gene murJ 1697 3241 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544918.1 protein_id gnl|my_center|LOCUS_06040 >Feature sequence138 <1 1121 gene locus_tag LOCUS_06050 <1 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000747885.1:OFA family MFS transporter 2844 1204 gene locus_tag LOCUS_06060 gene groL 2844 1204 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943952.1 protein_id gnl|my_center|LOCUS_06060 3170 2880 gene locus_tag LOCUS_06070 gene groES 3170 2880 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943951.1 protein_id gnl|my_center|LOCUS_06070 >Feature sequence139 2187 136 gene locus_tag LOCUS_06080 gene brxL 2187 136 CDS product protease Lon-related BREX system protein BrxL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022338.1 protein_id gnl|my_center|LOCUS_06080 <3412 2204 gene locus_tag LOCUS_06090 <3412 2204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022339.1:BREX-1 system phosphatase PglZ type A >Feature sequence140 257 1771 gene locus_tag LOCUS_06100 gene atpA 257 1771 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940787.1 protein_id gnl|my_center|LOCUS_06100 1781 2638 gene locus_tag LOCUS_06110 gene atpG 1781 2638 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940788.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence141 >Feature sequence142 9 3242 gene locus_tag LOCUS_06120 9 3242 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941727.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence143 <1 1064 gene locus_tag LOCUS_06130 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930607.1:SLBB domain-containing protein >Feature sequence144 1342 761 gene locus_tag LOCUS_06140 gene yihA 1342 761 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003546867.1 protein_id gnl|my_center|LOCUS_06140 1735 1343 gene locus_tag LOCUS_06150 1735 1343 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496720.1 protein_id gnl|my_center|LOCUS_06150 >Feature sequence145 271 753 gene locus_tag LOCUS_06160 271 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 753 1817 gene locus_tag LOCUS_06170 gene wecB 753 1817 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113418.1 protein_id gnl|my_center|LOCUS_06170 1904 2143 gene locus_tag LOCUS_06180 1904 2143 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 2133 3299 gene locus_tag LOCUS_06190 2133 3299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 >Feature sequence146 3202 1328 gene locus_tag LOCUS_06200 gene mnmG 3202 1328 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence147 538 218 gene locus_tag LOCUS_06210 538 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 1386 535 gene locus_tag LOCUS_06220 gene rfbA 1386 535 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002286449.1 protein_id gnl|my_center|LOCUS_06220 3122 1383 gene locus_tag LOCUS_06230 3122 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence148 1725 1576 gene locus_tag LOCUS_06240 1725 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 3291 1738 gene locus_tag LOCUS_06250 3291 1738 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762326.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence149 857 276 gene locus_tag LOCUS_06260 gene rsxA 857 276 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904083.1 protein_id gnl|my_center|LOCUS_06260 1007 1291 gene locus_tag LOCUS_06270 1007 1291 CDS product PxxKW family cysteine-rich protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942657.1 protein_id gnl|my_center|LOCUS_06270 2418 1300 gene locus_tag LOCUS_06280 gene larC 2418 1300 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870904.1 protein_id gnl|my_center|LOCUS_06280 3246 2422 gene locus_tag LOCUS_06290 3246 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 >Feature sequence150 1041 529 gene locus_tag LOCUS_06300 1041 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 2462 1383 gene locus_tag LOCUS_06310 2462 1383 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496660.1 protein_id gnl|my_center|LOCUS_06310 <3311 2474 gene locus_tag LOCUS_06320 <3311 2474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942109.1:aspartate--tRNA ligase >Feature sequence151 1800 415 gene locus_tag LOCUS_06330 1800 415 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817128.1 protein_id gnl|my_center|LOCUS_06330 1916 3169 gene locus_tag LOCUS_06340 1916 3169 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082016.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence152 2124 961 gene locus_tag LOCUS_06350 2124 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 <3302 2130 gene locus_tag LOCUS_06360 <3302 2130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242596.1:UDP-glucose 6-dehydrogenase TuaD >Feature sequence153 <1 568 gene locus_tag LOCUS_06370 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927008.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein 592 2577 gene locus_tag LOCUS_06380 592 2577 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927008.1 protein_id gnl|my_center|LOCUS_06380 2582 3124 gene locus_tag LOCUS_06390 2582 3124 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939676.1 protein_id gnl|my_center|LOCUS_06390 >Feature sequence154 1021 1431 gene locus_tag LOCUS_06400 1021 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 1451 1822 gene locus_tag LOCUS_06410 1451 1822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 2184 1993 gene locus_tag LOCUS_06420 2184 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 >Feature sequence155 693 289 gene locus_tag LOCUS_06430 693 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1163 705 gene locus_tag LOCUS_06440 1163 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 724 733 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2078 1422 gene locus_tag LOCUS_06450 2078 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 2899 2075 gene locus_tag LOCUS_06460 2899 2075 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224017.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence156 >Feature sequence157 139 978 gene locus_tag LOCUS_06470 139 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 1826 1026 gene locus_tag LOCUS_06480 gene kdsA 1826 1026 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_06480 <3228 1828 gene locus_tag LOCUS_06490 <3228 1828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942540.1:CTP synthase >Feature sequence158 1088 141 gene locus_tag LOCUS_06500 1088 141 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462477.1 protein_id gnl|my_center|LOCUS_06500 1561 1304 gene locus_tag LOCUS_06510 1561 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 2167 1562 gene locus_tag LOCUS_06520 gene pglC 2167 1562 CDS product undecaprenyl phosphate N,N'-diacetylbacillosamine 1-phosphate transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852766.1 protein_id gnl|my_center|LOCUS_06520 3210 2170 gene locus_tag LOCUS_06530 gene pglA 3210 2170 CDS product N,N'-diacetylbacillosaminyl-diphospho-undecaprenol alpha-1,3-N-acetylgalactosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852885.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence159 <1 2978 gene locus_tag LOCUS_06540 <1 2978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943007.1:methyl-accepting chemotaxis protein >Feature sequence160 1070 2695 gene locus_tag LOCUS_06550 1070 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence161 <1 2321 gene locus_tag LOCUS_06560 <1 2321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943129.1:PAS domain-containing sensor histidine kinase >Feature sequence162 2197 1568 gene locus_tag LOCUS_06570 2197 1568 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946654.1 protein_id gnl|my_center|LOCUS_06570 2712 2203 gene locus_tag LOCUS_06580 2712 2203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 >Feature sequence163 1261 1455 gene locus_tag LOCUS_06590 1261 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1616 1996 gene locus_tag LOCUS_06600 1616 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 2177 2416 gene locus_tag LOCUS_06610 2177 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 2420 2674 gene locus_tag LOCUS_06620 2420 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 >Feature sequence164 1095 1925 gene locus_tag LOCUS_06630 1095 1925 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_06630 1941 3014 gene locus_tag LOCUS_06640 1941 3014 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence165 372 1745 gene locus_tag LOCUS_06650 gene dnaB 372 1745 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_06650 1748 2812 gene locus_tag LOCUS_06660 gene dprA 1748 2812 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082954.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence166 1345 113 gene locus_tag LOCUS_06670 1345 113 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942910.1 protein_id gnl|my_center|LOCUS_06670 2825 1347 gene locus_tag LOCUS_06680 gene lysS 2825 1347 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942911.1 protein_id gnl|my_center|LOCUS_06680 3006 3080 gene locus_tag LOCUS_t00070 3006 3080 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence167 1 480 gene locus_tag LOCUS_06690 gene leuD 1 480 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_06690 482 1534 gene locus_tag LOCUS_06700 482 1534 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546078.1 protein_id gnl|my_center|LOCUS_06700 1544 2494 gene locus_tag LOCUS_06710 1544 2494 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707542.1 protein_id gnl|my_center|LOCUS_06710 2497 2676 gene locus_tag LOCUS_06720 2497 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 >Feature sequence168 827 375 gene locus_tag LOCUS_06730 827 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 1250 828 gene locus_tag LOCUS_06740 1250 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 2212 1247 gene locus_tag LOCUS_06750 2212 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2826 2206 gene locus_tag LOCUS_06760 2826 2206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence169 1236 352 gene locus_tag LOCUS_06770 1236 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 2009 1251 gene locus_tag LOCUS_06780 2009 1251 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268829.1 protein_id gnl|my_center|LOCUS_06780 <3104 2134 gene locus_tag LOCUS_06790 <3104 2134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545210.1:TldD/PmbA family protein >Feature sequence170 1045 257 gene locus_tag LOCUS_06800 gene flgG 1045 257 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943676.1 protein_id gnl|my_center|LOCUS_06800 1860 1075 gene locus_tag LOCUS_06810 1860 1075 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965439.1 protein_id gnl|my_center|LOCUS_06810 2831 2190 gene locus_tag LOCUS_06820 gene bioD 2831 2190 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496780.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence171 646 149 gene locus_tag LOCUS_06830 646 149 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 protein_id gnl|my_center|LOCUS_06830 1068 643 gene locus_tag LOCUS_06840 1068 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 1914 1102 gene locus_tag LOCUS_06850 1914 1102 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034353519.1 protein_id gnl|my_center|LOCUS_06850 2687 1911 gene locus_tag LOCUS_06860 2687 1911 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_06860 >Feature sequence172 1107 529 gene locus_tag LOCUS_06870 1107 529 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948147.1 protein_id gnl|my_center|LOCUS_06870 2109 1120 gene locus_tag LOCUS_06880 2109 1120 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_06880 <3077 2125 gene locus_tag LOCUS_06890 <3077 2125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198480691.1:electron transport complex subunit RsxC >Feature sequence173 1546 1379 gene locus_tag LOCUS_06900 1546 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2984 1698 gene locus_tag LOCUS_06910 2984 1698 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence174 <1 510 gene locus_tag LOCUS_06920 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938759.1:acetylglutamate kinase 507 1496 gene locus_tag LOCUS_06930 507 1496 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681095.1 protein_id gnl|my_center|LOCUS_06930 1508 2449 gene locus_tag LOCUS_06940 1508 2449 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942460.1 protein_id gnl|my_center|LOCUS_06940 2446 2922 gene locus_tag LOCUS_06950 2446 2922 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942658.1 protein_id gnl|my_center|LOCUS_06950 2895 3053 gene locus_tag LOCUS_06960 2895 3053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence175 238 1113 gene locus_tag LOCUS_06970 gene dapA 238 1113 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_06970 1132 1932 gene locus_tag LOCUS_06980 gene dapB 1132 1932 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_06980 1948 2694 gene locus_tag LOCUS_06990 1948 2694 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879714.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence176 265 29 gene locus_tag LOCUS_07000 265 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 640 1662 gene locus_tag LOCUS_07010 640 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 1659 2642 gene locus_tag LOCUS_07020 1659 2642 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080803342.