>Feature sequence0001 911 1642 gene locus_tag LOCUS_00010 911 1642 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275323.1 protein_id gnl|my_center|LOCUS_00010 2584 1763 gene locus_tag LOCUS_00020 2584 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2609 5494 gene locus_tag LOCUS_00030 2609 5494 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898759.1 protein_id gnl|my_center|LOCUS_00030 5546 7339 gene locus_tag LOCUS_00040 5546 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00040 9059 7401 gene locus_tag LOCUS_00050 9059 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 10279 9242 gene locus_tag LOCUS_00060 10279 9242 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763547.1 protein_id gnl|my_center|LOCUS_00060 10825 12966 gene locus_tag LOCUS_00070 10825 12966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 13075 13689 gene locus_tag LOCUS_00080 13075 13689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 14669 13713 gene locus_tag LOCUS_00090 14669 13713 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258074.1 protein_id gnl|my_center|LOCUS_00090 14945 15550 gene locus_tag LOCUS_00100 14945 15550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 15711 16769 gene locus_tag LOCUS_00110 gene nuoH 15711 16769 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552781.1 protein_id gnl|my_center|LOCUS_00110 >Feature sequence0002 2528 13351 gene locus_tag LOCUS_00120 2528 13351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13846 13421 gene locus_tag LOCUS_00130 13846 13421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14041 14958 gene locus_tag LOCUS_00140 14041 14958 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963067.1 protein_id gnl|my_center|LOCUS_00140 >Feature sequence0003 183 683 gene locus_tag LOCUS_00150 183 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 854 1258 gene locus_tag LOCUS_00160 854 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 1340 1588 gene locus_tag LOCUS_00170 1340 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 2004 2966 gene locus_tag LOCUS_00180 2004 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 2974 5400 gene locus_tag LOCUS_00190 2974 5400 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_00190 5468 6106 gene locus_tag LOCUS_00200 5468 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 6682 7995 gene locus_tag LOCUS_00210 6682 7995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 8063 8743 gene locus_tag LOCUS_00220 8063 8743 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_00220 8743 9681 gene locus_tag LOCUS_00230 8743 9681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 9795 10493 gene locus_tag LOCUS_00240 9795 10493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 10490 10978 gene locus_tag LOCUS_00250 gene ribE 10490 10978 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454467.1 protein_id gnl|my_center|LOCUS_00250 11292 11876 gene locus_tag LOCUS_00260 11292 11876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 11901 12728 gene locus_tag LOCUS_00270 11901 12728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 12742 12972 gene locus_tag LOCUS_00280 12742 12972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 13200 13766 gene locus_tag LOCUS_00290 13200 13766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 >Feature sequence0004 <1 550 gene locus_tag LOCUS_00300 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546137.1:amidohydrolase family protein 543 1046 gene locus_tag LOCUS_00310 543 1046 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389754.1 protein_id gnl|my_center|LOCUS_00310 1114 1842 gene locus_tag LOCUS_00320 1114 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00320 2039 2500 gene locus_tag LOCUS_00330 2039 2500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 3385 3089 gene locus_tag LOCUS_00340 3385 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 6960 3538 gene locus_tag LOCUS_00350 6960 3538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 7645 7157 gene locus_tag LOCUS_00360 gene rnhA 7645 7157 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962375.1 protein_id gnl|my_center|LOCUS_00360 7769 8467 gene locus_tag LOCUS_00370 7769 8467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 8618 10096 gene locus_tag LOCUS_00380 8618 10096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 11485 10148 gene locus_tag LOCUS_00390 11485 10148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 13185 11734 gene locus_tag LOCUS_00400 13185 11734 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327912.1 protein_id gnl|my_center|LOCUS_00400 13947 13213 gene locus_tag LOCUS_00410 13947 13213 CDS product PmeII family type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233708.1 protein_id gnl|my_center|LOCUS_00410 >Feature sequence0005 1618 767 gene locus_tag LOCUS_00420 1618 767 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_00420 2171 1947 gene locus_tag LOCUS_00430 2171 1947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 3739 2300 gene locus_tag LOCUS_00440 3739 2300 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962644.1 protein_id gnl|my_center|LOCUS_00440 3839 5839 gene locus_tag LOCUS_00450 3839 5839 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444445.1 protein_id gnl|my_center|LOCUS_00450 7149 5902 gene locus_tag LOCUS_00460 7149 5902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962254.1 protein_id gnl|my_center|LOCUS_00460 7561 7121 gene locus_tag LOCUS_00470 7561 7121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 8690 7563 gene locus_tag LOCUS_00480 8690 7563 CDS product di-heme oxidoredictase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962256.1 protein_id gnl|my_center|LOCUS_00480 9022 9741 gene locus_tag LOCUS_00490 9022 9741 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173508710.1 protein_id gnl|my_center|LOCUS_00490 10869 9916 gene locus_tag LOCUS_00500 10869 9916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 11386 11874 gene locus_tag LOCUS_00510 11386 11874 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_00510 11936 12394 gene locus_tag LOCUS_00520 11936 12394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 >Feature sequence0006 173 1030 gene locus_tag LOCUS_00530 173 1030 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086558.1 protein_id gnl|my_center|LOCUS_00530 1870 1496 gene locus_tag LOCUS_00540 gene crcB 1870 1496 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939743.1 protein_id gnl|my_center|LOCUS_00540 2459 1863 gene locus_tag LOCUS_00550 2459 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 4038 2479 gene locus_tag LOCUS_00560 gene gpmI 4038 2479 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964233.1 protein_id gnl|my_center|LOCUS_00560 4190 4582 gene locus_tag LOCUS_00570 4190 4582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 5052 5687 gene locus_tag LOCUS_00580 5052 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 5823 7154 gene locus_tag LOCUS_00590 5823 7154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 7363 8856 gene locus_tag LOCUS_00600 7363 8856 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337079.1 protein_id gnl|my_center|LOCUS_00600 9912 8893 gene locus_tag LOCUS_00610 gene ruvB 9912 8893 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964224.1 protein_id gnl|my_center|LOCUS_00610 10809 10288 gene locus_tag LOCUS_00620 10809 10288 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029031045.1 protein_id gnl|my_center|LOCUS_00620 11863 10949 gene locus_tag LOCUS_00630 11863 10949 CDS product NmrA/HSCARG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142276.1 protein_id gnl|my_center|LOCUS_00630 12378 13367 gene locus_tag LOCUS_00640 12378 13367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 >Feature sequence0007 <1 702 gene locus_tag LOCUS_00650 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528000.1:aromatic ring-hydroxylating dioxygenase subunit alpha 900 3905 gene locus_tag LOCUS_00660 900 3905 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_00660 3972 5291 gene locus_tag LOCUS_00670 3972 5291 CDS product RagB/SusD family nutrient uptake outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_022835601.1 protein_id gnl|my_center|LOCUS_00670 5368 6204 gene locus_tag LOCUS_00680 5368 6204 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392779.1 protein_id gnl|my_center|LOCUS_00680 6327 6581 gene locus_tag LOCUS_00690 6327 6581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 8162 6465 gene locus_tag LOCUS_00700 8162 6465 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878782.1 protein_id gnl|my_center|LOCUS_00700 8965 8414 gene locus_tag LOCUS_00710 8965 8414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 9045 9989 gene locus_tag LOCUS_00720 9045 9989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 10436 11071 gene locus_tag LOCUS_00730 10436 11071 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268114.1 protein_id gnl|my_center|LOCUS_00730 >Feature sequence0008 <1 1187 gene locus_tag LOCUS_00740 <1 1187 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964003.1:CTP synthase 1285 3171 gene locus_tag LOCUS_00750 gene yidC 1285 3171 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763174.1 protein_id gnl|my_center|LOCUS_00750 3313 3609 gene locus_tag LOCUS_00760 3313 3609 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667001.1 protein_id gnl|my_center|LOCUS_00760 3602 3967 gene locus_tag LOCUS_00770 3602 3967 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680824.1 protein_id gnl|my_center|LOCUS_00770 4664 4020 gene locus_tag LOCUS_00780 4664 4020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 5141 8437 gene locus_tag LOCUS_00790 5141 8437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 8803 9774 gene locus_tag LOCUS_00800 8803 9774 CDS product NADPH:quinone oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114042.1 protein_id gnl|my_center|LOCUS_00800 9838 10575 gene locus_tag LOCUS_00810 9838 10575 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335855.1 protein_id gnl|my_center|LOCUS_00810 10580 11905 gene locus_tag LOCUS_00820 10580 11905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 11919 12743 gene locus_tag LOCUS_00830 11919 12743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 12821 13003 gene locus_tag LOCUS_00840 12821 13003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence0009 485 132 gene locus_tag LOCUS_00850 gene rplS 485 132 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898626.1 protein_id gnl|my_center|LOCUS_00850 1315 641 gene locus_tag LOCUS_00860 gene trmD 1315 641 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963979.1 protein_id gnl|my_center|LOCUS_00860 2158 1673 gene locus_tag LOCUS_00870 2158 1673 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359806.1 protein_id gnl|my_center|LOCUS_00870 3472 2477 gene locus_tag LOCUS_00880 3472 2477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 4876 3785 gene locus_tag LOCUS_00890 gene serC 4876 3785 CDS product phosphoserine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011029607.1 protein_id gnl|my_center|LOCUS_00890 4988 6172 gene locus_tag LOCUS_00900 4988 6172 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000065081.1 protein_id gnl|my_center|LOCUS_00900 7080 6208 gene locus_tag LOCUS_00910 7080 6208 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434910.1 protein_id gnl|my_center|LOCUS_00910 7517 8677 gene locus_tag LOCUS_00920 7517 8677 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_00920 10065 8683 gene locus_tag LOCUS_00930 gene hydA 10065 8683 CDS product dihydropyrimidinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066590.1 protein_id gnl|my_center|LOCUS_00930 11831 10092 gene locus_tag LOCUS_00940 11831 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 >Feature sequence0010 1270 83 gene locus_tag LOCUS_00950 1270 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002263257.1 protein_id gnl|my_center|LOCUS_00950 1926 1351 gene locus_tag LOCUS_00960 1926 1351 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763969.1 protein_id gnl|my_center|LOCUS_00960 2663 1926 gene locus_tag LOCUS_00970 2663 1926 CDS product beta-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259103.1 protein_id gnl|my_center|LOCUS_00970 4266 2764 gene locus_tag LOCUS_00980 gene glpK 4266 2764 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015864.1 protein_id gnl|my_center|LOCUS_00980 5513 4455 gene locus_tag LOCUS_00990 5513 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 6538 5684 gene locus_tag LOCUS_01000 6538 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 8110 6827 gene locus_tag LOCUS_01010 8110 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 9936 8341 gene locus_tag LOCUS_01020 9936 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01020 <12344 10014 gene locus_tag LOCUS_01030 <12344 10014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838961.1:tetratricopeptide repeat protein >Feature sequence0011 162 532 gene locus_tag LOCUS_tm00010 162 532 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 1823 693 gene locus_tag LOCUS_01040 1823 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 1952 2923 gene locus_tag LOCUS_01050 1952 2923 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479569.1 protein_id gnl|my_center|LOCUS_01050 2953 4269 gene locus_tag LOCUS_01060 2953 4269 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051113354.1 protein_id gnl|my_center|LOCUS_01060 4573 5970 gene locus_tag LOCUS_01070 4573 5970 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870209.1 protein_id gnl|my_center|LOCUS_01070 6029 6101 gene locus_tag LOCUS_t00010 6029 6101 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6190 7749 gene locus_tag LOCUS_01080 6190 7749 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_01080 9206 8115 gene locus_tag LOCUS_01090 9206 8115 CDS product DUF3179 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256451.1 protein_id gnl|my_center|LOCUS_01090 9610 10014 gene locus_tag LOCUS_01100 9610 10014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 10066 10437 gene locus_tag LOCUS_01110 10066 10437 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942448.1 protein_id gnl|my_center|LOCUS_01110 10913 11593 gene locus_tag LOCUS_01120 10913 11593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 >Feature sequence0012 233 532 gene locus_tag LOCUS_01130 233 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 848 1774 gene locus_tag LOCUS_01140 848 1774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 1800 2990 gene locus_tag LOCUS_01150 1800 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3037 3993 gene locus_tag LOCUS_01160 3037 3993 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601375.1 protein_id gnl|my_center|LOCUS_01160 3993 5111 gene locus_tag LOCUS_01170 3993 5111 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023661.1 protein_id gnl|my_center|LOCUS_01170 5960 5760 gene locus_tag LOCUS_01180 5960 5760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 6215 7264 gene locus_tag LOCUS_01190 6215 7264 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208591.1 protein_id gnl|my_center|LOCUS_01190 7342 8127 gene locus_tag LOCUS_01200 7342 8127 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_01200 8180 9157 gene locus_tag LOCUS_01210 8180 9157 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000433078.1 protein_id gnl|my_center|LOCUS_01210 9302 10225 gene locus_tag LOCUS_01220 9302 10225 CDS product glycosyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004186499.1 protein_id gnl|my_center|LOCUS_01220 10288 12141 gene locus_tag LOCUS_01230 10288 12141 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946701.1 protein_id gnl|my_center|LOCUS_01230 >Feature sequence0013 892 338 gene locus_tag LOCUS_01240 892 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 1931 876 gene locus_tag LOCUS_01250 1931 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 2758 1925 gene locus_tag LOCUS_01260 2758 1925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 3578 2784 gene locus_tag LOCUS_01270 3578 2784 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_01270 4998 3670 gene locus_tag LOCUS_01280 4998 3670 CDS product phenylacetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879167.1 protein_id gnl|my_center|LOCUS_01280 6573 5023 gene locus_tag LOCUS_01290 6573 5023 CDS product 4-hydroxyphenylacetate 3-hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878527.1 protein_id gnl|my_center|LOCUS_01290 7132 8244 gene locus_tag LOCUS_01300 7132 8244 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086606.1 protein_id gnl|my_center|LOCUS_01300 9157 8984 gene locus_tag LOCUS_01310 9157 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 9505 10110 gene locus_tag LOCUS_01320 9505 10110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 10124 10828 gene locus_tag LOCUS_01330 10124 10828 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085970.1 protein_id gnl|my_center|LOCUS_01330 10835 11521 gene locus_tag LOCUS_01340 10835 11521 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809848.1 protein_id gnl|my_center|LOCUS_01340 11539 11757 gene locus_tag LOCUS_01350 11539 11757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 >Feature sequence0014 190 711 gene locus_tag LOCUS_01360 190 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 2147 981 gene locus_tag LOCUS_01370 2147 981 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256669.1 protein_id gnl|my_center|LOCUS_01370 2786 2331 gene locus_tag LOCUS_01380 2786 2331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 3993 2779 gene locus_tag LOCUS_01390 3993 2779 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479643.1 protein_id gnl|my_center|LOCUS_01390 4637 4008 gene locus_tag LOCUS_01400 4637 4008 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226991426.1 protein_id gnl|my_center|LOCUS_01400 4855 5445 gene locus_tag LOCUS_01410 4855 5445 CDS product DNA-3-methyladenine glycosylase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045020.1 protein_id gnl|my_center|LOCUS_01410 5894 9808 gene locus_tag LOCUS_01420 5894 9808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 11669 10296 gene locus_tag LOCUS_01430 gene nhaD 11669 10296 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence0015 498 731 gene locus_tag LOCUS_01440 498 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01440 1166 2698 gene locus_tag LOCUS_01450 1166 2698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 3741 4358 gene locus_tag LOCUS_01460 3741 4358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01460 4355 5173 gene locus_tag LOCUS_01470 4355 5173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 5221 6246 gene locus_tag LOCUS_01480 5221 6246 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081188.1 protein_id gnl|my_center|LOCUS_01480 6410 8872 gene locus_tag LOCUS_01490 6410 8872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 9217 9489 gene locus_tag LOCUS_01500 9217 9489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 10113 10793 gene locus_tag LOCUS_01510 10113 10793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 11276 11962 gene locus_tag LOCUS_01520 11276 11962 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393842.1 protein_id gnl|my_center|LOCUS_01520 >Feature sequence0016 154 1245 gene locus_tag LOCUS_01530 gene lpxB 154 1245 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_01530 1996 1418 gene locus_tag LOCUS_01540 gene yfbR 1996 1418 CDS product 5'-deoxynucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171739.1 protein_id gnl|my_center|LOCUS_01540 2249 7420 gene locus_tag LOCUS_01550 2249 7420 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000686845.1 protein_id gnl|my_center|LOCUS_01550 7432 8349 gene locus_tag LOCUS_01560 7432 8349 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403347.1 protein_id gnl|my_center|LOCUS_01560 8373 9938 gene locus_tag LOCUS_01570 8373 9938 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766137.1 protein_id gnl|my_center|LOCUS_01570 9910 11562 gene locus_tag LOCUS_01580 9910 11562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 >Feature sequence0017 884 180 gene locus_tag LOCUS_01590 884 180 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_01590 1715 930 gene locus_tag LOCUS_01600 1715 930 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000567380.1 protein_id gnl|my_center|LOCUS_01600 3643 1712 gene locus_tag LOCUS_01610 3643 1712 CDS product glutamate-cysteine ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062080.1 protein_id gnl|my_center|LOCUS_01610 4455 3868 gene locus_tag LOCUS_01620 4455 3868 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962901.1 protein_id gnl|my_center|LOCUS_01620 5205 4609 gene locus_tag LOCUS_01630 5205 4609 CDS product DUF937 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120998.1 protein_id gnl|my_center|LOCUS_01630 5323 6375 gene locus_tag LOCUS_01640 gene aroB 5323 6375 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963817.1 protein_id gnl|my_center|LOCUS_01640 8956 6776 gene locus_tag LOCUS_01650 8956 6776 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919006.1 protein_id gnl|my_center|LOCUS_01650 10306 9011 gene locus_tag LOCUS_01660 10306 9011 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761420.1 protein_id gnl|my_center|LOCUS_01660 11551 10310 gene locus_tag LOCUS_01670 11551 10310 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766931.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence0018 460 1161 gene locus_tag LOCUS_01680 460 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1527 2684 gene locus_tag LOCUS_01690 1527 2684 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839857.1 protein_id gnl|my_center|LOCUS_01690 2703 3758 gene locus_tag LOCUS_01700 2703 3758 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973787.1 protein_id gnl|my_center|LOCUS_01700 3966 5114 gene locus_tag LOCUS_01710 3966 5114 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071679105.1 protein_id gnl|my_center|LOCUS_01710 5167 6402 gene locus_tag LOCUS_01720 5167 6402 CDS product ectonucleotide pyrophosphatase/phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_098062761.1 protein_id gnl|my_center|LOCUS_01720 6403 6873 gene locus_tag LOCUS_01730 6403 6873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 6895 7497 gene locus_tag LOCUS_01740 6895 7497 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099939.1 protein_id gnl|my_center|LOCUS_01740 7487 7948 gene locus_tag LOCUS_01750 7487 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 9284 7926 gene locus_tag LOCUS_01760 9284 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 <11691 9636 gene locus_tag LOCUS_01770 <11691 9636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203231.1:SusF/SusE family outer membrane protein >Feature sequence0019 247 789 gene locus_tag LOCUS_01780 gene yjjX 247 789 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001226224.1 protein_id gnl|my_center|LOCUS_01780 1101 1292 gene locus_tag LOCUS_01790 1101 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 1448 3520 gene locus_tag LOCUS_01800 1448 3520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 4898 3549 gene locus_tag LOCUS_01810 4898 3549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 7042 5027 gene locus_tag LOCUS_01820 7042 5027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 8746 7337 gene locus_tag LOCUS_01830 8746 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence0020 3715 2660 gene locus_tag LOCUS_01840 3715 2660 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964071.1 protein_id gnl|my_center|LOCUS_01840 4185 3769 gene locus_tag LOCUS_01850 4185 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 4520 4188 gene locus_tag LOCUS_01860 4520 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 6634 4646 gene locus_tag LOCUS_01870 6634 4646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 6823 7173 gene locus_tag LOCUS_01880 6823 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 8211 7207 gene locus_tag LOCUS_01890 8211 7207 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387819.1 protein_id gnl|my_center|LOCUS_01890 8794 9765 gene locus_tag LOCUS_01900 8794 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 11624 10371 gene locus_tag LOCUS_01910 11624 10371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence0021 1436 501 gene locus_tag LOCUS_01920 1436 501 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963848.1 protein_id gnl|my_center|LOCUS_01920 1595 3082 gene locus_tag LOCUS_01930 1595 3082 CDS product catalase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269092.1 protein_id gnl|my_center|LOCUS_01930 3371 3598 gene locus_tag LOCUS_01940 3371 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 3675 4634 gene locus_tag LOCUS_01950 3675 4634 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_01950 4631 6538 gene locus_tag LOCUS_01960 4631 6538 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107811.1 protein_id gnl|my_center|LOCUS_01960 6582 7604 gene locus_tag LOCUS_01970 6582 7604 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206182.1 protein_id gnl|my_center|LOCUS_01970 9486 8122 gene locus_tag LOCUS_01980 9486 8122 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118973.1 protein_id gnl|my_center|LOCUS_01980 <11464 9626 gene locus_tag LOCUS_01990 <11464 9626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007330113.1:CRTAC1 family protein >Feature sequence0022 1124 180 gene locus_tag LOCUS_02000 1124 180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 2810 1134 gene locus_tag LOCUS_02010 2810 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 3656 2871 gene locus_tag LOCUS_02020 gene gldL 3656 2871 CDS product gliding motility protein GldL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964074.1 protein_id gnl|my_center|LOCUS_02020 4881 3811 gene locus_tag LOCUS_02030 4881 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 6070 5081 gene locus_tag LOCUS_02040 6070 5081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 7014 6253 gene locus_tag LOCUS_02050 7014 6253 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_02050 8013 7111 gene locus_tag LOCUS_02060 gene hemC 8013 7111 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842596.1 protein_id gnl|my_center|LOCUS_02060 9524 8028 gene locus_tag LOCUS_02070 9524 8028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 9726 10439 gene locus_tag LOCUS_02080 9726 10439 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963729.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence0023 4422 280 gene locus_tag LOCUS_02090 4422 280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 4510 4989 gene locus_tag LOCUS_02100 4510 4989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 6141 5062 gene locus_tag LOCUS_02110 6141 5062 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931764.1 protein_id gnl|my_center|LOCUS_02110 6993 6343 gene locus_tag LOCUS_02120 6993 6343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_02120 7372 7016 gene locus_tag LOCUS_02130 7372 7016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 8557 7925 gene locus_tag LOCUS_02140 8557 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 9144 8563 gene locus_tag LOCUS_02150 9144 8563 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763967.1 protein_id gnl|my_center|LOCUS_02150 9250 10095 gene locus_tag LOCUS_02160 9250 10095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 10385 10849 gene locus_tag LOCUS_02170 10385 10849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02170 >Feature sequence0024 288 863 gene locus_tag LOCUS_02180 288 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 1904 1140 gene locus_tag LOCUS_02190 1904 1140 CDS product copper homeostasis protein CutC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063172331.1 protein_id gnl|my_center|LOCUS_02190 2955 1948 gene locus_tag LOCUS_02200 2955 1948 CDS product N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038037.1 protein_id gnl|my_center|LOCUS_02200 4188 3115 gene locus_tag LOCUS_02210 4188 3115 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254572.1 protein_id gnl|my_center|LOCUS_02210 4526 5443 gene locus_tag LOCUS_02220 4526 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 5492 6673 gene locus_tag LOCUS_02230 5492 6673 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390788.1 protein_id gnl|my_center|LOCUS_02230 7014 7460 gene locus_tag LOCUS_02240 7014 7460 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_122034607.1 protein_id gnl|my_center|LOCUS_02240 7658 9232 gene locus_tag LOCUS_02250 gene lepB 7658 9232 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963265.1 protein_id gnl|my_center|LOCUS_02250 9573 9337 gene locus_tag LOCUS_02260 9573 9337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 <10984 9761 gene locus_tag LOCUS_02270 <10984 9761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203207.1:ATP-binding cassette domain-containing protein >Feature sequence0025 248 517 gene locus_tag LOCUS_02280 248 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 811 1584 gene locus_tag LOCUS_02290 811 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 3319 1949 gene locus_tag LOCUS_02300 3319 1949 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122824.1 protein_id gnl|my_center|LOCUS_02300 3463 4767 gene locus_tag LOCUS_02310 3463 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 4916 5575 gene locus_tag LOCUS_02320 4916 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 5572 5757 gene locus_tag LOCUS_02330 5572 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 5800 6078 gene locus_tag LOCUS_02340 5800 6078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 6313 6483 gene locus_tag LOCUS_02350 6313 6483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 6606 7163 gene locus_tag LOCUS_02360 6606 7163 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108164.1 protein_id gnl|my_center|LOCUS_02360 7291 8271 gene locus_tag LOCUS_02370 7291 8271 CDS product FecR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765756.1 protein_id gnl|my_center|LOCUS_02370 >Feature sequence0026 2037 5306 gene locus_tag LOCUS_02380 2037 5306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 5409 5485 gene locus_tag LOCUS_t00020 5409 5485 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7673 5640 gene locus_tag LOCUS_02390 7673 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 8078 7728 gene locus_tag LOCUS_02400 8078 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 <10852 8093 gene locus_tag LOCUS_02410 <10852 8093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein note possible pseudo, internal stop codon, frameshifted >Feature sequence0027 <1 2427 gene locus_tag LOCUS_02420 <1 2427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058185.1:CHAT domain-containing protein 5566 2441 gene locus_tag LOCUS_02430 5566 2441 CDS product DUF5107 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109240.1 protein_id gnl|my_center|LOCUS_02430 6714 5713 gene locus_tag LOCUS_02440 gene sbnB 6714 5713 CDS product 2,3-diaminopropionate biosynthesis protein SbnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002115662.1 protein_id gnl|my_center|LOCUS_02440 7659 6724 gene locus_tag LOCUS_02450 7659 6724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 8628 7660 gene locus_tag LOCUS_02460 gene sbnA 8628 7660 CDS product 2,3-diaminopropionate biosynthesis protein SbnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207017.1 protein_id gnl|my_center|LOCUS_02460 9661 8630 gene locus_tag LOCUS_02470 gene alr 9661 8630 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011181633.1 protein_id gnl|my_center|LOCUS_02470 >Feature sequence0028 784 2163 gene locus_tag LOCUS_02480 784 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 3414 2365 gene locus_tag LOCUS_02490 3414 2365 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000917836.1 protein_id gnl|my_center|LOCUS_02490 3521 4357 gene locus_tag LOCUS_02500 gene sseA 3521 4357 CDS product 3-mercaptopyruvate sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338566.1 protein_id gnl|my_center|LOCUS_02500 4354 4782 gene locus_tag LOCUS_02510 4354 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 6189 4816 gene locus_tag LOCUS_02520 gene nhaD 6189 4816 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966224.1 protein_id gnl|my_center|LOCUS_02520 8267 6480 gene locus_tag LOCUS_02530 8267 6480 CDS product alpha-amylase family glycosyl hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202799.1 protein_id gnl|my_center|LOCUS_02530 9300 9881 gene locus_tag LOCUS_02540 9300 9881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 >Feature sequence0029 548 2152 gene locus_tag LOCUS_02550 548 2152 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_02550 2302 4122 gene locus_tag LOCUS_02560 2302 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 7013 4107 gene locus_tag LOCUS_02570 gene gcvP 7013 4107 CDS product aminomethyl-transferring glycine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012166094.1 protein_id gnl|my_center|LOCUS_02570 7160 7810 gene locus_tag LOCUS_02580 7160 7810 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404680.1 protein_id gnl|my_center|LOCUS_02580 9203 8034 gene locus_tag LOCUS_02590 9203 8034 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226125.1 protein_id gnl|my_center|LOCUS_02590 >Feature sequence0030 1167 3506 gene locus_tag LOCUS_02600 1167 3506 CDS product heavy metal translocating P-type ATPase metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963291.1 protein_id gnl|my_center|LOCUS_02600 3645 3815 gene locus_tag LOCUS_02610 3645 3815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 3796 5982 gene locus_tag LOCUS_02620 gene ccoN 3796 5982 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_02620 6021 6230 gene locus_tag LOCUS_02630 6021 6230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 6227 7135 gene locus_tag LOCUS_02640 6227 7135 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963296.1 protein_id gnl|my_center|LOCUS_02640 7230 8666 gene locus_tag LOCUS_02650 gene ccoG 7230 8666 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963297.1 protein_id gnl|my_center|LOCUS_02650 8673 9128 gene locus_tag LOCUS_02660 8673 9128 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963298.1 protein_id gnl|my_center|LOCUS_02660 9141 9809 gene locus_tag LOCUS_02670 9141 9809 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963299.1 protein_id gnl|my_center|LOCUS_02670 >Feature sequence0031 954 871 gene locus_tag LOCUS_t00030 954 871 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1106 3397 gene locus_tag LOCUS_02680 1106 3397 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796220.1 protein_id gnl|my_center|LOCUS_02680 3533 5554 gene locus_tag LOCUS_02690 3533 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 5850 5623 gene locus_tag LOCUS_02700 5850 5623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 6541 6053 gene locus_tag LOCUS_02710 gene rfaE2 6541 6053 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931903.1 protein_id gnl|my_center|LOCUS_02710 7659 6898 gene locus_tag LOCUS_02720 7659 6898 CDS product [alpha-L-fucopyranosyl-(1->3)-alpha-L-rhamnopyranosyl-(1->3)-2-O-methyl-alpha-L-rhamnopyranosyl] dimycocerosyl phenol-phthiocerol 2'''-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899556.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence0032 <1 1106 gene locus_tag LOCUS_02730 <1 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405560.1:SusC/RagA family TonB-linked outer membrane protein 1150 2796 gene locus_tag LOCUS_02740 1150 2796 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405561.1 protein_id gnl|my_center|LOCUS_02740 2973 4940 gene locus_tag LOCUS_02750 2973 4940 CDS product 4-hydroxy-3-methylbut-2-en-1-yl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108331.1 protein_id gnl|my_center|LOCUS_02750 5039 6589 gene locus_tag LOCUS_02760 5039 6589 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393655.1 protein_id gnl|my_center|LOCUS_02760 8596 6692 gene locus_tag LOCUS_02770 8596 6692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 9154 9783 gene locus_tag LOCUS_02780 9154 9783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 >Feature sequence0033 697 110 gene locus_tag LOCUS_02790 697 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 1011 832 gene locus_tag LOCUS_02800 1011 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 1723 1421 gene locus_tag LOCUS_02810 1723 1421 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784184.1 protein_id gnl|my_center|LOCUS_02810 2048 1707 gene locus_tag LOCUS_02820 2048 1707 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201974.1 protein_id gnl|my_center|LOCUS_02820 2223 2843 gene locus_tag LOCUS_02830 2223 2843 CDS product FMN-binding negative transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479904.1 protein_id gnl|my_center|LOCUS_02830 2840 3982 gene locus_tag LOCUS_02840 2840 3982 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006310902.1 protein_id gnl|my_center|LOCUS_02840 3979 4920 gene locus_tag LOCUS_02850 3979 4920 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970027.1 protein_id gnl|my_center|LOCUS_02850 5501 6460 gene locus_tag LOCUS_02860 5501 6460 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107797.1 protein_id gnl|my_center|LOCUS_02860 6457 7197 gene locus_tag LOCUS_02870 6457 7197 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764714.1 protein_id gnl|my_center|LOCUS_02870 7399 8937 gene locus_tag LOCUS_02880 7399 8937 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108010.1 protein_id gnl|my_center|LOCUS_02880 9766 9224 gene locus_tag LOCUS_02890 9766 9224 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405616.1 protein_id gnl|my_center|LOCUS_02890 >Feature sequence0034 1037 45 gene locus_tag LOCUS_02900 1037 45 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766605.1 protein_id gnl|my_center|LOCUS_02900 2451 1048 gene locus_tag LOCUS_02910 2451 1048 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761968.1 protein_id gnl|my_center|LOCUS_02910 3711 2869 gene locus_tag LOCUS_02920 3711 2869 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790222.1 protein_id gnl|my_center|LOCUS_02920 3868 3686 gene locus_tag LOCUS_02930 3868 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 5288 4188 gene locus_tag LOCUS_02940 5288 4188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 5348 6085 gene locus_tag LOCUS_02950 5348 6085 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965790.1 protein_id gnl|my_center|LOCUS_02950 6236 6562 gene locus_tag LOCUS_02960 6236 6562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 7030 7221 gene locus_tag LOCUS_02970 7030 7221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 <9800 7401 gene locus_tag LOCUS_02980 <9800 7401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929161.1:VCBS repeat-containing protein >Feature sequence0035 1132 284 gene locus_tag LOCUS_02990 1132 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1940 1164 gene locus_tag LOCUS_03000 1940 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2392 1937 gene locus_tag LOCUS_03010 2392 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 4643 4119 gene locus_tag LOCUS_03020 4643 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 6685 5402 gene locus_tag LOCUS_03030 6685 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 9052 8603 gene locus_tag LOCUS_03040 9052 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 9684 9418 gene locus_tag LOCUS_03050 9684 9418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03050 >Feature sequence0036 1604 327 gene locus_tag LOCUS_03060 1604 327 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921601.1 protein_id gnl|my_center|LOCUS_03060 2394 1741 gene locus_tag LOCUS_03070 2394 1741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2733 2993 gene locus_tag LOCUS_03080 2733 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_03080 2977 3216 gene locus_tag LOCUS_03090 2977 3216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 4612 3185 gene locus_tag LOCUS_03100 4612 3185 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118827171.1 protein_id gnl|my_center|LOCUS_03100 7340 4875 gene locus_tag LOCUS_03110 7340 4875 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503907.1 protein_id gnl|my_center|LOCUS_03110 7459 8901 gene locus_tag LOCUS_03120 7459 8901 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053756.1 protein_id gnl|my_center|LOCUS_03120 >Feature sequence0037 <1 7789 gene locus_tag LOCUS_03130 <1 7789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein 8491 8126 gene locus_tag LOCUS_03140 8491 8126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03140 8780 8496 gene locus_tag LOCUS_03150 8780 8496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03150 9247 8951 gene locus_tag LOCUS_03160 9247 8951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03160 >Feature sequence0038 923 3043 gene locus_tag LOCUS_03170 923 3043 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392035.1 protein_id gnl|my_center|LOCUS_03170 3054 3704 gene locus_tag LOCUS_03180 gene cas5c 3054 3704 CDS product type I-C CRISPR-associated protein Cas5c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392034.1 protein_id gnl|my_center|LOCUS_03180 3704 5389 gene locus_tag LOCUS_03190 gene cas8c 3704 5389 CDS product type I-C CRISPR-associated protein Cas8c/Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392033.1 protein_id gnl|my_center|LOCUS_03190 5389 6294 gene locus_tag LOCUS_03200 gene cas7c 5389 6294 CDS product type I-C CRISPR-associated protein Cas7/Csd2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392032.1 protein_id gnl|my_center|LOCUS_03200 6330 6941 gene locus_tag LOCUS_03210 gene cas4 6330 6941 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392031.1 protein_id gnl|my_center|LOCUS_03210 6943 7989 gene locus_tag LOCUS_03220 gene cas1c 6943 7989 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392030.1 protein_id gnl|my_center|LOCUS_03220 7993 8283 gene locus_tag LOCUS_03230 gene cas2 7993 8283 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392029.1 protein_id gnl|my_center|LOCUS_03230 8466 >9641 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgctccgtccttaattgggcggagaggattgaaac >Feature sequence0039 <1 777 gene locus_tag LOCUS_03240 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002561589.1:RNA polymerase sigma factor RpoD/SigA 1287 871 gene locus_tag LOCUS_03250 1287 871 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669943.1 protein_id gnl|my_center|LOCUS_03250 1427 1284 gene locus_tag LOCUS_03260 1427 1284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 2912 1569 gene locus_tag LOCUS_03270 gene accC 2912 1569 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_03270 3523 3008 gene locus_tag LOCUS_03280 gene accB 3523 3008 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_03280 4187 3621 gene locus_tag LOCUS_03290 gene efp 4187 3621 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963122.1 protein_id gnl|my_center|LOCUS_03290 5287 4337 gene locus_tag LOCUS_03300 5287 4337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6273 5284 gene locus_tag LOCUS_03310 6273 5284 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964468.1 protein_id gnl|my_center|LOCUS_03310 6652 7170 gene locus_tag LOCUS_03320 6652 7170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 8333 7323 gene locus_tag LOCUS_03330 gene aroF 8333 7323 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545770.1 protein_id gnl|my_center|LOCUS_03330 >Feature sequence0040 357 1331 gene locus_tag LOCUS_03340 357 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1500 2189 gene locus_tag LOCUS_03350 1500 2189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2648 4090 gene locus_tag LOCUS_03360 2648 4090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 4345 5859 gene locus_tag LOCUS_03370 4345 5859 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964569.1 protein_id gnl|my_center|LOCUS_03370 6401 8587 gene locus_tag LOCUS_03380 6401 8587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence0041 1042 3855 gene locus_tag LOCUS_03390 gene carB 1042 3855 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964089.1 protein_id gnl|my_center|LOCUS_03390 4413 3886 gene locus_tag LOCUS_03400 4413 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 5671 4460 gene locus_tag LOCUS_03410 5671 4460 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_03410 7327 5840 gene locus_tag LOCUS_03420 gene miaB 7327 5840 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964081.1 protein_id gnl|my_center|LOCUS_03420 7658 8740 gene locus_tag LOCUS_03430 gene aroC 7658 8740 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802245.1 protein_id gnl|my_center|LOCUS_03430 <9355 8792 gene locus_tag LOCUS_03440 <9355 8792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057636.1:Uma2 family endonuclease >Feature sequence0042 796 236 gene locus_tag LOCUS_03450 796 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 1051 878 gene locus_tag LOCUS_03460 1051 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 1285 1139 gene locus_tag LOCUS_03470 1285 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 2062 3423 gene locus_tag LOCUS_03480 2062 3423 CDS product sodium:alanine symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956710.1 protein_id gnl|my_center|LOCUS_03480 3649 3740 gene locus_tag LOCUS_t00040 3649 3740 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 3786 3861 gene locus_tag LOCUS_t00050 3786 3861 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3962 4036 gene locus_tag LOCUS_t00060 3962 4036 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4327 4557 gene locus_tag LOCUS_03490 4327 4557 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_03490 4567 4767 gene locus_tag LOCUS_03500 4567 4767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 4806 5243 gene locus_tag LOCUS_03510 4806 5243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 5806 5402 gene locus_tag LOCUS_03520 5806 5402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 6024 6239 gene locus_tag LOCUS_03530 6024 6239 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202295.1 protein_id gnl|my_center|LOCUS_03530 6505 7278 gene locus_tag LOCUS_03540 6505 7278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 7454 8782 gene locus_tag LOCUS_03550 gene rimO 7454 8782 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963524.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence0043 625 1638 gene locus_tag LOCUS_03560 625 1638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 1816 2895 gene locus_tag LOCUS_03570 1816 2895 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393984.1 protein_id gnl|my_center|LOCUS_03570 3944 2928 gene locus_tag LOCUS_03580 3944 2928 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_03580 4959 4132 gene locus_tag LOCUS_03590 4959 4132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5899 5681 gene locus_tag LOCUS_03600 5899 5681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 5934 6476 gene locus_tag LOCUS_03610 5934 6476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 7769 6720 gene locus_tag LOCUS_03620 gene ribD 7769 6720 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766987.1 protein_id gnl|my_center|LOCUS_03620 8351 7923 gene locus_tag LOCUS_03630 8351 7923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence0044 5274 238 gene locus_tag LOCUS_03640 5274 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 7485 5278 gene locus_tag LOCUS_03650 7485 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7801 7520 gene locus_tag LOCUS_03660 7801 7520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 >Feature sequence0045 1841 1161 gene locus_tag LOCUS_03670 gene pxpB 1841 1161 CDS product 5-oxoprolinase subunit PxpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249288.1 protein_id gnl|my_center|LOCUS_03670 2604 1843 gene locus_tag LOCUS_03680 2604 1843 CDS product 5-oxoprolinase subunit PxpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206321.1 protein_id gnl|my_center|LOCUS_03680 3215 2652 gene locus_tag LOCUS_03690 gene msrA 3215 2652 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257533.1 protein_id gnl|my_center|LOCUS_03690 6019 3566 gene locus_tag LOCUS_03700 6019 3566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 6456 6743 gene locus_tag LOCUS_03710 6456 6743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 6941 7444 gene locus_tag LOCUS_03720 6941 7444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 8968 7544 gene locus_tag LOCUS_03730 8968 7544 CDS product IS4-like element ISGvi2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140150.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence0046 1400 231 gene locus_tag LOCUS_03740 1400 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 1661 3457 gene locus_tag LOCUS_03750 gene argS 1661 3457 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765307.1 protein_id gnl|my_center|LOCUS_03750 3688 4497 gene locus_tag LOCUS_03760 3688 4497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5242 4679 gene locus_tag LOCUS_03770 5242 4679 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_03770 6530 5541 gene locus_tag LOCUS_03780 6530 5541 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545989.1 protein_id gnl|my_center|LOCUS_03780 6694 6924 gene locus_tag LOCUS_03790 6694 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 7044 7226 gene locus_tag LOCUS_03800 7044 7226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 9160 7340 gene locus_tag LOCUS_03810 9160 7340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 >Feature sequence0047 <1 629 gene locus_tag LOCUS_03820 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096592.1:DeoR/GlpR family DNA-binding transcription regulator 665 2581 gene locus_tag LOCUS_03830 665 2581 CDS product glucosamine-6-phosphate deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007330748.1 protein_id gnl|my_center|LOCUS_03830 3918 2746 gene locus_tag LOCUS_03840 3918 2746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 4357 5793 gene locus_tag LOCUS_03850 4357 5793 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868284.1 protein_id gnl|my_center|LOCUS_03850 6361 5795 gene locus_tag LOCUS_03860 6361 5795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 6976 7494 gene locus_tag LOCUS_03870 6976 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 >Feature sequence0048 2105 384 gene locus_tag LOCUS_03880 2105 384 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_03880 2644 2240 gene locus_tag LOCUS_03890 2644 2240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 3351 2641 gene locus_tag LOCUS_03900 3351 2641 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762319.1 protein_id gnl|my_center|LOCUS_03900 4352 3348 gene locus_tag LOCUS_03910 4352 3348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 4799 5197 gene locus_tag LOCUS_03920 4799 5197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 6047 5208 gene locus_tag LOCUS_03930 6047 5208 CDS product DUF5777 family beta-barrel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000576382.1 protein_id gnl|my_center|LOCUS_03930 6706 6155 gene locus_tag LOCUS_03940 6706 6155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 7287 6862 gene locus_tag LOCUS_03950 7287 6862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 7721 7326 gene locus_tag LOCUS_03960 7721 7326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 >Feature sequence0049 <1 550 gene locus_tag LOCUS_03970 <1 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392284.1:Uma2 family endonuclease 593 1438 gene locus_tag LOCUS_03980 593 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 1441 2805 gene locus_tag LOCUS_03990 1441 2805 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_03990 3591 2842 gene locus_tag LOCUS_04000 3591 2842 CDS product thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203428.1 protein_id gnl|my_center|LOCUS_04000 3882 4184 gene locus_tag LOCUS_04010 3882 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 4255 5196 gene locus_tag LOCUS_04020 4255 5196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 5535 6113 gene locus_tag LOCUS_04030 5535 6113 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108700.1 protein_id gnl|my_center|LOCUS_04030 6133 6615 gene locus_tag LOCUS_04040 6133 6615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 7104 8165 gene locus_tag LOCUS_04050 7104 8165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 8931 8320 gene locus_tag LOCUS_04060 8931 8320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 >Feature sequence0050 3426 892 gene locus_tag LOCUS_04070 3426 892 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404969.1 protein_id gnl|my_center|LOCUS_04070 3684 4031 gene locus_tag LOCUS_04080 3684 4031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 4173 5186 gene locus_tag LOCUS_04090 4173 5186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 6401 5520 gene locus_tag LOCUS_04100 6401 5520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence0051 1377 457 gene locus_tag LOCUS_04110 1377 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 3529 1382 gene locus_tag LOCUS_04120 3529 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 4825 3695 gene locus_tag LOCUS_04130 4825 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 7103 5424 gene locus_tag LOCUS_04140 7103 5424 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_04140 8401 7184 gene locus_tag LOCUS_04150 gene sucC 8401 7184 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_04150 8533 8835 gene locus_tag LOCUS_04160 8533 8835 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084050946.1 protein_id gnl|my_center|LOCUS_04160 >Feature sequence0052 4674 1594 gene locus_tag LOCUS_04170 4674 1594 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_222838248.1 protein_id gnl|my_center|LOCUS_04170 5384 7015 gene locus_tag LOCUS_04180 5384 7015 CDS product FAD-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528300.1 protein_id gnl|my_center|LOCUS_04180 7047 7580 gene locus_tag LOCUS_04190 gene lspA 7047 7580 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933470.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence0053 2461 662 gene locus_tag LOCUS_04200 2461 662 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_04200 2996 2637 gene locus_tag LOCUS_04210 2996 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 3860 3075 gene locus_tag LOCUS_04220 3860 3075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4929 3871 gene locus_tag LOCUS_04230 4929 3871 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761569.1 protein_id gnl|my_center|LOCUS_04230 6194 5190 gene locus_tag LOCUS_04240 6194 5190 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_04240 7217 6213 gene locus_tag LOCUS_04250 7217 6213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202862.1 protein_id gnl|my_center|LOCUS_04250 8208 7303 gene locus_tag LOCUS_04260 8208 7303 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_04260 >Feature sequence0054 2 1111 gene locus_tag LOCUS_04270 2 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 3094 1310 gene locus_tag LOCUS_04280 3094 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3635 5944 gene locus_tag LOCUS_04290 3635 5944 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_04290 6922 5951 gene locus_tag LOCUS_04300 6922 5951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7865 6975 gene locus_tag LOCUS_04310 7865 6975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 8234 8749 gene locus_tag LOCUS_04320 8234 8749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 >Feature sequence0055 3001 1742 gene locus_tag LOCUS_04330 3001 1742 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_04330 3107 3781 gene locus_tag LOCUS_04340 3107 3781 CDS product oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064094285.1 protein_id gnl|my_center|LOCUS_04340 4495 3782 gene locus_tag LOCUS_04350 4495 3782 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962837.1 protein_id gnl|my_center|LOCUS_04350 5534 4500 gene locus_tag LOCUS_04360 5534 4500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 6231 5620 gene locus_tag LOCUS_04370 6231 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 6830 6252 gene locus_tag LOCUS_04380 6830 6252 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073603.1 protein_id gnl|my_center|LOCUS_04380 7207 7058 gene locus_tag LOCUS_04390 7207 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 7542 8309 gene locus_tag LOCUS_04400 gene yaaA 7542 8309 CDS product peroxide stress protein YaaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420750.1 protein_id gnl|my_center|LOCUS_04400 >Feature sequence0056 407 1702 gene locus_tag LOCUS_04410 407 1702 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963825.1 protein_id gnl|my_center|LOCUS_04410 1699 3048 gene locus_tag LOCUS_04420 1699 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 3775 8499 gene locus_tag LOCUS_04430 3775 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence0057 <1 808 gene locus_tag LOCUS_04440 <1 808 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003242925.1:copper-exporting P-type ATPase CopA 1472 2161 gene locus_tag LOCUS_04450 1472 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 2452 3105 gene locus_tag LOCUS_04460 2452 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3109 3528 gene locus_tag LOCUS_04470 3109 3528 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094547338.1 protein_id gnl|my_center|LOCUS_04470 3737 4774 gene locus_tag LOCUS_04480 gene prfB 3737 4774 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_117386928.1 protein_id gnl|my_center|LOCUS_04480 6012 5167 gene locus_tag LOCUS_04490 6012 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 >Feature sequence0058 637 1986 gene locus_tag LOCUS_04500 gene allB 637 1986 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003972680.1 protein_id gnl|my_center|LOCUS_04500 2026 3021 gene locus_tag LOCUS_04510 gene alc 2026 3021 CDS product allantoicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004553942.1 protein_id gnl|my_center|LOCUS_04510 3059 3562 gene locus_tag LOCUS_04520 gene uraD 3059 3562 CDS product 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030740.1 protein_id gnl|my_center|LOCUS_04520 3585 3923 gene locus_tag LOCUS_04530 gene hiuH 3585 3923 CDS product hydroxyisourate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833187.1 protein_id gnl|my_center|LOCUS_04530 6408 3946 gene locus_tag LOCUS_04540 gene priA 6408 3946 CDS product primosomal protein N' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963958.1 protein_id gnl|my_center|LOCUS_04540 6879 7613 gene locus_tag LOCUS_04550 6879 7613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 >Feature sequence0059 1899 361 gene locus_tag LOCUS_04560 1899 361 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_04560 2160 1939 gene locus_tag LOCUS_04570 2160 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 2435 2217 gene locus_tag LOCUS_04580 2435 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 2484 3824 gene locus_tag LOCUS_04590 2484 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5694 4432 gene locus_tag LOCUS_04600 5694 4432 CDS product cellobiose 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583022.1 protein_id gnl|my_center|LOCUS_04600 7167 6334 gene locus_tag LOCUS_04610 7167 6334 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922282.1 protein_id gnl|my_center|LOCUS_04610 7424 7849 gene locus_tag LOCUS_04620 7424 7849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence0060 <1 711 gene locus_tag LOCUS_04630 <1 711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_032555792.1:lysylphosphatidylglycerol synthase transmembrane domain-containing protein 1317 850 gene locus_tag LOCUS_04640 gene lysM 1317 850 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963486.1 protein_id gnl|my_center|LOCUS_04640 1607 2911 gene locus_tag LOCUS_04650 1607 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 2931 3695 gene locus_tag LOCUS_04660 2931 3695 CDS product creatininase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011082924.1 protein_id gnl|my_center|LOCUS_04660 4264 4449 gene locus_tag LOCUS_04670 4264 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 5790 4441 gene locus_tag LOCUS_04680 gene argH 5790 4441 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766984.1 protein_id gnl|my_center|LOCUS_04680 5895 7679 gene locus_tag LOCUS_04690 5895 7679 CDS product MutS family DNA mismatch repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765433.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence0061 2377 1013 gene locus_tag LOCUS_04700 gene hemL 2377 1013 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_04700 2481 3683 gene locus_tag LOCUS_04710 2481 3683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 4938 3832 gene locus_tag LOCUS_04720 4938 3832 CDS product D-TA family PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921979.1 protein_id gnl|my_center|LOCUS_04720 6238 4997 gene locus_tag LOCUS_04730 6238 4997 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_04730 7178 6276 gene locus_tag LOCUS_04740 gene cysD 7178 6276 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002735002.1 protein_id gnl|my_center|LOCUS_04740 8113 7505 gene locus_tag LOCUS_04750 gene cysC 8113 7505 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107257.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence0062 166 435 gene locus_tag LOCUS_04760 166 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 647 1789 gene locus_tag LOCUS_04770 647 1789 CDS product alpha-hydroxy acid oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162992331.1 protein_id gnl|my_center|LOCUS_04770 3769 2528 gene locus_tag LOCUS_04780 3769 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 4115 4420 gene locus_tag LOCUS_04790 4115 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 4760 5401 gene locus_tag LOCUS_04800 4760 5401 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004537687.1 protein_id gnl|my_center|LOCUS_04800 5398 6372 gene locus_tag LOCUS_04810 5398 6372 CDS product YeeE/YedE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582889.1 protein_id gnl|my_center|LOCUS_04810 6547 7836 gene locus_tag LOCUS_04820 6547 7836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 7836 8438 gene locus_tag LOCUS_04830 7836 8438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 >Feature sequence0063 <1 3293 gene locus_tag LOCUS_04840 <1 3293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962369.1:transcription-repair coupling factor 3511 4122 gene locus_tag LOCUS_04850 3511 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 6750 4153 gene locus_tag LOCUS_04860 6750 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 <8464 7005 gene locus_tag LOCUS_04870 <8464 7005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230124.1:amidohydrolase >Feature sequence0064 987 2135 gene locus_tag LOCUS_04880 987 2135 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_04880 2968 2300 gene locus_tag LOCUS_04890 2968 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 3423 4571 gene locus_tag LOCUS_04900 3423 4571 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962574.1 protein_id gnl|my_center|LOCUS_04900 4651 5985 gene locus_tag LOCUS_04910 4651 5985 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_04910 6046 7005 gene locus_tag LOCUS_04920 6046 7005 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403373.1 protein_id gnl|my_center|LOCUS_04920 7070 7540 gene locus_tag LOCUS_04930 gene rfbC 7070 7540 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100801.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence0065 <1 1217 gene locus_tag LOCUS_04940 <1 1217 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_021779460.1:DEAD/DEAH box helicase family protein note possible pseudo, internal stop codon 1387 1569 gene locus_tag LOCUS_04950 1387 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 1566 3506 gene locus_tag LOCUS_04960 gene dndD 1566 3506 CDS product DNA sulfur modification protein DndD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005109923.1 protein_id gnl|my_center|LOCUS_04960 3507 3911 gene locus_tag LOCUS_04970 3507 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 4040 5161 gene locus_tag LOCUS_04980 4040 5161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5179 6186 gene locus_tag LOCUS_04990 5179 6186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 7343 6183 gene locus_tag LOCUS_05000 7343 6183 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144367.1 protein_id gnl|my_center|LOCUS_05000 7741 7349 gene locus_tag LOCUS_05010 7741 7349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 <8419 7746 gene locus_tag LOCUS_05020 <8419 7746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005109923.1:DNA sulfur modification protein DndD >Feature sequence0066 909 1343 gene locus_tag LOCUS_05030 909 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1430 3082 gene locus_tag LOCUS_05040 1430 3082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3488 3931 gene locus_tag LOCUS_05050 3488 3931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 4379 5650 gene locus_tag LOCUS_05060 4379 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 6114 5647 gene locus_tag LOCUS_05070 6114 5647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 7796 6165 gene locus_tag LOCUS_05080 7796 6165 CDS product FMN-binding glutamate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001181592.1 protein_id gnl|my_center|LOCUS_05080 8329 7796 gene locus_tag LOCUS_05090 8329 7796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 >Feature sequence0067 294 1043 gene locus_tag LOCUS_05100 294 1043 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928653.1 protein_id gnl|my_center|LOCUS_05100 3175 1082 gene locus_tag LOCUS_05110 gene pbpC 3175 1082 CDS product peptidoglycan glycosyltransferase PbpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105204.1 protein_id gnl|my_center|LOCUS_05110 3838 5202 gene locus_tag LOCUS_05120 3838 5202 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009902866.1 protein_id gnl|my_center|LOCUS_05120 5199 6350 gene locus_tag LOCUS_05130 gene galK 5199 6350 CDS product galactokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107224.1 protein_id gnl|my_center|LOCUS_05130 6724 7770 gene locus_tag LOCUS_05140 6724 7770 CDS product UDP-glucose--hexose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909272.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence0068 1462 23 gene locus_tag LOCUS_05150 1462 23 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 1914 1459 gene locus_tag LOCUS_05160 gene dtd 1914 1459 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796976.1 protein_id gnl|my_center|LOCUS_05160 3146 1932 gene locus_tag LOCUS_05170 3146 1932 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_05170 3268 4533 gene locus_tag LOCUS_05180 gene hemA 3268 4533 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_05180 4684 5673 gene locus_tag LOCUS_05190 4684 5673 CDS product nitrilase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816316.1 protein_id gnl|my_center|LOCUS_05190 7310 5886 gene locus_tag LOCUS_05200 7310 5886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 8209 7412 gene locus_tag LOCUS_05210 gene ispE 8209 7412 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793430.1 protein_id gnl|my_center|LOCUS_05210 >Feature sequence0069 38 274 gene locus_tag LOCUS_05220 38 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 325 1332 gene locus_tag LOCUS_05230 325 1332 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404059.1 protein_id gnl|my_center|LOCUS_05230 2797 1463 gene locus_tag LOCUS_05240 2797 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 3629 3099 gene locus_tag LOCUS_05250 3629 3099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 4730 3864 gene locus_tag LOCUS_05260 4730 3864 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028152332.1 protein_id gnl|my_center|LOCUS_05260 5009 6025 gene locus_tag LOCUS_05270 5009 6025 CDS product DUF4065 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461870.1 protein_id gnl|my_center|LOCUS_05270 6150 7643 gene locus_tag LOCUS_05280 gene accC 6150 7643 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_05280 7814 8116 gene locus_tag LOCUS_05290 7814 8116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 >Feature sequence0070 3699 688 gene locus_tag LOCUS_05300 3699 688 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798729.1 protein_id gnl|my_center|LOCUS_05300 4245 3826 gene locus_tag LOCUS_05310 4245 3826 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035636367.1 protein_id gnl|my_center|LOCUS_05310 5762 4350 gene locus_tag LOCUS_05320 5762 4350 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789010.1 protein_id gnl|my_center|LOCUS_05320 7539 6472 gene locus_tag LOCUS_05330 7539 6472 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107390.1 protein_id gnl|my_center|LOCUS_05330 >Feature sequence0071 1612 428 gene locus_tag LOCUS_05340 1612 428 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_05340 1826 2110 gene locus_tag LOCUS_05350 1826 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2318 3850 gene locus_tag LOCUS_05360 2318 3850 CDS product D-aminoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727481.1 protein_id gnl|my_center|LOCUS_05360 3894 4496 gene locus_tag LOCUS_05370 3894 4496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 5920 4493 gene locus_tag LOCUS_05380 5920 4493 CDS product SGNH/GDSL hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108446.1 protein_id gnl|my_center|LOCUS_05380 >Feature sequence0072 <1 4873 gene locus_tag LOCUS_05390 <1 4873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004536886.1:LysM peptidoglycan-binding domain-containing protein 4977 5390 gene locus_tag LOCUS_05400 4977 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 5902 5630 gene locus_tag LOCUS_05410 5902 5630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 6558 7688 gene locus_tag LOCUS_05420 6558 7688 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_05420 7845 8030 gene locus_tag LOCUS_05430 7845 8030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05430 >Feature sequence0073 4453 2744 gene locus_tag LOCUS_05440 4453 2744 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_05440 5400 4477 gene locus_tag LOCUS_05450 5400 4477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5492 5668 gene locus_tag LOCUS_05460 5492 5668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6844 5810 gene locus_tag LOCUS_05470 6844 5810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 7445 6888 gene locus_tag LOCUS_05480 7445 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 7999 7442 gene locus_tag LOCUS_05490 7999 7442 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence0074 2 1840 gene locus_tag LOCUS_05500 2 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 2613 4313 gene locus_tag LOCUS_05510 gene atsA 2613 4313 CDS product arylsulfatase AtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106692.1 protein_id gnl|my_center|LOCUS_05510 6691 4739 gene locus_tag LOCUS_05520 6691 4739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 <8129 7052 gene locus_tag LOCUS_05530 <8129 7052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_138432165.1:sodium-translocating pyrophosphatase >Feature sequence0075 740 78 gene locus_tag LOCUS_05540 740 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1919 4315 gene locus_tag LOCUS_05550 1919 4315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence0076 654 1193 gene locus_tag LOCUS_05560 gene upp 654 1193 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791972.1 protein_id gnl|my_center|LOCUS_05560 1370 3634 gene locus_tag LOCUS_05570 1370 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 4948 3719 gene locus_tag LOCUS_05580 gene hflX 4948 3719 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202100.1 protein_id gnl|my_center|LOCUS_05580 6791 5004 gene locus_tag LOCUS_05590 gene lepA 6791 5004 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964332.1 protein_id gnl|my_center|LOCUS_05590 <8063 7172 gene locus_tag LOCUS_05600 <8063 7172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207866.1:homoserine kinase >Feature sequence0077 1044 1721 gene locus_tag LOCUS_05610 1044 1721 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002299518.1 protein_id gnl|my_center|LOCUS_05610 1828 3942 gene locus_tag LOCUS_05620 1828 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4034 5578 gene locus_tag LOCUS_05630 4034 5578 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_05630 5735 7204 gene locus_tag LOCUS_05640 5735 7204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 7188 7859 gene locus_tag LOCUS_05650 7188 7859 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence0078 579 2480 gene locus_tag LOCUS_05660 579 2480 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_086595297.1 protein_id gnl|my_center|LOCUS_05660 3424 2534 gene locus_tag LOCUS_05670 3424 2534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 4505 3750 gene locus_tag LOCUS_05680 4505 3750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_219771186.1 protein_id gnl|my_center|LOCUS_05680 5498 5100 gene locus_tag LOCUS_05690 5498 5100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 7982 5526 gene locus_tag LOCUS_05700 7982 5526 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926008.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence0079 1331 2953 gene locus_tag LOCUS_05710 1331 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 3436 5178 gene locus_tag LOCUS_05720 3436 5178 CDS product glycoside hydrolase family 13 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839780.1 protein_id gnl|my_center|LOCUS_05720 6999 5575 gene locus_tag LOCUS_05730 6999 5575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 >Feature sequence0080 <1 2078 gene locus_tag LOCUS_05740 <1 2078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964496.1:2-oxoglutarate dehydrogenase E1 component 2151 4064 gene locus_tag LOCUS_05750 gene dxs 2151 4064 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992199.1 protein_id gnl|my_center|LOCUS_05750 4066 5463 gene locus_tag LOCUS_05760 4066 5463 CDS product DUF2029 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838851.1 protein_id gnl|my_center|LOCUS_05760 5475 6719 gene locus_tag LOCUS_05770 5475 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964068.1 protein_id gnl|my_center|LOCUS_05770 6739 7350 gene locus_tag LOCUS_05780 6739 7350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 >Feature sequence0081 1011 367 gene locus_tag LOCUS_05790 1011 367 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947903.1 protein_id gnl|my_center|LOCUS_05790 1470 1144 gene locus_tag LOCUS_05800 1470 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 1563 2309 gene locus_tag LOCUS_05810 1563 2309 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962383.1 protein_id gnl|my_center|LOCUS_05810 2311 2721 gene locus_tag LOCUS_05820 2311 2721 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812348.1 protein_id gnl|my_center|LOCUS_05820 4104 3148 gene locus_tag LOCUS_05830 4104 3148 CDS product NUP-family purine nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265508.1 protein_id gnl|my_center|LOCUS_05830 5843 4761 gene locus_tag LOCUS_05840 5843 4761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 7604 6243 gene locus_tag LOCUS_05850 7604 6243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 >Feature sequence0082 1840 1769 gene locus_tag LOCUS_t00070 1840 1769 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 2741 1929 gene locus_tag LOCUS_05860 gene cdaA 2741 1929 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404681.1 protein_id gnl|my_center|LOCUS_05860 3516 2728 gene locus_tag LOCUS_05870 gene folP 3516 2728 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963546.1 protein_id gnl|my_center|LOCUS_05870 3654 4208 gene locus_tag LOCUS_05880 3654 4208 CDS product DUF1599 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963547.1 protein_id gnl|my_center|LOCUS_05880 4233 5309 gene locus_tag LOCUS_05890 4233 5309 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188467563.1 protein_id gnl|my_center|LOCUS_05890 5310 5834 gene locus_tag LOCUS_05900 5310 5834 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783866.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence0083 759 1145 gene locus_tag LOCUS_05910 759 1145 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_05910 1910 1167 gene locus_tag LOCUS_05920 1910 1167 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480005.1 protein_id gnl|my_center|LOCUS_05920 2895 1903 gene locus_tag LOCUS_05930 gene legB 2895 1903 CDS product 4,6-dehydratase LegB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786732.1 protein_id gnl|my_center|LOCUS_05930 3053 3949 gene locus_tag LOCUS_05940 3053 3949 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775476.1 protein_id gnl|my_center|LOCUS_05940 4024 4788 gene locus_tag LOCUS_05950 4024 4788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 4807 5535 gene locus_tag LOCUS_05960 gene dapB 4807 5535 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783772.1 protein_id gnl|my_center|LOCUS_05960 5742 5963 gene locus_tag LOCUS_05970 5742 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6184 7632 gene locus_tag LOCUS_05980 6184 7632 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122120.