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence177 1983 844 gene locus_tag LOCUS_07030 gene icd 1983 844 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000206898.1 protein_id gnl|my_center|LOCUS_07030 2565 2224 gene locus_tag LOCUS_07040 2565 2224 CDS product L-rhamnose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369371.1 protein_id gnl|my_center|LOCUS_07040 3053 2565 gene locus_tag LOCUS_07050 3053 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence178 1344 2366 gene locus_tag LOCUS_07060 1344 2366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106006607.1 protein_id gnl|my_center|LOCUS_07060 2378 2509 gene locus_tag LOCUS_07070 2378 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07070 2693 2875 gene locus_tag LOCUS_07080 2693 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 >Feature sequence179 85 798 gene locus_tag LOCUS_07090 85 798 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942449.1 protein_id gnl|my_center|LOCUS_07090 812 2350 gene locus_tag LOCUS_07100 gene guaA 812 2350 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence180 636 118 gene locus_tag LOCUS_07110 gene rplJ 636 118 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_07110 1433 741 gene locus_tag LOCUS_07120 gene rplA 1433 741 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943496.1 protein_id gnl|my_center|LOCUS_07120 1869 1444 gene locus_tag LOCUS_07130 gene rplK 1869 1444 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_07130 2412 1882 gene locus_tag LOCUS_07140 gene nusG 2412 1882 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393950.1 protein_id gnl|my_center|LOCUS_07140 2645 2424 gene locus_tag LOCUS_07150 gene secE 2645 2424 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943499.1 protein_id gnl|my_center|LOCUS_07150 2758 2682 gene locus_tag LOCUS_t00080 2758 2682 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 2905 2756 gene locus_tag LOCUS_07160 gene rpmG 2905 2756 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881260.1 protein_id gnl|my_center|LOCUS_07160 >Feature sequence181 2267 1212 gene locus_tag LOCUS_07170 gene thrC 2267 1212 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880238.1 protein_id gnl|my_center|LOCUS_07170 >Feature sequence182 186 674 gene locus_tag LOCUS_07180 gene tsaA 186 674 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249662.1 protein_id gnl|my_center|LOCUS_07180 2729 1386 gene locus_tag LOCUS_07190 2729 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 >Feature sequence183 1110 358 gene locus_tag LOCUS_07200 gene larE 1110 358 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964093.1 protein_id gnl|my_center|LOCUS_07200 1229 2176 gene locus_tag LOCUS_07210 1229 2176 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861553.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence184 2819 1107 gene locus_tag LOCUS_07220 gene recJ 2819 1107 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence185 954 19 gene locus_tag LOCUS_07230 954 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 1341 958 gene locus_tag LOCUS_07240 1341 958 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940486.1 protein_id gnl|my_center|LOCUS_07240 2694 1345 gene locus_tag LOCUS_07250 gene bioA 2694 1345 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964671.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence186 364 1617 gene locus_tag LOCUS_07260 364 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 1629 2360 gene locus_tag LOCUS_07270 1629 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence187 838 308 gene locus_tag LOCUS_07280 838 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 1499 828 gene locus_tag LOCUS_07290 1499 828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_07290 2868 1711 gene locus_tag LOCUS_07300 2868 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 >Feature sequence188 292 1302 gene locus_tag LOCUS_07310 292 1302 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942881.1 protein_id gnl|my_center|LOCUS_07310 1324 2022 gene locus_tag LOCUS_07320 1324 2022 CDS product cytidylate kinase-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583266.1 protein_id gnl|my_center|LOCUS_07320 2730 2002 gene locus_tag LOCUS_07330 2730 2002 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence189 1367 297 gene locus_tag LOCUS_07340 gene mobAB 1367 297 CDS product bifunctional molybdenum cofactor guanylyltransferase MobA/molybdopterin-guanine dinucleotide biosynthesis adaptor protein MobB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943769.1 protein_id gnl|my_center|LOCUS_07340 1656 1369 gene locus_tag LOCUS_07350 1656 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 2390 1656 gene locus_tag LOCUS_07360 gene ricT 2390 1656 CDS product regulatory iron-sulfur-containing complex subunit RicT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546016.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence190 535 1086 gene locus_tag LOCUS_07370 535 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 1263 1877 gene locus_tag LOCUS_07380 1263 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 <2951 1906 gene locus_tag LOCUS_07390 <2951 1906 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000145511.1:replication initiation protein >Feature sequence191 139 921 gene locus_tag LOCUS_07400 139 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 958 2619 gene locus_tag LOCUS_07410 958 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence192 728 459 gene locus_tag LOCUS_07420 728 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 1730 729 gene locus_tag LOCUS_07430 1730 729 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_07430 2518 1736 gene locus_tag LOCUS_07440 2518 1736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2670 2515 gene locus_tag LOCUS_07450 2670 2515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence193 205 1473 gene locus_tag LOCUS_07460 gene murD 205 1473 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545218.1 protein_id gnl|my_center|LOCUS_07460 1254 1263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1466 2569 gene locus_tag LOCUS_07470 gene ftsW 1466 2569 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943695.1 protein_id gnl|my_center|LOCUS_07470 2544 2666 gene locus_tag LOCUS_07480 2544 2666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence194 589 2565 gene locus_tag LOCUS_07490 gene cooS 589 2565 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066467.1 protein_id gnl|my_center|LOCUS_07490 >Feature sequence195 <1 811 gene locus_tag LOCUS_07500 <1 811 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868579.1:glycosyltransferase family 4 protein 795 2111 gene locus_tag LOCUS_07510 795 2111 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000822361.1 protein_id gnl|my_center|LOCUS_07510 2116 2781 gene locus_tag LOCUS_07520 2116 2781 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773049.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence196 <1 530 gene locus_tag LOCUS_07530 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584159.1:Crp/Fnr family transcriptional regulator 1301 519 gene locus_tag LOCUS_07540 1301 519 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020084.1 protein_id gnl|my_center|LOCUS_07540 2085 1309 gene locus_tag LOCUS_07550 2085 1309 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584029.1 protein_id gnl|my_center|LOCUS_07550 2362 2069 gene locus_tag LOCUS_07560 gene rpsT 2362 2069 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942846.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence197 1349 135 gene locus_tag LOCUS_07570 1349 135 CDS product DUF401 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545901.1 protein_id gnl|my_center|LOCUS_07570 2516 1353 gene locus_tag LOCUS_07580 2516 1353 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143109.1 protein_id gnl|my_center|LOCUS_07580 >Feature sequence198 229 1359 gene locus_tag LOCUS_07590 229 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 1511 2617 gene locus_tag LOCUS_07600 1511 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 >Feature sequence199 >Feature sequence200 2081 1719 gene locus_tag LOCUS_07610 2081 1719 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858673.1 protein_id gnl|my_center|LOCUS_07610 2212 2457 gene locus_tag LOCUS_07620 2212 2457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 >Feature sequence201 115 585 gene locus_tag LOCUS_07630 gene ribE 115 585 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_07630 595 2184 gene locus_tag LOCUS_07640 595 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence202 1513 77 gene locus_tag LOCUS_07650 gene gatA 1513 77 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943992.1 protein_id gnl|my_center|LOCUS_07650 2637 1528 gene locus_tag LOCUS_07660 2637 1528 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938320.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence203 2293 1037 gene locus_tag LOCUS_07670 gene clpX 2293 1037 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546526.1 protein_id gnl|my_center|LOCUS_07670 <2825 2302 gene locus_tag LOCUS_07680 <2825 2302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545836.1:biosynthetic-type acetolactate synthase large subunit >Feature sequence204 724 8 gene locus_tag LOCUS_07690 gene fabG 724 8 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_07690 371 380 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1920 724 gene locus_tag LOCUS_07700 1920 724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 <2819 1910 gene locus_tag LOCUS_07710 <2819 1910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073065.1:polysaccharide deacetylase family protein >Feature sequence205 1229 282 gene locus_tag LOCUS_07720 gene fabD 1229 282 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942247.1 protein_id gnl|my_center|LOCUS_07720 2201 1245 gene locus_tag LOCUS_07730 gene fabK 2201 1245 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419125.1 protein_id gnl|my_center|LOCUS_07730 <2816 2217 gene locus_tag LOCUS_07740 <2816 2217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392461.1:ketoacyl-ACP synthase III >Feature sequence206 1327 2094 gene locus_tag LOCUS_07750 1327 2094 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_07750 >Feature sequence207 1322 537 gene locus_tag LOCUS_07760 gene fliR 1322 537 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930333.1 protein_id gnl|my_center|LOCUS_07760 1657 1388 gene locus_tag LOCUS_07770 gene fliQ 1657 1388 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546140.1 protein_id gnl|my_center|LOCUS_07770 2437 1676 gene locus_tag LOCUS_07780 gene fliP 2437 1676 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence208 340 1422 gene locus_tag LOCUS_07790 340 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1540 1761 gene locus_tag LOCUS_07800 1540 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07800 1744 1753 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence209 128 2698 gene locus_tag LOCUS_07810 128 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence210 >Feature sequence211 <1 1883 gene locus_tag LOCUS_07820 <1 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975050.1:xanthine dehydrogenase family protein molybdopterin-binding subunit 1873 2067 gene locus_tag LOCUS_07830 1873 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 2076 2321 gene locus_tag LOCUS_07840 2076 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence212 1910 522 gene locus_tag LOCUS_07850 1910 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 <2787 1938 gene locus_tag LOCUS_07860 <2787 1938 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013385254.1:TRAP transporter large permease subunit >Feature sequence213 888 1655 gene locus_tag LOCUS_07870 888 1655 CDS product 3',5'-cyclic-nucleotide phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546308.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence214 >Feature sequence215 209 622 gene locus_tag LOCUS_07880 209 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 612 2177 gene locus_tag LOCUS_07890 612 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1649 1658 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2178 2741 gene locus_tag LOCUS_07900 2178 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence216 <1 756 gene locus_tag LOCUS_07910 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546774.1:phenylalanine--tRNA ligase subunit alpha 770 2323 gene locus_tag LOCUS_07920 770 2323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_07920 >Feature sequence217 1927 2370 gene locus_tag LOCUS_07930 1927 2370 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence218 1038 358 gene locus_tag LOCUS_07940 1038 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 <2763 1155 gene locus_tag LOCUS_07950 <2763 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052729532.1:DNA methyltransferase >Feature sequence219 2456 480 gene locus_tag LOCUS_07960 2456 480 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence220 974 783 gene locus_tag LOCUS_07970 974 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 2319 976 gene locus_tag LOCUS_07980 gene dnaA 2319 976 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence221 <1 1778 gene locus_tag LOCUS_07990 <1 1778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228476.1:TRAP transporter permease 2670 1771 gene locus_tag LOCUS_08000 2670 1771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 >Feature sequence222 <1 2102 gene locus_tag LOCUS_08010 <1 2102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein 2230 2154 gene locus_tag LOCUS_t00090 2230 2154 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 2319 2245 gene locus_tag LOCUS_t00100 2319 2245 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2610 2338 gene locus_tag LOCUS_08020 2610 2338 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391633.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence223 >Feature sequence224 340 885 gene locus_tag LOCUS_08030 340 885 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_08030 918 1220 gene locus_tag LOCUS_08040 918 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 1220 2398 gene locus_tag LOCUS_08050 gene porA 1220 2398 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868478.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence225 839 192 gene locus_tag LOCUS_08060 839 192 CDS product FmdE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927076.1 protein_id gnl|my_center|LOCUS_08060 1652 912 gene locus_tag LOCUS_08070 1652 912 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_08070 2224 1787 gene locus_tag LOCUS_08080 2224 1787 CDS product flavodoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021802.1 protein_id gnl|my_center|LOCUS_08080 >Feature sequence226 <1 1509 gene locus_tag LOCUS_08090 <1 1509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942111.1:NADP-dependent isocitrate dehydrogenase 1619 2575 gene locus_tag LOCUS_08100 1619 2575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence227 260 1030 gene locus_tag LOCUS_08110 260 1030 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722150.1 protein_id gnl|my_center|LOCUS_08110 1023 1856 gene locus_tag LOCUS_08120 1023 1856 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003429290.