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence0084 <1 1537 gene locus_tag LOCUS_05990 <1 1537 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107799.1:carboxypeptidase-like regulatory domain-containing protein 2065 3048 gene locus_tag LOCUS_06000 2065 3048 CDS product histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109044.1 protein_id gnl|my_center|LOCUS_06000 3103 3861 gene locus_tag LOCUS_06010 3103 3861 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109043.1 protein_id gnl|my_center|LOCUS_06010 3957 4949 gene locus_tag LOCUS_06020 3957 4949 CDS product isopenicillin N synthase family oxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101381.1 protein_id gnl|my_center|LOCUS_06020 5252 6328 gene locus_tag LOCUS_06030 5252 6328 CDS product galactose mutarotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120973.1 protein_id gnl|my_center|LOCUS_06030 6501 6824 gene locus_tag LOCUS_06040 6501 6824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence0085 557 300 gene locus_tag LOCUS_06050 557 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 758 2473 gene locus_tag LOCUS_06060 758 2473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 2643 4088 gene locus_tag LOCUS_06070 2643 4088 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299143.1 protein_id gnl|my_center|LOCUS_06070 6045 4123 gene locus_tag LOCUS_06080 6045 4123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6489 7562 gene locus_tag LOCUS_06090 6489 7562 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence0086 202 1146 gene locus_tag LOCUS_06100 202 1146 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962409.1 protein_id gnl|my_center|LOCUS_06100 1806 2378 gene locus_tag LOCUS_06110 1806 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 2539 3981 gene locus_tag LOCUS_06120 2539 3981 CDS product alpha-amylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250835.1 protein_id gnl|my_center|LOCUS_06120 4718 5164 gene locus_tag LOCUS_06130 4718 5164 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_06130 5171 5560 gene locus_tag LOCUS_06140 5171 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 6965 5574 gene locus_tag LOCUS_06150 6965 5574 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001079544.1 protein_id gnl|my_center|LOCUS_06150 7405 6965 gene locus_tag LOCUS_06160 7405 6965 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence0087 2293 1829 gene locus_tag LOCUS_06170 2293 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 4225 2609 gene locus_tag LOCUS_06180 4225 2609 CDS product acyl-CoA--6-aminopenicillanic acid acyl-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964344.1 protein_id gnl|my_center|LOCUS_06180 5831 4323 gene locus_tag LOCUS_06190 5831 4323 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964345.1 protein_id gnl|my_center|LOCUS_06190 <7883 5828 gene locus_tag LOCUS_06200 <7883 5828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964346.1:MMPL family transporter >Feature sequence0088 916 2847 gene locus_tag LOCUS_06210 916 2847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 3840 2929 gene locus_tag LOCUS_06220 3840 2929 CDS product DUF6206 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879311.1 protein_id gnl|my_center|LOCUS_06220 5133 3844 gene locus_tag LOCUS_06230 5133 3844 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879310.1 protein_id gnl|my_center|LOCUS_06230 5300 5467 gene locus_tag LOCUS_06240 5300 5467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 5511 5711 gene locus_tag LOCUS_06250 5511 5711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7373 5958 gene locus_tag LOCUS_06260 7373 5958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence0089 1680 331 gene locus_tag LOCUS_06270 1680 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 2073 1681 gene locus_tag LOCUS_06280 gene csx20 2073 1681 CDS product CRISPR-associated protein Csx20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871197.1 protein_id gnl|my_center|LOCUS_06280 3398 2088 gene locus_tag LOCUS_06290 3398 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3824 3405 gene locus_tag LOCUS_06300 3824 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 4880 3831 gene locus_tag LOCUS_06310 gene cmr4 4880 3831 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064477.1 protein_id gnl|my_center|LOCUS_06310 6594 4906 gene locus_tag LOCUS_06320 6594 4906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 7681 6605 gene locus_tag LOCUS_06330 7681 6605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 >Feature sequence0090 1988 1524 gene locus_tag LOCUS_06340 1988 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 2512 2051 gene locus_tag LOCUS_06350 2512 2051 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108357.1 protein_id gnl|my_center|LOCUS_06350 2703 3233 gene locus_tag LOCUS_06360 2703 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 3697 3299 gene locus_tag LOCUS_06370 3697 3299 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088521.1 protein_id gnl|my_center|LOCUS_06370 4714 3926 gene locus_tag LOCUS_06380 4714 3926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4954 5220 gene locus_tag LOCUS_06390 4954 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06390 6690 5317 gene locus_tag LOCUS_06400 6690 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 7593 6697 gene locus_tag LOCUS_06410 7593 6697 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001156916.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence0091 524 1096 gene locus_tag LOCUS_06420 524 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 1189 1467 gene locus_tag LOCUS_06430 1189 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 1556 2209 gene locus_tag LOCUS_06440 1556 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 2646 3083 gene locus_tag LOCUS_06450 2646 3083 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869004.1 protein_id gnl|my_center|LOCUS_06450 3076 3861 gene locus_tag LOCUS_06460 3076 3861 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037434659.1 protein_id gnl|my_center|LOCUS_06460 5077 4271 gene locus_tag LOCUS_06470 5077 4271 CDS product arsenite methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405176.1 protein_id gnl|my_center|LOCUS_06470 5468 5145 gene locus_tag LOCUS_06480 5468 5145 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963707.1 protein_id gnl|my_center|LOCUS_06480 7019 5856 gene locus_tag LOCUS_06490 gene menC 7019 5856 CDS product o-succinylbenzoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002387683.1 protein_id gnl|my_center|LOCUS_06490 7682 7020 gene locus_tag LOCUS_06500 7682 7020 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence0092 583 164 gene locus_tag LOCUS_06510 583 164 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546540.1 protein_id gnl|my_center|LOCUS_06510 839 594 gene locus_tag LOCUS_06520 839 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 1263 4799 gene locus_tag LOCUS_06530 1263 4799 CDS product indolepyruvate ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005115449.1 protein_id gnl|my_center|LOCUS_06530 5159 6277 gene locus_tag LOCUS_06540 5159 6277 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921354.1 protein_id gnl|my_center|LOCUS_06540 6492 7682 gene locus_tag LOCUS_06550 6492 7682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 >Feature sequence0093 4270 3128 gene locus_tag LOCUS_06560 4270 3128 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962543.1 protein_id gnl|my_center|LOCUS_06560 4672 6039 gene locus_tag LOCUS_06570 4672 6039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence0094 964 2232 gene locus_tag LOCUS_06580 964 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 5530 2513 gene locus_tag LOCUS_06590 5530 2513 CDS product hybrid sensor histidine kinase/response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108846.1 protein_id gnl|my_center|LOCUS_06590 6966 5689 gene locus_tag LOCUS_06600 6966 5689 CDS product Dyp-type peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228803.1 protein_id gnl|my_center|LOCUS_06600 7269 6970 gene locus_tag LOCUS_06610 7269 6970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence0095 743 210 gene locus_tag LOCUS_06620 743 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 4278 1177 gene locus_tag LOCUS_06630 4278 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 4799 4362 gene locus_tag LOCUS_06640 4799 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 4935 5273 gene locus_tag LOCUS_06650 4935 5273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 6537 5281 gene locus_tag LOCUS_06660 6537 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963252.1 protein_id gnl|my_center|LOCUS_06660 >Feature sequence0096 <1 1325 gene locus_tag LOCUS_06670 <1 1325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435637.1:trypsin-like peptidase domain-containing protein 1579 2436 gene locus_tag LOCUS_06680 1579 2436 CDS product Stp1/IreP family PP2C-type Ser/Thr phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392426.1 protein_id gnl|my_center|LOCUS_06680 2433 4178 gene locus_tag LOCUS_06690 2433 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4336 4983 gene locus_tag LOCUS_06700 4336 4983 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033930894.1 protein_id gnl|my_center|LOCUS_06700 4980 6791 gene locus_tag LOCUS_06710 4980 6791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence0097 2088 1579 gene locus_tag LOCUS_06720 2088 1579 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056674.1 protein_id gnl|my_center|LOCUS_06720 2179 2535 gene locus_tag LOCUS_06730 2179 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2748 3431 gene locus_tag LOCUS_06740 2748 3431 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943268.1 protein_id gnl|my_center|LOCUS_06740 4332 3577 gene locus_tag LOCUS_06750 4332 3577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 5098 6654 gene locus_tag LOCUS_06760 gene istA 5098 6654 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_06760 6714 7424 gene locus_tag LOCUS_06770 gene istB 6714 7424 CDS product IS21-like element ISFK1 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090937.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence0098 1178 864 gene locus_tag LOCUS_06780 1178 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2773 1340 gene locus_tag LOCUS_06790 2773 1340 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_06790 3115 4062 gene locus_tag LOCUS_06800 3115 4062 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119568.1 protein_id gnl|my_center|LOCUS_06800 4173 6221 gene locus_tag LOCUS_06810 4173 6221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 <7510 6311 gene locus_tag LOCUS_06820 <7510 6311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118989.1:DUF1501 domain-containing protein >Feature sequence0099 815 66 gene locus_tag LOCUS_06830 815 66 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970171.1 protein_id gnl|my_center|LOCUS_06830 1660 929 gene locus_tag LOCUS_06840 1660 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2739 1657 gene locus_tag LOCUS_06850 2739 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4137 2818 gene locus_tag LOCUS_06860 4137 2818 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_06860 5590 4346 gene locus_tag LOCUS_06870 5590 4346 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000858692.1 protein_id gnl|my_center|LOCUS_06870 6522 5839 gene locus_tag LOCUS_06880 6522 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 6586 6888 gene locus_tag LOCUS_06890 6586 6888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence0100 738 604 gene locus_tag LOCUS_06900 738 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 861 3410 gene locus_tag LOCUS_06910 861 3410 CDS product DUF5686 and carboxypeptidase regulatory-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964117.1 protein_id gnl|my_center|LOCUS_06910 4985 3675 gene locus_tag LOCUS_06920 4985 3675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 5947 5099 gene locus_tag LOCUS_06930 5947 5099 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_06930 6478 6056 gene locus_tag LOCUS_06940 6478 6056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 >Feature sequence0101 1575 292 gene locus_tag LOCUS_06950 1575 292 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065084.1 protein_id gnl|my_center|LOCUS_06950 2354 1881 gene locus_tag LOCUS_06960 2354 1881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 4825 2390 gene locus_tag LOCUS_06970 4825 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 <7476 4999 gene locus_tag LOCUS_06980 <7476 4999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058185.1:CHAT domain-containing protein >Feature sequence0102 824 27 gene locus_tag LOCUS_06990 824 27 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839609.1 protein_id gnl|my_center|LOCUS_06990 1684 869 gene locus_tag LOCUS_07000 1684 869 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103550.1 protein_id gnl|my_center|LOCUS_07000 1813 3099 gene locus_tag LOCUS_07010 gene eno 1813 3099 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898301.1 protein_id gnl|my_center|LOCUS_07010 3274 6138 gene locus_tag LOCUS_07020 3274 6138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence0103 101 532 gene locus_tag LOCUS_07030 gene rpiB 101 532 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786501.1 protein_id gnl|my_center|LOCUS_07030 533 1138 gene locus_tag LOCUS_07040 533 1138 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_07040 4055 1191 gene locus_tag LOCUS_07050 4055 1191 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259048.1 protein_id gnl|my_center|LOCUS_07050 5669 4068 gene locus_tag LOCUS_07060 gene nrfD 5669 4068 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259049.1 protein_id gnl|my_center|LOCUS_07060 6330 5938 gene locus_tag LOCUS_07070 6330 5938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 <7387 6346 gene locus_tag LOCUS_07080 <7387 6346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973888.1:pyridoxamine 5'-phosphate oxidase family protein >Feature sequence0104 3586 2627 gene locus_tag LOCUS_07090 3586 2627 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719803.1 protein_id gnl|my_center|LOCUS_07090 5039 3579 gene locus_tag LOCUS_07100 5039 3579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 6503 5589 gene locus_tag LOCUS_07110 6503 5589 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436788.1 protein_id gnl|my_center|LOCUS_07110 <7376 6615 gene locus_tag LOCUS_07120 <7376 6615 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199111712.1:T9SS type A sorting domain-containing protein >Feature sequence0105 3343 2891 gene locus_tag LOCUS_07130 3343 2891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 4075 3344 gene locus_tag LOCUS_07140 4075 3344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4281 4075 gene locus_tag LOCUS_07150 4281 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 4671 4414 gene locus_tag LOCUS_07160 4671 4414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 4937 4677 gene locus_tag LOCUS_07170 4937 4677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 5913 5008 gene locus_tag LOCUS_07180 5913 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 6214 5897 gene locus_tag LOCUS_07190 6214 5897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 6871 6533 gene locus_tag LOCUS_07200 6871 6533 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021317.1 protein_id gnl|my_center|LOCUS_07200 7166 6864 gene locus_tag LOCUS_07210 7166 6864 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546611.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence0106 <1 1139 gene locus_tag LOCUS_07220 <1 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021623.1:tetratricopeptide repeat protein 1282 2049 gene locus_tag LOCUS_07230 1282 2049 CDS product phosphosulfolactate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402811.1 protein_id gnl|my_center|LOCUS_07230 2338 3477 gene locus_tag LOCUS_07240 gene mqnC 2338 3477 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940023.1 protein_id gnl|my_center|LOCUS_07240 6012 3502 gene locus_tag LOCUS_07250 6012 3502 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787020.1 protein_id gnl|my_center|LOCUS_07250 >Feature sequence0107 <1 1696 gene locus_tag LOCUS_07260 <1 1696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_092901243.1:ATP-binding protein 2519 1965 gene locus_tag LOCUS_07270 gene ruvC 2519 1965 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962385.1 protein_id gnl|my_center|LOCUS_07270 4042 2573 gene locus_tag LOCUS_07280 gene guaB 4042 2573 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963927.1 protein_id gnl|my_center|LOCUS_07280 4304 5050 gene locus_tag LOCUS_07290 4304 5050 CDS product head GIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258992.1 protein_id gnl|my_center|LOCUS_07290 6685 5189 gene locus_tag LOCUS_07300 6685 5189 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963433.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence0108 373 849 gene locus_tag LOCUS_07310 373 849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2134 875 gene locus_tag LOCUS_07320 2134 875 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992045.1 protein_id gnl|my_center|LOCUS_07320 3388 2351 gene locus_tag LOCUS_07330 gene proB 3388 2351 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909083.1 protein_id gnl|my_center|LOCUS_07330 3848 6235 gene locus_tag LOCUS_07340 3848 6235 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838717.1 protein_id gnl|my_center|LOCUS_07340 <7304 6339 gene locus_tag LOCUS_07350 <7304 6339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117740.1:prolyl oligopeptidase family serine peptidase >Feature sequence0109 1059 892 gene locus_tag LOCUS_07360 1059 892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1439 2545 gene locus_tag LOCUS_07370 1439 2545 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_07370 3540 2725 gene locus_tag LOCUS_07380 3540 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 4092 3571 gene locus_tag LOCUS_07390 4092 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 5395 4238 gene locus_tag LOCUS_07400 5395 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 6339 5629 gene locus_tag LOCUS_07410 gene recO 6339 5629 CDS product DNA repair protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962443.1 protein_id gnl|my_center|LOCUS_07410 6899 6336 gene locus_tag LOCUS_07420 6899 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence0110 <1 834 gene locus_tag LOCUS_07430 <1 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963037.1:efflux RND transporter periplasmic adaptor subunit 1267 3333 gene locus_tag LOCUS_07440 1267 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3635 4282 gene locus_tag LOCUS_07450 3635 4282 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107672.1 protein_id gnl|my_center|LOCUS_07450 4325 5476 gene locus_tag LOCUS_07460 gene dnaJ 4325 5476 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763399.1 protein_id gnl|my_center|LOCUS_07460 <7281 5473 gene locus_tag LOCUS_07470 <7281 5473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927048.1:insulinase family protein >Feature sequence0111 <1 773 gene locus_tag LOCUS_07480 <1 773 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962584.1:L-glutamate gamma-semialdehyde dehydrogenase 907 1215 gene locus_tag LOCUS_07490 907 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 1514 2656 gene locus_tag LOCUS_07500 1514 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2707 3483 gene locus_tag LOCUS_07510 2707 3483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 3607 4167 gene locus_tag LOCUS_07520 3607 4167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 4238 4993 gene locus_tag LOCUS_07530 4238 4993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 5048 5233 gene locus_tag LOCUS_07540 5048 5233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 5241 5642 gene locus_tag LOCUS_07550 5241 5642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence0112 295 999 gene locus_tag LOCUS_07560 295 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 1231 1830 gene locus_tag LOCUS_07570 1231 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1985 4051 gene locus_tag LOCUS_07580 1985 4051 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_07580 5996 4587 gene locus_tag LOCUS_07590 5996 4587 CDS product DUF4407 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962329.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence0113 891 2573 gene locus_tag LOCUS_07600 891 2573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 3845 2610 gene locus_tag LOCUS_07610 3845 2610 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_07610 5076 4399 gene locus_tag LOCUS_07620 5076 4399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 5289 6257 gene locus_tag LOCUS_07630 5289 6257 CDS product alkaline phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794948.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence0114 865 1560 gene locus_tag LOCUS_07640 865 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 2011 2670 gene locus_tag LOCUS_07650 2011 2670 CDS product beta-phosphoglucomutase family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927183.1 protein_id gnl|my_center|LOCUS_07650 4493 2745 gene locus_tag LOCUS_07660 4493 2745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 5270 4728 gene locus_tag LOCUS_07670 5270 4728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 <7220 5720 gene locus_tag LOCUS_07680 <7220 5720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142241.1:caspase family protein >Feature sequence0115 489 851 gene locus_tag LOCUS_07690 489 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 1977 1042 gene locus_tag LOCUS_07700 1977 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 2918 2739 gene locus_tag LOCUS_07710 2918 2739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 4313 3267 gene locus_tag LOCUS_07720 4313 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5027 4422 gene locus_tag LOCUS_07730 5027 4422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 5493 6251 gene locus_tag LOCUS_07740 5493 6251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 6266 7054 gene locus_tag LOCUS_07750 6266 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 >Feature sequence0116 2142 454 gene locus_tag LOCUS_07760 2142 454 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839376.1 protein_id gnl|my_center|LOCUS_07760 2369 2752 gene locus_tag LOCUS_07770 2369 2752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 3254 4738 gene locus_tag LOCUS_07780 3254 4738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4748 5005 gene locus_tag LOCUS_07790 4748 5005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5061 6329 gene locus_tag LOCUS_07800 5061 6329 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_07800 6688 6852 gene locus_tag LOCUS_07810 6688 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence0117 843 361 gene locus_tag LOCUS_07820 gene ybeY 843 361 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_07820 1301 867 gene locus_tag LOCUS_07830 1301 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4689 1294 gene locus_tag LOCUS_07840 4689 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 5609 4842 gene locus_tag LOCUS_07850 5609 4842 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765510.1 protein_id gnl|my_center|LOCUS_07850 6368 5613 gene locus_tag LOCUS_07860 6368 5613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 7165 6416 gene locus_tag LOCUS_07870 7165 6416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence0118 <1 1463 gene locus_tag LOCUS_07880 <1 1463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS type A sorting domain-containing protein 1766 2428 gene locus_tag LOCUS_07890 1766 2428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 2712 3833 gene locus_tag LOCUS_07900 2712 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 3978 4919 gene locus_tag LOCUS_07910 3978 4919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4924 6291 gene locus_tag LOCUS_07920 4924 6291 CDS product cystathionine beta-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421588.1 protein_id gnl|my_center|LOCUS_07920 6584 6312 gene locus_tag LOCUS_07930 6584 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence0119 842 420 gene locus_tag LOCUS_07940 842 420 CDS product hotdog family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460561.1 protein_id gnl|my_center|LOCUS_07940 1732 857 gene locus_tag LOCUS_07950 1732 857 CDS product lipid A biosynthesis acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964372.1 protein_id gnl|my_center|LOCUS_07950 1995 1732 gene locus_tag LOCUS_07960 1995 1732 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964373.1 protein_id gnl|my_center|LOCUS_07960 3227 2004 gene locus_tag LOCUS_07970 3227 2004 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964374.1 protein_id gnl|my_center|LOCUS_07970 3970 3242 gene locus_tag LOCUS_07980 gene fabG 3970 3242 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964375.1 protein_id gnl|my_center|LOCUS_07980 5579 4041 gene locus_tag LOCUS_07990 5579 4041 CDS product aromatic amino acid ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964377.1 protein_id gnl|my_center|LOCUS_07990 5690 6748 gene locus_tag LOCUS_08000 5690 6748 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072813.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence0120 991 5139 gene locus_tag LOCUS_08010 991 5139 CDS product AAA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081440580.1 protein_id gnl|my_center|LOCUS_08010 <7085 5172 gene locus_tag LOCUS_08020 <7085 5172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962742.1:preprotein translocase subunit SecA >Feature sequence0121 554 970 gene locus_tag LOCUS_08030 554 970 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143422.1 protein_id gnl|my_center|LOCUS_08030 2232 967 gene locus_tag LOCUS_08040 2232 967 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_08040 2977 2333 gene locus_tag LOCUS_08050 gene fsa 2977 2333 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789246.1 protein_id gnl|my_center|LOCUS_08050 3208 4695 gene locus_tag LOCUS_08060 3208 4695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence0122 764 15 gene locus_tag LOCUS_08070 764 15 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1973 837 gene locus_tag LOCUS_08080 1973 837 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_08080 2701 1973 gene locus_tag LOCUS_08090 2701 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 2822 3058 gene locus_tag LOCUS_08100 2822 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3675 4727 gene locus_tag LOCUS_08110 3675 4727 CDS product membrane dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005082423.1 protein_id gnl|my_center|LOCUS_08110 >Feature sequence0123 <1 569 gene locus_tag LOCUS_08120 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794868.1:creatininase family protein 2802 1279 gene locus_tag LOCUS_08130 2802 1279 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_08130 3060 3416 gene locus_tag LOCUS_08140 3060 3416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 4080 4352 gene locus_tag LOCUS_08150 4080 4352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 4360 4830 gene locus_tag LOCUS_08160 gene rpsG 4360 4830 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963472.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence0124 1572 691 gene locus_tag LOCUS_08170 1572 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 2515 3285 gene locus_tag LOCUS_08180 2515 3285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3324 3473 gene locus_tag LOCUS_08190 3324 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 3620 4081 gene locus_tag LOCUS_08200 3620 4081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 4078 5010 gene locus_tag LOCUS_08210 4078 5010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 6528 5068 gene locus_tag LOCUS_08220 6528 5068 CDS product Do family serine endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963348.1 protein_id gnl|my_center|LOCUS_08220 >Feature sequence0125 726 172 gene locus_tag LOCUS_08230 726 172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 853 2157 gene locus_tag LOCUS_08240 gene thrC 853 2157 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108281.1 protein_id gnl|my_center|LOCUS_08240 3253 2351 gene locus_tag LOCUS_08250 3253 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 3775 6387 gene locus_tag LOCUS_08260 gene clpB 3775 6387 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_08260 6697 6512 gene locus_tag LOCUS_08270 6697 6512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence0126 2630 4300 gene locus_tag LOCUS_08280 2630 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 4488 5549 gene locus_tag LOCUS_08290 4488 5549 CDS product beta-ketoacyl synthase chain length factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964354.1 protein_id gnl|my_center|LOCUS_08290 5642 6319 gene locus_tag LOCUS_08300 5642 6319 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964353.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence0127 2060 3130 gene locus_tag LOCUS_08310 2060 3130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_090662474.1 protein_id gnl|my_center|LOCUS_08310 3200 4963 gene locus_tag LOCUS_08320 3200 4963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 4969 5172 gene locus_tag LOCUS_08330 4969 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 >Feature sequence0128 <1 1658 gene locus_tag LOCUS_08340 <1 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962764.1:ATP-dependent zinc metalloprotease FtsH 1766 2539 gene locus_tag LOCUS_08350 1766 2539 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_08350 2598 3422 gene locus_tag LOCUS_08360 2598 3422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 3459 4523 gene locus_tag LOCUS_08370 gene prfA 3459 4523 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545879.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence0129 1107 1838 gene locus_tag LOCUS_08380 1107 1838 CDS product PspA/IM30 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403918.1 protein_id gnl|my_center|LOCUS_08380 1936 2415 gene locus_tag LOCUS_08390 1936 2415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 4175 2412 gene locus_tag LOCUS_08400 4175 2412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 4740 4168 gene locus_tag LOCUS_08410 4740 4168 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760422.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence0130 3 623 gene locus_tag LOCUS_08420 3 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 632 1174 gene locus_tag LOCUS_08430 632 1174 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_08430 1201 2508 gene locus_tag LOCUS_08440 1201 2508 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_08440 3516 2797 gene locus_tag LOCUS_08450 3516 2797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 3643 4296 gene locus_tag LOCUS_08460 3643 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 5888 4455 gene locus_tag LOCUS_08470 5888 4455 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_08470 6214 6011 gene locus_tag LOCUS_08480 6214 6011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 >Feature sequence0131 1834 1241 gene locus_tag LOCUS_08490 1834 1241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 3200 1893 gene locus_tag LOCUS_08500 3200 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 5073 3469 gene locus_tag LOCUS_08510 5073 3469 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764149.1 protein_id gnl|my_center|LOCUS_08510 5813 5229 gene locus_tag LOCUS_08520 5813 5229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 6678 6166 gene locus_tag LOCUS_08530 6678 6166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08530 >Feature sequence0132 1530 583 gene locus_tag LOCUS_08540 1530 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 2359 1655 gene locus_tag LOCUS_08550 gene mqnB 2359 1655 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941120.1 protein_id gnl|my_center|LOCUS_08550 4068 2383 gene locus_tag LOCUS_08560 4068 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 4834 5985 gene locus_tag LOCUS_08570 4834 5985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 6222 6407 gene locus_tag LOCUS_08580 6222 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 6448 6747 gene locus_tag LOCUS_08590 6448 6747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence0133 600 3512 gene locus_tag LOCUS_08600 600 3512 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798907.1 protein_id gnl|my_center|LOCUS_08600 3499 5718 gene locus_tag LOCUS_08610 3499 5718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 >Feature sequence0134 2037 505 gene locus_tag LOCUS_08620 2037 505 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_08620 2385 2537 gene locus_tag LOCUS_08630 2385 2537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 2627 2821 gene locus_tag LOCUS_08640 2627 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2826 3362 gene locus_tag LOCUS_08650 2826 3362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4687 3686 gene locus_tag LOCUS_08660 4687 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 4953 5987 gene locus_tag LOCUS_08670 4953 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence0135 782 1600 gene locus_tag LOCUS_08680 782 1600 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010895674.1 protein_id gnl|my_center|LOCUS_08680 3441 2029 gene locus_tag LOCUS_08690 gene lpdA 3441 2029 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963845.1 protein_id gnl|my_center|LOCUS_08690 4030 3512 gene locus_tag LOCUS_08700 4030 3512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 4248 5216 gene locus_tag LOCUS_08710 4248 5216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 5874 6071 gene locus_tag LOCUS_08720 5874 6071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 >Feature sequence0136 1139 1501 gene locus_tag LOCUS_08730 1139 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719490.1 protein_id gnl|my_center|LOCUS_08730 2761 1619 gene locus_tag LOCUS_08740 2761 1619 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_08740 4307 3129 gene locus_tag LOCUS_08750 4307 3129 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964347.1 protein_id gnl|my_center|LOCUS_08750 4858 4445 gene locus_tag LOCUS_08760 4858 4445 CDS product DUF1761 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265721.1 protein_id gnl|my_center|LOCUS_08760 6736 5066 gene locus_tag LOCUS_08770 6736 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence0137 3 650 gene locus_tag LOCUS_08780 3 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 1475 780 gene locus_tag LOCUS_08790 1475 780 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003855408.1 protein_id gnl|my_center|LOCUS_08790 2322 1480 gene locus_tag LOCUS_08800 2322 1480 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814520.1 protein_id gnl|my_center|LOCUS_08800 3443 2403 gene locus_tag LOCUS_08810 3443 2403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 5060 3657 gene locus_tag LOCUS_08820 5060 3657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08820 5805 4972 gene locus_tag LOCUS_08830 5805 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08830 >Feature sequence0138 2 1882 gene locus_tag LOCUS_08840 2 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1901 5830 gene locus_tag LOCUS_08850 1901 5830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence0139 376 3465 gene locus_tag LOCUS_08860 376 3465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3587 5572 gene locus_tag LOCUS_08870 gene gyrB 3587 5572 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962691.1 protein_id gnl|my_center|LOCUS_08870 6381 5587 gene locus_tag LOCUS_08880 6381 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence0140 713 147 gene locus_tag LOCUS_08890 713 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 2669 1020 gene locus_tag LOCUS_08900 2669 1020 CDS product PfaD family polyunsaturated fatty acid/polyketide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141954.1 protein_id gnl|my_center|LOCUS_08900 <6646 2914 gene locus_tag LOCUS_08910 <6646 2914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_172966575.1:beta-ketoacyl synthase N-terminal-like domain-containing protein >Feature sequence0141 601 353 gene locus_tag LOCUS_08920 601 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1126 764 gene locus_tag LOCUS_08930 1126 764 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140715.1 protein_id gnl|my_center|LOCUS_08930 3328 1349 gene locus_tag LOCUS_08940 3328 1349 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776044.1 protein_id gnl|my_center|LOCUS_08940 4159 3407 gene locus_tag LOCUS_08950 4159 3407 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528140.1 protein_id gnl|my_center|LOCUS_08950 4262 5434 gene locus_tag LOCUS_08960 4262 5434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 6077 5544 gene locus_tag LOCUS_08970 6077 5544 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782842.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence0142 1178 153 gene locus_tag LOCUS_08980 1178 153 CDS product GntG family PLP-dependent aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963030.1 protein_id gnl|my_center|LOCUS_08980 2025 3935 gene locus_tag LOCUS_08990 2025 3935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 6096 4042 gene locus_tag LOCUS_09000 6096 4042 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_09000 >Feature sequence0143 146 730 gene locus_tag LOCUS_09010 146 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 984 1148 gene locus_tag LOCUS_09020 984 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 1915 1118 gene locus_tag LOCUS_09030 gene mazG 1915 1118 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_09030 2297 3703 gene locus_tag LOCUS_09040 2297 3703 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_09040 3976 4896 gene locus_tag LOCUS_09050 3976 4896 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760345.1 protein_id gnl|my_center|LOCUS_09050 5018 6250 gene locus_tag LOCUS_09060 5018 6250 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142358.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence0144 1343 222 gene locus_tag LOCUS_09070 1343 222 CDS product DUF3524 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403829.1 protein_id gnl|my_center|LOCUS_09070 1860 1423 gene locus_tag LOCUS_09080 1860 1423 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141374.1 protein_id gnl|my_center|LOCUS_09080 3071 1857 gene locus_tag LOCUS_09090 3071 1857 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141373.1 protein_id gnl|my_center|LOCUS_09090 3973 3206 gene locus_tag LOCUS_09100 3973 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 4616 4053 gene locus_tag LOCUS_09110 4616 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence0145 1150 560 gene locus_tag LOCUS_09120 1150 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 1399 3612 gene locus_tag LOCUS_09130 1399 3612 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_111477477.1 protein_id gnl|my_center|LOCUS_09130 3951 3622 gene locus_tag LOCUS_09140 3951 3622 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964047.1 protein_id gnl|my_center|LOCUS_09140 4985 4026 gene locus_tag LOCUS_09150 4985 4026 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964046.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence0146 3362 51 gene locus_tag LOCUS_09160 3362 51 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_185958394.1 protein_id gnl|my_center|LOCUS_09160 4681 3662 gene locus_tag LOCUS_09170 4681 3662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 5609 5031 gene locus_tag LOCUS_09180 5609 5031 CDS product RNA polymerase sigma-70 factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768015.1 protein_id gnl|my_center|LOCUS_09180 >Feature sequence0147 791 1177 gene locus_tag LOCUS_09190 791 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 1323 2156 gene locus_tag LOCUS_09200 gene prmA 1323 2156 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963788.1 protein_id gnl|my_center|LOCUS_09200 >Feature sequence0148 527 288 gene locus_tag LOCUS_09210 527 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1183 1440 gene locus_tag LOCUS_09220 1183 1440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 1451 1726 gene locus_tag LOCUS_09230 1451 1726 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972002.1 protein_id gnl|my_center|LOCUS_09230 2225 1953 gene locus_tag LOCUS_09240 2225 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2466 2771 gene locus_tag LOCUS_09250 2466 2771 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107149.1 protein_id gnl|my_center|LOCUS_09250 2772 3116 gene locus_tag LOCUS_09260 2772 3116 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766714.1 protein_id gnl|my_center|LOCUS_09260 4388 4110 gene locus_tag LOCUS_09270 4388 4110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 <6541 5511 gene locus_tag LOCUS_09280 <6541 5511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012640274.1:serine hydrolase domain-containing protein >Feature sequence0149 1101 238 gene locus_tag LOCUS_09290 1101 238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1706 1293 gene locus_tag LOCUS_09300 1706 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 1979 3922 gene locus_tag LOCUS_09310 1979 3922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3969 5363 gene locus_tag LOCUS_09320 3969 5363 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809662.1 protein_id gnl|my_center|LOCUS_09320 6527 5457 gene locus_tag LOCUS_09330 6527 5457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616126.