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence228 <1 808 gene locus_tag LOCUS_08130 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790471.1:PEP/pyruvate-binding domain-containing protein 1415 810 gene locus_tag LOCUS_08140 gene cbiM 1415 810 CDS product cobalt transporter CbiM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546305.1 protein_id gnl|my_center|LOCUS_08140 2164 1415 gene locus_tag LOCUS_08150 2164 1415 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence229 <2695 1758 gene locus_tag LOCUS_08160 <2695 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545008.1:glycoside hydrolase family 57 protein >Feature sequence230 <2694 791 gene locus_tag LOCUS_08170 <2694 791 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877386.1:radical SAM protein >Feature sequence231 1775 816 gene locus_tag LOCUS_08180 1775 816 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851095.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence232 <1 760 gene locus_tag LOCUS_08190 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948625.1:lysophospholipid acyltransferase family protein 2108 753 gene locus_tag LOCUS_08200 2108 753 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148202592.1 protein_id gnl|my_center|LOCUS_08200 <2682 2125 gene locus_tag LOCUS_08210 <2682 2125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003436139.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence233 >Feature sequence234 <1 1873 gene locus_tag LOCUS_08220 <1 1873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_136798312.1:glycosyltransferase 1870 2664 gene locus_tag LOCUS_08230 1870 2664 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004419153.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence235 999 28 gene locus_tag LOCUS_08240 999 28 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_08240 1480 1010 gene locus_tag LOCUS_08250 1480 1010 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029306122.1 protein_id gnl|my_center|LOCUS_08250 <2676 1489 gene locus_tag LOCUS_08260 <2676 1489 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119978.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence236 <1 1239 gene locus_tag LOCUS_08270 <1 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015063709.1:TRAP transporter large permease 1246 1998 gene locus_tag LOCUS_08280 1246 1998 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259471.1 protein_id gnl|my_center|LOCUS_08280 >Feature sequence237 2529 1978 gene locus_tag LOCUS_08290 2529 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence238 1374 433 gene locus_tag LOCUS_08300 gene hprK 1374 433 CDS product HPr(Ser) kinase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942530.1 protein_id gnl|my_center|LOCUS_08300 1839 1384 gene locus_tag LOCUS_08310 1839 1384 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005919085.1 protein_id gnl|my_center|LOCUS_08310 2369 1851 gene locus_tag LOCUS_08320 gene raiA 2369 1851 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938920.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence239 1728 436 gene locus_tag LOCUS_08330 1728 436 CDS product conjugal transfer protein TraF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001039344.1 protein_id gnl|my_center|LOCUS_08330 2606 1740 gene locus_tag LOCUS_08340 2606 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence240 296 21 gene locus_tag LOCUS_08350 296 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 919 293 gene locus_tag LOCUS_08360 919 293 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962633.1 protein_id gnl|my_center|LOCUS_08360 1529 921 gene locus_tag LOCUS_08370 gene dut 1529 921 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_08370 1497 1506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1939 1592 gene locus_tag LOCUS_08380 1939 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2285 1953 gene locus_tag LOCUS_08390 2285 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence241 1636 734 gene locus_tag LOCUS_08400 1636 734 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_08400 2618 1623 gene locus_tag LOCUS_08410 gene mnmA 2618 1623 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047964.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence242 643 2613 gene locus_tag LOCUS_08420 gene pglB 643 2613 CDS product undecaprenyl-diphosphooligosaccharide--protein glycotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852780.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence243 >Feature sequence244 317 898 gene locus_tag LOCUS_08430 317 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 915 1322 gene locus_tag LOCUS_08440 915 1322 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_08440 1339 2310 gene locus_tag LOCUS_08450 gene meaB 1339 2310 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942224.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence245 <1 674 gene locus_tag LOCUS_08460 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858465.1:RND family transporter 690 1202 gene locus_tag LOCUS_08470 690 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1199 2488 gene locus_tag LOCUS_08480 gene hemL 1199 2488 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545461.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence246 2562 2296 gene locus_tag LOCUS_08490 2562 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence247 246 440 gene locus_tag LOCUS_08500 246 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 870 2501 gene locus_tag LOCUS_08510 870 2501 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942080.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence248 4 2469 gene locus_tag LOCUS_08520 4 2469 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942688.1 protein_id gnl|my_center|LOCUS_08520 >Feature sequence249 1065 484 gene locus_tag LOCUS_08530 gene rsxA 1065 484 CDS product electron transport complex subunit RsxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000141550.1 protein_id gnl|my_center|LOCUS_08530 1313 1122 gene locus_tag LOCUS_08540 1313 1122 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_08540 2156 1323 gene locus_tag LOCUS_08550 2156 1323 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861372.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence250 230 36 gene locus_tag LOCUS_08560 230 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 >Feature sequence251 <1 845 gene locus_tag LOCUS_08570 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942378.1:branched-chain amino acid ABC transporter permease 829 1776 gene locus_tag LOCUS_08580 829 1776 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_08580 1821 2540 gene locus_tag LOCUS_08590 1821 2540 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525179.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence252 <2608 465 gene locus_tag LOCUS_08600 <2608 465 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048141058.1:PKD domain-containing protein >Feature sequence253 789 1571 gene locus_tag LOCUS_08610 gene pomA 789 1571 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000362404.1 protein_id gnl|my_center|LOCUS_08610 1561 2220 gene locus_tag LOCUS_08620 1561 2220 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986952.1 protein_id gnl|my_center|LOCUS_08620 2220 2600 gene locus_tag LOCUS_08630 2220 2600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence254 1303 785 gene locus_tag LOCUS_08640 1303 785 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_08640 1853 1308 gene locus_tag LOCUS_08650 1853 1308 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258749.1 protein_id gnl|my_center|LOCUS_08650 2221 1844 gene locus_tag LOCUS_08660 2221 1844 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence255 >Feature sequence256 2451 118 gene locus_tag LOCUS_08670 2451 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence257 2481 793 gene locus_tag LOCUS_08680 2481 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence258 1714 677 gene locus_tag LOCUS_08690 1714 677 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942731.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence259 1735 653 gene locus_tag LOCUS_08700 1735 653 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980223.1 protein_id gnl|my_center|LOCUS_08700 <2567 1928 gene locus_tag LOCUS_08710 <2567 1928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947237.1:septal ring lytic transglycosylase RlpA family protein >Feature sequence260 1264 632 gene locus_tag LOCUS_08720 1264 632 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004598533.1 protein_id gnl|my_center|LOCUS_08720 2295 1279 gene locus_tag LOCUS_08730 gene ilvC 2295 1279 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545824.1 protein_id gnl|my_center|LOCUS_08730 2564 2292 gene locus_tag LOCUS_08740 2564 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence261 84 1400 gene locus_tag LOCUS_08750 gene trmFO 84 1400 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880411.1 protein_id gnl|my_center|LOCUS_08750 1810 1424 gene locus_tag LOCUS_08760 1810 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 >Feature sequence262 2372 1371 gene locus_tag LOCUS_08770 2372 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence263 <1 738 gene locus_tag LOCUS_08780 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869569.1:peptide chain release factor 1 731 1597 gene locus_tag LOCUS_08790 gene prmC 731 1597 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003437849.1 protein_id gnl|my_center|LOCUS_08790 1614 2417 gene locus_tag LOCUS_08800 gene proC 1614 2417 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000360701.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence264 >Feature sequence265 125 709 gene locus_tag LOCUS_08810 gene hisB 125 709 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546516.1 protein_id gnl|my_center|LOCUS_08810 726 1340 gene locus_tag LOCUS_08820 gene hisH 726 1340 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_08820 1340 1984 gene locus_tag LOCUS_08830 1340 1984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 >Feature sequence266 564 971 gene locus_tag LOCUS_08840 564 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1035 2381 gene locus_tag LOCUS_08850 1035 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence267 212 1171 gene locus_tag LOCUS_08860 212 1171 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081442.1 protein_id gnl|my_center|LOCUS_08860 1777 1145 gene locus_tag LOCUS_08870 1777 1145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 <2546 1777 gene locus_tag LOCUS_08880 <2546 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767220.1:methionine--tRNA ligase >Feature sequence268 944 192 gene locus_tag LOCUS_08890 gene fdhD 944 192 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227709.1 protein_id gnl|my_center|LOCUS_08890 2099 948 gene locus_tag LOCUS_08900 2099 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence269 <1 709 gene locus_tag LOCUS_08910 <1 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942281.1:amidophosphoribosyltransferase 740 1954 gene locus_tag LOCUS_08920 gene nirJ1 740 1954 CDS product putative heme d1 biosynthesis radical SAM protein NirJ1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460179.1 protein_id gnl|my_center|LOCUS_08920 1986 2516 gene locus_tag LOCUS_08930 gene cobO 1986 2516 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942222.1 protein_id gnl|my_center|LOCUS_08930 >Feature sequence270 529 32 gene locus_tag LOCUS_08940 529 32 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458814.1 protein_id gnl|my_center|LOCUS_08940 1695 526 gene locus_tag LOCUS_08950 gene alaC 1695 526 CDS product alanine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546347.1 protein_id gnl|my_center|LOCUS_08950 2236 1706 gene locus_tag LOCUS_08960 2236 1706 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787811.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence271 >Feature sequence272 737 30 gene locus_tag LOCUS_08970 gene cas5b 737 30 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439785.1 protein_id gnl|my_center|LOCUS_08970 1007 741 gene locus_tag LOCUS_08980 1007 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530088.1 protein_id gnl|my_center|LOCUS_08980 1237 1004 gene locus_tag LOCUS_08990 1237 1004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 2178 1258 gene locus_tag LOCUS_09000 gene cas7i 2178 1258 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861770.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence273 381 2003 gene locus_tag LOCUS_09010 381 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 >Feature sequence274 222 566 gene locus_tag LOCUS_09020 222 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 554 871 gene locus_tag LOCUS_09030 554 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 822 1562 gene locus_tag LOCUS_09040 822 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 1540 2070 gene locus_tag LOCUS_09050 gene yfcE 1540 2070 CDS product phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428581.1 protein_id gnl|my_center|LOCUS_09050 2207 2479 gene locus_tag LOCUS_09060 2207 2479 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546355.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence275 902 462 gene locus_tag LOCUS_09070 gene fliN 902 462 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937357.1 protein_id gnl|my_center|LOCUS_09070 1887 904 gene locus_tag LOCUS_09080 gene fliM 1887 904 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938209.1 protein_id gnl|my_center|LOCUS_09080 2437 1910 gene locus_tag LOCUS_09090 2437 1910 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881216.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence276 >Feature sequence277 1639 401 gene locus_tag LOCUS_09100 1639 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2440 1652 gene locus_tag LOCUS_09110 2440 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence278 1215 436 gene locus_tag LOCUS_09120 1215 436 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546451.1 protein_id gnl|my_center|LOCUS_09120 >Feature sequence279 1302 706 gene locus_tag LOCUS_09130 1302 706 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870045.1 protein_id gnl|my_center|LOCUS_09130 <2510 1364 gene locus_tag LOCUS_09140 <2510 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016159.1:ATP-binding protein >Feature sequence280 <2493 146 gene locus_tag LOCUS_09150 <2493 146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase >Feature sequence281 227 412 gene locus_tag LOCUS_09160 227 412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 402 803 gene locus_tag LOCUS_09170 402 803 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331447.