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence0150 1118 189 gene locus_tag LOCUS_09340 gene miaA 1118 189 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404248.1 protein_id gnl|my_center|LOCUS_09340 1595 1128 gene locus_tag LOCUS_09350 1595 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1983 1597 gene locus_tag LOCUS_09360 1983 1597 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878974.1 protein_id gnl|my_center|LOCUS_09360 4709 2034 gene locus_tag LOCUS_09370 4709 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 4872 5456 gene locus_tag LOCUS_09380 4872 5456 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202196.1 protein_id gnl|my_center|LOCUS_09380 5460 5909 gene locus_tag LOCUS_09390 5460 5909 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence0151 178 696 gene locus_tag LOCUS_09400 178 696 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528765.1 protein_id gnl|my_center|LOCUS_09400 709 1239 gene locus_tag LOCUS_09410 709 1239 CDS product tail fiber protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528766.1 protein_id gnl|my_center|LOCUS_09410 1725 3098 gene locus_tag LOCUS_09420 1725 3098 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_09420 3124 4419 gene locus_tag LOCUS_09430 3124 4419 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405033.1 protein_id gnl|my_center|LOCUS_09430 4927 4526 gene locus_tag LOCUS_09440 4927 4526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 5572 4982 gene locus_tag LOCUS_09450 5572 4982 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015366547.1 protein_id gnl|my_center|LOCUS_09450 5790 5915 gene locus_tag LOCUS_09460 5790 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 <6480 5928 gene locus_tag LOCUS_09470 <6480 5928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964301.1:DUF853 family protein >Feature sequence0152 558 872 gene locus_tag LOCUS_09480 558 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 2757 1543 gene locus_tag LOCUS_09490 2757 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 3820 2759 gene locus_tag LOCUS_09500 3820 2759 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_09500 5306 4401 gene locus_tag LOCUS_09510 5306 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 6162 5284 gene locus_tag LOCUS_09520 6162 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence0153 814 2901 gene locus_tag LOCUS_09530 814 2901 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962553.1 protein_id gnl|my_center|LOCUS_09530 3011 3928 gene locus_tag LOCUS_09540 3011 3928 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409255.1 protein_id gnl|my_center|LOCUS_09540 3934 4803 gene locus_tag LOCUS_09550 3934 4803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4918 6063 gene locus_tag LOCUS_09560 4918 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975374.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0154 <1 1410 gene locus_tag LOCUS_09570 <1 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142355.1:gamma-glutamyltransferase 2815 1460 gene locus_tag LOCUS_09580 2815 1460 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108171.1 protein_id gnl|my_center|LOCUS_09580 3041 2802 gene locus_tag LOCUS_09590 3041 2802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 3357 3596 gene locus_tag LOCUS_09600 3357 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 5728 4019 gene locus_tag LOCUS_09610 5728 4019 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_09610 5834 6283 gene locus_tag LOCUS_09620 5834 6283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence0155 1390 530 gene locus_tag LOCUS_09630 gene hisG 1390 530 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963108.1 protein_id gnl|my_center|LOCUS_09630 2017 3813 gene locus_tag LOCUS_09640 2017 3813 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043552510.1 protein_id gnl|my_center|LOCUS_09640 3884 6088 gene locus_tag LOCUS_09650 3884 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence0156 1 1014 gene locus_tag LOCUS_09660 1 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 995 1447 gene locus_tag LOCUS_09670 995 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1813 1484 gene locus_tag LOCUS_09680 1813 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2012 1803 gene locus_tag LOCUS_09690 2012 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 2372 2025 gene locus_tag LOCUS_09700 2372 2025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2855 4144 gene locus_tag LOCUS_09710 2855 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5134 4325 gene locus_tag LOCUS_09720 5134 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 6010 5654 gene locus_tag LOCUS_09730 6010 5654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 6145 6348 gene locus_tag LOCUS_09740 6145 6348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 >Feature sequence0157 71 970 gene locus_tag LOCUS_09750 71 970 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203586.1 protein_id gnl|my_center|LOCUS_09750 1080 2183 gene locus_tag LOCUS_09760 1080 2183 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042402692.1 protein_id gnl|my_center|LOCUS_09760 4140 2377 gene locus_tag LOCUS_09770 4140 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 5900 4173 gene locus_tag LOCUS_09780 5900 4173 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181146628.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence0158 1143 1529 gene locus_tag LOCUS_09790 1143 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 1972 3228 gene locus_tag LOCUS_09800 1972 3228 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173402023.1 protein_id gnl|my_center|LOCUS_09800 4517 3237 gene locus_tag LOCUS_09810 4517 3237 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762301.1 protein_id gnl|my_center|LOCUS_09810 4682 5977 gene locus_tag LOCUS_09820 4682 5977 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201998.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence0159 3744 538 gene locus_tag LOCUS_09830 3744 538 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404656.1 protein_id gnl|my_center|LOCUS_09830 4985 4482 gene locus_tag LOCUS_09840 4985 4482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence0160 <1 942 gene locus_tag LOCUS_09850 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039182.1:SMP-30/gluconolactonase/LRE family protein 1057 1518 gene locus_tag LOCUS_09860 1057 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1557 2114 gene locus_tag LOCUS_09870 1557 2114 CDS product DUF1572 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963698.1 protein_id gnl|my_center|LOCUS_09870 4791 2269 gene locus_tag LOCUS_09880 4791 2269 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202769.1 protein_id gnl|my_center|LOCUS_09880 5128 6363 gene locus_tag LOCUS_09890 5128 6363 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640575.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence0161 459 698 gene locus_tag LOCUS_09900 459 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 915 1829 gene locus_tag LOCUS_09910 915 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3200 2436 gene locus_tag LOCUS_09920 3200 2436 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258021.1 protein_id gnl|my_center|LOCUS_09920 5013 3325 gene locus_tag LOCUS_09930 5013 3325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 >Feature sequence0162 50 643 gene locus_tag LOCUS_09940 50 643 CDS product heme-copper oxidase subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014948.1 protein_id gnl|my_center|LOCUS_09940 1044 1373 gene locus_tag LOCUS_09950 1044 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 1595 2302 gene locus_tag LOCUS_09960 gene modA 1595 2302 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_09960 2299 2970 gene locus_tag LOCUS_09970 gene modB 2299 2970 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_09970 2972 3847 gene locus_tag LOCUS_09980 2972 3847 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_09980 4056 4841 gene locus_tag LOCUS_09990 4056 4841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 5275 4844 gene locus_tag LOCUS_10000 5275 4844 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938635.1 protein_id gnl|my_center|LOCUS_10000 6148 5369 gene locus_tag LOCUS_10010 6148 5369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence0163 1294 479 gene locus_tag LOCUS_10020 gene proC 1294 479 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804294.1 protein_id gnl|my_center|LOCUS_10020 2605 1379 gene locus_tag LOCUS_10030 gene aroA 2605 1379 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303115.1 protein_id gnl|my_center|LOCUS_10030 3421 2672 gene locus_tag LOCUS_10040 3421 2672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 3692 4264 gene locus_tag LOCUS_10050 3692 4264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 4451 4639 gene locus_tag LOCUS_10060 gene rpmI 4451 4639 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 protein_id gnl|my_center|LOCUS_10060 4751 5095 gene locus_tag LOCUS_10070 gene rplT 4751 5095 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963048.1 protein_id gnl|my_center|LOCUS_10070 6067 5276 gene locus_tag LOCUS_10080 gene dapF 6067 5276 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_135464474.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence0164 625 2298 gene locus_tag LOCUS_10090 625 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 2635 3345 gene locus_tag LOCUS_10100 2635 3345 CDS product DUF2071 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120331.1 protein_id gnl|my_center|LOCUS_10100 4370 3453 gene locus_tag LOCUS_10110 4370 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 5613 4480 gene locus_tag LOCUS_10120 gene dprA 5613 4480 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence0165 909 673 gene locus_tag LOCUS_10130 909 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1185 970 gene locus_tag LOCUS_10140 1185 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1471 1247 gene locus_tag LOCUS_10150 1471 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 1889 1509 gene locus_tag LOCUS_10160 1889 1509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 2776 1946 gene locus_tag LOCUS_10170 2776 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 2906 3526 gene locus_tag LOCUS_10180 2906 3526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 3903 4424 gene locus_tag LOCUS_10190 3903 4424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 >Feature sequence0166 1 225 gene locus_tag LOCUS_10200 1 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 318 962 gene locus_tag LOCUS_10210 318 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1015 1992 gene locus_tag LOCUS_10220 1015 1992 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761931.1 protein_id gnl|my_center|LOCUS_10220 1976 3028 gene locus_tag LOCUS_10230 1976 3028 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791183.1 protein_id gnl|my_center|LOCUS_10230 3395 5077 gene locus_tag LOCUS_10240 3395 5077 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898122.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence0167 1804 785 gene locus_tag LOCUS_10250 1804 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 2035 2289 gene locus_tag LOCUS_10260 2035 2289 CDS product DUF4212 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262767.1 protein_id gnl|my_center|LOCUS_10260 2364 4067 gene locus_tag LOCUS_10270 2364 4067 CDS product cation acetate symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_188216241.1 protein_id gnl|my_center|LOCUS_10270 <6315 4356 gene locus_tag LOCUS_10280 <6315 4356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123667.1:PQQ-binding-like beta-propeller repeat protein >Feature sequence0168 <1 3115 gene locus_tag LOCUS_10290 <1 3115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071225.1:efflux RND transporter permease subunit 3141 4484 gene locus_tag LOCUS_10300 3141 4484 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784703.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence0169 3134 3811 gene locus_tag LOCUS_10310 3134 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 3808 4461 gene locus_tag LOCUS_10320 3808 4461 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_10320 5865 4465 gene locus_tag LOCUS_10330 5865 4465 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000831876.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence0170 <1 2772 gene locus_tag LOCUS_10340 <1 2772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein 2840 5170 gene locus_tag LOCUS_10350 2840 5170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 >Feature sequence0171 1199 1969 gene locus_tag LOCUS_10360 1199 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 1971 3266 gene locus_tag LOCUS_10370 1971 3266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 3263 4312 gene locus_tag LOCUS_10380 3263 4312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5815 4370 gene locus_tag LOCUS_10390 5815 4370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence0172 588 370 gene locus_tag LOCUS_10400 588 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 774 998 gene locus_tag LOCUS_10410 774 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 4709 1194 gene locus_tag LOCUS_10420 gene dnaE 4709 1194 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403739.1 protein_id gnl|my_center|LOCUS_10420 <6268 5160 gene locus_tag LOCUS_10430 <6268 5160 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143384.1:amidohydrolase family protein >Feature sequence0173 <1 1314 gene locus_tag LOCUS_10440 <1 1314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921785.1:PAS domain S-box protein 2072 1584 gene locus_tag LOCUS_10450 2072 1584 CDS product TIGR04282 family arsenosugar biosynthesis glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933082.1 protein_id gnl|my_center|LOCUS_10450 4386 2275 gene locus_tag LOCUS_10460 4386 2275 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404166.1 protein_id gnl|my_center|LOCUS_10460 5880 4591 gene locus_tag LOCUS_10470 5880 4591 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760040.1 protein_id gnl|my_center|LOCUS_10470 6145 5915 gene locus_tag LOCUS_10480 6145 5915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 >Feature sequence0174 2070 649 gene locus_tag LOCUS_10490 2070 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 4089 2101 gene locus_tag LOCUS_10500 4089 2101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 6131 4218 gene locus_tag LOCUS_10510 6131 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence0175 1179 676 gene locus_tag LOCUS_10520 1179 676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1832 1257 gene locus_tag LOCUS_10530 1832 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 5365 2063 gene locus_tag LOCUS_10540 5365 2063 CDS product VCBS repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024768457.1 protein_id gnl|my_center|LOCUS_10540 <6229 5576 gene locus_tag LOCUS_10550 <6229 5576 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108773.1:RagB/SusD family nutrient uptake outer membrane protein >Feature sequence0176 1800 706 gene locus_tag LOCUS_10560 1800 706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1959 2282 gene locus_tag LOCUS_10570 1959 2282 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015938.1 protein_id gnl|my_center|LOCUS_10570 4703 3075 gene locus_tag LOCUS_10580 4703 3075 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403341.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence0177 1719 172 gene locus_tag LOCUS_10590 1719 172 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013228252.1 protein_id gnl|my_center|LOCUS_10590 3222 1837 gene locus_tag LOCUS_10600 3222 1837 CDS product formimidoylglutamate deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765557.1 protein_id gnl|my_center|LOCUS_10600 3813 3226 gene locus_tag LOCUS_10610 gene rimM 3813 3226 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938138.1 protein_id gnl|my_center|LOCUS_10610 5298 3847 gene locus_tag LOCUS_10620 5298 3847 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986368.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence0178 634 3864 gene locus_tag LOCUS_10630 634 3864 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545943.1 protein_id gnl|my_center|LOCUS_10630 4357 6021 gene locus_tag LOCUS_10640 4357 6021 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963873.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence0179 1192 734 gene locus_tag LOCUS_10650 gene folK 1192 734 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531872.1 protein_id gnl|my_center|LOCUS_10650 1446 3137 gene locus_tag LOCUS_10660 gene sppA 1446 3137 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765466.1 protein_id gnl|my_center|LOCUS_10660 3215 4075 gene locus_tag LOCUS_10670 3215 4075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 4216 5412 gene locus_tag LOCUS_10680 4216 5412 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326180.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence0180 951 1829 gene locus_tag LOCUS_10690 gene fabD 951 1829 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_10690 1954 2241 gene locus_tag LOCUS_10700 1954 2241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 2926 2291 gene locus_tag LOCUS_10710 gene pth 2926 2291 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785758.1 protein_id gnl|my_center|LOCUS_10710 3618 2998 gene locus_tag LOCUS_10720 3618 2998 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760337.1 protein_id gnl|my_center|LOCUS_10720 4648 3716 gene locus_tag LOCUS_10730 4648 3716 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768748.1 protein_id gnl|my_center|LOCUS_10730 4730 4658 gene locus_tag LOCUS_t00080 4730 4658 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 4854 6164 gene locus_tag LOCUS_10740 4854 6164 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962330.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence0181 456 1364 gene locus_tag LOCUS_10750 456 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 1670 2272 gene locus_tag LOCUS_10760 1670 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459261.1 protein_id gnl|my_center|LOCUS_10760 2429 3439 gene locus_tag LOCUS_10770 2429 3439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 3601 4524 gene locus_tag LOCUS_10780 3601 4524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence0182 <1 1347 gene locus_tag LOCUS_10790 <1 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119978.1:asparagine synthase (glutamine-hydrolyzing) 1752 1501 gene locus_tag LOCUS_10800 1752 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2861 1851 gene locus_tag LOCUS_10810 gene holA 2861 1851 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403276.1 protein_id gnl|my_center|LOCUS_10810 3296 3087 gene locus_tag LOCUS_10820 3296 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 3542 4681 gene locus_tag LOCUS_10830 3542 4681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4805 5608 gene locus_tag LOCUS_10840 4805 5608 CDS product L,D-transpeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928634.1 protein_id gnl|my_center|LOCUS_10840 5792 5971 gene locus_tag LOCUS_10850 5792 5971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence0183 4992 55 gene locus_tag LOCUS_10860 4992 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 6143 5082 gene locus_tag LOCUS_10870 6143 5082 CDS product PorV/PorQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099202.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence0184 <1 2926 gene locus_tag LOCUS_10880 <1 2926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_090706773.1:SusC/RagA family TonB-linked outer membrane protein 2952 4520 gene locus_tag LOCUS_10890 2952 4520 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766966.1 protein_id gnl|my_center|LOCUS_10890 >Feature sequence0185 1262 369 gene locus_tag LOCUS_10900 1262 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1334 2527 gene locus_tag LOCUS_10910 1334 2527 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962525.1 protein_id gnl|my_center|LOCUS_10910 2814 2506 gene locus_tag LOCUS_10920 2814 2506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 2921 4462 gene locus_tag LOCUS_10930 2921 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 5218 4619 gene locus_tag LOCUS_10940 5218 4619 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_146459507.1 protein_id gnl|my_center|LOCUS_10940 5344 5541 gene locus_tag LOCUS_10950 5344 5541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5519 5701 gene locus_tag LOCUS_10960 5519 5701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence0186 4041 1546 gene locus_tag LOCUS_10970 4041 1546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 5381 4626 gene locus_tag LOCUS_10980 5381 4626 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963156.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence0187 821 177 gene locus_tag LOCUS_10990 821 177 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_10990 4136 861 gene locus_tag LOCUS_11000 4136 861 CDS product CHAT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141063.1 protein_id gnl|my_center|LOCUS_11000 4234 5448 gene locus_tag LOCUS_11010 4234 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 >Feature sequence0188 2191 533 gene locus_tag LOCUS_11020 2191 533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3033 2275 gene locus_tag LOCUS_11030 3033 2275 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_11030 4509 3328 gene locus_tag LOCUS_11040 4509 3328 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545078.1 protein_id gnl|my_center|LOCUS_11040 5130 5912 gene locus_tag LOCUS_11050 5130 5912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 >Feature sequence0189 1920 943 gene locus_tag LOCUS_11060 1920 943 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046116578.1 protein_id gnl|my_center|LOCUS_11060 3205 2195 gene locus_tag LOCUS_11070 3205 2195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 5206 3422 gene locus_tag LOCUS_11080 5206 3422 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011120263.1 protein_id gnl|my_center|LOCUS_11080 5721 5407 gene locus_tag LOCUS_11090 5721 5407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence0190 230 1006 gene locus_tag LOCUS_11100 230 1006 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965790.1 protein_id gnl|my_center|LOCUS_11100 3402 1717 gene locus_tag LOCUS_11110 3402 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 4981 3638 gene locus_tag LOCUS_11120 4981 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 5805 5179 gene locus_tag LOCUS_11130 5805 5179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 6087 5947 gene locus_tag LOCUS_11140 6087 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence0191 331 137 gene locus_tag LOCUS_11150 331 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 655 2868 gene locus_tag LOCUS_11160 655 2868 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_11160 2876 4174 gene locus_tag LOCUS_11170 2876 4174 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_101335788.1 protein_id gnl|my_center|LOCUS_11170 5527 4889 gene locus_tag LOCUS_11180 gene pncA 5527 4889 CDS product bifunctional nicotinamidase/pyrazinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000030361.1 protein_id gnl|my_center|LOCUS_11180 <6064 5530 gene locus_tag LOCUS_11190 <6064 5530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963587.1:lipoyl synthase >Feature sequence0192 261 470 gene locus_tag LOCUS_11200 261 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 559 786 gene locus_tag LOCUS_11210 559 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1137 3275 gene locus_tag LOCUS_11220 1137 3275 CDS product DPP IV N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963251.1 protein_id gnl|my_center|LOCUS_11220 4656 3475 gene locus_tag LOCUS_11230 4656 3475 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_11230 5242 4802 gene locus_tag LOCUS_11240 5242 4802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 5933 5373 gene locus_tag LOCUS_11250 5933 5373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 >Feature sequence0193 <1 758 gene locus_tag LOCUS_11260 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963630.1:DUF1501 domain-containing protein 1396 908 gene locus_tag LOCUS_11270 1396 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 2106 1507 gene locus_tag LOCUS_11280 2106 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 4770 2155 gene locus_tag LOCUS_11290 4770 2155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 5855 5040 gene locus_tag LOCUS_11300 5855 5040 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962731.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence0194 <1 2431 gene locus_tag LOCUS_11310 <1 2431 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441479.1:amidohydrolase family protein 2436 3587 gene locus_tag LOCUS_11320 gene argE 2436 3587 CDS product acetylornithine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921458.1 protein_id gnl|my_center|LOCUS_11320 4697 3768 gene locus_tag LOCUS_11330 gene queG 4697 3768 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_11330 4861 6018 gene locus_tag LOCUS_11340 4861 6018 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257167.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence0195 856 509 gene locus_tag LOCUS_11350 856 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 965 1255 gene locus_tag LOCUS_11360 965 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11360 1381 1566 gene locus_tag LOCUS_11370 1381 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 4827 1696 gene locus_tag LOCUS_11380 4827 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence0196 1157 240 gene locus_tag LOCUS_11390 1157 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 2742 1288 gene locus_tag LOCUS_11400 2742 1288 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530939.1 protein_id gnl|my_center|LOCUS_11400 4594 2840 gene locus_tag LOCUS_11410 4594 2840 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_175139359.1 protein_id gnl|my_center|LOCUS_11410 5196 4591 gene locus_tag LOCUS_11420 5196 4591 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001283365.1 protein_id gnl|my_center|LOCUS_11420 5733 5521 gene locus_tag LOCUS_11430 5733 5521 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257467.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence0197 528 1592 gene locus_tag LOCUS_11440 528 1592 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011013491.1 protein_id gnl|my_center|LOCUS_11440 1558 3285 gene locus_tag LOCUS_11450 gene msbA 1558 3285 CDS product lipid A ABC transporter ATP-binding protein/permease MsbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005649789.1 protein_id gnl|my_center|LOCUS_11450 3272 4618 gene locus_tag LOCUS_11460 3272 4618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence0198 2896 1376 gene locus_tag LOCUS_11470 2896 1376 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_11470 3705 3034 gene locus_tag LOCUS_11480 3705 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 3730 4761 gene locus_tag LOCUS_11490 gene mltG 3730 4761 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_11490 4860 5099 gene locus_tag LOCUS_11500 4860 5099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 >Feature sequence0199 2847 1282 gene locus_tag LOCUS_11510 2847 1282 CDS product fatty acid CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259368.1 protein_id gnl|my_center|LOCUS_11510 3884 2838 gene locus_tag LOCUS_11520 3884 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 4555 3881 gene locus_tag LOCUS_11530 4555 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 5640 4552 gene locus_tag LOCUS_11540 5640 4552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence0200 <1 1355 gene locus_tag LOCUS_11550 <1 1355 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963054.1:excinuclease ABC subunit UvrB 1888 1352 gene locus_tag LOCUS_11560 gene dcd 1888 1352 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963354.1 protein_id gnl|my_center|LOCUS_11560 2324 3427 gene locus_tag LOCUS_11570 2324 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 3463 4071 gene locus_tag LOCUS_11580 3463 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4093 4581 gene locus_tag LOCUS_11590 4093 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4736 5584 gene locus_tag LOCUS_11600 4736 5584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence0201 2242 764 gene locus_tag LOCUS_11610 2242 764 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946492.1 protein_id gnl|my_center|LOCUS_11610 3430 2294 gene locus_tag LOCUS_11620 gene neuC 3430 2294 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946490.1 protein_id gnl|my_center|LOCUS_11620 4481 3432 gene locus_tag LOCUS_11630 gene legI 4481 3432 CDS product N,N'-diacetyllegionaminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213308.1 protein_id gnl|my_center|LOCUS_11630 5278 4475 gene locus_tag LOCUS_11640 5278 4475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088738.1 protein_id gnl|my_center|LOCUS_11640 <5993 5271 gene locus_tag LOCUS_11650 <5993 5271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088737.1:acylneuraminate cytidylyltransferase family protein >Feature sequence0202 786 4202 gene locus_tag LOCUS_11660 786 4202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11660 <5974 4444 gene locus_tag LOCUS_11670 <5974 4444 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203587.1:BamA/TamA family outer membrane protein >Feature sequence0203 470 2596 gene locus_tag LOCUS_11680 470 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3144 3302 gene locus_tag LOCUS_11690 3144 3302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence0204 3848 2175 gene locus_tag LOCUS_11700 gene gldM 3848 2175 CDS product gliding motility protein GldM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964073.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence0205 65 784 gene locus_tag LOCUS_11710 65 784 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762577.1 protein_id gnl|my_center|LOCUS_11710 1935 1027 gene locus_tag LOCUS_11720 gene xerD 1935 1027 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964120.1 protein_id gnl|my_center|LOCUS_11720 2513 2004 gene locus_tag LOCUS_11730 2513 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2667 4577 gene locus_tag LOCUS_11740 2667 4577 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403075.1 protein_id gnl|my_center|LOCUS_11740 <5958 4661 gene locus_tag LOCUS_11750 <5958 4661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838678.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence0206 403 155 gene locus_tag LOCUS_11760 403 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 505 1053 gene locus_tag LOCUS_11770 gene pyrR 505 1053 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963903.1 protein_id gnl|my_center|LOCUS_11770 1072 1998 gene locus_tag LOCUS_11780 1072 1998 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963902.1 protein_id gnl|my_center|LOCUS_11780 2097 3578 gene locus_tag LOCUS_11790 2097 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 3575 5020 gene locus_tag LOCUS_11800 3575 5020 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784513.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence0207 169 1131 gene locus_tag LOCUS_11810 169 1131 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108084.1 protein_id gnl|my_center|LOCUS_11810 1147 1641 gene locus_tag LOCUS_11820 1147 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 1919 2311 gene locus_tag LOCUS_11830 1919 2311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 2351 3472 gene locus_tag LOCUS_11840 gene atpB 2351 3472 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964549.1 protein_id gnl|my_center|LOCUS_11840 3511 3732 gene locus_tag LOCUS_11850 gene atpE 3511 3732 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931714.1 protein_id gnl|my_center|LOCUS_11850 3822 4316 gene locus_tag LOCUS_11860 3822 4316 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_11860 4340 4882 gene locus_tag LOCUS_11870 4340 4882 CDS product F0F1 ATP synthase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003732515.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence0208 128 763 gene locus_tag LOCUS_11880 128 763 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963240.1 protein_id gnl|my_center|LOCUS_11880 1880 792 gene locus_tag LOCUS_11890 1880 792 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403685.1 protein_id gnl|my_center|LOCUS_11890 2177 4099 gene locus_tag LOCUS_11900 2177 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 5427 4159 gene locus_tag LOCUS_11910 5427 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence0209 795 253 gene locus_tag LOCUS_11920 795 253 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_11920 1418 798 gene locus_tag LOCUS_11930 1418 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 2807 1440 gene locus_tag LOCUS_11940 2807 1440 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962327.1 protein_id gnl|my_center|LOCUS_11940 3190 3429 gene locus_tag LOCUS_11950 3190 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3527 5131 gene locus_tag LOCUS_11960 3527 5131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence0210 32 1123 gene locus_tag LOCUS_11970 32 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1769 1128 gene locus_tag LOCUS_11980 gene gmhA 1769 1128 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016435.1 protein_id gnl|my_center|LOCUS_11980 1970 2938 gene locus_tag LOCUS_11990 1970 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 2991 3182 gene locus_tag LOCUS_12000 2991 3182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3819 3289 gene locus_tag LOCUS_12010 3819 3289 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986783.1 protein_id gnl|my_center|LOCUS_12010 4676 3831 gene locus_tag LOCUS_12020 4676 3831 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962641.1 protein_id gnl|my_center|LOCUS_12020 4856 5287 gene locus_tag LOCUS_12030 4856 5287 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021289.1 protein_id gnl|my_center|LOCUS_12030 >Feature sequence0211 2401 347 gene locus_tag LOCUS_12040 2401 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 3873 2656 gene locus_tag LOCUS_12050 3873 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 5283 4141 gene locus_tag LOCUS_12060 5283 4141 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902843.1 protein_id gnl|my_center|LOCUS_12060 <5923 5377 gene locus_tag LOCUS_12070 <5923 5377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011087691.1:peptidase T >Feature sequence0212 2406 1021 gene locus_tag LOCUS_12080 2406 1021 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037525.1 protein_id gnl|my_center|LOCUS_12080 3504 2671 gene locus_tag LOCUS_12090 3504 2671 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503931.1 protein_id gnl|my_center|LOCUS_12090 4744 3608 gene locus_tag LOCUS_12100 4744 3608 CDS product cystathionine gamma-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001242837.1 protein_id gnl|my_center|LOCUS_12100 4876 5310 gene locus_tag LOCUS_12110 4876 5310 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791341.1 protein_id gnl|my_center|LOCUS_12110 5441 5872 gene locus_tag LOCUS_12120 5441 5872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 >Feature sequence0213 633 2843 gene locus_tag LOCUS_12130 633 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 3200 4576 gene locus_tag LOCUS_12140 gene radA 3200 4576 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962283.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence0214 21 428 gene locus_tag LOCUS_12150 21 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 440 3043 gene locus_tag LOCUS_12160 440 3043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 >Feature sequence0215 4714 3974 gene locus_tag LOCUS_12170 4714 3974 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405213.1 protein_id gnl|my_center|LOCUS_12170 5585 4785 gene locus_tag LOCUS_12180 5585 4785 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence0216 917 1423 gene locus_tag LOCUS_12190 917 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3733 1754 gene locus_tag LOCUS_12200 3733 1754 CDS product dehydrogenase E1 component subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963173.1 protein_id gnl|my_center|LOCUS_12200 5465 4122 gene locus_tag LOCUS_12210 5465 4122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 5674 5811 gene locus_tag LOCUS_12220 5674 5811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence0217 288 791 gene locus_tag LOCUS_12230 288 791 CDS product DinB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001076326.1 protein_id gnl|my_center|LOCUS_12230 1483 824 gene locus_tag LOCUS_12240 1483 824 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_12240 1634 2968 gene locus_tag LOCUS_12250 1634 2968 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962341.1 protein_id gnl|my_center|LOCUS_12250 4170 3013 gene locus_tag LOCUS_12260 4170 3013 CDS product murein hydrolase activator EnvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269286.1 protein_id gnl|my_center|LOCUS_12260 4951 4163 gene locus_tag LOCUS_12270 4951 4163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 <5871 5208 gene locus_tag LOCUS_12280 <5871 5208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000250222.1:threonine ammonia-lyase IlvA >Feature sequence0218 <1 1258 gene locus_tag LOCUS_12290 <1 1258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791502.1:glutamate--tRNA ligase 1347 2243 gene locus_tag LOCUS_12300 1347 2243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 2246 3016 gene locus_tag LOCUS_12310 2246 3016 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816058.1 protein_id gnl|my_center|LOCUS_12310 3192 3695 gene locus_tag LOCUS_12320 3192 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 4099 5067 gene locus_tag LOCUS_12330 4099 5067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence0219 1037 2920 gene locus_tag LOCUS_12340 1037 2920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence0220 890 93 gene locus_tag LOCUS_12350 890 93 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_12350 2086 1055 gene locus_tag LOCUS_12360 2086 1055 CDS product phosphatidylinositol-4-phosphate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787585.1 protein_id gnl|my_center|LOCUS_12360 3698 2340 gene locus_tag LOCUS_12370 3698 2340 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930806.1 protein_id gnl|my_center|LOCUS_12370 3811 5328 gene locus_tag LOCUS_12380 3811 5328 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888658.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence0221 1145 402 gene locus_tag LOCUS_12390 1145 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 1330 1163 gene locus_tag LOCUS_12400 1330 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1484 1290 gene locus_tag LOCUS_12410 1484 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1849 2262 gene locus_tag LOCUS_12420 1849 2262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 3758 5554 gene locus_tag LOCUS_12430 3758 5554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 >Feature sequence0222 482 1237 gene locus_tag LOCUS_12440 482 1237 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257603.1 protein_id gnl|my_center|LOCUS_12440 3113 1323 gene locus_tag LOCUS_12450 3113 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 4536 3187 gene locus_tag LOCUS_12460 4536 3187 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878451.1 protein_id gnl|my_center|LOCUS_12460 5405 4806 gene locus_tag LOCUS_12470 5405 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence0223 672 2765 gene locus_tag LOCUS_12480 672 2765 CDS product carboxy terminal-processing peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964422.1 protein_id gnl|my_center|LOCUS_12480 3451 3942 gene locus_tag LOCUS_12490 3451 3942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence0224 723 1919 gene locus_tag LOCUS_12500 723 1919 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_12500 2931 1888 gene locus_tag LOCUS_12510 gene lpxK 2931 1888 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927066.1 protein_id gnl|my_center|LOCUS_12510 3715 2951 gene locus_tag LOCUS_12520 3715 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 3991 4596 gene locus_tag LOCUS_12530 3991 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 4538 4747 gene locus_tag LOCUS_12540 4538 4747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4858 5766 gene locus_tag LOCUS_12550 4858 5766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12550 >Feature sequence0225 <1 620 gene locus_tag LOCUS_12560 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931961.1:succinate--CoA ligase subunit alpha 2058 628 gene locus_tag LOCUS_12570 2058 628 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868284.1 protein_id gnl|my_center|LOCUS_12570 3212 2247 gene locus_tag LOCUS_12580 3212 2247 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_12580 3425 4234 gene locus_tag LOCUS_12590 3425 4234 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963221.1 protein_id gnl|my_center|LOCUS_12590 5025 4363 gene locus_tag LOCUS_12600 5025 4363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 5602 5066 gene locus_tag LOCUS_12610 5602 5066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence0226 1362 1072 gene locus_tag LOCUS_12620 1362 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 1588 1343 gene locus_tag LOCUS_12630 1588 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 2378 1845 gene locus_tag LOCUS_12640 2378 1845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3271 2468 gene locus_tag LOCUS_12650 3271 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 4729 3467 gene locus_tag LOCUS_12660 4729 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12660 5710 5270 gene locus_tag LOCUS_12670 5710 5270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence0227 <1 647 gene locus_tag LOCUS_12680 <1 647 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941121.1:1,4-dihydroxy-6-naphthoate synthase 730 963 gene locus_tag LOCUS_12690 730 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 935 2257 gene locus_tag LOCUS_12700 935 2257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 2883 2518 gene locus_tag LOCUS_12710 2883 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 3036 3485 gene locus_tag LOCUS_12720 3036 3485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 3509 3688 gene locus_tag LOCUS_12730 3509 3688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 3729 4742 gene locus_tag LOCUS_12740 3729 4742 CDS product aminoglycoside phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459460.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence0228 2870 477 gene locus_tag LOCUS_12750 2870 477 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_12750 3691 2891 gene locus_tag LOCUS_12760 3691 2891 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963408.1 protein_id gnl|my_center|LOCUS_12760 4308 5678 gene locus_tag LOCUS_12770 4308 5678 CDS product undecaprenyl-phosphate glucose phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766006.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence0229 832 4674 gene locus_tag LOCUS_12780 832 4674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence0230 1646 1014 gene locus_tag LOCUS_12790 1646 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12790 2829 1864 gene locus_tag LOCUS_12800 gene rfaD 2829 1864 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_12800 3048 2833 gene locus_tag LOCUS_12810 3048 2833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 4347 3691 gene locus_tag LOCUS_12820 4347 3691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 4428 5447 gene locus_tag LOCUS_12830 4428 5447 CDS product FecR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766765.1 protein_id gnl|my_center|LOCUS_12830 >Feature sequence0231 689 1720 gene locus_tag LOCUS_12840 689 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2918 1953 gene locus_tag LOCUS_12850 2918 1953 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208036286.1 protein_id gnl|my_center|LOCUS_12850 3067 4485 gene locus_tag LOCUS_12860 3067 4485 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922975.1 protein_id gnl|my_center|LOCUS_12860 <5741 4664 gene locus_tag LOCUS_12870 <5741 4664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108629.1:TonB-dependent receptor >Feature sequence0232 2499 2314 gene locus_tag LOCUS_12880 2499 2314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 2704 3399 gene locus_tag LOCUS_12890 2704 3399 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927022.1 protein_id gnl|my_center|LOCUS_12890 5086 3569 gene locus_tag LOCUS_12900 5086 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence0233 3806 4807 gene locus_tag LOCUS_12910 gene tsaD 3806 4807 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503448.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence0234 1686 67 gene locus_tag LOCUS_12920 1686 67 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003899914.1 protein_id gnl|my_center|LOCUS_12920 2805 1735 gene locus_tag LOCUS_12930 2805 1735 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence0235 <1 3739 gene locus_tag LOCUS_12940 <1 3739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929290.1:VCBS repeat-containing protein 3817 4596 gene locus_tag LOCUS_12950 3817 4596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence0236 609 79 gene locus_tag LOCUS_12960 609 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 4089 868 gene locus_tag LOCUS_12970 4089 868 CDS product glycoside hydrolase family 2 TIM barrel-domain containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764442.1 protein_id gnl|my_center|LOCUS_12970 >Feature sequence0237 1472 471 gene locus_tag LOCUS_12980 1472 471 CDS product isocitrate/isopropylmalate family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404422.1 protein_id gnl|my_center|LOCUS_12980 2078 1560 gene locus_tag LOCUS_12990 gene nusB 2078 1560 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933372.1 protein_id gnl|my_center|LOCUS_12990 3567 2287 gene locus_tag LOCUS_13000 3567 2287 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_147744042.1 protein_id gnl|my_center|LOCUS_13000 5167 3764 gene locus_tag LOCUS_13010 5167 3764 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_13010 <5688 5189 gene locus_tag LOCUS_13020 <5688 5189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403982.1:aldehyde dehydrogenase family protein >Feature sequence0238 3011 336 gene locus_tag LOCUS_13030 3011 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 <5685 3116 gene locus_tag LOCUS_13040 <5685 3116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108585.1:TonB-dependent receptor >Feature sequence0239 774 163 gene locus_tag LOCUS_13050 774 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 1028 2407 gene locus_tag LOCUS_13060 gene eat 1028 2407 CDS product ethanolamine permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388785.1 protein_id gnl|my_center|LOCUS_13060 2411 3844 gene locus_tag LOCUS_13070 gene rlmD 2411 3844 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788070.1 protein_id gnl|my_center|LOCUS_13070 4468 3959 gene locus_tag LOCUS_13080 4468 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 4581 5168 gene locus_tag LOCUS_13090 4581 5168 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence0240 1135 185 gene locus_tag LOCUS_13100 1135 185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 3035 1872 gene locus_tag LOCUS_13110 3035 1872 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_13110 3134 4111 gene locus_tag LOCUS_13120 3134 4111 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017237.1 protein_id gnl|my_center|LOCUS_13120 4595 4182 gene locus_tag LOCUS_13130 4595 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 4785 5549 gene locus_tag LOCUS_13140 4785 5549 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_13140 >Feature sequence0241 <1 1302 gene locus_tag LOCUS_13150 <1 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143694.1:Ig-like domain-containing protein 3493 1421 gene locus_tag LOCUS_13160 3493 1421 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_13160 5218 3668 gene locus_tag LOCUS_13170 gene hutH 5218 3668 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838340.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence0242 1286 1882 gene locus_tag LOCUS_13180 1286 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 1863 3551 gene locus_tag LOCUS_13190 1863 3551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 4032 4697 gene locus_tag LOCUS_13200 4032 4697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 4703 5638 gene locus_tag LOCUS_13210 4703 5638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence0243 1966 299 gene locus_tag LOCUS_13220 1966 299 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705768.1 protein_id gnl|my_center|LOCUS_13220 3174 2143 gene locus_tag LOCUS_13230 3174 2143 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963200.1 protein_id gnl|my_center|LOCUS_13230 3588 3178 gene locus_tag LOCUS_13240 3588 3178 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197537018.1 protein_id gnl|my_center|LOCUS_13240 5300 3783 gene locus_tag LOCUS_13250 5300 3783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 >Feature sequence0244 4622 3483 gene locus_tag LOCUS_13260 4622 3483 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_13260 <5595 4661 gene locus_tag LOCUS_13270 <5595 4661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184492906.1:TolC family protein >Feature sequence0245 1424 837 gene locus_tag LOCUS_13280 1424 837 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228340.1 protein_id gnl|my_center|LOCUS_13280 1496 2704 gene locus_tag LOCUS_13290 1496 2704 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966003.1 protein_id gnl|my_center|LOCUS_13290 2801 3013 gene locus_tag LOCUS_13300 2801 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3030 3191 gene locus_tag LOCUS_13310 3030 3191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 3381 4322 gene locus_tag LOCUS_13320 3381 4322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 <5594 4505 gene locus_tag LOCUS_13330 <5594 4505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840190.1:prolyl oligopeptidase family serine peptidase >Feature sequence0246 1253 2914 gene locus_tag LOCUS_13340 1253 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 3000 4742 gene locus_tag LOCUS_13350 3000 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence0247 159 1292 gene locus_tag LOCUS_13360 159 1292 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963743.1 protein_id gnl|my_center|LOCUS_13360 2037 1378 gene locus_tag LOCUS_13370 2037 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 3133 2213 gene locus_tag LOCUS_13380 3133 2213 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201850.1 protein_id gnl|my_center|LOCUS_13380 5261 3399 gene locus_tag LOCUS_13390 gene mnmG 5261 3399 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962184.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence0248 1627 449 gene locus_tag LOCUS_13400 1627 449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence0249 203 388 gene locus_tag LOCUS_13410 203 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 786 1418 gene locus_tag LOCUS_13420 786 1418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1457 3118 gene locus_tag LOCUS_13430 1457 3118 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142246.1 protein_id gnl|my_center|LOCUS_13430 3561 3388 gene locus_tag LOCUS_13440 3561 3388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4871 3519 gene locus_tag LOCUS_13450 4871 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 >Feature sequence0250 2018 228 gene locus_tag LOCUS_13460 2018 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 2259 3698 gene locus_tag LOCUS_13470 2259 3698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence0251 1121 909 gene locus_tag LOCUS_13480 1121 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2408 1425 gene locus_tag LOCUS_13490 2408 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 3141 2398 gene locus_tag LOCUS_13500 3141 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 4996 3125 gene locus_tag LOCUS_13510 4996 3125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 5121 5315 gene locus_tag LOCUS_13520 5121 5315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 >Feature sequence0252 700 167 gene locus_tag LOCUS_13530 700 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 2696 693 gene locus_tag LOCUS_13540 2696 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3032 2700 gene locus_tag LOCUS_13550 3032 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 3673 3338 gene locus_tag LOCUS_13560 3673 3338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 4641 3862 gene locus_tag LOCUS_13570 4641 3862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence0253 <1 3348 gene locus_tag LOCUS_13580 <1 3348 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943837.1:CARDB domain-containing protein 3629 3841 gene locus_tag LOCUS_13590 3629 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 3841 4134 gene locus_tag LOCUS_13600 3841 4134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 5277 4111 gene locus_tag LOCUS_13610 5277 4111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261739.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence0254 1825 1232 gene locus_tag LOCUS_13620 1825 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2953 2030 gene locus_tag LOCUS_13630 2953 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 3878 2955 gene locus_tag LOCUS_13640 3878 2955 CDS product ribonuclease activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018324898.1 protein_id gnl|my_center|LOCUS_13640 5460 4468 gene locus_tag LOCUS_13650 5460 4468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 >Feature sequence0255 1205 1972 gene locus_tag LOCUS_13660 1205 1972 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391693.1 protein_id gnl|my_center|LOCUS_13660 1962 3317 gene locus_tag LOCUS_13670 1962 3317 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966692.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence0256 1734 1159 gene locus_tag LOCUS_13680 1734 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 2770 2102 gene locus_tag LOCUS_13690 2770 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3004 3288 gene locus_tag LOCUS_13700 3004 3288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3988 4668 gene locus_tag LOCUS_13710 3988 4668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 4672 5370 gene locus_tag LOCUS_13720 4672 5370 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence0257 61 747 gene locus_tag LOCUS_13730 61 747 CDS product ERCC4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763433.1 protein_id gnl|my_center|LOCUS_13730 1101 2906 gene locus_tag LOCUS_13740 1101 2906 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974101.1 protein_id gnl|my_center|LOCUS_13740 <5502 3090 gene locus_tag LOCUS_13750 <5502 3090 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796991.1:DNA polymerase I >Feature sequence0258 816 511 gene locus_tag LOCUS_13760 816 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1711 809 gene locus_tag LOCUS_13770 1711 809 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790934.1 protein_id gnl|my_center|LOCUS_13770 1961 2659 gene locus_tag LOCUS_13780 1961 2659 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761529.1 protein_id gnl|my_center|LOCUS_13780 2652 3167 gene locus_tag LOCUS_13790 2652 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 3160 4002 gene locus_tag LOCUS_13800 3160 4002 CDS product FRG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921712.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence0259 718 2553 gene locus_tag LOCUS_13810 718 2553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2885 3811 gene locus_tag LOCUS_13820 2885 3811 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382227.1 protein_id gnl|my_center|LOCUS_13820 5012 3798 gene locus_tag LOCUS_13830 5012 3798 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057204.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence0260 1535 1254 gene locus_tag LOCUS_13840 gene purS 1535 1254 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_13840 2232 1555 gene locus_tag LOCUS_13850 2232 1555 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099200.1 protein_id gnl|my_center|LOCUS_13850 3352 2960 gene locus_tag LOCUS_13860 3352 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 4159 3668 gene locus_tag LOCUS_13870 4159 3668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence0261 4 1236 gene locus_tag LOCUS_13880 4 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 1229 1765 gene locus_tag LOCUS_13890 1229 1765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 2145 2852 gene locus_tag LOCUS_13900 2145 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence0262 >Feature sequence0263 847 80 gene locus_tag LOCUS_13910 847 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 1816 863 gene locus_tag LOCUS_13920 1816 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 5395 1847 gene locus_tag LOCUS_13930 5395 1847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence0264 2 1861 gene locus_tag LOCUS_13940 2 1861 CDS product pyruvate carboxylase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788675.1 protein_id gnl|my_center|LOCUS_13940 1867 3228 gene locus_tag LOCUS_13950 1867 3228 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788673.1 protein_id gnl|my_center|LOCUS_13950 3683 3225 gene locus_tag LOCUS_13960 3683 3225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 5136 3823 gene locus_tag LOCUS_13970 5136 3823 CDS product beta-galactosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202166.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence0265 <1 716 gene locus_tag LOCUS_13980 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766232.1:histidinol dehydrogenase 795 1772 gene locus_tag LOCUS_13990 gene hisC 795 1772 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766231.1 protein_id gnl|my_center|LOCUS_13990 1813 2955 gene locus_tag LOCUS_14000 gene hisB 1813 2955 CDS product bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766230.1 protein_id gnl|my_center|LOCUS_14000 3241 3729 gene locus_tag LOCUS_14010 3241 3729 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_14010 <5381 3860 gene locus_tag LOCUS_14020 <5381 3860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023741.1:PKD domain-containing protein >Feature sequence0266 1488 415 gene locus_tag LOCUS_14030 gene hppD 1488 415 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_14030 2365 1577 gene locus_tag LOCUS_14040 gene cysQ 2365 1577 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071807.1 protein_id gnl|my_center|LOCUS_14040 3776 2640 gene locus_tag LOCUS_14050 3776 2640 CDS product LegC family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942618.1 protein_id gnl|my_center|LOCUS_14050 4270 3869 gene locus_tag LOCUS_14060 4270 3869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 4464 4267 gene locus_tag LOCUS_14070 4464 4267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 >Feature sequence0267 <1 1678 gene locus_tag LOCUS_14080 <1 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001192277.1:NAD(+) synthase 3384 1738 gene locus_tag LOCUS_14090 3384 1738 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_14090 3706 4197 gene locus_tag LOCUS_14100 3706 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4224 5327 gene locus_tag LOCUS_14110 4224 5327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence0268 866 1753 gene locus_tag LOCUS_14120 866 1753 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973725.1 protein_id gnl|my_center|LOCUS_14120 1831 2826 gene locus_tag LOCUS_14130 1831 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 2947 3936 gene locus_tag LOCUS_14140 2947 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 4573 4809 gene locus_tag LOCUS_14150 4573 4809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 4912 5151 gene locus_tag LOCUS_14160 4912 5151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence0269 848 75 gene locus_tag LOCUS_14170 848 75 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922035.1 protein_id gnl|my_center|LOCUS_14170 2155 962 gene locus_tag LOCUS_14180 2155 962 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403700.1 protein_id gnl|my_center|LOCUS_14180 2710 3468 gene locus_tag LOCUS_14190 gene soj 2710 3468 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000516114.1 protein_id gnl|my_center|LOCUS_14190 3500 3961 gene locus_tag LOCUS_14200 3500 3961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 <5357 4128 gene locus_tag LOCUS_14210 <5357 4128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765612.1:phosphatidylinositol-4-phosphate 5-kinase >Feature sequence0270 32 1228 gene locus_tag LOCUS_14220 gene mnmA 32 1228 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963885.1 protein_id gnl|my_center|LOCUS_14220 1285 2055 gene locus_tag LOCUS_14230 1285 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 2692 3837 gene locus_tag LOCUS_14240 2692 3837 CDS product cysteine desulfurase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008588454.1 protein_id gnl|my_center|LOCUS_14240 3932 5113 gene locus_tag LOCUS_14250 3932 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 >Feature sequence0271 3737 294 gene locus_tag LOCUS_14260 3737 294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 4161 5201 gene locus_tag LOCUS_14270 4161 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 >Feature sequence0272 1621 647 gene locus_tag LOCUS_14280 gene trpS 1621 647 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964337.1 protein_id gnl|my_center|LOCUS_14280 1748 2191 gene locus_tag LOCUS_14290 1748 2191 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070531.1 protein_id gnl|my_center|LOCUS_14290 3954 2212 gene locus_tag LOCUS_14300 3954 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence0273 49 309 gene locus_tag LOCUS_14310 49 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 1055 2488 gene locus_tag LOCUS_14320 1055 2488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 2565 3890 gene locus_tag LOCUS_14330 2565 3890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 3956 4972 gene locus_tag LOCUS_14340 3956 4972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 4979 5122 gene locus_tag LOCUS_14350 4979 5122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 >Feature sequence0274 369 1052 gene locus_tag LOCUS_14360 369 1052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1543 2658 gene locus_tag LOCUS_14370 1543 2658 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_14370 2965 3528 gene locus_tag LOCUS_14380 2965 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 3913 4446 gene locus_tag LOCUS_14390 3913 4446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 4499 5188 gene locus_tag LOCUS_14400 gene aat 4499 5188 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964441.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence0275 861 1730 gene locus_tag LOCUS_14410 861 1730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14410 1827 2960 gene locus_tag LOCUS_14420 gene dnaN 1827 2960 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963230.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence0276 377 3454 gene locus_tag LOCUS_14430 377 3454 CDS product DUF1553 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121300.1 protein_id gnl|my_center|LOCUS_14430 3529 4932 gene locus_tag LOCUS_14440 3529 4932 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence0277 1592 606 gene locus_tag LOCUS_14450 gene add 1592 606 CDS product adenosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966287.1 protein_id gnl|my_center|LOCUS_14450 2527 1649 gene locus_tag LOCUS_14460 2527 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 3648 2524 gene locus_tag LOCUS_14470 3648 2524 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_14470 5126 3648 gene locus_tag LOCUS_14480 5126 3648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence0278 <1 2838 gene locus_tag LOCUS_14490 <1 2838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein 2860 3924 gene locus_tag LOCUS_14500 2860 3924 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201961.1 protein_id gnl|my_center|LOCUS_14500 4628 5062 gene locus_tag LOCUS_14510 4628 5062 CDS product Dabb family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329772.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence0279 1163 1963 gene locus_tag LOCUS_14520 1163 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence0280 <1 1391 gene locus_tag LOCUS_14530 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582994.1:CRISPR-associated helicase/endonuclease Cas3 1612 1926 gene locus_tag LOCUS_14540 1612 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 2525 1983 gene locus_tag LOCUS_14550 2525 1983 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807752.1 protein_id gnl|my_center|LOCUS_14550 2574 3074 gene locus_tag LOCUS_14560 gene cas4 2574 3074 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768968.1 protein_id gnl|my_center|LOCUS_14560 3310 4314 gene locus_tag LOCUS_14570 gene cas1b 3310 4314 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768967.1 protein_id gnl|my_center|LOCUS_14570 4524 4784 gene locus_tag LOCUS_14580 gene cas2 4524 4784 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202914.1 protein_id gnl|my_center|LOCUS_14580 5080 5238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gctttaatcgcaccattttggaattgaaac >Feature sequence0281 <1 703 gene locus_tag LOCUS_14590 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009291361.1:ribonuclease III 947 1870 gene locus_tag LOCUS_14600 947 1870 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764795.1 protein_id gnl|my_center|LOCUS_14600 2720 1917 gene locus_tag LOCUS_14610 2720 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 3391 2717 gene locus_tag LOCUS_14620 3391 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 4108 3416 gene locus_tag LOCUS_14630 4108 3416 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963914.1 protein_id gnl|my_center|LOCUS_14630 <5264 4146 gene locus_tag LOCUS_14640 <5264 4146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839113.1:acyl-CoA dehydrogenase >Feature sequence0282 218 1678 gene locus_tag LOCUS_14650 218 1678 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_14650 1871 2938 gene locus_tag LOCUS_14660 1871 2938 CDS product peptidylglycine monooxygenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008663621.1 protein_id gnl|my_center|LOCUS_14660 3091 3017 gene locus_tag LOCUS_t00090 3091 3017 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3792 3469 gene locus_tag LOCUS_14670 3792 3469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 4475 3789 gene locus_tag LOCUS_14680 4475 3789 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015776105.1 protein_id gnl|my_center|LOCUS_14680 4682 4605 gene locus_tag LOCUS_t00100 4682 4605 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 <5263 4756 gene locus_tag LOCUS_14690 <5263 4756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_134204540.1:PKD domain-containing protein >Feature sequence0283 2329 659 gene locus_tag LOCUS_14700 2329 659 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114249.1 protein_id gnl|my_center|LOCUS_14700 2540 2947 gene locus_tag LOCUS_14710 2540 2947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 2944 4491 gene locus_tag LOCUS_14720 2944 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 >Feature sequence0284 <1 658 gene locus_tag LOCUS_14730 <1 658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792061.1:rod shape-determining protein RodA 1429 1061 gene locus_tag LOCUS_14740 1429 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 1736 1422 gene locus_tag LOCUS_14750 1736 1422 CDS product BrnT family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772654.1 protein_id gnl|my_center|LOCUS_14750 2078 3697 gene locus_tag LOCUS_14760 2078 3697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 >Feature sequence0285 1547 228 gene locus_tag LOCUS_14770 1547 228 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931864.1 protein_id gnl|my_center|LOCUS_14770 2139 1561 gene locus_tag LOCUS_14780 2139 1561 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_14780 2669 2136 gene locus_tag LOCUS_14790 2669 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 2959 3945 gene locus_tag LOCUS_14800 2959 3945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 <5256 4174 gene locus_tag LOCUS_14810 <5256 4174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962730.1:MATE family efflux transporter >Feature sequence0286 2679 2332 gene locus_tag LOCUS_14820 2679 2332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 3396 2818 gene locus_tag LOCUS_14830 3396 2818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 3654 3932 gene locus_tag LOCUS_14840 3654 3932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 4041 4859 gene locus_tag LOCUS_14850 4041 4859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence0287 554 1555 gene locus_tag LOCUS_14860 554 1555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 1936 3984 gene locus_tag LOCUS_14870 1936 3984 CDS product guanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000691480.1 protein_id gnl|my_center|LOCUS_14870 >Feature sequence0288 546 1052 gene locus_tag LOCUS_14880 546 1052 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938859.1 protein_id gnl|my_center|LOCUS_14880 1223 1002 gene locus_tag LOCUS_14890 1223 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1798 1385 gene locus_tag LOCUS_14900 1798 1385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14900 2697 2014 gene locus_tag LOCUS_14910 2697 2014 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868927.1 protein_id gnl|my_center|LOCUS_14910 2871 3686 gene locus_tag LOCUS_14920 2871 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4206 3895 gene locus_tag LOCUS_14930 4206 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence0289 3210 3686 gene locus_tag LOCUS_14940 3210 3686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 4875 3976 gene locus_tag LOCUS_14950 4875 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 >Feature sequence0290 216 1301 gene locus_tag LOCUS_14960 gene nuoH 216 1301 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785048.1 protein_id gnl|my_center|LOCUS_14960 1311 1793 gene locus_tag LOCUS_14970 1311 1793 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109090.1 protein_id gnl|my_center|LOCUS_14970 1797 2297 gene locus_tag LOCUS_14980 1797 2297 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785044.1 protein_id gnl|my_center|LOCUS_14980 2443 2760 gene locus_tag LOCUS_14990 gene nuoK 2443 2760 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932455.1 protein_id gnl|my_center|LOCUS_14990 2783 4702 gene locus_tag LOCUS_15000 gene nuoL 2783 4702 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764299.1 protein_id gnl|my_center|LOCUS_15000 >Feature sequence0291 699 2297 gene locus_tag LOCUS_15010 699 2297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3434 2685 gene locus_tag LOCUS_15020 3434 2685 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107611.1 protein_id gnl|my_center|LOCUS_15020 4432 3431 gene locus_tag LOCUS_15030 4432 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence0292 1011 2756 gene locus_tag LOCUS_15040 1011 2756 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143530.1 protein_id gnl|my_center|LOCUS_15040 3066 3602 gene locus_tag LOCUS_15050 3066 3602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 <5214 3628 gene locus_tag LOCUS_15060 <5214 3628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_193484633.1:sialidase family protein >Feature sequence0293 3388 767 gene locus_tag LOCUS_15070 3388 767 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962291.1 protein_id gnl|my_center|LOCUS_15070 4567 3740 gene locus_tag LOCUS_15080 gene murI 4567 3740 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545640.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence0294 359 12 gene locus_tag LOCUS_15090 359 12 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 1034 723 gene locus_tag LOCUS_15100 1034 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 2032 1238 gene locus_tag LOCUS_15110 2032 1238 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403503.1 protein_id gnl|my_center|LOCUS_15110 3226 2099 gene locus_tag LOCUS_15120 3226 2099 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962537.1 protein_id gnl|my_center|LOCUS_15120 4544 3393 gene locus_tag LOCUS_15130 4544 3393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence0295 2181 1288 gene locus_tag LOCUS_15140 2181 1288 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402958.1 protein_id gnl|my_center|LOCUS_15140 2433 3896 gene locus_tag LOCUS_15150 2433 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 4911 4177 gene locus_tag LOCUS_15160 4911 4177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 >Feature sequence0296 1441 290 gene locus_tag LOCUS_15170 gene porV 1441 290 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_15170 5041 1589 gene locus_tag LOCUS_15180 gene porU 5041 1589 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence0297 1139 387 gene locus_tag LOCUS_15190 gene hisIE 1139 387 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706033.1 protein_id gnl|my_center|LOCUS_15190 2341 1136 gene locus_tag LOCUS_15200 2341 1136 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_15200 2508 4670 gene locus_tag LOCUS_15210 2508 4670 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791499.1 protein_id gnl|my_center|LOCUS_15210 >Feature sequence0298 1292 363 gene locus_tag LOCUS_15220 gene mdh 1292 363 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_15220 1523 2233 gene locus_tag LOCUS_15230 1523 2233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 2389 3069 gene locus_tag LOCUS_15240 2389 3069 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_15240 3125 3745 gene locus_tag LOCUS_15250 3125 3745 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958122.1 protein_id gnl|my_center|LOCUS_15250 4007 4777 gene locus_tag LOCUS_15260 4007 4777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103017756.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence0299 914 276 gene locus_tag LOCUS_15270 914 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 3229 1493 gene locus_tag LOCUS_15280 3229 1493 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258732.1 protein_id gnl|my_center|LOCUS_15280 4559 3417 gene locus_tag LOCUS_15290 4559 3417 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101527.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence0300 2043 385 gene locus_tag LOCUS_15300 gene groL 2043 385 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964087.1 protein_id gnl|my_center|LOCUS_15300 2383 2108 gene locus_tag LOCUS_15310 2383 2108 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_15310 3968 2598 gene locus_tag LOCUS_15320 gene hisS 3968 2598 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_15320 4117 5052 gene locus_tag LOCUS_15330 4117 5052 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964584.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence0301 1070 555 gene locus_tag LOCUS_15340 1070 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962860.1 protein_id gnl|my_center|LOCUS_15340 1215 3218 gene locus_tag LOCUS_15350 1215 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15350 3811 3233 gene locus_tag LOCUS_15360 3811 3233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 4002 5096 gene locus_tag LOCUS_15370 4002 5096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence0302 1606 2232 gene locus_tag LOCUS_15380 1606 2232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3310 2606 gene locus_tag LOCUS_15390 3310 2606 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975745.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence0303 713 252 gene locus_tag LOCUS_15400 gene mraZ 713 252 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964164.1 protein_id gnl|my_center|LOCUS_15400 1717 3114 gene locus_tag LOCUS_15410 1717 3114 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258696.1 protein_id gnl|my_center|LOCUS_15410 4125 3409 gene locus_tag LOCUS_15420 4125 3409 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence0304 1518 1000 gene locus_tag LOCUS_15430 1518 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 1620 1850 gene locus_tag LOCUS_15440 1620 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15440 2672 1905 gene locus_tag LOCUS_15450 2672 1905 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254313.1 protein_id gnl|my_center|LOCUS_15450 2880 3752 gene locus_tag LOCUS_15460 2880 3752 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011730493.1 protein_id gnl|my_center|LOCUS_15460 4274 4359 gene locus_tag LOCUS_t00110 4274 4359 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0305 295 744 gene locus_tag LOCUS_15470 295 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15470 1587 940 gene locus_tag LOCUS_15480 1587 940 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_15480 2703 1729 gene locus_tag LOCUS_15490 2703 1729 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962506.1 protein_id gnl|my_center|LOCUS_15490 3491 2751 gene locus_tag LOCUS_15500 3491 2751 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_15500 3557 3895 gene locus_tag LOCUS_15510 3557 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence0306 <1 715 gene locus_tag LOCUS_15520 <1 715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002470194.1:RNA degradosome polyphosphate kinase 2539 665 gene locus_tag LOCUS_15530 2539 665 CDS product YgiQ family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788960.1 protein_id gnl|my_center|LOCUS_15530 2642 2848 gene locus_tag LOCUS_15540 2642 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 3174 3102 gene locus_tag LOCUS_t00120 3174 3102 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3792 3301 gene locus_tag LOCUS_15550 3792 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 4570 4139 gene locus_tag LOCUS_15560 4570 4139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence0307 2516 1326 gene locus_tag LOCUS_15570 2516 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 3758 2748 gene locus_tag LOCUS_15580 3758 2748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3988 4782 gene locus_tag LOCUS_15590 3988 4782 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262210.