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence282 246 1772 gene locus_tag LOCUS_09180 246 1772 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence283 1237 512 gene locus_tag LOCUS_09190 1237 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1384 2007 gene locus_tag LOCUS_09200 1384 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2217 2041 gene locus_tag LOCUS_09210 2217 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence284 66 542 gene locus_tag LOCUS_09220 66 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1786 557 gene locus_tag LOCUS_09230 1786 557 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940443.1 protein_id gnl|my_center|LOCUS_09230 2415 1852 gene locus_tag LOCUS_09240 2415 1852 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943910.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence285 3 188 gene locus_tag LOCUS_09250 3 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 533 1087 gene locus_tag LOCUS_09260 533 1087 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258193.1 protein_id gnl|my_center|LOCUS_09260 1102 2439 gene locus_tag LOCUS_09270 1102 2439 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258192.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence286 1245 466 gene locus_tag LOCUS_09280 gene cobM 1245 466 CDS product precorrin-4 C(11)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871103.1 protein_id gnl|my_center|LOCUS_09280 2282 1260 gene locus_tag LOCUS_09290 2282 1260 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938090.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence287 2122 1559 gene locus_tag LOCUS_09300 2122 1559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 >Feature sequence288 853 38 gene locus_tag LOCUS_09310 853 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 >Feature sequence289 1999 341 gene locus_tag LOCUS_09320 gene ilvD 1999 341 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_09320 >Feature sequence290 >Feature sequence291 <1 517 gene locus_tag LOCUS_09330 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957235.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA 1367 507 gene locus_tag LOCUS_09340 1367 507 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256944.1 protein_id gnl|my_center|LOCUS_09340 2010 1348 gene locus_tag LOCUS_09350 2010 1348 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942096.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence292 2214 1426 gene locus_tag LOCUS_09360 2214 1426 CDS product enoyl-CoA hydratase/isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174808.1 protein_id gnl|my_center|LOCUS_09360 >Feature sequence293 298 1572 gene locus_tag LOCUS_09370 298 1572 CDS product TRAP transporter large permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937320.1 protein_id gnl|my_center|LOCUS_09370 1659 2381 gene locus_tag LOCUS_09380 1659 2381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence294 981 223 gene locus_tag LOCUS_09390 981 223 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582660.1 protein_id gnl|my_center|LOCUS_09390 1903 974 gene locus_tag LOCUS_09400 1903 974 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053095240.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence295 62 565 gene locus_tag LOCUS_09410 62 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 574 1293 gene locus_tag LOCUS_09420 574 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 1305 2300 gene locus_tag LOCUS_09430 1305 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 >Feature sequence296 12 1337 gene locus_tag LOCUS_09440 gene ahcY 12 1337 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545526.1 protein_id gnl|my_center|LOCUS_09440 1361 1963 gene locus_tag LOCUS_09450 gene pal 1361 1963 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546782.1 protein_id gnl|my_center|LOCUS_09450 >Feature sequence297 156 2135 gene locus_tag LOCUS_09460 gene aor 156 2135 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence298 1033 1341 gene locus_tag LOCUS_09470 1033 1341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 2039 1344 gene locus_tag LOCUS_09480 2039 1344 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004198636.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence299 335 1282 gene locus_tag LOCUS_09490 335 1282 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358892.1 protein_id gnl|my_center|LOCUS_09490 1560 1354 gene locus_tag LOCUS_09500 1560 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 1756 1550 gene locus_tag LOCUS_09510 1756 1550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence300 749 45 gene locus_tag LOCUS_09520 749 45 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 protein_id gnl|my_center|LOCUS_09520 1337 867 gene locus_tag LOCUS_09530 1337 867 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392649.1 protein_id gnl|my_center|LOCUS_09530 <2410 1339 gene locus_tag LOCUS_09540 <2410 1339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012533907.1:type IV pilus secretin PilQ >Feature sequence301 273 1922 gene locus_tag LOCUS_09550 273 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence302 296 138 gene locus_tag LOCUS_09560 296 138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 1131 298 gene locus_tag LOCUS_09570 1131 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846484.1 protein_id gnl|my_center|LOCUS_09570 1866 1345 gene locus_tag LOCUS_09580 1866 1345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880458.1 protein_id gnl|my_center|LOCUS_09580 2357 1863 gene locus_tag LOCUS_09590 2357 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880459.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence303 158 1051 gene locus_tag LOCUS_09600 158 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 1766 1329 gene locus_tag LOCUS_09610 1766 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence304 1525 401 gene locus_tag LOCUS_09620 gene ftsZ 1525 401 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943688.1 protein_id gnl|my_center|LOCUS_09620 <2394 1577 gene locus_tag LOCUS_09630 <2394 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943689.1:cell division protein FtsA >Feature sequence305 >Feature sequence306 <1 651 gene locus_tag LOCUS_09640 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258942.1:response regulator 820 1680 gene locus_tag LOCUS_09650 820 1680 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256215.1 protein_id gnl|my_center|LOCUS_09650 1697 2038 gene locus_tag LOCUS_09660 1697 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 >Feature sequence307 239 2368 gene locus_tag LOCUS_09670 239 2368 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence308 461 715 gene locus_tag LOCUS_09680 461 715 CDS product type II toxin-antitoxin system prevent-host-death family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388730.1 protein_id gnl|my_center|LOCUS_09680 708 968 gene locus_tag LOCUS_09690 708 968 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464459.1 protein_id gnl|my_center|LOCUS_09690 2225 984 gene locus_tag LOCUS_09700 2225 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 >Feature sequence309 >Feature sequence310 1 441 gene locus_tag LOCUS_09710 1 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 443 1624 gene locus_tag LOCUS_09720 443 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 <2370 1627 gene locus_tag LOCUS_09730 <2370 1627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879949.1:GGDEF domain-containing protein >Feature sequence311 1298 276 gene locus_tag LOCUS_09740 1298 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 2226 1393 gene locus_tag LOCUS_09750 2226 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence312 <1 890 gene locus_tag LOCUS_09760 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257630.1:sugar phosphate nucleotidyltransferase 1900 887 gene locus_tag LOCUS_09770 1900 887 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003733041.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence313 222 31 gene locus_tag LOCUS_09780 222 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 1496 234 gene locus_tag LOCUS_09790 gene hemA 1496 234 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546522.1 protein_id gnl|my_center|LOCUS_09790 2336 1509 gene locus_tag LOCUS_09800 gene ccsB 2336 1509 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence314 1131 124 gene locus_tag LOCUS_09810 1131 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 1435 2334 gene locus_tag LOCUS_09820 1435 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence315 488 18 gene locus_tag LOCUS_09830 488 18 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 1450 515 gene locus_tag LOCUS_09840 1450 515 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045001.1 protein_id gnl|my_center|LOCUS_09840 2231 1440 gene locus_tag LOCUS_09850 2231 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 >Feature sequence316 1947 64 gene locus_tag LOCUS_09860 1947 64 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865311.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence317 <1 1230 gene locus_tag LOCUS_09870 <1 1230 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937705.1:cache domain-containing protein >Feature sequence318 >Feature sequence319 835 1275 gene locus_tag LOCUS_09880 835 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 <2334 1272 gene locus_tag LOCUS_09890 <2334 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942226.1:CBS domain-containing protein >Feature sequence320 <1 845 gene locus_tag LOCUS_09900 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933859.1:polysaccharide biosynthesis C-terminal domain-containing protein 842 2113 gene locus_tag LOCUS_09910 842 2113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 >Feature sequence321 1524 55 gene locus_tag LOCUS_09920 1524 55 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021497.1 protein_id gnl|my_center|LOCUS_09920 <2323 1524 gene locus_tag LOCUS_09930 <2323 1524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545959.1:Trk system potassium transporter TrkA >Feature sequence322 951 76 gene locus_tag LOCUS_09940 gene sucD 951 76 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931961.1 protein_id gnl|my_center|LOCUS_09940 2129 969 gene locus_tag LOCUS_09950 gene sucC 2129 969 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001020785.1 protein_id gnl|my_center|LOCUS_09950 >Feature sequence323 322 131 gene locus_tag LOCUS_09960 322 131 CDS product CooT family nickel-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545767.1 protein_id gnl|my_center|LOCUS_09960 734 315 gene locus_tag LOCUS_09970 734 315 CDS product DUF3842 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545623.1 protein_id gnl|my_center|LOCUS_09970 <2317 796 gene locus_tag LOCUS_09980 <2317 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933059.1:chloride channel protein >Feature sequence324 2191 218 gene locus_tag LOCUS_09990 gene acs 2191 218 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391322.1 protein_id gnl|my_center|LOCUS_09990 >Feature sequence325 >Feature sequence326 774 205 gene locus_tag LOCUS_10000 774 205 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_10000 1956 790 gene locus_tag LOCUS_10010 1956 790 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583100.1 protein_id gnl|my_center|LOCUS_10010 >Feature sequence327 <1 902 gene locus_tag LOCUS_10020 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964501.1:fibronectin type III domain-containing protein >Feature sequence328 <1 962 gene locus_tag LOCUS_10030 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880089.1:sigma-54-dependent Fis family transcriptional regulator 1838 1302 gene locus_tag LOCUS_10040 1838 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence329 744 55 gene locus_tag LOCUS_10050 744 55 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990006.1 protein_id gnl|my_center|LOCUS_10050 <2281 756 gene locus_tag LOCUS_10060 <2281 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808106.1:ATP-binding protein >Feature sequence330 <1 1510 gene locus_tag LOCUS_10070 <1 1510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879949.1:GGDEF domain-containing protein 2280 1507 gene locus_tag LOCUS_10080 2280 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 >Feature sequence331 1402 1007 gene locus_tag LOCUS_10090 1402 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence332 107 1273 gene locus_tag LOCUS_10100 gene nifS 107 1273 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_10100 >Feature sequence333 74 883 gene locus_tag LOCUS_10110 74 883 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942082.1 protein_id gnl|my_center|LOCUS_10110 883 1506 gene locus_tag LOCUS_10120 883 1506 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582919.1 protein_id gnl|my_center|LOCUS_10120 1517 1693 gene locus_tag LOCUS_10130 1517 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1703 2086 gene locus_tag LOCUS_10140 1703 2086 CDS product iron-sulfur cluster assembly scaffold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392929.1 protein_id gnl|my_center|LOCUS_10140 >Feature sequence334 3 878 gene locus_tag LOCUS_10150 3 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 >Feature sequence335 130 723 gene locus_tag LOCUS_10160 130 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 738 2018 gene locus_tag LOCUS_10170 gene purD 738 2018 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941272.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence336 404 1102 gene locus_tag LOCUS_10180 404 1102 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_10180 1118 1564 gene locus_tag LOCUS_10190 1118 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1564 2244 gene locus_tag LOCUS_10200 1564 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence337 <2248 1037 gene locus_tag LOCUS_10210 <2248 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964994.1:U32 family peptidase >Feature sequence338 905 180 gene locus_tag LOCUS_10220 905 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 1896 925 gene locus_tag LOCUS_10230 gene fabH 1896 925 CDS product 3-oxoacyl-ACP synthase III FabH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722325.