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence0308 372 719 gene locus_tag LOCUS_15600 372 719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 680 1510 gene locus_tag LOCUS_15610 680 1510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1767 2336 gene locus_tag LOCUS_15620 1767 2336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2478 3218 gene locus_tag LOCUS_15630 2478 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 3395 3616 gene locus_tag LOCUS_15640 3395 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 4327 3509 gene locus_tag LOCUS_15650 4327 3509 CDS product DUF4349 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680721.1 protein_id gnl|my_center|LOCUS_15650 <5109 4420 gene locus_tag LOCUS_15660 <5109 4420 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767601.1:head GIN domain-containing protein >Feature sequence0309 1224 511 gene locus_tag LOCUS_15670 gene ric 1224 511 CDS product iron-sulfur cluster repair di-iron protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941513.1 protein_id gnl|my_center|LOCUS_15670 4888 1274 gene locus_tag LOCUS_15680 4888 1274 CDS product nitrate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000729064.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence0310 742 1209 gene locus_tag LOCUS_15690 742 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 2700 1963 gene locus_tag LOCUS_15700 2700 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 3911 2751 gene locus_tag LOCUS_15710 3911 2751 CDS product DUF3810 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861460.1 protein_id gnl|my_center|LOCUS_15710 <5081 3981 gene locus_tag LOCUS_15720 <5081 3981 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence0311 2870 141 gene locus_tag LOCUS_15730 2870 141 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_15730 3903 2920 gene locus_tag LOCUS_15740 3903 2920 CDS product DUF4974 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765463.1 protein_id gnl|my_center|LOCUS_15740 4621 3995 gene locus_tag LOCUS_15750 4621 3995 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767805.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence0312 1728 1540 gene locus_tag LOCUS_15760 1728 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 1965 2957 gene locus_tag LOCUS_15770 1965 2957 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201216554.1 protein_id gnl|my_center|LOCUS_15770 3777 4049 gene locus_tag LOCUS_15780 3777 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 >Feature sequence0313 1618 1280 gene locus_tag LOCUS_15790 1618 1280 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964483.1 protein_id gnl|my_center|LOCUS_15790 2868 1759 gene locus_tag LOCUS_15800 2868 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 4463 2871 gene locus_tag LOCUS_15810 4463 2871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence0314 295 1215 gene locus_tag LOCUS_15820 295 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1376 1795 gene locus_tag LOCUS_15830 1376 1795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 1792 3294 gene locus_tag LOCUS_15840 gene nirK 1792 3294 CDS product copper-containing nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200986.1 protein_id gnl|my_center|LOCUS_15840 3375 4073 gene locus_tag LOCUS_15850 3375 4073 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689183.1 protein_id gnl|my_center|LOCUS_15850 4079 4669 gene locus_tag LOCUS_15860 4079 4669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence0315 594 2405 gene locus_tag LOCUS_15870 594 2405 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266447.1 protein_id gnl|my_center|LOCUS_15870 2464 4575 gene locus_tag LOCUS_15880 2464 4575 CDS product molybdopterin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112888.1 protein_id gnl|my_center|LOCUS_15880 4597 4977 gene locus_tag LOCUS_15890 4597 4977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 >Feature sequence0316 <1 2298 gene locus_tag LOCUS_15900 <1 2298 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258209.1:lamin tail domain-containing protein 2531 2340 gene locus_tag LOCUS_15910 2531 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 2837 2691 gene locus_tag LOCUS_15920 2837 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 3284 3586 gene locus_tag LOCUS_15930 3284 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15930 3590 3907 gene locus_tag LOCUS_15940 3590 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 4670 4305 gene locus_tag LOCUS_15950 4670 4305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15950 >Feature sequence0317 1573 278 gene locus_tag LOCUS_15960 1573 278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 2018 1605 gene locus_tag LOCUS_15970 2018 1605 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963793.1 protein_id gnl|my_center|LOCUS_15970 2544 2053 gene locus_tag LOCUS_15980 2544 2053 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963794.1 protein_id gnl|my_center|LOCUS_15980 3095 4003 gene locus_tag LOCUS_15990 3095 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence0318 582 2315 gene locus_tag LOCUS_16000 gene ilvI 582 2315 CDS product acetolactate synthase 3 large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095564.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence0319 2103 1912 gene locus_tag LOCUS_16010 2103 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 2195 2593 gene locus_tag LOCUS_16020 2195 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 3801 2722 gene locus_tag LOCUS_16030 gene fbaA 3801 2722 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962494.1 protein_id gnl|my_center|LOCUS_16030 <4984 4004 gene locus_tag LOCUS_16040 <4984 4004 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121811552.1:ABC transporter permease >Feature sequence0320 467 1702 gene locus_tag LOCUS_16050 467 1702 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927265.1 protein_id gnl|my_center|LOCUS_16050 2885 1995 gene locus_tag LOCUS_16060 gene prmC 2885 1995 CDS product peptide chain release factor N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202032.1 protein_id gnl|my_center|LOCUS_16060 3080 3958 gene locus_tag LOCUS_16070 3080 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 4130 4057 gene locus_tag LOCUS_t00130 4130 4057 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0321 2140 1913 gene locus_tag LOCUS_16080 2140 1913 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639890.1 protein_id gnl|my_center|LOCUS_16080 2777 2145 gene locus_tag LOCUS_16090 2777 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 2931 2785 gene locus_tag LOCUS_16100 2931 2785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 3094 4275 gene locus_tag LOCUS_16110 3094 4275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 4294 4602 gene locus_tag LOCUS_16120 4294 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence0322 353 4897 gene locus_tag LOCUS_16130 353 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence0323 228 1169 gene locus_tag LOCUS_16140 228 1169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 1309 2112 gene locus_tag LOCUS_16150 1309 2112 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962915.1 protein_id gnl|my_center|LOCUS_16150 2685 2251 gene locus_tag LOCUS_16160 gene aroQ 2685 2251 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791941.1 protein_id gnl|my_center|LOCUS_16160 3191 2787 gene locus_tag LOCUS_16170 3191 2787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 <4961 3621 gene locus_tag LOCUS_16180 <4961 3621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964202.1:thioredoxin domain-containing protein >Feature sequence0324 213 755 gene locus_tag LOCUS_16190 213 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 1411 899 gene locus_tag LOCUS_16200 1411 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 2345 1422 gene locus_tag LOCUS_16210 2345 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16210 3439 2642 gene locus_tag LOCUS_16220 3439 2642 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384321.1 protein_id gnl|my_center|LOCUS_16220 3860 3699 gene locus_tag LOCUS_16230 3860 3699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 >Feature sequence0325 2342 1881 gene locus_tag LOCUS_16240 2342 1881 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639856.1 protein_id gnl|my_center|LOCUS_16240 4256 2460 gene locus_tag LOCUS_16250 4256 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence0326 <1 1194 gene locus_tag LOCUS_16260 <1 1194 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103259.1:cytochrome C Snr1 1214 2449 gene locus_tag LOCUS_16270 1214 2449 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_16270 2449 2670 gene locus_tag LOCUS_16280 2449 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 3808 2684 gene locus_tag LOCUS_16290 3808 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 4785 3895 gene locus_tag LOCUS_16300 4785 3895 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228215.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence0327 21 2159 gene locus_tag LOCUS_16310 21 2159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 3036 2371 gene locus_tag LOCUS_16320 3036 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16320 3099 3863 gene locus_tag LOCUS_16330 3099 3863 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028174479.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence0328 920 378 gene locus_tag LOCUS_16340 920 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 1890 1030 gene locus_tag LOCUS_16350 1890 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2920 2093 gene locus_tag LOCUS_16360 gene legD1 2920 2093 CDS product Dot/Icm type IV secretion system effector LegD1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948394.1 protein_id gnl|my_center|LOCUS_16360 3188 3457 gene locus_tag LOCUS_16370 3188 3457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence0329 <1 4333 gene locus_tag LOCUS_16380 <1 4333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066275.1:PKD domain-containing protein >Feature sequence0330 1676 1801 gene locus_tag LOCUS_16390 1676 1801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 2666 1974 gene locus_tag LOCUS_16400 2666 1974 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762308.1 protein_id gnl|my_center|LOCUS_16400 3987 2731 gene locus_tag LOCUS_16410 3987 2731 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762307.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence0331 1 1515 gene locus_tag LOCUS_16420 1 1515 CDS product M2 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072459.1 protein_id gnl|my_center|LOCUS_16420 2163 3605 gene locus_tag LOCUS_16430 2163 3605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 3886 4611 gene locus_tag LOCUS_16440 3886 4611 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence0332 483 1784 gene locus_tag LOCUS_16450 gene secY 483 1784 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_16450 1795 2592 gene locus_tag LOCUS_16460 gene map 1795 2592 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_16460 2607 2825 gene locus_tag LOCUS_16470 gene infA 2607 2825 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933820.1 protein_id gnl|my_center|LOCUS_16470 2968 3345 gene locus_tag LOCUS_16480 gene rpsM 2968 3345 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963448.1 protein_id gnl|my_center|LOCUS_16480 3402 3788 gene locus_tag LOCUS_16490 gene rpsK 3402 3788 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_16490 3810 4412 gene locus_tag LOCUS_16500 gene rpsD 3810 4412 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403819.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence0333 451 1740 gene locus_tag LOCUS_16510 451 1740 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404924.1 protein_id gnl|my_center|LOCUS_16510 1751 2794 gene locus_tag LOCUS_16520 gene lpxD 1751 2794 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764416.1 protein_id gnl|my_center|LOCUS_16520 2799 3725 gene locus_tag LOCUS_16530 2799 3725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16530 3738 4193 gene locus_tag LOCUS_16540 3738 4193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_16540 >Feature sequence0334 1171 431 gene locus_tag LOCUS_16550 1171 431 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003722710.1 protein_id gnl|my_center|LOCUS_16550 1979 1248 gene locus_tag LOCUS_16560 1979 1248 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037350.1 protein_id gnl|my_center|LOCUS_16560 3401 2124 gene locus_tag LOCUS_16570 3401 2124 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804138.1 protein_id gnl|my_center|LOCUS_16570 4547 3531 gene locus_tag LOCUS_16580 4547 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence0335 2333 2560 gene locus_tag LOCUS_16590 2333 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 2547 2888 gene locus_tag LOCUS_16600 2547 2888 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142285.1 protein_id gnl|my_center|LOCUS_16600 3099 3497 gene locus_tag LOCUS_16610 3099 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence0336 1453 359 gene locus_tag LOCUS_16620 1453 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 2315 1515 gene locus_tag LOCUS_16630 2315 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 2412 3533 gene locus_tag LOCUS_16640 2412 3533 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_16640 3597 4640 gene locus_tag LOCUS_16650 3597 4640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 >Feature sequence0337 901 3756 gene locus_tag LOCUS_16660 901 3756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence0338 200 685 gene locus_tag LOCUS_16670 200 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 1974 787 gene locus_tag LOCUS_16680 1974 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 3197 2112 gene locus_tag LOCUS_16690 3197 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 >Feature sequence0339 511 909 gene locus_tag LOCUS_16700 511 909 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763087.1 protein_id gnl|my_center|LOCUS_16700 921 2321 gene locus_tag LOCUS_16710 921 2321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16710 2662 3918 gene locus_tag LOCUS_16720 2662 3918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 >Feature sequence0340 823 26 gene locus_tag LOCUS_16730 gene panB 823 26 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_16730 1246 2298 gene locus_tag LOCUS_16740 1246 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 2371 2760 gene locus_tag LOCUS_16750 2371 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16750 2887 4251 gene locus_tag LOCUS_16760 2887 4251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence0341 1010 321 gene locus_tag LOCUS_16770 1010 321 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444475.1 protein_id gnl|my_center|LOCUS_16770 1066 1644 gene locus_tag LOCUS_16780 1066 1644 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391278.1 protein_id gnl|my_center|LOCUS_16780 <4816 1939 gene locus_tag LOCUS_16790 <4816 1939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:amidohydrolase family protein >Feature sequence0342 1629 313 gene locus_tag LOCUS_16800 1629 313 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005814884.1 protein_id gnl|my_center|LOCUS_16800 2765 1962 gene locus_tag LOCUS_16810 2765 1962 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108474.1 protein_id gnl|my_center|LOCUS_16810 3851 2838 gene locus_tag LOCUS_16820 3851 2838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16820 4502 3873 gene locus_tag LOCUS_16830 4502 3873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence0343 209 538 gene locus_tag LOCUS_16840 209 538 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783700.1 protein_id gnl|my_center|LOCUS_16840 769 891 gene locus_tag LOCUS_16850 769 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16850 1306 2217 gene locus_tag LOCUS_16860 1306 2217 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109361.1 protein_id gnl|my_center|LOCUS_16860 2221 3009 gene locus_tag LOCUS_16870 2221 3009 CDS product SIS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974589.1 protein_id gnl|my_center|LOCUS_16870 3069 4094 gene locus_tag LOCUS_16880 3069 4094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 4297 4789 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaattccaatctggtgcgattaaagc >Feature sequence0344 1850 2380 gene locus_tag LOCUS_16890 1850 2380 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000256461.1 protein_id gnl|my_center|LOCUS_16890 2634 2990 gene locus_tag LOCUS_16900 2634 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 3036 3716 gene locus_tag LOCUS_16910 3036 3716 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086566.1 protein_id gnl|my_center|LOCUS_16910 >Feature sequence0345 2776 3147 gene locus_tag LOCUS_16920 2776 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 4655 3153 gene locus_tag LOCUS_16930 4655 3153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence0346 3218 360 gene locus_tag LOCUS_16940 3218 360 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109196.1 protein_id gnl|my_center|LOCUS_16940 4411 3398 gene locus_tag LOCUS_16950 4411 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence0347 <1 1231 gene locus_tag LOCUS_16960 <1 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072834.1:SO2930 family diheme c-type cytochrome 1616 1314 gene locus_tag LOCUS_16970 1616 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 3023 1635 gene locus_tag LOCUS_16980 3023 1635 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922285.1 protein_id gnl|my_center|LOCUS_16980 4352 3207 gene locus_tag LOCUS_16990 4352 3207 CDS product PQQ-dependent sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390122.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence0348 1077 118 gene locus_tag LOCUS_17000 1077 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17000 2592 1297 gene locus_tag LOCUS_17010 2592 1297 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784716.1 protein_id gnl|my_center|LOCUS_17010 2727 3554 gene locus_tag LOCUS_17020 2727 3554 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879249.1 protein_id gnl|my_center|LOCUS_17020 <4777 3559 gene locus_tag LOCUS_17030 <4777 3559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963323.1:acyl-CoA dehydrogenase family protein >Feature sequence0349 990 682 gene locus_tag LOCUS_17040 990 682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 1925 1065 gene locus_tag LOCUS_17050 1925 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 3211 2039 gene locus_tag LOCUS_17060 gene acdA 3211 2039 CDS product acyl-CoA dehydrogenase AcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003242719.1 protein_id gnl|my_center|LOCUS_17060 4517 3333 gene locus_tag LOCUS_17070 4517 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence0350 569 1360 gene locus_tag LOCUS_17080 569 1360 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846972.1 protein_id gnl|my_center|LOCUS_17080 >Feature sequence0351 1363 842 gene locus_tag LOCUS_17090 1363 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 2076 1534 gene locus_tag LOCUS_17100 2076 1534 CDS product pyridoxamine 5'-phosphate oxidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087442.1 protein_id gnl|my_center|LOCUS_17100 2739 2236 gene locus_tag LOCUS_17110 2739 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17110 3415 2789 gene locus_tag LOCUS_17120 gene pyrE 3415 2789 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_17120 3504 4226 gene locus_tag LOCUS_17130 3504 4226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence0352 2089 3072 gene locus_tag LOCUS_17140 2089 3072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 3104 4024 gene locus_tag LOCUS_17150 3104 4024 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368544.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence0353 670 1455 gene locus_tag LOCUS_17160 670 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 1523 3694 gene locus_tag LOCUS_17170 1523 3694 CDS product helix-hairpin-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838897.1 protein_id gnl|my_center|LOCUS_17170 3712 4425 gene locus_tag LOCUS_17180 3712 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 >Feature sequence0354 3017 447 gene locus_tag LOCUS_17190 3017 447 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_17190 3704 3312 gene locus_tag LOCUS_17200 3704 3312 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763564.1 protein_id gnl|my_center|LOCUS_17200 4293 3817 gene locus_tag LOCUS_17210 gene greA 4293 3817 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964455.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence0355 3845 2589 gene locus_tag LOCUS_17220 gene nusA 3845 2589 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_17220 4450 3926 gene locus_tag LOCUS_17230 gene rimP 4450 3926 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931931.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence0356 1394 408 gene locus_tag LOCUS_17240 1394 408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 4261 1487 gene locus_tag LOCUS_17250 4261 1487 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202132.1 protein_id gnl|my_center|LOCUS_17250 >Feature sequence0357 <1 2283 gene locus_tag LOCUS_17260 <1 2283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963833.1:3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein 2323 3501 gene locus_tag LOCUS_17270 2323 3501 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963835.1 protein_id gnl|my_center|LOCUS_17270 >Feature sequence0358 2801 1341 gene locus_tag LOCUS_17280 2801 1341 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796464.1 protein_id gnl|my_center|LOCUS_17280 3397 4413 gene locus_tag LOCUS_17290 3397 4413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence0359 <1 758 gene locus_tag LOCUS_17300 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202132.1:carboxypeptidase-like regulatory domain-containing protein 755 1837 gene locus_tag LOCUS_17310 755 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17310 3780 2050 gene locus_tag LOCUS_17320 3780 2050 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_17320 >Feature sequence0360 498 1391 gene locus_tag LOCUS_17330 gene galU 498 1391 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892053.1 protein_id gnl|my_center|LOCUS_17330 2588 1455 gene locus_tag LOCUS_17340 2588 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 3828 2617 gene locus_tag LOCUS_17350 3828 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 4104 3838 gene locus_tag LOCUS_17360 4104 3838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 4686 4189 gene locus_tag LOCUS_17370 4686 4189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence0361 <1 1189 gene locus_tag LOCUS_17380 <1 1189 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880726.1:hydrogenase maturation protein 1254 2273 gene locus_tag LOCUS_17390 gene hypE 1254 2273 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545205.1 protein_id gnl|my_center|LOCUS_17390 2292 3395 gene locus_tag LOCUS_17400 2292 3395 CDS product NHL repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029104264.1 protein_id gnl|my_center|LOCUS_17400 3406 4017 gene locus_tag LOCUS_17410 3406 4017 CDS product hydantoin utilization protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125521.1 protein_id gnl|my_center|LOCUS_17410 4014 4574 gene locus_tag LOCUS_17420 4014 4574 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962505.1 protein_id gnl|my_center|LOCUS_17420 >Feature sequence0362 3687 106 gene locus_tag LOCUS_17430 3687 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 >Feature sequence0363 1078 128 gene locus_tag LOCUS_17440 1078 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 3373 2759 gene locus_tag LOCUS_17450 3373 2759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 4626 3868 gene locus_tag LOCUS_17460 4626 3868 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014527266.1 protein_id gnl|my_center|LOCUS_17460 >Feature sequence0364 559 221 gene locus_tag LOCUS_17470 559 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17470 4369 860 gene locus_tag LOCUS_17480 4369 860 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680859.1 protein_id gnl|my_center|LOCUS_17480 >Feature sequence0365 66 791 gene locus_tag LOCUS_17490 66 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17490 797 1708 gene locus_tag LOCUS_17500 797 1708 CDS product 1-phosphofructokinase family hexose kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966234.1 protein_id gnl|my_center|LOCUS_17500 1710 2657 gene locus_tag LOCUS_17510 1710 2657 CDS product PfkB family carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974044.1 protein_id gnl|my_center|LOCUS_17510 2664 3500 gene locus_tag LOCUS_17520 2664 3500 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393881.1 protein_id gnl|my_center|LOCUS_17520 3663 4655 gene locus_tag LOCUS_17530 3663 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence0366 201 1085 gene locus_tag LOCUS_17540 201 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 1101 2432 gene locus_tag LOCUS_17550 1101 2432 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963305.1 protein_id gnl|my_center|LOCUS_17550 2432 3412 gene locus_tag LOCUS_17560 2432 3412 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_17560 3931 3497 gene locus_tag LOCUS_17570 3931 3497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17570 3825 4103 gene locus_tag LOCUS_17580 3825 4103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 4428 4354 gene locus_tag LOCUS_t00140 4428 4354 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0367 2425 1127 gene locus_tag LOCUS_17590 2425 1127 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963440.1 protein_id gnl|my_center|LOCUS_17590 2968 4089 gene locus_tag LOCUS_17600 2968 4089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence0368 457 2826 gene locus_tag LOCUS_17610 457 2826 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_121811552.1 protein_id gnl|my_center|LOCUS_17610 >Feature sequence0369 294 1559 gene locus_tag LOCUS_17620 294 1559 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976362.1 protein_id gnl|my_center|LOCUS_17620 2279 1563 gene locus_tag LOCUS_17630 gene tsaB 2279 1563 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_17630 2340 3932 gene locus_tag LOCUS_17640 2340 3932 CDS product NFACT RNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932427.1 protein_id gnl|my_center|LOCUS_17640 >Feature sequence0370 <1 1210 gene locus_tag LOCUS_17650 <1 1210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403056.1:sodium/sugar symporter 1211 2047 gene locus_tag LOCUS_17660 1211 2047 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122036.1 protein_id gnl|my_center|LOCUS_17660 3847 2642 gene locus_tag LOCUS_17670 3847 2642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence0371 533 105 gene locus_tag LOCUS_17680 533 105 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061215.1 protein_id gnl|my_center|LOCUS_17680 1504 536 gene locus_tag LOCUS_17690 1504 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 2081 1647 gene locus_tag LOCUS_17700 2081 1647 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788218.1 protein_id gnl|my_center|LOCUS_17700 3934 3536 gene locus_tag LOCUS_17710 3934 3536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17710 4612 4100 gene locus_tag LOCUS_17720 4612 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence0372 911 2356 gene locus_tag LOCUS_17730 911 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 2562 3221 gene locus_tag LOCUS_17740 gene mnmD 2562 3221 CDS product tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108715.1 protein_id gnl|my_center|LOCUS_17740 3492 4595 gene locus_tag LOCUS_17750 gene rlmG 3492 4595 CDS product 23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011817237.1 protein_id gnl|my_center|LOCUS_17750 >Feature sequence0373 2197 4479 gene locus_tag LOCUS_17760 2197 4479 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962206.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence0374 569 1231 gene locus_tag LOCUS_17770 569 1231 CDS product acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986573.1 protein_id gnl|my_center|LOCUS_17770 1765 1343 gene locus_tag LOCUS_17780 1765 1343 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027480246.1 protein_id gnl|my_center|LOCUS_17780 2058 3005 gene locus_tag LOCUS_17790 2058 3005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 3514 4185 gene locus_tag LOCUS_17800 3514 4185 CDS product haloacid dehalogenase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011204015.1 protein_id gnl|my_center|LOCUS_17800 >Feature sequence0375 <1 2629 gene locus_tag LOCUS_17810 <1 2629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169313288.1:Calx-beta domain-containing protein 2626 3255 gene locus_tag LOCUS_17820 2626 3255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 3368 3586 gene locus_tag LOCUS_17830 3368 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 3761 4138 gene locus_tag LOCUS_17840 3761 4138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17840 >Feature sequence0376 783 1754 gene locus_tag LOCUS_17850 783 1754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 <4592 1836 gene locus_tag LOCUS_17860 <4592 1836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929325.1:tetratricopeptide repeat protein >Feature sequence0377 63 245 gene locus_tag LOCUS_17870 63 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17870 378 929 gene locus_tag LOCUS_17880 378 929 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013383663.1 protein_id gnl|my_center|LOCUS_17880 988 1953 gene locus_tag LOCUS_17890 988 1953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 3298 2060 gene locus_tag LOCUS_17900 3298 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 <4591 3358 gene locus_tag LOCUS_17910 <4591 3358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582613.1:CehA/McbA family metallohydrolase >Feature sequence0378 1130 2032 gene locus_tag LOCUS_17920 gene mmuM 1130 2032 CDS product homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909348.1 protein_id gnl|my_center|LOCUS_17920 3546 2149 gene locus_tag LOCUS_17930 3546 2149 CDS product sulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108982.1 protein_id gnl|my_center|LOCUS_17930 >Feature sequence0379 <1 881 gene locus_tag LOCUS_17940 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765353.1:S41 family peptidase 1392 2336 gene locus_tag LOCUS_17950 1392 2336 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123957.1 protein_id gnl|my_center|LOCUS_17950 2358 3158 gene locus_tag LOCUS_17960 2358 3158 CDS product MOSC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113973.1 protein_id gnl|my_center|LOCUS_17960 3362 4369 gene locus_tag LOCUS_17970 3362 4369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17970 >Feature sequence0380 400 1929 gene locus_tag LOCUS_17980 400 1929 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004453606.1 protein_id gnl|my_center|LOCUS_17980 3367 2048 gene locus_tag LOCUS_17990 3367 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence0381 962 120 gene locus_tag LOCUS_18000 gene panC 962 120 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_18000 1063 1923 gene locus_tag LOCUS_18010 1063 1923 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_18010 1973 2548 gene locus_tag LOCUS_18020 1973 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18020 2575 3246 gene locus_tag LOCUS_18030 2575 3246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18030 >Feature sequence0382 <1 575 gene locus_tag LOCUS_18040 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108349.1:M28 family peptidase 1313 2338 gene locus_tag LOCUS_18050 1313 2338 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_18050 3714 2581 gene locus_tag LOCUS_18060 gene tgt 3714 2581 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962771.1 protein_id gnl|my_center|LOCUS_18060 <4570 3848 gene locus_tag LOCUS_18070 <4570 3848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013096489.1:TonB-dependent receptor PqqU >Feature sequence0383 1343 300 gene locus_tag LOCUS_18080 gene metX 1343 300 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932292.1 protein_id gnl|my_center|LOCUS_18080 2770 1451 gene locus_tag LOCUS_18090 2770 1451 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932291.1 protein_id gnl|my_center|LOCUS_18090 4147 2915 gene locus_tag LOCUS_18100 4147 2915 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021070980.1 protein_id gnl|my_center|LOCUS_18100 >Feature sequence0384 <1 670 gene locus_tag LOCUS_18110 <1 670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964302.1:NAD(P)/FAD-dependent oxidoreductase 2013 916 gene locus_tag LOCUS_18120 2013 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18120 >Feature sequence0385 4079 1341 gene locus_tag LOCUS_18130 4079 1341 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091704098.1 protein_id gnl|my_center|LOCUS_18130 4334 4191 gene locus_tag LOCUS_18140 4334 4191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18140 >Feature sequence0386 708 3173 gene locus_tag LOCUS_18150 708 3173 CDS product penicillin acylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004529751.1 protein_id gnl|my_center|LOCUS_18150 3323 4309 gene locus_tag LOCUS_18160 3323 4309 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193443.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence0387 309 698 gene locus_tag LOCUS_18170 309 698 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005777736.1 protein_id gnl|my_center|LOCUS_18170 741 1415 gene locus_tag LOCUS_18180 741 1415 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_18180 1412 2665 gene locus_tag LOCUS_18190 1412 2665 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_18190 2734 4077 gene locus_tag LOCUS_18200 2734 4077 CDS product dihydrolipoamide acetyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962751.1 protein_id gnl|my_center|LOCUS_18200 >Feature sequence0388 48 356 gene locus_tag LOCUS_18210 48 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 502 2472 gene locus_tag LOCUS_18220 502 2472 CDS product bifunctional aldolase/short-chain dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532918.1 protein_id gnl|my_center|LOCUS_18220 2650 2982 gene locus_tag LOCUS_18230 2650 2982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 3006 3200 gene locus_tag LOCUS_18240 3006 3200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18240 >Feature sequence0389 3 1358 gene locus_tag LOCUS_18250 3 1358 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838678.1 protein_id gnl|my_center|LOCUS_18250 1799 1431 gene locus_tag LOCUS_18260 1799 1431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 3056 1890 gene locus_tag LOCUS_18270 3056 1890 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_18270 4092 3499 gene locus_tag LOCUS_18280 4092 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence0390 309 494 gene locus_tag LOCUS_18290 309 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18290 523 1188 gene locus_tag LOCUS_18300 523 1188 CDS product peptidoglycan-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941648.1 protein_id gnl|my_center|LOCUS_18300 1212 2963 gene locus_tag LOCUS_18310 1212 2963 CDS product VgrG-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226667.1 protein_id gnl|my_center|LOCUS_18310 3021 3311 gene locus_tag LOCUS_18320 3021 3311 CDS product PAAR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007340539.1 protein_id gnl|my_center|LOCUS_18320 3330 3740 gene locus_tag LOCUS_18330 3330 3740 CDS product GPW/gp25 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941652.1 protein_id gnl|my_center|LOCUS_18330 >Feature sequence0391 725 2776 gene locus_tag LOCUS_18340 725 2776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18340 4066 2780 gene locus_tag LOCUS_18350 4066 2780 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963326.1 protein_id gnl|my_center|LOCUS_18350 >Feature sequence0392 534 166 gene locus_tag LOCUS_18360 gene rplN 534 166 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005055680.1 protein_id gnl|my_center|LOCUS_18360 817 548 gene locus_tag LOCUS_18370 gene rpsQ 817 548 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_18370 1039 824 gene locus_tag LOCUS_18380 gene rpmC 1039 824 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644737.1 protein_id gnl|my_center|LOCUS_18380 1466 1044 gene locus_tag LOCUS_18390 gene rplP 1466 1044 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933835.1 protein_id gnl|my_center|LOCUS_18390 2171 1479 gene locus_tag LOCUS_18400 gene rpsC 2171 1479 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963464.1 protein_id gnl|my_center|LOCUS_18400 2745 2191 gene locus_tag LOCUS_18410 2745 2191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18410 3809 2979 gene locus_tag LOCUS_18420 gene rplB 3809 2979 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963466.1 protein_id gnl|my_center|LOCUS_18420 4173 3880 gene locus_tag LOCUS_18430 gene rplW 4173 3880 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963467.1 protein_id gnl|my_center|LOCUS_18430 >Feature sequence0393 1872 856 gene locus_tag LOCUS_18440 gene pdhA 1872 856 CDS product pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963513.1 protein_id gnl|my_center|LOCUS_18440 1994 3112 gene locus_tag LOCUS_18450 gene recF 1994 3112 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_18450 3257 4210 gene locus_tag LOCUS_18460 3257 4210 CDS product threonine/serine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209638.1 protein_id gnl|my_center|LOCUS_18460 >Feature sequence0394 57 1577 gene locus_tag LOCUS_18470 57 1577 CDS product magnesium chelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405041.1 protein_id gnl|my_center|LOCUS_18470 2961 1597 gene locus_tag LOCUS_18480 gene preA 2961 1597 CDS product NAD-dependent dihydropyrimidine dehydrogenase subunit PreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338051.1 protein_id gnl|my_center|LOCUS_18480 4007 3072 gene locus_tag LOCUS_18490 4007 3072 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962404.1 protein_id gnl|my_center|LOCUS_18490 >Feature sequence0395 <1 1973 gene locus_tag LOCUS_18500 <1 1973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963808.1:valine--tRNA ligase 2935 2255 gene locus_tag LOCUS_18510 2935 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18510 >Feature sequence0396 418 29 gene locus_tag LOCUS_18520 418 29 CDS product GxxExxY protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784536.1 protein_id gnl|my_center|LOCUS_18520 925 1308 gene locus_tag LOCUS_18530 925 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18530 1327 2397 gene locus_tag LOCUS_18540 1327 2397 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091411521.1 protein_id gnl|my_center|LOCUS_18540 2579 4009 gene locus_tag LOCUS_18550 2579 4009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18550 >Feature sequence0397 736 1491 gene locus_tag LOCUS_18560 736 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18560 1594 1971 gene locus_tag LOCUS_18570 1594 1971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18570 2119 3531 gene locus_tag LOCUS_18580 2119 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18580 3644 3940 gene locus_tag LOCUS_18590 3644 3940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18590 >Feature sequence0398 >Feature sequence0399 1883 3772 gene locus_tag LOCUS_18600 1883 3772 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_18600 3791 3913 gene locus_tag LOCUS_18610 3791 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18610 >Feature sequence0400 <1 1422 gene locus_tag LOCUS_18620 <1 1422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962775.1:replicative DNA helicase 1790 2656 gene locus_tag LOCUS_18630 1790 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18630 >Feature sequence0401 <1 1737 gene locus_tag LOCUS_18640 <1 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044884.1:PAS domain S-box protein 1847 2554 gene locus_tag LOCUS_18650 1847 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18650 4197 2878 gene locus_tag LOCUS_18660 gene ahcY 4197 2878 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962366.1 protein_id gnl|my_center|LOCUS_18660 >Feature sequence0402 776 204 gene locus_tag LOCUS_18670 776 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18670 1490 819 gene locus_tag LOCUS_18680 1490 819 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116185855.1 protein_id gnl|my_center|LOCUS_18680 3170 1737 gene locus_tag LOCUS_18690 3170 1737 CDS product ribonuclease inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_141613167.1 protein_id gnl|my_center|LOCUS_18690 <4393 3642 gene locus_tag LOCUS_18700 <4393 3642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922285.1:DUF1501 domain-containing protein >Feature sequence0403 142 810 gene locus_tag LOCUS_18710 142 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_18710 881 1525 gene locus_tag LOCUS_18720 881 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18720 2572 1598 gene locus_tag LOCUS_18730 2572 1598 CDS product YpdA family putative bacillithiol disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403438.1 protein_id gnl|my_center|LOCUS_18730 3372 3833 gene locus_tag LOCUS_18740 3372 3833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18740 >Feature sequence0404 138 1337 gene locus_tag LOCUS_18750 138 1337 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_18750 1901 1425 gene locus_tag LOCUS_18760 1901 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18760 2392 3291 gene locus_tag LOCUS_18770 2392 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18770 3975 3475 gene locus_tag LOCUS_18780 gene purE 3975 3475 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081520.1 protein_id gnl|my_center|LOCUS_18780 >Feature sequence0405 338 592 gene locus_tag LOCUS_18790 338 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18790 681 1079 gene locus_tag LOCUS_18800 681 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18800 1076 1993 gene locus_tag LOCUS_18810 1076 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18810 1975 2322 gene locus_tag LOCUS_18820 1975 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18820 2340 2774 gene locus_tag LOCUS_18830 2340 2774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18830 2771 3097 gene locus_tag LOCUS_18840 2771 3097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18840 3181 3333 gene locus_tag LOCUS_18850 3181 3333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18850 3336 4118 gene locus_tag LOCUS_18860 3336 4118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18860 >Feature sequence0406 365 2068 gene locus_tag LOCUS_18870 365 2068 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113337.1 protein_id gnl|my_center|LOCUS_18870 2080 3639 gene locus_tag LOCUS_18880 2080 3639 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_18880 <4379 3722 gene locus_tag LOCUS_18890 <4379 3722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250640.1:S8 family serine peptidase >Feature sequence0407 2048 435 gene locus_tag LOCUS_18900 2048 435 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766122.1 protein_id gnl|my_center|LOCUS_18900 3893 2307 gene locus_tag LOCUS_18910 3893 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18910 >Feature sequence0408 1586 174 gene locus_tag LOCUS_18920 gene leuC 1586 174 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763197.1 protein_id gnl|my_center|LOCUS_18920 2808 1645 gene locus_tag LOCUS_18930 2808 1645 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763196.1 protein_id gnl|my_center|LOCUS_18930 3234 4355 gene locus_tag LOCUS_18940 3234 4355 CDS product Sb-PDE family phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054959405.1 protein_id gnl|my_center|LOCUS_18940 >Feature sequence0409 1945 2493 gene locus_tag LOCUS_18950 1945 2493 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_18950 2572 3582 gene locus_tag LOCUS_18960 2572 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18960 <4372 3760 gene locus_tag LOCUS_18970 <4372 3760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080870.1:2-phosphosulfolactate phosphatase family protein >Feature sequence0410 393 1511 gene locus_tag LOCUS_18980 393 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18980 3445 1772 gene locus_tag LOCUS_18990 3445 1772 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_18990 3995 3504 gene locus_tag LOCUS_19000 3995 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19000 4236 4309 gene locus_tag LOCUS_t00150 4236 4309 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0411 <1 2082 gene locus_tag LOCUS_19010 <1 2082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030494.1:alpha-galactosidase 2090 2563 gene locus_tag LOCUS_19020 2090 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19020 2603 3703 gene locus_tag LOCUS_19030 2603 3703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19030 3737 4117 gene locus_tag LOCUS_19040 3737 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19040 >Feature sequence0412 3 2252 gene locus_tag LOCUS_19050 3 2252 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109374.1 protein_id gnl|my_center|LOCUS_19050 2440 2985 gene locus_tag LOCUS_19060 2440 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19060 2988 4109 gene locus_tag LOCUS_19070 gene carA 2988 4109 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963443.1 protein_id gnl|my_center|LOCUS_19070 >Feature sequence0413 585 373 gene locus_tag LOCUS_19080 585 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19080 753 4316 gene locus_tag LOCUS_19090 753 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19090 >Feature sequence0414 <4335 1175 gene locus_tag LOCUS_19100 <4335 1175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011031032.1:discoidin domain-containing protein >Feature sequence0415 291 1658 gene locus_tag LOCUS_19110 291 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19110 1729 2988 gene locus_tag LOCUS_19120 1729 2988 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058221.1 protein_id gnl|my_center|LOCUS_19120 4209 3187 gene locus_tag LOCUS_19130 4209 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19130 >Feature sequence0416 441 13 gene locus_tag LOCUS_19140 441 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19140 848 2275 gene locus_tag LOCUS_19150 848 2275 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001142683.1 protein_id gnl|my_center|LOCUS_19150 3903 2299 gene locus_tag LOCUS_19160 3903 2299 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839369.1 protein_id gnl|my_center|LOCUS_19160 4032 4157 gene locus_tag LOCUS_19170 4032 4157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19170 >Feature sequence0417 >Feature sequence0418 779 12 gene locus_tag LOCUS_19180 779 12 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129903.1 protein_id gnl|my_center|LOCUS_19180 2233 782 gene locus_tag LOCUS_19190 gene pyk 2233 782 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962380.1 protein_id gnl|my_center|LOCUS_19190 2682 2230 gene locus_tag LOCUS_19200 2682 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19200 2815 3051 gene locus_tag LOCUS_19210 2815 3051 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291965.1 protein_id gnl|my_center|LOCUS_19210 >Feature sequence0419 499 3516 gene locus_tag LOCUS_19220 499 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19220 <4303 3546 gene locus_tag LOCUS_19230 <4303 3546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108010.1:ATP-binding protein >Feature sequence0420 1625 585 gene locus_tag LOCUS_19240 gene mnmH 1625 585 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937872.1 protein_id gnl|my_center|LOCUS_19240 3185 1917 gene locus_tag LOCUS_19250 3185 1917 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962463.1 protein_id gnl|my_center|LOCUS_19250 >Feature sequence0421 1648 752 gene locus_tag LOCUS_19260 1648 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19260 1992 2777 gene locus_tag LOCUS_19270 1992 2777 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888478.1 protein_id gnl|my_center|LOCUS_19270 2875 3801 gene locus_tag LOCUS_19280 2875 3801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19280 >Feature sequence0422 678 346 gene locus_tag LOCUS_19290 678 346 CDS product type II toxin-antitoxin system HigB family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963358.1 protein_id gnl|my_center|LOCUS_19290 1143 865 gene locus_tag LOCUS_19300 1143 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19300 1525 1247 gene locus_tag LOCUS_19310 1525 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19310 1944 1537 gene locus_tag LOCUS_19320 1944 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19320 2118 2402 gene locus_tag LOCUS_19330 2118 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19330 2396 2755 gene locus_tag LOCUS_19340 gene tnpB 2396 2755 CDS product IS66 family insertion sequence element accessory protein TnpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108244.1 protein_id gnl|my_center|LOCUS_19340 >Feature sequence0423 244 1272 gene locus_tag LOCUS_19350 244 1272 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194045.1 protein_id gnl|my_center|LOCUS_19350 1260 1856 gene locus_tag LOCUS_19360 gene gmhA2 1260 1856 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857991.1 protein_id gnl|my_center|LOCUS_19360 1849 2526 gene locus_tag LOCUS_19370 1849 2526 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194086.1 protein_id gnl|my_center|LOCUS_19370 2523 2969 gene locus_tag LOCUS_19380 2523 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19380 3380 3051 gene locus_tag LOCUS_19390 3380 3051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19390 >Feature sequence0424 779 141 gene locus_tag LOCUS_19400 779 141 CDS product GyrI-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990775.1 protein_id gnl|my_center|LOCUS_19400 1480 776 gene locus_tag LOCUS_19410 1480 776 CDS product DNA alkylation repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932971.1 protein_id gnl|my_center|LOCUS_19410 2320 1511 gene locus_tag LOCUS_19420 2320 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19420 4000 2489 gene locus_tag LOCUS_19430 4000 2489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000354584.1 protein_id gnl|my_center|LOCUS_19430 >Feature sequence0425 647 1540 gene locus_tag LOCUS_19440 647 1540 CDS product DUF2797 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962570.1 protein_id gnl|my_center|LOCUS_19440 2478 1789 gene locus_tag LOCUS_19450 2478 1789 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_19450 3893 2475 gene locus_tag LOCUS_19460 3893 2475 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303152.1 protein_id gnl|my_center|LOCUS_19460 >Feature sequence0426 2542 2198 gene locus_tag LOCUS_19470 2542 2198 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258722.1 protein_id gnl|my_center|LOCUS_19470 3097 2546 gene locus_tag LOCUS_19480 3097 2546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19480 3212 3679 gene locus_tag LOCUS_19490 3212 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19490 3672 4265 gene locus_tag LOCUS_19500 3672 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000621286.1 protein_id gnl|my_center|LOCUS_19500 >Feature sequence0427 142 2550 gene locus_tag LOCUS_19510 142 2550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19510 <4268 2650 gene locus_tag LOCUS_19520 <4268 2650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144200.1:VCBS repeat-containing protein >Feature sequence0428 1721 291 gene locus_tag LOCUS_19530 1721 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19530 1860 2138 gene locus_tag LOCUS_19540 1860 2138 CDS product 4a-hydroxytetrahydrobiopterin dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012709729.1 protein_id gnl|my_center|LOCUS_19540 2261 2695 gene locus_tag LOCUS_19550 gene dut 2261 2695 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_19550 2857 3867 gene locus_tag LOCUS_19560 2857 3867 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_19560 >Feature sequence0429 364 1707 gene locus_tag LOCUS_19570 364 1707 CDS product quinol:cytochrome C oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962548.1 protein_id gnl|my_center|LOCUS_19570 1803 2867 gene locus_tag LOCUS_19580 1803 2867 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962549.1 protein_id gnl|my_center|LOCUS_19580 >Feature sequence0430 38 2062 gene locus_tag LOCUS_19590 38 2062 CDS product NADPH-dependent 2,4-dienoyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530263.1 protein_id gnl|my_center|LOCUS_19590 2688 2239 gene locus_tag LOCUS_19600 2688 2239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19600 3218 2829 gene locus_tag LOCUS_19610 3218 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19610 3538 4119 gene locus_tag LOCUS_19620 3538 4119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19620 >Feature sequence0431 49 765 gene locus_tag LOCUS_19630 49 765 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_19630 1040 2641 gene locus_tag LOCUS_19640 1040 2641 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014466887.1 protein_id gnl|my_center|LOCUS_19640 2822 3625 gene locus_tag LOCUS_19650 2822 3625 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973973.1 protein_id gnl|my_center|LOCUS_19650 >Feature sequence0432 650 51 gene locus_tag LOCUS_19660 650 51 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796757.1 protein_id gnl|my_center|LOCUS_19660 1726 1082 gene locus_tag LOCUS_19670 1726 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19670 2836 2141 gene locus_tag LOCUS_19680 2836 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19680 4096 2843 gene locus_tag LOCUS_19690 4096 2843 CDS product nitrous oxide reductase family maturation protein NosD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550379.1 protein_id gnl|my_center|LOCUS_19690 >Feature sequence0433 323 568 gene locus_tag LOCUS_19700 323 568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19700 1462 587 gene locus_tag LOCUS_19710 1462 587 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_19710 1941 1459 gene locus_tag LOCUS_19720 1941 1459 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962451.1 protein_id gnl|my_center|LOCUS_19720 >Feature sequence0434 1632 1288 gene locus_tag LOCUS_19730 1632 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19730 1942 3405 gene locus_tag LOCUS_19740 1942 3405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19740 >Feature sequence0435 <1 1474 gene locus_tag LOCUS_19750 <1 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962291.1:TonB-dependent receptor 1529 3175 gene locus_tag LOCUS_19760 1529 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19760 >Feature sequence0436 204 524 gene locus_tag LOCUS_19770 204 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19770 1848 754 gene locus_tag LOCUS_19780 1848 754 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_19780 2999 2124 gene locus_tag LOCUS_19790 2999 2124 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_179240768.1 protein_id gnl|my_center|LOCUS_19790 4192 3014 gene locus_tag LOCUS_19800 4192 3014 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203532.1 protein_id gnl|my_center|LOCUS_19800 >Feature sequence0437 1586 306 gene locus_tag LOCUS_19810 1586 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19810 1864 3582 gene locus_tag LOCUS_19820 1864 3582 CDS product GMC family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405241.1 protein_id gnl|my_center|LOCUS_19820 >Feature sequence0438 518 868 gene locus_tag LOCUS_19830 518 868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19830 1481 1005 gene locus_tag LOCUS_19840 1481 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19840 2397 1642 gene locus_tag LOCUS_19850 gene istB 2397 1642 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010974232.1 protein_id gnl|my_center|LOCUS_19850 3970 2420 gene locus_tag LOCUS_19860 gene istA 3970 2420 CDS product IS21-like element IS1326 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001324342.1 protein_id gnl|my_center|LOCUS_19860 >Feature sequence0439 <1 547 gene locus_tag LOCUS_19870 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838198.1:rhomboid family intramembrane serine protease 1077 559 gene locus_tag LOCUS_19880 gene pyrR 1077 559 CDS product bifunctional pyrimidine operon transcriptional regulator/uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232127.1 protein_id gnl|my_center|LOCUS_19880 <4197 1215 gene locus_tag LOCUS_19890 <4197 1215 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963311.1:DNA-directed RNA polymerase subunit beta' >Feature sequence0440 1387 230 gene locus_tag LOCUS_19900 1387 230 CDS product ThuA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326116.1 protein_id gnl|my_center|LOCUS_19900 2387 1425 gene locus_tag LOCUS_19910 2387 1425 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064724.1 protein_id gnl|my_center|LOCUS_19910 2621 3076 gene locus_tag LOCUS_19920 2621 3076 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011123131.1 protein_id gnl|my_center|LOCUS_19920 3728 3156 gene locus_tag LOCUS_19930 3728 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_19930 >Feature sequence0441 650 1684 gene locus_tag LOCUS_19940 650 1684 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020124.1 protein_id gnl|my_center|LOCUS_19940 1746 2519 gene locus_tag LOCUS_19950 1746 2519 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496912.1 protein_id gnl|my_center|LOCUS_19950 2503 3306 gene locus_tag LOCUS_19960 2503 3306 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803988.1 protein_id gnl|my_center|LOCUS_19960 3308 3853 gene locus_tag LOCUS_19970 gene porC 3308 3853 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082456.1 protein_id gnl|my_center|LOCUS_19970 3859 4116 gene locus_tag LOCUS_19980 gene porD 3859 4116 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_19980 >Feature sequence0442 >Feature sequence0443 <1 2384 gene locus_tag LOCUS_19990 <1 2384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008672586.1:c-type cytochrome 2613 3473 gene locus_tag LOCUS_20000 2613 3473 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784230.1 protein_id gnl|my_center|LOCUS_20000 >Feature sequence0444 <1 1176 gene locus_tag LOCUS_20010 <1 1176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010969941.1:NAD(P)-dependent oxidoreductase 1727 2998 gene locus_tag LOCUS_20020 1727 2998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20020 >Feature sequence0445 <1 612 gene locus_tag LOCUS_20030 <1 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964065.1:ribosome biogenesis GTPase Der 2213 648 gene locus_tag LOCUS_20040 2213 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20040 4094 2544 gene locus_tag LOCUS_20050 4094 2544 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_20050 >Feature sequence0446 3867 757 gene locus_tag LOCUS_20060 3867 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20060 >Feature sequence0447 1298 114 gene locus_tag LOCUS_20070 1298 114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20070 3451 1502 gene locus_tag LOCUS_20080 3451 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20080 3964 3482 gene locus_tag LOCUS_20090 3964 3482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20090 >Feature sequence0448 3 605 gene locus_tag LOCUS_20100 3 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20100 715 1236 gene locus_tag LOCUS_20110 715 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939977.1 protein_id gnl|my_center|LOCUS_20110 2504 1356 gene locus_tag LOCUS_20120 2504 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20120 2644 3645 gene locus_tag LOCUS_20130 2644 3645 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_20130 >Feature sequence0449 615 1520 gene locus_tag LOCUS_20140 615 1520 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_20140 1863 2705 gene locus_tag LOCUS_20150 1863 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20150 2951 3694 gene locus_tag LOCUS_20160 2951 3694 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_20160 >Feature sequence0450 537 992 gene locus_tag LOCUS_20170 537 992 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000543296.1 protein_id gnl|my_center|LOCUS_20170 1234 2361 gene locus_tag LOCUS_20180 1234 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20180 >Feature sequence0451 <1 769 gene locus_tag LOCUS_20190 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763318.1:peptide chain release factor 3 938 2854 gene locus_tag LOCUS_20200 938 2854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20200 3147 3455 gene locus_tag LOCUS_20210 3147 3455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20210 >Feature sequence0452 497 718 gene locus_tag LOCUS_20220 497 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20220 816 1328 gene locus_tag LOCUS_20230 816 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20230 1954 2877 gene locus_tag LOCUS_20240 1954 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20240 4053 3277 gene locus_tag LOCUS_20250 4053 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20250 >Feature sequence0453 410 919 gene locus_tag LOCUS_20260 gene lspA 410 919 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965414.1 protein_id gnl|my_center|LOCUS_20260 2081 1122 gene locus_tag LOCUS_20270 2081 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20270 2744 2151 gene locus_tag LOCUS_20280 gene coaE 2744 2151 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963935.1 protein_id gnl|my_center|LOCUS_20280 3736 2741 gene locus_tag LOCUS_20290 3736 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20290 4063 3740 gene locus_tag LOCUS_20300 gene yajC 4063 3740 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402802.1 protein_id gnl|my_center|LOCUS_20300 >Feature sequence0454 79 582 gene locus_tag LOCUS_20310 79 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20310 675 2423 gene locus_tag LOCUS_20320 675 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20320 2420 3790 gene locus_tag LOCUS_20330 2420 3790 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011674500.1 protein_id gnl|my_center|LOCUS_20330 >Feature sequence0455 1501 722 gene locus_tag LOCUS_20340 1501 722 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405392.1 protein_id gnl|my_center|LOCUS_20340 1644 3803 gene locus_tag LOCUS_20350 1644 3803 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921322.1 protein_id gnl|my_center|LOCUS_20350 >Feature sequence0456 1219 380 gene locus_tag LOCUS_20360 1219 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20360 1561 2661 gene locus_tag LOCUS_20370 1561 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20370 2707 3441 gene locus_tag LOCUS_20380 2707 3441 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798966.1 protein_id gnl|my_center|LOCUS_20380 >Feature sequence0457 144 1130 gene locus_tag LOCUS_20390 144 1130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20390 2656 1367 gene locus_tag LOCUS_20400 2656 1367 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846674.1 protein_id gnl|my_center|LOCUS_20400 2847 3977 gene locus_tag LOCUS_20410 2847 3977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20410 >Feature sequence0458 1777 821 gene locus_tag LOCUS_20420 1777 821 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_20420 2671 1790 gene locus_tag LOCUS_20430 2671 1790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20430 2898 3470 gene locus_tag LOCUS_20440 2898 3470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20440 >Feature sequence0459 1227 142 gene locus_tag LOCUS_20450 gene gcvT 1227 142 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962992.1 protein_id gnl|my_center|LOCUS_20450 1645 1388 gene locus_tag LOCUS_20460 1645 1388 CDS product GlsB/YeaQ/YmgE family stress response membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004197795.1 protein_id gnl|my_center|LOCUS_20460 >Feature sequence0460 2450 27 gene locus_tag LOCUS_20470 2450 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20470 3252 2359 gene locus_tag LOCUS_20480 3252 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20480 >Feature sequence0461 573 1601 gene locus_tag LOCUS_20490 573 1601 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922549.1 protein_id gnl|my_center|LOCUS_20490 1628 2290 gene locus_tag LOCUS_20500 1628 2290 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403534.1 protein_id gnl|my_center|LOCUS_20500 2679 2353 gene locus_tag LOCUS_20510 2679 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20510 3309 2965 gene locus_tag LOCUS_20520 3309 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20520 >Feature sequence0462 322 1323 gene locus_tag LOCUS_20530 322 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20530 2676 1447 gene locus_tag LOCUS_20540 2676 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20540 3313 2798 gene locus_tag LOCUS_20550 3313 2798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20550 <4117 3428 gene locus_tag LOCUS_20560 <4117 3428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0463 2999 462 gene locus_tag LOCUS_20570 2999 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20570 <4114 3393 gene locus_tag LOCUS_20580 <4114 3393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103015543.1:DUF4835 family protein >Feature sequence0464 3875 243 gene locus_tag LOCUS_20590 3875 243 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037426.1 protein_id gnl|my_center|LOCUS_20590 >Feature sequence0465 <1 942 gene locus_tag LOCUS_20600 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764298.1:NADH-quinone oxidoreductase subunit M 1006 2430 gene locus_tag LOCUS_20610 1006 2430 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010992198.1 protein_id gnl|my_center|LOCUS_20610 2427 2825 gene locus_tag LOCUS_20620 2427 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20620 <4109 2942 gene locus_tag LOCUS_20630 <4109 2942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879270.1:amino acid permease >Feature sequence0466 3435 391 gene locus_tag LOCUS_20640 3435 391 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_20640 >Feature sequence0467 <1 1610 gene locus_tag LOCUS_20650 <1 1610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014795300.1:glycosyltransferase family 2 protein 1591 2115 gene locus_tag LOCUS_20660 1591 2115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20660 2115 2270 gene locus_tag LOCUS_20670 2115 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20670 2290 2688 gene locus_tag LOCUS_20680 2290 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20680 2696 3061 gene locus_tag LOCUS_20690 2696 3061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20690 >Feature sequence0468 <1 803 gene locus_tag LOCUS_20700 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973799.1:nitric oxide reductase activation protein NorD 810 1028 gene locus_tag LOCUS_20710 810 1028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20710 1413 2003 gene locus_tag LOCUS_20720 1413 2003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20720 2229 2423 gene locus_tag LOCUS_20730 2229 2423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20730 3374 2430 gene locus_tag LOCUS_20740 3374 2430 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_20740 3740 3384 gene locus_tag LOCUS_20750 3740 3384 CDS product 3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964349.1 protein_id gnl|my_center|LOCUS_20750 >Feature sequence0469 <1 618 gene locus_tag LOCUS_20760 <1 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036908.1:alpha/beta fold hydrolase 761 1963 gene locus_tag LOCUS_20770 761 1963 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207598.1 protein_id gnl|my_center|LOCUS_20770 2003 3220 gene locus_tag LOCUS_20780 2003 3220 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784515.1 protein_id gnl|my_center|LOCUS_20780 <4091 3206 gene locus_tag LOCUS_20790 <4091 3206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001221646.1:glycosyltransferase >Feature sequence0470 569 1852 gene locus_tag LOCUS_20800 569 1852 CDS product acetyl-CoA C-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021108.1 protein_id gnl|my_center|LOCUS_20800 1849 3963 gene locus_tag LOCUS_20810 gene fadJ 1849 3963 CDS product fatty acid oxidation complex subunit alpha FadJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072985.1 protein_id gnl|my_center|LOCUS_20810 >Feature sequence0471 3612 3109 gene locus_tag LOCUS_20820 3612 3109 CDS product HNH endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403943.1 protein_id gnl|my_center|LOCUS_20820 >Feature sequence0472 3545 1872 gene locus_tag LOCUS_20830 3545 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20830 >Feature sequence0473 1475 462 gene locus_tag LOCUS_20840 1475 462 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791975.1 protein_id gnl|my_center|LOCUS_20840 3332 1482 gene locus_tag LOCUS_20850 3332 1482 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_20850 3650 3985 gene locus_tag LOCUS_20860 3650 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20860 >Feature sequence0474 308 1489 gene locus_tag LOCUS_20870 308 1489 CDS product Wzz/FepE/Etk N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942498.1 protein_id gnl|my_center|LOCUS_20870 2363 2950 gene locus_tag LOCUS_20880 2363 2950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20880 >Feature sequence0475 711 3530 gene locus_tag LOCUS_20890 gene uvrA 711 3530 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963005.1 protein_id gnl|my_center|LOCUS_20890 >Feature sequence0476 <4065 3095 gene locus_tag LOCUS_20900 <4065 3095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199111712.1:T9SS type A sorting domain-containing protein >Feature sequence0477 2165 1527 gene locus_tag LOCUS_20910 2165 1527 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025687389.1 protein_id gnl|my_center|LOCUS_20910 2863 2288 gene locus_tag LOCUS_20920 2863 2288 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001115288.1 protein_id gnl|my_center|LOCUS_20920 3581 3096 gene locus_tag LOCUS_20930 3581 3096 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067313.1 protein_id gnl|my_center|LOCUS_20930 >Feature sequence0478 1045 74 gene locus_tag LOCUS_20940 1045 74 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_20940 3579 2014 gene locus_tag LOCUS_20950 3579 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20950 >Feature sequence0479 <1 698 gene locus_tag LOCUS_20960 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964358.1:amidohydrolase 1005 700 gene locus_tag LOCUS_20970 1005 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_20970 2165 1386 gene locus_tag LOCUS_20980 2165 1386 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_20980 3602 2175 gene locus_tag LOCUS_20990 gene rseP 3602 2175 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931818.1 protein_id gnl|my_center|LOCUS_20990 >Feature sequence0480 1819 1094 gene locus_tag LOCUS_21000 1819 1094 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_21000 2766 1840 gene locus_tag LOCUS_21010 2766 1840 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_21010 3287 2868 gene locus_tag LOCUS_21020 3287 2868 CDS product thiol-disulfide oxidoreductase DCC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003228839.1 protein_id gnl|my_center|LOCUS_21020 >Feature sequence0481 <1 1685 gene locus_tag LOCUS_21030 <1 1685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933164.1:apolipoprotein N-acyltransferase 1850 2671 gene locus_tag LOCUS_21040 1850 2671 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958026.1 protein_id gnl|my_center|LOCUS_21040 >Feature sequence0482 466 1662 gene locus_tag LOCUS_21050 466 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21050 2637 1669 gene locus_tag LOCUS_21060 2637 1669 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942316.1 protein_id gnl|my_center|LOCUS_21060 >Feature sequence0483 2564 2211 gene locus_tag LOCUS_21070 2564 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21070 3105 2929 gene locus_tag LOCUS_21080 3105 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21080 3699 3433 gene locus_tag LOCUS_21090 gene rpmA 3699 3433 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383095.1 protein_id gnl|my_center|LOCUS_21090 4052 3741 gene locus_tag LOCUS_21100 4052 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21100 >Feature sequence0484 145 1962 gene locus_tag LOCUS_21110 145 1962 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_21110 3855 2209 gene locus_tag LOCUS_21120 3855 2209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21120 >Feature sequence0485 556 50 gene locus_tag LOCUS_21130 556 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21130 1067 561 gene locus_tag LOCUS_21140 1067 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21140 1616 1086 gene locus_tag LOCUS_21150 1616 1086 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783878.1 protein_id gnl|my_center|LOCUS_21150 3292 1853 gene locus_tag LOCUS_21160 3292 1853 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202124.1 protein_id gnl|my_center|LOCUS_21160 3743 3501 gene locus_tag LOCUS_21170 3743 3501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21170 >Feature sequence0486 2257 983 gene locus_tag LOCUS_21180 2257 983 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_21180 2912 2268 gene locus_tag LOCUS_21190 2912 2268 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941085.1 protein_id gnl|my_center|LOCUS_21190 3982 2942 gene locus_tag LOCUS_21200 3982 2942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21200 >Feature sequence0487 546 1010 gene locus_tag LOCUS_21210 546 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21210 1022 1993 gene locus_tag LOCUS_21220 1022 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21220 2012 2941 gene locus_tag LOCUS_21230 2012 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21230 >Feature sequence0488 1545 244 gene locus_tag LOCUS_21240 1545 244 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963904.1 protein_id gnl|my_center|LOCUS_21240 1608 2708 gene locus_tag LOCUS_21250 gene wecB 1608 2708 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_21250 3551 2787 gene locus_tag LOCUS_21260 gene rlmB 3551 2787 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788741.1 protein_id gnl|my_center|LOCUS_21260 >Feature sequence0489 1909 2520 gene locus_tag LOCUS_21270 1909 2520 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_21270 2498 2992 gene locus_tag LOCUS_21280 2498 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21280 <4016 3081 gene locus_tag LOCUS_21290 <4016 3081 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964340.1:asparagine--tRNA ligase >Feature sequence0490 473 1888 gene locus_tag LOCUS_21300 gene flgK 473 1888 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943669.1 protein_id gnl|my_center|LOCUS_21300 2016 2897 gene locus_tag LOCUS_21310 gene flgL 2016 2897 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015704938.1 protein_id gnl|my_center|LOCUS_21310 3101 3937 gene locus_tag LOCUS_21320 3101 3937 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390485.1 protein_id gnl|my_center|LOCUS_21320 >Feature sequence0491 540 1448 gene locus_tag LOCUS_21330 gene rocF 540 1448 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226959.1 protein_id gnl|my_center|LOCUS_21330 1469 2701 gene locus_tag LOCUS_21340 gene rocD 1469 2701 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_21340 3038 3730 gene locus_tag LOCUS_21350 3038 3730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21350 >Feature sequence0492 1472 2281 gene locus_tag LOCUS_21360 1472 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21360 2566 3387 gene locus_tag LOCUS_21370 2566 3387 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918288.1 protein_id gnl|my_center|LOCUS_21370 <4002 3501 gene locus_tag LOCUS_21380 <4002 3501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010871155.1:alpha-glucan family phosphorylase >Feature sequence0493 1163 492 gene locus_tag LOCUS_21390 1163 492 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962258.1 protein_id gnl|my_center|LOCUS_21390 >Feature sequence0494 52 273 gene locus_tag LOCUS_21400 52 273 CDS product ferrous iron transport protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933404.1 protein_id gnl|my_center|LOCUS_21400 292 2391 gene locus_tag LOCUS_21410 gene feoB 292 2391 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962270.1 protein_id gnl|my_center|LOCUS_21410 3096 2455 gene locus_tag LOCUS_21420 3096 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21420 3340 3119 gene locus_tag LOCUS_21430 3340 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21430 3431 3550 gene locus_tag LOCUS_21440 3431 3550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21440 3625 3861 gene locus_tag LOCUS_21450 3625 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21450 >Feature sequence0495 1508 1882 gene locus_tag LOCUS_21460 1508 1882 CDS product co-chaperone GroES family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932256.1 protein_id gnl|my_center|LOCUS_21460 2107 2799 gene locus_tag LOCUS_21470 2107 2799 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_21470 2876 3937 gene locus_tag LOCUS_21480 gene recA 2876 3937 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_21480 >Feature sequence0496 784 3060 gene locus_tag LOCUS_21490 784 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21490 >Feature sequence0497 1192 3018 gene locus_tag LOCUS_21500 1192 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21500 >Feature sequence0498 >Feature sequence0499 197 1999 gene locus_tag LOCUS_21510 gene typA 197 1999 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962640.1 protein_id gnl|my_center|LOCUS_21510 >Feature sequence0500 <3970 1593 gene locus_tag LOCUS_21520 <3970 1593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838618.1:choice-of-anchor B family protein >Feature sequence0501 1510 1803 gene locus_tag LOCUS_21530 1510 1803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21530 1776 3581 gene locus_tag LOCUS_21540 1776 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_21540 >Feature sequence0502 <1 601 gene locus_tag LOCUS_21550 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001831154.