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence339 109 1011 gene locus_tag LOCUS_10240 gene argF 109 1011 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_10240 <2243 1003 gene locus_tag LOCUS_10250 <2243 1003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence340 860 2215 gene locus_tag LOCUS_10260 860 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence341 >Feature sequence342 <1 896 gene locus_tag LOCUS_10270 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:PAS domain-containing sensor histidine kinase 1276 899 gene locus_tag LOCUS_10280 1276 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 1702 1277 gene locus_tag LOCUS_10290 gene dtd 1702 1277 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_10290 <2223 1677 gene locus_tag LOCUS_10300 <2223 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858523.1:ferrochelatase >Feature sequence343 <1 1787 gene locus_tag LOCUS_10310 <1 1787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924874.1:ATP-binding protein 1791 1946 gene locus_tag LOCUS_10320 1791 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence344 2219 1611 gene locus_tag LOCUS_10330 2219 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 >Feature sequence345 <1 830 gene locus_tag LOCUS_10340 <1 830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001185445.1:methyl-accepting chemotaxis protein >Feature sequence346 1447 143 gene locus_tag LOCUS_10350 1447 143 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_10350 <2218 1458 gene locus_tag LOCUS_10360 <2218 1458 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262256.1:lytic murein transglycosylase >Feature sequence347 >Feature sequence348 1740 991 gene locus_tag LOCUS_10370 1740 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 2188 2054 gene locus_tag LOCUS_10380 2188 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 >Feature sequence349 1742 534 gene locus_tag LOCUS_10390 1742 534 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764755.1 protein_id gnl|my_center|LOCUS_10390 >Feature sequence350 757 1014 gene locus_tag LOCUS_10400 757 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 1024 1638 gene locus_tag LOCUS_10410 1024 1638 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091163.1 protein_id gnl|my_center|LOCUS_10410 1628 2029 gene locus_tag LOCUS_10420 1628 2029 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021779456.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence351 15 179 gene locus_tag LOCUS_10430 15 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 1050 919 gene locus_tag LOCUS_10440 1050 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 2090 1728 gene locus_tag LOCUS_10450 2090 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 >Feature sequence352 <2198 1358 gene locus_tag LOCUS_10460 <2198 1358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943853.1:ribonuclease G >Feature sequence353 2131 629 gene locus_tag LOCUS_10470 2131 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 >Feature sequence354 <2173 317 gene locus_tag LOCUS_10480 <2173 317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011947899.1:DNA gyrase subunit A >Feature sequence355 <1 953 gene locus_tag LOCUS_10490 <1 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197951145.1:DNA polymerase/3'-5' exonuclease PolX 950 1240 gene locus_tag LOCUS_10500 950 1240 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966071.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence356 1173 715 gene locus_tag LOCUS_10510 1173 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence357 >Feature sequence358 298 131 gene locus_tag LOCUS_10520 298 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1089 955 gene locus_tag LOCUS_10530 1089 955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 1708 1526 gene locus_tag LOCUS_10540 1708 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence359 1335 334 gene locus_tag LOCUS_10550 1335 334 CDS product Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869498.1 protein_id gnl|my_center|LOCUS_10550 1761 1351 gene locus_tag LOCUS_10560 1761 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 2145 1840 gene locus_tag LOCUS_10570 2145 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 >Feature sequence360 73 267 gene locus_tag LOCUS_10580 73 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence361 1577 522 gene locus_tag LOCUS_10590 gene ahbD 1577 522 CDS product heme b synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020622.1 protein_id gnl|my_center|LOCUS_10590 2042 1635 gene locus_tag LOCUS_10600 2042 1635 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940354.1 protein_id gnl|my_center|LOCUS_10600 >Feature sequence362 1734 778 gene locus_tag LOCUS_10610 1734 778 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005454688.1 protein_id gnl|my_center|LOCUS_10610 2138 1839 gene locus_tag LOCUS_10620 2138 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 >Feature sequence363 376 1713 gene locus_tag LOCUS_10630 gene mshL 376 1713 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence364 >Feature sequence365 <1 858 gene locus_tag LOCUS_10640 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002805291.1:flagellar hook protein FlgE >Feature sequence366 <1 1396 gene locus_tag LOCUS_10650 <1 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545959.1:Trk system potassium transporter TrkA >Feature sequence367 17 1405 gene locus_tag LOCUS_10660 17 1405 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence368 865 47 gene locus_tag LOCUS_10670 gene trmBL2 865 47 CDS product HTH-type transcriptional regulator TrmBL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146940.1 protein_id gnl|my_center|LOCUS_10670 1052 1954 gene locus_tag LOCUS_10680 gene dusB 1052 1954 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434962.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence369 >Feature sequence370 1166 639 gene locus_tag LOCUS_10690 1166 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 1874 1179 gene locus_tag LOCUS_10700 1874 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence371 >Feature sequence372 152 1630 gene locus_tag LOCUS_10710 152 1630 CDS product L-lactate permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107792.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence373 <1 574 gene locus_tag LOCUS_10720 <1 574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456304.1:type II secretion system F family protein 544 954 gene locus_tag LOCUS_10730 544 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 1044 1325 gene locus_tag LOCUS_10740 1044 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 <2102 1338 gene locus_tag LOCUS_10750 <2102 1338 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868579.1:glycosyltransferase family 4 protein >Feature sequence374 <2102 394 gene locus_tag LOCUS_10760 <2102 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_050518129.1:glycosyltransferase >Feature sequence375 28 1053 gene locus_tag LOCUS_10770 28 1053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1077 1412 gene locus_tag LOCUS_10780 1077 1412 CDS product anti-sigma factor antagonist inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670686.1 protein_id gnl|my_center|LOCUS_10780 1414 1920 gene locus_tag LOCUS_10790 1414 1920 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence376 185 598 gene locus_tag LOCUS_10800 185 598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 982 593 gene locus_tag LOCUS_10810 982 593 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043553480.1 protein_id gnl|my_center|LOCUS_10810 2062 995 gene locus_tag LOCUS_10820 2062 995 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_10820 >Feature sequence377 14 1234 gene locus_tag LOCUS_10830 14 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 1702 1583 gene locus_tag LOCUS_10840 1702 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence378 348 872 gene locus_tag LOCUS_10850 348 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence379 1925 546 gene locus_tag LOCUS_10860 1925 546 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942511.1 protein_id gnl|my_center|LOCUS_10860 1686 1695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence380 <1 544 gene locus_tag LOCUS_10870 <1 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990820.1:ion transporter 609 1382 gene locus_tag LOCUS_10880 609 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 1436 1524 gene locus_tag LOCUS_t00110 1436 1524 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1582 1657 gene locus_tag LOCUS_t00120 1582 1657 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence381 >Feature sequence382 1395 292 gene locus_tag LOCUS_10890 1395 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 1723 1412 gene locus_tag LOCUS_10900 1723 1412 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545961.1 protein_id gnl|my_center|LOCUS_10900 2036 1734 gene locus_tag LOCUS_10910 2036 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence383 <1 1837 gene locus_tag LOCUS_10920 <1 1837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941478.1:ATP-binding protein >Feature sequence384 784 305 gene locus_tag LOCUS_10930 784 305 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434079.1 protein_id gnl|my_center|LOCUS_10930 1936 992 gene locus_tag LOCUS_10940 1936 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence385 <2068 28 gene locus_tag LOCUS_10950 <2068 28 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:T9SS type A sorting domain-containing protein >Feature sequence386 1566 67 gene locus_tag LOCUS_10960 1566 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 1961 1581 gene locus_tag LOCUS_10970 1961 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence387 >Feature sequence388 1022 228 gene locus_tag LOCUS_10980 1022 228 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942855.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence389 <1 752 gene locus_tag LOCUS_10990 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207285055.1:phosphoglycerate dehydrogenase 1028 1960 gene locus_tag LOCUS_11000 1028 1960 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937649.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence390 374 66 gene locus_tag LOCUS_11010 374 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 954 592 gene locus_tag LOCUS_11020 954 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1202 1008 gene locus_tag LOCUS_11030 1202 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1642 1274 gene locus_tag LOCUS_11040 1642 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2014 1802 gene locus_tag LOCUS_11050 2014 1802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence391 1101 793 gene locus_tag LOCUS_11060 1101 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11060 <2059 1103 gene locus_tag LOCUS_11070 <2059 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_204874017.1:helicase-related protein >Feature sequence392 1768 521 gene locus_tag LOCUS_11080 1768 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence393 <1 1576 gene locus_tag LOCUS_11090 <1 1576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496444.1:pyruvate synthase subunit PorB >Feature sequence394 30 1916 gene locus_tag LOCUS_11100 30 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 >Feature sequence395 448 1995 gene locus_tag LOCUS_11110 448 1995 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877924.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence396 217 510 gene locus_tag LOCUS_11120 217 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11120 560 1687 gene locus_tag LOCUS_11130 560 1687 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816049.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence397 >Feature sequence398 <1 950 gene locus_tag LOCUS_11140 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546645.1:DNA methyltransferase 935 1558 gene locus_tag LOCUS_11150 935 1558 CDS product MjaI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545491.1 protein_id gnl|my_center|LOCUS_11150 >Feature sequence399 <2025 38 gene locus_tag LOCUS_11160 <2025 38 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011389031.1:ribonucleoside triphosphate reductase >Feature sequence400 <1 767 gene locus_tag LOCUS_11170 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942918.1:peptide chain release factor 2 >Feature sequence401 1429 482 gene locus_tag LOCUS_11180 1429 482 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941322.1 protein_id gnl|my_center|LOCUS_11180 1526 1451 gene locus_tag LOCUS_t00130 1526 1451 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence402 1002 340 gene locus_tag LOCUS_11190 1002 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 1756 1337 gene locus_tag LOCUS_11200 1756 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 >Feature sequence403 465 1 gene locus_tag LOCUS_11210 gene ribE 465 1 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 protein_id gnl|my_center|LOCUS_11210 794 462 gene locus_tag LOCUS_11220 794 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 694 703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 975 1706 gene locus_tag LOCUS_11230 975 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence404 1959 382 gene locus_tag LOCUS_11240 1959 382 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461744.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence405 180 464 gene locus_tag LOCUS_11250 180 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 512 1279 gene locus_tag LOCUS_11260 512 1279 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937361.1 protein_id gnl|my_center|LOCUS_11260 1276 1965 gene locus_tag LOCUS_11270 1276 1965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence406 1944 985 gene locus_tag LOCUS_11280 1944 985 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_11280 >Feature sequence407 <1 631 gene locus_tag LOCUS_11290 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_174849222.1:flagellar basal body P-ring formation chaperone FlgA 650 1732 gene locus_tag LOCUS_11300 650 1732 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence408 <1 947 gene locus_tag LOCUS_11310 <1 947 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858483.1:ketol-acid reductoisomerase 1001 1810 gene locus_tag LOCUS_11320 gene minD 1001 1810 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019069.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence409 3 1055 gene locus_tag LOCUS_11330 3 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence410 3 662 gene locus_tag LOCUS_11340 3 662 CDS product 5'-methylthioadenosine/adenosylhomocysteine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010896005.1 protein_id gnl|my_center|LOCUS_11340 717 1457 gene locus_tag LOCUS_11350 717 1457 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011969401.1 protein_id gnl|my_center|LOCUS_11350 >Feature sequence411 56 811 gene locus_tag LOCUS_11360 56 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 932 1129 gene locus_tag LOCUS_11370 932 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11370 >Feature sequence412 >Feature sequence413 <1 566 gene locus_tag LOCUS_11380 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022682.1:thiamine phosphate synthase 538 1836 gene locus_tag LOCUS_11390 gene thiC 538 1836 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392914.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence414 1796 837 gene locus_tag LOCUS_11400 gene bioB 1796 837 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942229.1 protein_id gnl|my_center|LOCUS_11400 >Feature sequence415 1133 339 gene locus_tag LOCUS_11410 1133 339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 <1976 1121 gene locus_tag LOCUS_11420 <1976 1121 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001011139.1:VWA domain-containing protein >Feature sequence416 <1 869 gene locus_tag LOCUS_11430 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943652.1:glycosyltransferase family 9 protein 880 1500 gene locus_tag LOCUS_11440 880 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937717.1 protein_id gnl|my_center|LOCUS_11440 1510 1935 gene locus_tag LOCUS_11450 1510 1935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence417 >Feature sequence418 1593 1183 gene locus_tag LOCUS_11460 1593 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 1806 1627 gene locus_tag LOCUS_11470 1806 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 >Feature sequence419 >Feature sequence420 320 778 gene locus_tag LOCUS_11480 gene ribE 320 778 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_11480 780 1187 gene locus_tag LOCUS_11490 gene nusB 780 1187 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546543.1 protein_id gnl|my_center|LOCUS_11490 1177 1479 gene locus_tag LOCUS_11500 1177 1479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 1472 1861 gene locus_tag LOCUS_11510 1472 1861 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943810.1 protein_id gnl|my_center|LOCUS_11510 >Feature sequence421 >Feature sequence422 1716 1444 gene locus_tag LOCUS_11520 1716 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence423 357 725 gene locus_tag LOCUS_11530 357 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 783 977 gene locus_tag LOCUS_11540 783 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence424 470 1225 gene locus_tag LOCUS_11550 gene cbiQ 470 1225 CDS product cobalt ECF transporter T component CbiQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545677.1 protein_id gnl|my_center|LOCUS_11550 1213 1869 gene locus_tag LOCUS_11560 1213 1869 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546570.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence425 1689 1153 gene locus_tag LOCUS_11570 1689 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_11570 >Feature sequence426 >Feature sequence427 68 1468 gene locus_tag LOCUS_11580 68 1468 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_11580 1593 1511 gene locus_tag LOCUS_t00140 1593 1511 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1656 1665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence428 <1953 375 gene locus_tag LOCUS_11590 <1953 375 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001047444.1:ATP-dependent deoxyribonuclease AddB >Feature sequence429 >Feature sequence430 1809 193 gene locus_tag LOCUS_11600 gene hflX 1809 193 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545622.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence431 480 944 gene locus_tag LOCUS_11610 480 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 947 1255 gene locus_tag LOCUS_11620 947 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence432 <1 795 gene locus_tag LOCUS_11630 <1 795 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029491176.1:polysaccharide deacetylase family protein >Feature sequence433 201 1421 gene locus_tag LOCUS_11640 201 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 >Feature sequence434 515 1132 gene locus_tag LOCUS_11650 515 1132 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191860.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence435 490 942 gene locus_tag LOCUS_11660 490 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 1054 1428 gene locus_tag LOCUS_11670 1054 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 1470 1688 gene locus_tag LOCUS_11680 1470 1688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence436 1644 115 gene locus_tag LOCUS_11690 1644 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence437 340 1500 gene locus_tag LOCUS_11700 gene argJ 340 1500 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546755.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence438 >Feature sequence439 1683 37 gene locus_tag LOCUS_11710 1683 37 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence440 <1931 427 gene locus_tag LOCUS_11720 <1931 427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546153.1:UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase >Feature sequence441 305 997 gene locus_tag LOCUS_11730 305 997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 1326 1021 gene locus_tag LOCUS_11740 1326 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 <1929 1332 gene locus_tag LOCUS_11750 <1929 1332 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942074.1:ATP-binding protein >Feature sequence442 1883 501 gene locus_tag LOCUS_11760 gene selA 1883 501 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545074.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence443 1107 892 gene locus_tag LOCUS_11770 1107 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 1487 1269 gene locus_tag LOCUS_11780 1487 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1781 1569 gene locus_tag LOCUS_11790 1781 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 >Feature sequence444 <1 1175 gene locus_tag LOCUS_11800 <1 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460436.1:NADH-quinone oxidoreductase subunit L >Feature sequence445 926 201 gene locus_tag LOCUS_11810 926 201 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544951.1 protein_id gnl|my_center|LOCUS_11810 <1920 923 gene locus_tag LOCUS_11820 <1920 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948168.1:methyl-accepting chemotaxis protein >Feature sequence446 1619 1215 gene locus_tag LOCUS_11830 1619 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence447 <1 1000 gene locus_tag LOCUS_11840 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852957.1:mechanosensitive ion channel 966 1610 gene locus_tag LOCUS_11850 966 1610 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930750.1 protein_id gnl|my_center|LOCUS_11850 1607 1858 gene locus_tag LOCUS_11860 1607 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence448 1652 321 gene locus_tag LOCUS_11870 gene hslU 1652 321 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence449 38 625 gene locus_tag LOCUS_11880 38 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence450 947 1216 gene locus_tag LOCUS_11890 947 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 >Feature sequence451 1188 55 gene locus_tag LOCUS_11900 gene dnaJ 1188 55 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_11900 <1907 1322 gene locus_tag LOCUS_11910 <1907 1322 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545409.1:molecular chaperone DnaK >Feature sequence452 <1 1189 gene locus_tag LOCUS_11920 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963430.1:tyrosine-protein kinase domain-containing protein >Feature sequence453 378 851 gene locus_tag LOCUS_11930 gene trmL 378 851 CDS product tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772048.1 protein_id gnl|my_center|LOCUS_11930 <1905 843 gene locus_tag LOCUS_11940 <1905 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence454 962 528 gene locus_tag LOCUS_11950 962 528 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814887.1 protein_id gnl|my_center|LOCUS_11950 1227 952 gene locus_tag LOCUS_11960 1227 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1676 1470 gene locus_tag LOCUS_11970 1676 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence455 363 785 gene locus_tag LOCUS_11980 363 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1016 1879 gene locus_tag LOCUS_11990 1016 1879 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003721396.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence456 739 314 gene locus_tag LOCUS_12000 gene rplK 739 314 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_12000 1287 757 gene locus_tag LOCUS_12010 gene nusG 1287 757 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943498.1 protein_id gnl|my_center|LOCUS_12010 1531 1292 gene locus_tag LOCUS_12020 1531 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 1630 1554 gene locus_tag LOCUS_t00150 1630 1554 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 1789 1637 gene locus_tag LOCUS_12030 gene rpmG 1789 1637 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943500.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence457 <1 794 gene locus_tag LOCUS_12040 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546417.1:pitrilysin family protein >Feature sequence458 199 44 gene locus_tag LOCUS_12050 199 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 469 1122 gene locus_tag LOCUS_12060 469 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence459 1452 418 gene locus_tag LOCUS_12070 gene mtnA 1452 418 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence460 355 364 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence461 570 1505 gene locus_tag LOCUS_12080 570 1505 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942295.1 protein_id gnl|my_center|LOCUS_12080 >Feature sequence462 1133 18 gene locus_tag LOCUS_12090 gene rfbG 1133 18 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934346.1 protein_id gnl|my_center|LOCUS_12090 <1891 1115 gene locus_tag LOCUS_12100 <1891 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937383.1:glucose-1-phosphate cytidylyltransferase >Feature sequence463 113 298 gene locus_tag LOCUS_12110 gene rpmF 113 298 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389355.1 protein_id gnl|my_center|LOCUS_12110 298 1353 gene locus_tag LOCUS_12120 gene plsX 298 1353 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence464 831 121 gene locus_tag LOCUS_12130 831 121 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_12130 1792 854 gene locus_tag LOCUS_12140 1792 854 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence465 748 74 gene locus_tag LOCUS_12150 748 74 CDS product flagellar basal body rod modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805290.1 protein_id gnl|my_center|LOCUS_12150 <1882 758 gene locus_tag LOCUS_12160 <1882 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891831.1:flagellar hook-length control protein FliK >Feature sequence466 >Feature sequence467 698 210 gene locus_tag LOCUS_12170 698 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1284 838 gene locus_tag LOCUS_12180 1284 838 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943713.1 protein_id gnl|my_center|LOCUS_12180 1494 1285 gene locus_tag LOCUS_12190 gene rpsU 1494 1285 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009874014.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence468 >Feature sequence469 439 1632 gene locus_tag LOCUS_12200 439 1632 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460369.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence470 1519 428 gene locus_tag LOCUS_12210 1519 428 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence471 1676 810 gene locus_tag LOCUS_12220 1676 810 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942649.1 protein_id gnl|my_center|LOCUS_12220 >Feature sequence472 >Feature sequence473 354 629 gene locus_tag LOCUS_12230 354 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence474 586 41 gene locus_tag LOCUS_12240 586 41 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868100.1 protein_id gnl|my_center|LOCUS_12240 <1854 653 gene locus_tag LOCUS_12250 <1854 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015444894.1:nicotinate phosphoribosyltransferase >Feature sequence475 860 477 gene locus_tag LOCUS_12260 860 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12260 <1852 915 gene locus_tag LOCUS_12270 <1852 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152804487.1:phosphoenolpyruvate--protein phosphotransferase >Feature sequence476 <1845 1070 gene locus_tag LOCUS_12280 <1845 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545433.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase >Feature sequence477 1177 578 gene locus_tag LOCUS_12290 1177 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1746 1198 gene locus_tag LOCUS_12300 1746 1198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence478 1839 673 gene locus_tag LOCUS_12310 1839 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence479 186 380 gene locus_tag LOCUS_12320 186 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 358 837 gene locus_tag LOCUS_12330 358 837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 822 1580 gene locus_tag LOCUS_12340 822 1580 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881445.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence480 1602 91 gene locus_tag LOCUS_12350 1602 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence481 <1 588 gene locus_tag LOCUS_12360 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546729.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence482 1821 703 gene locus_tag LOCUS_12370 1821 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence483 83 241 gene locus_tag LOCUS_12380 83 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 242 1375 gene locus_tag LOCUS_12390 242 1375 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868007.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence484 84 911 gene locus_tag LOCUS_12400 84 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 929 1819 gene locus_tag LOCUS_12410 929 1819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence485 193 1356 gene locus_tag LOCUS_12420 193 1356 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020134.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence486 >Feature sequence487 486 959 gene locus_tag LOCUS_12430 486 959 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062284418.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence488 <1 1002 gene locus_tag LOCUS_12440 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545054.1:HD domain-containing protein >Feature sequence489 448 65 gene locus_tag LOCUS_12450 448 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 840 469 gene locus_tag LOCUS_12460 840 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence490 <1 1385 gene locus_tag LOCUS_12470 <1 1385 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878783.1:methylmalonyl-CoA mutase family protein >Feature sequence491 <1808 1173 gene locus_tag LOCUS_12480 <1808 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004454756.1:radical SAM family heme chaperone HemW >Feature sequence492 >Feature sequence493 103 345 gene locus_tag LOCUS_12490 103 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence494 630 848 gene locus_tag LOCUS_12500 630 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 1076 1639 gene locus_tag LOCUS_12510 1076 1639 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921338.1 protein_id gnl|my_center|LOCUS_12510 >Feature sequence495 <1 874 gene locus_tag LOCUS_12520 <1 874 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003231949.1:flagellar biosynthesis protein FlhB >Feature sequence496 197 322 gene locus_tag LOCUS_12530 197 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 405 1334 gene locus_tag LOCUS_12540 405 1334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1344 1697 gene locus_tag LOCUS_12550 1344 1697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence497 225 1580 gene locus_tag LOCUS_12560 gene amrB 225 1580 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444593.1 protein_id gnl|my_center|LOCUS_12560 >Feature sequence498 268 909 gene locus_tag LOCUS_12570 268 909 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461604.1 protein_id gnl|my_center|LOCUS_12570 <1799 968 gene locus_tag LOCUS_12580 <1799 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721396.1:AEC family transporter >Feature sequence499 1747 245 gene locus_tag LOCUS_12590 gene dnaB 1747 245 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788141.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence500 808 817 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 830 1468 gene locus_tag LOCUS_12600 830 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_12600 >Feature sequence501 704 174 gene locus_tag LOCUS_12610 704 174 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948274.1 protein_id gnl|my_center|LOCUS_12610 1161 757 gene locus_tag LOCUS_12620 gene mce 1161 757 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_12620 1564 1163 gene locus_tag LOCUS_12630 1564 1163 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942223.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence502 <1 772 gene locus_tag LOCUS_12640 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942686.1:A24 family peptidase 778 1713 gene locus_tag LOCUS_12650 778 1713 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545673.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence503 1342 1115 gene locus_tag LOCUS_12660 1342 1115 CDS product DUF465 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546280.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence504 946 263 gene locus_tag LOCUS_12670 946 263 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942909.1 protein_id gnl|my_center|LOCUS_12670 <1784 949 gene locus_tag LOCUS_12680 <1784 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546542.1:Crp/Fnr family transcriptional regulator >Feature sequence505 205 1365 gene locus_tag LOCUS_12690 gene trpB 205 1365 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_132873806.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence506 <1 1462 gene locus_tag LOCUS_12700 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392708.1:FAD-dependent oxidoreductase >Feature sequence507 <1 621 gene locus_tag LOCUS_12710 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861967.1:adenosylcobinamide-phosphate synthase CbiB 618 1736 gene locus_tag LOCUS_12720 618 1736 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000600562.1 protein_id gnl|my_center|LOCUS_12720 >Feature sequence508 116 679 gene locus_tag LOCUS_12730 gene efp 116 679 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393047.1 protein_id gnl|my_center|LOCUS_12730 <1775 669 gene locus_tag LOCUS_12740 <1775 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546567.1:tRNA guanosine(34) transglycosylase Tgt >Feature sequence509 >Feature sequence510 <1 1270 gene locus_tag LOCUS_12750 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001038317.1:DNA polymerase I >Feature sequence511 <1 1568 gene locus_tag LOCUS_12760 <1 1568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012775423.1:right-handed parallel beta-helix repeat-containing protein >Feature sequence512 285 800 gene locus_tag LOCUS_12770 285 800 CDS product transcription repressor NadR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000812272.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence513 989 489 gene locus_tag LOCUS_12780 989 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 1609 1361 gene locus_tag LOCUS_12790 1609 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 >Feature sequence514 >Feature sequence515 1469 15 gene locus_tag LOCUS_12800 1469 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence516 <1 569 gene locus_tag LOCUS_12810 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_108558166.1:DEAD/DEAH box helicase >Feature sequence517 >Feature sequence518 <1750 1002 gene locus_tag LOCUS_12820 <1750 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943681.1:flagellar biosynthesis protein FlhA >Feature sequence519 3 122 gene locus_tag LOCUS_12830 3 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 135 1136 gene locus_tag LOCUS_12840 gene hflK 135 1136 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181409358.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence520 >Feature sequence521 1303 56 gene locus_tag LOCUS_12850 1303 56 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015770.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence522 <1 514 gene locus_tag LOCUS_12860 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761981.1:XRE family transcriptional regulator >Feature sequence523 360 1649 gene locus_tag LOCUS_12870 360 1649 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_12870 >Feature sequence524 361 1527 gene locus_tag LOCUS_12880 361 1527 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081194.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence525 186 1280 gene locus_tag LOCUS_12890 186 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1280 1693 gene locus_tag LOCUS_12900 1280 1693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence526 <1736 603 gene locus_tag LOCUS_12910 <1736 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706045.1:PAS domain S-box protein >Feature sequence527 >Feature sequence528 <1 903 gene locus_tag LOCUS_12920 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000397283.1:acyl-CoA dehydrogenase 893 1672 gene locus_tag LOCUS_12930 893 1672 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence529 <1 934 gene locus_tag LOCUS_12940 <1 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005459669.1:UDP-N-acetylglucosamine 4,6-dehydratase >Feature sequence530 828 286 gene locus_tag LOCUS_12950 828 286 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680868.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence531 357 1 gene locus_tag LOCUS_12960 gene rplN 357 1 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393927.1 protein_id gnl|my_center|LOCUS_12960 359 368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 615 382 gene locus_tag LOCUS_12970 615 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 824 615 gene locus_tag LOCUS_12980 824 615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 1200 826 gene locus_tag LOCUS_12990 gene rplP 1200 826 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810150.1 protein_id gnl|my_center|LOCUS_12990 1484 1558 gene locus_tag LOCUS_t00160 1484 1558 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence532 560 240 gene locus_tag LOCUS_13000 560 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 999 634 gene locus_tag LOCUS_13010 999 634 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870231.1 protein_id gnl|my_center|LOCUS_13010 <1726 1037 gene locus_tag LOCUS_13020 <1726 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941002.1:F0F1 ATP synthase subunit A >Feature sequence533 >Feature sequence534 1498 1274 gene locus_tag LOCUS_13030 1498 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence535 >Feature sequence536 >Feature sequence537 1442 555 gene locus_tag LOCUS_13040 1442 555 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545671.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence538 >Feature sequence539 1118 684 gene locus_tag LOCUS_13050 1118 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 >Feature sequence540 <1 1672 gene locus_tag LOCUS_13060 <1 1672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391442.1:acetoacetate--CoA ligase >Feature sequence541 310 1398 gene locus_tag LOCUS_13070 310 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence542 690 43 gene locus_tag LOCUS_13080 690 43 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 <1715 696 gene locus_tag LOCUS_13090 <1715 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545515.1:AAA family ATPase >Feature sequence543 1482 7 gene locus_tag LOCUS_13100 gene pelF 1482 7 CDS product GT4 family glycosyltransferase PelF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887358.1 protein_id gnl|my_center|LOCUS_13100 >Feature sequence544 1522 530 gene locus_tag LOCUS_13110 1522 530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence545 226 35 gene locus_tag LOCUS_13120 226 35 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937959.1 protein_id gnl|my_center|LOCUS_13120 <1708 290 gene locus_tag LOCUS_13130 <1708 290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942559.1:methylenetetrahydrofolate reductase C-terminal domain-containing protein >Feature sequence546 448 2 gene locus_tag LOCUS_13140 448 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 1389 448 gene locus_tag LOCUS_13150 1389 448 CDS product tripartite tricarboxylate transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223851095.1 protein_id gnl|my_center|LOCUS_13150 >Feature sequence547 59 889 gene locus_tag LOCUS_13160 gene xerD 59 889 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204200.1 protein_id gnl|my_center|LOCUS_13160 886 1179 gene locus_tag LOCUS_13170 886 1179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence548 <1 564 gene locus_tag LOCUS_13180 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011793001.1:sugar transferase 1215 559 gene locus_tag LOCUS_13190 1215 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence549 <1 592 gene locus_tag LOCUS_13200 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262977.1:MSHA biogenesis protein MshQ 589 1032 gene locus_tag LOCUS_13210 589 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1022 1558 gene locus_tag LOCUS_13220 1022 1558 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481015.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence550 >Feature sequence551 1631 201 gene locus_tag LOCUS_13230 gene gatB 1631 201 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence552 123 317 gene locus_tag LOCUS_13240 123 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 317 1591 gene locus_tag LOCUS_13250 gene serS 317 1591 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940715.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence553 >Feature sequence554 <1690 620 gene locus_tag LOCUS_13260 <1690 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939362.1:DEAD/DEAH box helicase >Feature sequence555 326 75 gene locus_tag LOCUS_13270 326 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 537 319 gene locus_tag LOCUS_13280 537 319 CDS product 2-oxoisovalerate dehydrogenase E1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545302.1 protein_id gnl|my_center|LOCUS_13280 1427 558 gene locus_tag LOCUS_13290 1427 558 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010968071.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence556 1046 378 gene locus_tag LOCUS_13300 gene purN 1046 378 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545849.1 protein_id gnl|my_center|LOCUS_13300 <1683 1059 gene locus_tag LOCUS_13310 <1683 1059 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942402.1:phosphoribosylformylglycinamidine cyclo-ligase >Feature sequence557 212 9 gene locus_tag LOCUS_13320 212 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 869 672 gene locus_tag LOCUS_13330 869 672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 1545 982 gene locus_tag LOCUS_13340 1545 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence558 334 1530 gene locus_tag LOCUS_13350 334 1530 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809685.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence559 920 342 gene locus_tag LOCUS_13360 920 342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926920.1 protein_id gnl|my_center|LOCUS_13360 <1680 913 gene locus_tag LOCUS_13370 <1680 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010945991.1:diguanylate cyclase >Feature sequence560 >Feature sequence561 <1 1528 gene locus_tag LOCUS_13380 <1 1528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003433028.1:prolyl-tRNA synthetase associated domain-containing protein >Feature sequence562 <1 1309 gene locus_tag LOCUS_13390 <1 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940832.1:argininosuccinate lyase >Feature sequence563 407 1174 gene locus_tag LOCUS_13400 gene pomA 407 1174 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_13400 >Feature sequence564 >Feature sequence565 1079 552 gene locus_tag LOCUS_13410 1079 552 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356161.1 protein_id gnl|my_center|LOCUS_13410 1452 1069 gene locus_tag LOCUS_13420 1452 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 >Feature sequence566 <1 1624 gene locus_tag LOCUS_13430 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938632.1:endopeptidase La >Feature sequence567 <1 844 gene locus_tag LOCUS_13440 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_084691428.1:PglZ domain-containing protein 844 1551 gene locus_tag LOCUS_13450 844 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392177.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence568 2 181 gene locus_tag LOCUS_13460 2 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 435 202 gene locus_tag LOCUS_13470 435 202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 648 1253 gene locus_tag LOCUS_13480 648 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence569 580 20 gene locus_tag LOCUS_13490 580 20 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545919.1 protein_id gnl|my_center|LOCUS_13490 1635 577 gene locus_tag LOCUS_13500 gene pilM 1635 577 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887416.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence570 224 1597 gene locus_tag LOCUS_13510 224 1597 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942946.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence571 >Feature sequence572 844 449 gene locus_tag LOCUS_13520 gene tsaE 844 449 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852319.1 protein_id gnl|my_center|LOCUS_13520 1252 881 gene locus_tag LOCUS_13530 gene msrB 1252 881 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence573 82 387 gene locus_tag LOCUS_13540 82 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 384 1076 gene locus_tag LOCUS_13550 384 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1358 1531 gene locus_tag LOCUS_13560 1358 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13560 >Feature sequence574 <1652 646 gene locus_tag LOCUS_13570 <1652 646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207012.1:nitrate reductase >Feature sequence575 <1 1005 gene locus_tag LOCUS_13580 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251214.1:transglutaminase-like domain-containing protein >Feature sequence576 318 166 gene locus_tag LOCUS_13590 318 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 923 1156 gene locus_tag LOCUS_13600 923 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1149 1406 gene locus_tag LOCUS_13610 1149 1406 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769718.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence577 >Feature sequence578 38 1168 gene locus_tag LOCUS_13620 38 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence579 197 9 gene locus_tag LOCUS_13630 197 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 1186 344 gene locus_tag LOCUS_13640 1186 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 >Feature sequence580 209 1126 gene locus_tag LOCUS_13650 209 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018641672.1 protein_id gnl|my_center|LOCUS_13650 1128 1385 gene locus_tag LOCUS_13660 1128 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence581 >Feature sequence582 >Feature sequence583 587 321 gene locus_tag LOCUS_13670 587 321 CDS product HPr family phosphocarrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942527.1 protein_id gnl|my_center|LOCUS_13670 998 591 gene locus_tag LOCUS_13680 998 591 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003505374.1 protein_id gnl|my_center|LOCUS_13680 <1633 1009 gene locus_tag LOCUS_13690 <1633 1009 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003416961.1:RNase adapter RapZ >Feature sequence584 146 463 gene locus_tag LOCUS_13700 146 463 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001059470.1 protein_id gnl|my_center|LOCUS_13700 591 517 gene locus_tag LOCUS_t00170 591 517 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 858 577 gene locus_tag LOCUS_13710 858 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 <1633 1046 gene locus_tag LOCUS_13720 <1633 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256763.1:DNA-directed RNA polymerase subunit beta >Feature sequence585 <1630 1043 gene locus_tag LOCUS_13730 <1630 1043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081188.1:glycosyltransferase >Feature sequence586 <1 616 gene locus_tag LOCUS_13740 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021256.1:ABC transporter ATP-binding protein 597 1352 gene locus_tag LOCUS_13750 597 1352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814372.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence587 441 1583 gene locus_tag LOCUS_13760 441 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 >Feature sequence588 <1 697 gene locus_tag LOCUS_13770 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003434244.1:aminotransferase class V-fold PLP-dependent enzyme 688 945 gene locus_tag LOCUS_13780 688 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence589 785 408 gene locus_tag LOCUS_13790 785 408 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792460.1 protein_id gnl|my_center|LOCUS_13790 <1620 985 gene locus_tag LOCUS_13800 <1620 985 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294604.1:tRNA-dihydrouridine synthase family protein >Feature sequence590 >Feature sequence591 >Feature sequence592 1572 937 gene locus_tag LOCUS_13810 1572 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence593 <1609 556 gene locus_tag LOCUS_13820 <1609 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_074859788.1:RHS repeat-associated core domain-containing protein >Feature sequence594 <1604 596 gene locus_tag LOCUS_13830 <1604 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545957.1:HD domain-containing protein >Feature sequence595 >Feature sequence596 1392 316 gene locus_tag LOCUS_13840 1392 316 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941901.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence597 1275 88 gene locus_tag LOCUS_13850 1275 88 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence598 249 1229 gene locus_tag LOCUS_13860 249 1229 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460055.1 protein_id gnl|my_center|LOCUS_13860 >Feature sequence599 713 937 gene locus_tag LOCUS_13870 713 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence600 1062 1 gene locus_tag LOCUS_13880 1062 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 <1595 1072 gene locus_tag LOCUS_13890 <1595 1072 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639909.1:SapC family protein >Feature sequence601 3 1526 gene locus_tag LOCUS_13900 3 1526 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942551.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence602 90 458 gene locus_tag LOCUS_13910 90 458 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence603 1389 1255 gene locus_tag LOCUS_13920 gene rpmH 1389 1255 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776864.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence604 1286 78 gene locus_tag LOCUS_13930 1286 78 CDS product OFA family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877874.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence605 1121 1215 gene locus_tag LOCUS_t00180 1121 1215 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 1236 1427 gene locus_tag LOCUS_13940 1236 1427 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545632.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence606 >Feature sequence607 823 164 gene locus_tag LOCUS_13950 gene ispD 823 164 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966461.1 protein_id gnl|my_center|LOCUS_13950 <1583 823 gene locus_tag LOCUS_13960 <1583 823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048364.1:PIN domain nuclease >Feature sequence608 >Feature sequence609 188 466 gene locus_tag LOCUS_13970 188 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13970 432 1184 gene locus_tag LOCUS_13980 432 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 >Feature sequence610 68 853 gene locus_tag LOCUS_13990 68 853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence611 <1575 712 gene locus_tag LOCUS_14000 <1575 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867831.1:proton-conducting transporter membrane subunit >Feature sequence612 346 355 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 362 1477 gene locus_tag LOCUS_14010 362 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14010 >Feature sequence613 >Feature sequence614 >Feature sequence615 <1570 984 gene locus_tag LOCUS_14020 <1570 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002780456.1:enoyl-ACP reductase FabI >Feature sequence616 <1 1330 gene locus_tag LOCUS_14030 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin family protein >Feature sequence617 <1 683 gene locus_tag LOCUS_14040 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003721396.1:AEC family transporter <1567 661 gene locus_tag LOCUS_14050 <1567 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861320.1:transporter substrate-binding domain-containing protein >Feature sequence618 <1 1032 gene locus_tag LOCUS_14060 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002869556.1:M99 family carboxypeptidase catalytic domain-containing protein >Feature sequence619 278 144 gene locus_tag LOCUS_14070 278 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 999 319 gene locus_tag LOCUS_14080 999 319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1451 999 gene locus_tag LOCUS_14090 1451 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 >Feature sequence620 328 1512 gene locus_tag LOCUS_14100 328 1512 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688780.1 protein_id gnl|my_center|LOCUS_14100 >Feature sequence621 696 28 gene locus_tag LOCUS_14110 696 28 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 <1559 731 gene locus_tag LOCUS_14120 <1559 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004440884.1:DAK2 domain-containing protein >Feature sequence622 123 1028 gene locus_tag LOCUS_14130 123 1028 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250169.1 protein_id gnl|my_center|LOCUS_14130 >Feature sequence623 1250 495 gene locus_tag LOCUS_14140 1250 495 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858388.1 protein_id gnl|my_center|LOCUS_14140 1488 1240 gene locus_tag LOCUS_14150 1488 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 >Feature sequence624 <1 1416 gene locus_tag LOCUS_14160 <1 1416 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942465.1:[protein-PII] uridylyltransferase >Feature sequence625 122 409 gene locus_tag LOCUS_14170 122 409 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545694.1 protein_id gnl|my_center|LOCUS_14170 409 813 gene locus_tag LOCUS_14180 409 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 810 1412 gene locus_tag LOCUS_14190 810 1412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 >Feature sequence626 839 129 gene locus_tag LOCUS_14200 839 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 1218 805 gene locus_tag LOCUS_14210 1218 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 820 829 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence627 <1549 167 gene locus_tag LOCUS_14220 <1549 167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546425.1:lytic transglycosylase domain-containing protein >Feature sequence628 <1 1316 gene locus_tag LOCUS_14230 <1 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000432947.1:radical SAM protein 1309 1527 gene locus_tag LOCUS_14240 1309 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 >Feature sequence629 <1 722 gene locus_tag LOCUS_14250 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010725246.1:DUF3820 family protein >Feature sequence630 >Feature sequence631 >Feature sequence632 211 1251 gene locus_tag LOCUS_14260 gene hrcA 211 1251 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence633 939 157 gene locus_tag LOCUS_14270 gene hisF 939 157 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943716.1 protein_id gnl|my_center|LOCUS_14270 1166 951 gene locus_tag LOCUS_14280 1166 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 >Feature sequence634 <1524 370 gene locus_tag LOCUS_14290 <1524 370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016463.1:glutamate-1-semialdehyde 2,1-aminomutase >Feature sequence635 >Feature sequence636 159 383 gene locus_tag LOCUS_14300 159 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1289 420 gene locus_tag LOCUS_14310 1289 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 >Feature sequence637 223 963 gene locus_tag LOCUS_14320 223 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 1490 972 gene locus_tag LOCUS_14330 gene ppa 1490 972 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881004.1 protein_id gnl|my_center|LOCUS_14330 >Feature sequence638 >Feature sequence639 528 1349 gene locus_tag LOCUS_14340 528 1349 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207107.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence640 309 1502 gene locus_tag LOCUS_14350 gene hisD 309 1502 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546313.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence641 >Feature sequence642 <1511 812 gene locus_tag LOCUS_14360 <1511 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938821.1:TIGR00730 family Rossman fold protein >Feature sequence643 1280 78 gene locus_tag LOCUS_14370 1280 78 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence644 184 193 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1365 331 gene locus_tag LOCUS_14380 1365 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence645 <1507 627 gene locus_tag LOCUS_14390 <1507 627 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257549.1:response regulator >Feature sequence646 <1503 304 gene locus_tag LOCUS_14400 <1503 304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958380.1:LbtU family siderophore porin >Feature sequence647 <1502 781 gene locus_tag LOCUS_14410 <1502 781 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986975.1:glycosyltransferase >Feature sequence648 <1501 212 gene locus_tag LOCUS_14420 <1501 212 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259235.1:S8 family peptidase >Feature sequence649 354 1475 gene locus_tag LOCUS_14430 354 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430