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase 1059 1700 gene locus_tag LOCUS_21560 1059 1700 CDS product Eco29kI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689649.1 protein_id gnl|my_center|LOCUS_21560 1697 2863 gene locus_tag LOCUS_21570 gene dcm 1697 2863 CDS product DNA (cytosine-5-)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689650.1 protein_id gnl|my_center|LOCUS_21570 >Feature sequence0503 893 297 gene locus_tag LOCUS_21580 gene gmk 893 297 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048695834.1 protein_id gnl|my_center|LOCUS_21580 1042 2535 gene locus_tag LOCUS_21590 1042 2535 CDS product polysaccharide biosynthesis C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108742.1 protein_id gnl|my_center|LOCUS_21590 3308 2691 gene locus_tag LOCUS_21600 3308 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21600 >Feature sequence0504 753 2489 gene locus_tag LOCUS_21610 753 2489 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_21610 2709 3179 gene locus_tag LOCUS_21620 2709 3179 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_21620 <3958 3279 gene locus_tag LOCUS_21630 <3958 3279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064241535.1:nucleoside hydrolase >Feature sequence0505 3 272 gene locus_tag LOCUS_21640 3 272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21640 400 774 gene locus_tag LOCUS_21650 400 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21650 1025 1954 gene locus_tag LOCUS_21660 1025 1954 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963815.1 protein_id gnl|my_center|LOCUS_21660 1947 2723 gene locus_tag LOCUS_21670 1947 2723 CDS product queuosine precursor transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944168.1 protein_id gnl|my_center|LOCUS_21670 >Feature sequence0506 1429 572 gene locus_tag LOCUS_21680 1429 572 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_21680 2088 3320 gene locus_tag LOCUS_21690 2088 3320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21690 3382 3639 gene locus_tag LOCUS_21700 3382 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21700 >Feature sequence0507 38 2764 gene locus_tag LOCUS_21710 38 2764 CDS product 4-alpha-glucanotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203461.1 protein_id gnl|my_center|LOCUS_21710 2764 2916 gene locus_tag LOCUS_21720 2764 2916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21720 <3925 3015 gene locus_tag LOCUS_21730 <3925 3015 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003421552.1:NCS2 family permease >Feature sequence0508 <1 1357 gene locus_tag LOCUS_21740 <1 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421589.1:acylase 1597 1761 gene locus_tag LOCUS_21750 1597 1761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21750 2350 2012 gene locus_tag LOCUS_21760 2350 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21760 2615 2247 gene locus_tag LOCUS_21770 2615 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21770 <3923 2819 gene locus_tag LOCUS_21780 <3923 2819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926104.1:ATP-binding protein >Feature sequence0509 7 936 gene locus_tag LOCUS_21790 7 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21790 971 2074 gene locus_tag LOCUS_21800 971 2074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21800 3716 2850 gene locus_tag LOCUS_21810 3716 2850 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_21810 >Feature sequence0510 55 540 gene locus_tag LOCUS_21820 55 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21820 1222 587 gene locus_tag LOCUS_21830 1222 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21830 1742 3184 gene locus_tag LOCUS_21840 1742 3184 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053756.1 protein_id gnl|my_center|LOCUS_21840 >Feature sequence0511 1184 3784 gene locus_tag LOCUS_21850 1184 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21850 >Feature sequence0512 2087 1236 gene locus_tag LOCUS_21860 2087 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21860 3596 2460 gene locus_tag LOCUS_21870 3596 2460 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004291480.1 protein_id gnl|my_center|LOCUS_21870 >Feature sequence0513 344 60 gene locus_tag LOCUS_21880 344 60 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21880 1196 534 gene locus_tag LOCUS_21890 1196 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21890 2228 1242 gene locus_tag LOCUS_21900 2228 1242 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007335559.1 protein_id gnl|my_center|LOCUS_21900 2472 3695 gene locus_tag LOCUS_21910 2472 3695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21910 >Feature sequence0514 1206 3035 gene locus_tag LOCUS_21920 1206 3035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21920 3013 3249 gene locus_tag LOCUS_21930 3013 3249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21930 >Feature sequence0515 449 9 gene locus_tag LOCUS_21940 449 9 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267849.1 protein_id gnl|my_center|LOCUS_21940 1001 1804 gene locus_tag LOCUS_21950 1001 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21950 >Feature sequence0516 366 716 gene locus_tag LOCUS_21960 366 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21960 1157 1585 gene locus_tag LOCUS_21970 1157 1585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21970 1569 2132 gene locus_tag LOCUS_21980 1569 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21980 2673 2212 gene locus_tag LOCUS_21990 2673 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_21990 3629 2676 gene locus_tag LOCUS_22000 3629 2676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22000 >Feature sequence0517 1208 714 gene locus_tag LOCUS_22010 1208 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22010 2509 1214 gene locus_tag LOCUS_22020 2509 1214 CDS product homocysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272631.1 protein_id gnl|my_center|LOCUS_22020 3042 2560 gene locus_tag LOCUS_22030 3042 2560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22030 3489 3334 gene locus_tag LOCUS_22040 3489 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22040 >Feature sequence0518 <1 2643 gene locus_tag LOCUS_22050 <1 2643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011118092.1:efflux RND transporter permease subunit >Feature sequence0519 <1 923 gene locus_tag LOCUS_22060 <1 923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223883297.1:DNA cytosine methyltransferase 961 2163 gene locus_tag LOCUS_22070 961 2163 CDS product type II restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940107.1 protein_id gnl|my_center|LOCUS_22070 2610 2215 gene locus_tag LOCUS_22080 2610 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22080 >Feature sequence0520 1153 791 gene locus_tag LOCUS_22090 1153 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22090 2959 1235 gene locus_tag LOCUS_22100 2959 1235 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948373.1 protein_id gnl|my_center|LOCUS_22100 3832 3083 gene locus_tag LOCUS_22110 3832 3083 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_22110 >Feature sequence0521 638 207 gene locus_tag LOCUS_22120 638 207 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000800772.1 protein_id gnl|my_center|LOCUS_22120 2409 562 gene locus_tag LOCUS_22130 2409 562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22130 2581 3288 gene locus_tag LOCUS_22140 2581 3288 CDS product M15 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000836548.1 protein_id gnl|my_center|LOCUS_22140 >Feature sequence0522 582 1349 gene locus_tag LOCUS_22150 582 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22150 1457 2179 gene locus_tag LOCUS_22160 1457 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22160 3222 2251 gene locus_tag LOCUS_22170 gene ftsY 3222 2251 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107516.1 protein_id gnl|my_center|LOCUS_22170 >Feature sequence0523 >Feature sequence0524 <1 1380 gene locus_tag LOCUS_22180 <1 1380 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107990.1:TonB-dependent receptor 1965 1402 gene locus_tag LOCUS_22190 1965 1402 CDS product DUF1697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962897.1 protein_id gnl|my_center|LOCUS_22190 2151 2747 gene locus_tag LOCUS_22200 2151 2747 CDS product superoxide dismutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962337.1 protein_id gnl|my_center|LOCUS_22200 3655 2969 gene locus_tag LOCUS_22210 3655 2969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22210 >Feature sequence0525 1859 3187 gene locus_tag LOCUS_22220 1859 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22220 >Feature sequence0526 1264 746 gene locus_tag LOCUS_22230 1264 746 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_22230 1525 1283 gene locus_tag LOCUS_22240 1525 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22240 2822 1713 gene locus_tag LOCUS_22250 2822 1713 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921045.1 protein_id gnl|my_center|LOCUS_22250 3570 2914 gene locus_tag LOCUS_22260 3570 2914 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_22260 >Feature sequence0527 1040 78 gene locus_tag LOCUS_22270 1040 78 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22270 2091 1150 gene locus_tag LOCUS_22280 2091 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705204.1 protein_id gnl|my_center|LOCUS_22280 3370 2255 gene locus_tag LOCUS_22290 3370 2255 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368633.1 protein_id gnl|my_center|LOCUS_22290 3757 3473 gene locus_tag LOCUS_22300 3757 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22300 >Feature sequence0528 1636 3531 gene locus_tag LOCUS_22310 1636 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22310 3800 3558 gene locus_tag LOCUS_22320 3800 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22320 >Feature sequence0529 927 520 gene locus_tag LOCUS_22330 927 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22330 1276 2337 gene locus_tag LOCUS_22340 1276 2337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22340 2634 2380 gene locus_tag LOCUS_22350 2634 2380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22350 2679 2963 gene locus_tag LOCUS_22360 2679 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22360 3322 3684 gene locus_tag LOCUS_22370 3322 3684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22370 >Feature sequence0530 233 2770 gene locus_tag LOCUS_22380 233 2770 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_091514757.1 protein_id gnl|my_center|LOCUS_22380 3382 2870 gene locus_tag LOCUS_22390 3382 2870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22390 >Feature sequence0531 1286 546 gene locus_tag LOCUS_22400 1286 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22400 2350 1289 gene locus_tag LOCUS_22410 2350 1289 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979941.1 protein_id gnl|my_center|LOCUS_22410 3542 2343 gene locus_tag LOCUS_22420 3542 2343 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_22420 >Feature sequence0532 <1 689 gene locus_tag LOCUS_22430 <1 689 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:efflux RND transporter permease subunit 693 2462 gene locus_tag LOCUS_22440 693 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22440 >Feature sequence0533 1744 1520 gene locus_tag LOCUS_22450 1744 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22450 1945 2637 gene locus_tag LOCUS_22460 1945 2637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22460 >Feature sequence0534 1555 98 gene locus_tag LOCUS_22470 1555 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22470 2423 1566 gene locus_tag LOCUS_22480 2423 1566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22480 >Feature sequence0535 1303 101 gene locus_tag LOCUS_22490 1303 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22490 1496 2275 gene locus_tag LOCUS_22500 1496 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22500 3578 2367 gene locus_tag LOCUS_22510 3578 2367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22510 >Feature sequence0536 2565 319 gene locus_tag LOCUS_22520 gene purL 2565 319 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_22520 2767 3354 gene locus_tag LOCUS_22530 2767 3354 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140873.1 protein_id gnl|my_center|LOCUS_22530 >Feature sequence0537 51 368 gene locus_tag LOCUS_22540 51 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22540 365 2125 gene locus_tag LOCUS_22550 365 2125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22550 2122 2286 gene locus_tag LOCUS_22560 2122 2286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22560 2279 2914 gene locus_tag LOCUS_22570 2279 2914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22570 2924 3079 gene locus_tag LOCUS_22580 2924 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22580 >Feature sequence0538 1958 522 gene locus_tag LOCUS_22590 1958 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22590 3818 2031 gene locus_tag LOCUS_22600 3818 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22600 >Feature sequence0539 871 1563 gene locus_tag LOCUS_22610 871 1563 CDS product RNA pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766957.1 protein_id gnl|my_center|LOCUS_22610 2877 1567 gene locus_tag LOCUS_22620 2877 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22620 3000 3740 gene locus_tag LOCUS_22630 3000 3740 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920880.1 protein_id gnl|my_center|LOCUS_22630 >Feature sequence0540 1050 331 gene locus_tag LOCUS_22640 1050 331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22640 2428 1256 gene locus_tag LOCUS_22650 2428 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22650 >Feature sequence0541 599 823 gene locus_tag LOCUS_22660 599 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22660 829 1230 gene locus_tag LOCUS_22670 829 1230 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162484774.1 protein_id gnl|my_center|LOCUS_22670 <3813 1768 gene locus_tag LOCUS_22680 <3813 1768 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206290416.1:TonB-dependent receptor >Feature sequence0542 3354 2677 gene locus_tag LOCUS_22690 3354 2677 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125415.1 protein_id gnl|my_center|LOCUS_22690 >Feature sequence0543 1313 219 gene locus_tag LOCUS_22700 1313 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22700 1588 3210 gene locus_tag LOCUS_22710 1588 3210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22710 3219 3659 gene locus_tag LOCUS_22720 3219 3659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22720 >Feature sequence0544 1862 2674 gene locus_tag LOCUS_22730 1862 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22730 >Feature sequence0545 203 1039 gene locus_tag LOCUS_22740 203 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22740 1208 2779 gene locus_tag LOCUS_22750 1208 2779 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_22750 <3794 3110 gene locus_tag LOCUS_22760 <3794 3110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962582.1:acyl-CoA desaturase >Feature sequence0546 2 556 gene locus_tag LOCUS_22770 2 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22770 1280 618 gene locus_tag LOCUS_22780 1280 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22780 >Feature sequence0547 <1 738 gene locus_tag LOCUS_22790 <1 738 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003246499.1:branched-chain amino acid aminotransferase 1244 1041 gene locus_tag LOCUS_22800 1244 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22800 1297 1845 gene locus_tag LOCUS_22810 1297 1845 CDS product DUF1415 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022607.1 protein_id gnl|my_center|LOCUS_22810 1879 2112 gene locus_tag LOCUS_22820 1879 2112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22820 2113 2478 gene locus_tag LOCUS_22830 2113 2478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22830 3633 2890 gene locus_tag LOCUS_22840 3633 2890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22840 >Feature sequence0548 238 522 gene locus_tag LOCUS_22850 238 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22850 1518 430 gene locus_tag LOCUS_22860 1518 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22860 3577 2249 gene locus_tag LOCUS_22870 3577 2249 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027082.1 protein_id gnl|my_center|LOCUS_22870 >Feature sequence0549 2043 535 gene locus_tag LOCUS_22880 2043 535 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000278208.1 protein_id gnl|my_center|LOCUS_22880 2560 2030 gene locus_tag LOCUS_22890 2560 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22890 >Feature sequence0550 1602 613 gene locus_tag LOCUS_22900 1602 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22900 1875 3455 gene locus_tag LOCUS_22910 1875 3455 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963934.1 protein_id gnl|my_center|LOCUS_22910 >Feature sequence0551 1203 631 gene locus_tag LOCUS_22920 1203 631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22920 1299 2459 gene locus_tag LOCUS_22930 1299 2459 CDS product homogentisate 1,2-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962401.1 protein_id gnl|my_center|LOCUS_22930 2475 3722 gene locus_tag LOCUS_22940 gene fahA 2475 3722 CDS product fumarylacetoacetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207985.1 protein_id gnl|my_center|LOCUS_22940 >Feature sequence0552 2971 557 gene locus_tag LOCUS_22950 2971 557 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813448.1 protein_id gnl|my_center|LOCUS_22950 >Feature sequence0553 2074 770 gene locus_tag LOCUS_22960 gene metK 2074 770 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762826.1 protein_id gnl|my_center|LOCUS_22960 2295 2675 gene locus_tag LOCUS_22970 2295 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_22970 2722 3399 gene locus_tag LOCUS_22980 gene trmB 2722 3399 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_22980 >Feature sequence0554 >Feature sequence0555 549 1154 gene locus_tag LOCUS_22990 549 1154 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141001.1 protein_id gnl|my_center|LOCUS_22990 1151 1930 gene locus_tag LOCUS_23000 1151 1930 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922781.1 protein_id gnl|my_center|LOCUS_23000 3739 1937 gene locus_tag LOCUS_23010 3739 1937 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793275.1 protein_id gnl|my_center|LOCUS_23010 >Feature sequence0556 <1 555 gene locus_tag LOCUS_23020 <1 555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790898.1:sensor histidine kinase <3730 930 gene locus_tag LOCUS_23030 <3730 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990888.1:PGF-pre-PGF domain-containing protein >Feature sequence0557 <1 1466 gene locus_tag LOCUS_23040 <1 1466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962618.1:dihydroxy-acid dehydratase 1522 3264 gene locus_tag LOCUS_23050 gene ilvB 1522 3264 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962617.1 protein_id gnl|my_center|LOCUS_23050 >Feature sequence0558 172 1089 gene locus_tag LOCUS_23060 172 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23060 1100 1897 gene locus_tag LOCUS_23070 1100 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23070 2111 2195 gene locus_tag LOCUS_t00160 2111 2195 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2289 3560 gene locus_tag LOCUS_23080 2289 3560 CDS product neutral/alkaline non-lysosomal ceramidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053061013.1 protein_id gnl|my_center|LOCUS_23080 >Feature sequence0559 290 2086 gene locus_tag LOCUS_23090 290 2086 CDS product altronate dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006311047.1 protein_id gnl|my_center|LOCUS_23090 2440 3108 gene locus_tag LOCUS_23100 2440 3108 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_23100 >Feature sequence0560 3651 3391 gene locus_tag LOCUS_23110 3651 3391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23110 >Feature sequence0561 <1 736 gene locus_tag LOCUS_23120 <1 736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000485071.1:PQQ-dependent sugar dehydrogenase <3714 888 gene locus_tag LOCUS_23130 <3714 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199111712.1:T9SS type A sorting domain-containing protein >Feature sequence0562 862 1749 gene locus_tag LOCUS_23140 862 1749 CDS product DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000123503.1 protein_id gnl|my_center|LOCUS_23140 2393 2629 gene locus_tag LOCUS_23150 gene rpmB 2393 2629 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002809459.1 protein_id gnl|my_center|LOCUS_23150 >Feature sequence0563 <1 1005 gene locus_tag LOCUS_23160 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005786503.1:transketolase 2427 1129 gene locus_tag LOCUS_23170 2427 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23170 2644 3420 gene locus_tag LOCUS_23180 2644 3420 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_23180 >Feature sequence0564 1933 125 gene locus_tag LOCUS_23190 1933 125 CDS product wax ester/triacylglycerol synthase family O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005093260.1 protein_id gnl|my_center|LOCUS_23190 2927 2007 gene locus_tag LOCUS_23200 2927 2007 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615746.1 protein_id gnl|my_center|LOCUS_23200 <3709 3177 gene locus_tag LOCUS_23210 <3709 3177 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000680714.1:M28 family peptidase >Feature sequence0565 <1 542 gene locus_tag LOCUS_23220 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962502.1:GLPGLI family protein 641 3466 gene locus_tag LOCUS_23230 641 3466 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760893.1 protein_id gnl|my_center|LOCUS_23230 >Feature sequence0566 252 2012 gene locus_tag LOCUS_23240 252 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23240 2762 2013 gene locus_tag LOCUS_23250 2762 2013 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401319.1 protein_id gnl|my_center|LOCUS_23250 <3697 2816 gene locus_tag LOCUS_23260 <3697 2816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224226.1:fumarate reductase/succinate dehydrogenase flavoprotein subunit >Feature sequence0567 2088 2909 gene locus_tag LOCUS_23270 2088 2909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23270 >Feature sequence0568 >Feature sequence0569 960 364 gene locus_tag LOCUS_23280 960 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23280 1432 980 gene locus_tag LOCUS_23290 1432 980 CDS product GatB/YqeY domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932294.1 protein_id gnl|my_center|LOCUS_23290 2224 1742 gene locus_tag LOCUS_23300 2224 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23300 2399 3367 gene locus_tag LOCUS_23310 2399 3367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23310 >Feature sequence0570 1554 2780 gene locus_tag LOCUS_23320 1554 2780 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013844973.1 protein_id gnl|my_center|LOCUS_23320 >Feature sequence0571 <1 904 gene locus_tag LOCUS_23330 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963534.1:MBOAT family O-acyltransferase 967 2058 gene locus_tag LOCUS_23340 967 2058 CDS product sugar O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963533.1 protein_id gnl|my_center|LOCUS_23340 >Feature sequence0572 <1 731 gene locus_tag LOCUS_23350 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012779652.1:translation initiation factor IF-2 799 1596 gene locus_tag LOCUS_23360 799 1596 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_23360 1662 2414 gene locus_tag LOCUS_23370 1662 2414 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_23370 >Feature sequence0573 1187 537 gene locus_tag LOCUS_23380 1187 537 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001920521.1 protein_id gnl|my_center|LOCUS_23380 1336 2163 gene locus_tag LOCUS_23390 1336 2163 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222968.1 protein_id gnl|my_center|LOCUS_23390 >Feature sequence0574 48 695 gene locus_tag LOCUS_23400 48 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23400 1095 787 gene locus_tag LOCUS_23410 1095 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23410 >Feature sequence0575 273 656 gene locus_tag LOCUS_23420 273 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23420 2476 653 gene locus_tag LOCUS_23430 2476 653 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963925.1 protein_id gnl|my_center|LOCUS_23430 >Feature sequence0576 1932 400 gene locus_tag LOCUS_23440 1932 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761961.1 protein_id gnl|my_center|LOCUS_23440 >Feature sequence0577 405 79 gene locus_tag LOCUS_23450 405 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23450 1021 791 gene locus_tag LOCUS_23460 1021 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23460 >Feature sequence0578 1675 449 gene locus_tag LOCUS_23470 1675 449 CDS product beta-ketoacyl-[acyl-carrier-protein] synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179058.1 protein_id gnl|my_center|LOCUS_23470 1942 1688 gene locus_tag LOCUS_23480 1942 1688 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964357.1 protein_id gnl|my_center|LOCUS_23480 2546 1926 gene locus_tag LOCUS_23490 2546 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964358.1 protein_id gnl|my_center|LOCUS_23490 <3649 2543 gene locus_tag LOCUS_23500 <3649 2543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964359.1:beta-ketoacyl synthase N-terminal-like domain-containing protein >Feature sequence0579 2036 873 gene locus_tag LOCUS_23510 2036 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23510 3339 2071 gene locus_tag LOCUS_23520 3339 2071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23520 >Feature sequence0580 193 29 gene locus_tag LOCUS_23530 193 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23530 1218 382 gene locus_tag LOCUS_23540 1218 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23540 2842 1502 gene locus_tag LOCUS_23550 gene ltrA 2842 1502 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_23550 >Feature sequence0581 >Feature sequence0582 >Feature sequence0583 1719 463 gene locus_tag LOCUS_23560 1719 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23560 >Feature sequence0584 1849 1328 gene locus_tag LOCUS_23570 1849 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23570 3203 1842 gene locus_tag LOCUS_23580 3203 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23580 3632 3453 gene locus_tag LOCUS_23590 3632 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23590 >Feature sequence0585 334 1362 gene locus_tag LOCUS_23600 334 1362 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121661.1 protein_id gnl|my_center|LOCUS_23600 1367 2425 gene locus_tag LOCUS_23610 1367 2425 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_213126768.1 protein_id gnl|my_center|LOCUS_23610 >Feature sequence0586 1012 1644 gene locus_tag LOCUS_23620 1012 1644 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107755.1 protein_id gnl|my_center|LOCUS_23620 1803 3080 gene locus_tag LOCUS_23630 1803 3080 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_23630 >Feature sequence0587 1396 944 gene locus_tag LOCUS_23640 1396 944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23640 2141 1401 gene locus_tag LOCUS_23650 gene narI 2141 1401 CDS product respiratory nitrate reductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000934155.1 protein_id gnl|my_center|LOCUS_23650 2854 2192 gene locus_tag LOCUS_23660 2854 2192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23660 <3625 2893 gene locus_tag LOCUS_23670 <3625 2893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000692685.1:nitrate reductase subunit beta >Feature sequence0588 >Feature sequence0589 1416 385 gene locus_tag LOCUS_23680 1416 385 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_23680 2811 1525 gene locus_tag LOCUS_23690 2811 1525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103037383.1 protein_id gnl|my_center|LOCUS_23690 >Feature sequence0590 1018 1395 gene locus_tag LOCUS_23700 1018 1395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23700 1432 2874 gene locus_tag LOCUS_23710 1432 2874 CDS product urate hydroxylase PuuD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083321.1 protein_id gnl|my_center|LOCUS_23710 3607 2987 gene locus_tag LOCUS_23720 3607 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23720 >Feature sequence0591 2021 363 gene locus_tag LOCUS_23730 2021 363 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986790.1 protein_id gnl|my_center|LOCUS_23730 2292 3206 gene locus_tag LOCUS_23740 2292 3206 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_23740 >Feature sequence0592 1158 82 gene locus_tag LOCUS_23750 1158 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23750 >Feature sequence0593 645 361 gene locus_tag LOCUS_23760 645 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23760 2051 705 gene locus_tag LOCUS_23770 2051 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23770 3104 2076 gene locus_tag LOCUS_23780 3104 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120514580.1 protein_id gnl|my_center|LOCUS_23780 >Feature sequence0594 1379 108 gene locus_tag LOCUS_23790 1379 108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23790 3405 1387 gene locus_tag LOCUS_23800 3405 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23800 >Feature sequence0595 1250 24 gene locus_tag LOCUS_23810 1250 24 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23810 1574 3247 gene locus_tag LOCUS_23820 1574 3247 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964434.1 protein_id gnl|my_center|LOCUS_23820 >Feature sequence0596 477 1400 gene locus_tag LOCUS_23830 477 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23830 1477 1686 gene locus_tag LOCUS_23840 1477 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23840 1692 1985 gene locus_tag LOCUS_23850 1692 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23850 1989 3167 gene locus_tag LOCUS_23860 1989 3167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23860 >Feature sequence0597 1175 48 gene locus_tag LOCUS_23870 1175 48 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_23870 2847 1180 gene locus_tag LOCUS_23880 2847 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23880 <3567 2896 gene locus_tag LOCUS_23890 <3567 2896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546063.1:potassium channel protein >Feature sequence0598 634 1365 gene locus_tag LOCUS_23900 634 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23900 2807 1383 gene locus_tag LOCUS_23910 2807 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23910 2882 3073 gene locus_tag LOCUS_23920 2882 3073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23920 >Feature sequence0599 501 1391 gene locus_tag LOCUS_23930 501 1391 CDS product phosphoribulokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125013.1 protein_id gnl|my_center|LOCUS_23930 1707 2402 gene locus_tag LOCUS_23940 1707 2402 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706961.1 protein_id gnl|my_center|LOCUS_23940 2395 3081 gene locus_tag LOCUS_23950 gene rpe 2395 3081 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943985.1 protein_id gnl|my_center|LOCUS_23950 >Feature sequence0600 <3559 987 gene locus_tag LOCUS_23960 <3559 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962291.1:TonB-dependent receptor >Feature sequence0601 397 71 gene locus_tag LOCUS_23970 397 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23970 1084 488 gene locus_tag LOCUS_23980 1084 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23980 1766 1110 gene locus_tag LOCUS_23990 1766 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_23990 2376 1885 gene locus_tag LOCUS_24000 2376 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24000 2859 2485 gene locus_tag LOCUS_24010 2859 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688254.1 protein_id gnl|my_center|LOCUS_24010 3354 2965 gene locus_tag LOCUS_24020 3354 2965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24020 >Feature sequence0602 352 38 gene locus_tag LOCUS_24030 352 38 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24030 425 916 gene locus_tag LOCUS_24040 425 916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24040 1075 2691 gene locus_tag LOCUS_24050 1075 2691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24050 >Feature sequence0603 111 242 gene locus_tag LOCUS_24060 111 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24060 1779 499 gene locus_tag LOCUS_24070 1779 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24070 1982 3253 gene locus_tag LOCUS_24080 gene tyrS 1982 3253 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_24080 >Feature sequence0604 <1 2003 gene locus_tag LOCUS_24090 <1 2003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963704.1:DNA translocase FtsK 2047 2703 gene locus_tag LOCUS_24100 2047 2703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24100 <3551 2976 gene locus_tag LOCUS_24110 <3551 2976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919508.1:lactose 3-dehydrogenase subunit gamma LacC >Feature sequence0605 <1 2077 gene locus_tag LOCUS_24120 <1 2077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962907.1:DNA gyrase subunit A 2233 3372 gene locus_tag LOCUS_24130 2233 3372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24130 >Feature sequence0606 <1 1690 gene locus_tag LOCUS_24140 <1 1690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000691480.1:guanylate cyclase 1829 1674 gene locus_tag LOCUS_24150 1829 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24150 <3547 1978 gene locus_tag LOCUS_24160 <3547 1978 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072577.1:NADP-dependent isocitrate dehydrogenase >Feature sequence0607 953 1528 gene locus_tag LOCUS_24170 953 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24170 1606 2625 gene locus_tag LOCUS_24180 gene pheS 1606 2625 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763378.1 protein_id gnl|my_center|LOCUS_24180 >Feature sequence0608 493 302 gene locus_tag LOCUS_24190 493 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24190 923 618 gene locus_tag LOCUS_24200 923 618 CDS product phasin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941748.1 protein_id gnl|my_center|LOCUS_24200 1450 1151 gene locus_tag LOCUS_24210 1450 1151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24210 1432 1764 gene locus_tag LOCUS_24220 1432 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24220 3247 1826 gene locus_tag LOCUS_24230 3247 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24230 >Feature sequence0609 2906 2340 gene locus_tag LOCUS_24240 2906 2340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24240 >Feature sequence0610 1832 486 gene locus_tag LOCUS_24250 1832 486 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765778.1 protein_id gnl|my_center|LOCUS_24250 2515 1832 gene locus_tag LOCUS_24260 2515 1832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008660145.1 protein_id gnl|my_center|LOCUS_24260 <3535 2522 gene locus_tag LOCUS_24270 <3535 2522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000486659.1:SulP family inorganic anion transporter >Feature sequence0611 <1 962 gene locus_tag LOCUS_24280 <1 962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480084.1:S8 family peptidase 1766 1122 gene locus_tag LOCUS_24290 1766 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24290 1829 2269 gene locus_tag LOCUS_24300 1829 2269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24300 3305 2421 gene locus_tag LOCUS_24310 3305 2421 CDS product polyphosphate kinase 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932760.1 protein_id gnl|my_center|LOCUS_24310 >Feature sequence0612 1404 1637 gene locus_tag LOCUS_24320 1404 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24320 1697 1939 gene locus_tag LOCUS_24330 1697 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24330 >Feature sequence0613 74 430 gene locus_tag LOCUS_24340 74 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24340 1452 442 gene locus_tag LOCUS_24350 1452 442 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_24350 1589 1449 gene locus_tag LOCUS_24360 1589 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24360 1836 1561 gene locus_tag LOCUS_24370 1836 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24370 2807 2079 gene locus_tag LOCUS_24380 gene lipB 2807 2079 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963333.1 protein_id gnl|my_center|LOCUS_24380 >Feature sequence0614 788 2182 gene locus_tag LOCUS_24390 gene lpdA 788 2182 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_24390 >Feature sequence0615 1092 1637 gene locus_tag LOCUS_24400 1092 1637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24400 2573 1872 gene locus_tag LOCUS_24410 2573 1872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24410 <3509 2557 gene locus_tag LOCUS_24420 <3509 2557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761569.1:VWA domain-containing protein >Feature sequence0616 390 1331 gene locus_tag LOCUS_24430 gene fmt 390 1331 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019538492.1 protein_id gnl|my_center|LOCUS_24430 1324 1770 gene locus_tag LOCUS_24440 1324 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24440 1823 3208 gene locus_tag LOCUS_24450 1823 3208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24450 >Feature sequence0617 <1 687 gene locus_tag LOCUS_24460 <1 687 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257973.1:ABC transporter ATP-binding protein 752 1984 gene locus_tag LOCUS_24470 752 1984 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987007.1 protein_id gnl|my_center|LOCUS_24470 2116 3411 gene locus_tag LOCUS_24480 2116 3411 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_192803820.1 protein_id gnl|my_center|LOCUS_24480 >Feature sequence0618 587 96 gene locus_tag LOCUS_24490 587 96 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24490 2775 628 gene locus_tag LOCUS_24500 2775 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404150.1 protein_id gnl|my_center|LOCUS_24500 >Feature sequence0619 489 941 gene locus_tag LOCUS_24510 489 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24510 1063 1386 gene locus_tag LOCUS_24520 1063 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24520 1525 2640 gene locus_tag LOCUS_24530 1525 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24530 >Feature sequence0620 3178 1313 gene locus_tag LOCUS_24540 3178 1313 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_24540 >Feature sequence0621 823 2277 gene locus_tag LOCUS_24550 823 2277 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_24550 <3452 2382 gene locus_tag LOCUS_24560 <3452 2382 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036169.1:zinc-dependent metalloprotease >Feature sequence0622 2866 740 gene locus_tag LOCUS_24570 2866 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24570 >Feature sequence0623 143 655 gene locus_tag LOCUS_24580 143 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24580 1142 705 gene locus_tag LOCUS_24590 1142 705 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101282.1 protein_id gnl|my_center|LOCUS_24590 1561 1166 gene locus_tag LOCUS_24600 1561 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24600 2346 1672 gene locus_tag LOCUS_24610 2346 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24610 >Feature sequence0624 1733 1254 gene locus_tag LOCUS_24620 1733 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24620 <3436 2275 gene locus_tag LOCUS_24630 <3436 2275 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013224310.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence0625 1803 3260 gene locus_tag LOCUS_24640 1803 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24640 >Feature sequence0626 1338 382 gene locus_tag LOCUS_24650 1338 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24650 >Feature sequence0627 91 723 gene locus_tag LOCUS_24660 91 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24660 2074 725 gene locus_tag LOCUS_24670 2074 725 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_24670 2589 2113 gene locus_tag LOCUS_24680 gene coaD 2589 2113 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_24680 3166 2621 gene locus_tag LOCUS_24690 gene rsmD 3166 2621 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963133.1 protein_id gnl|my_center|LOCUS_24690 >Feature sequence0628 229 1320 gene locus_tag LOCUS_24700 229 1320 CDS product DUF2855 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084188.1 protein_id gnl|my_center|LOCUS_24700 1971 1561 gene locus_tag LOCUS_24710 1971 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24710 2383 2069 gene locus_tag LOCUS_24720 2383 2069 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_24720 >Feature sequence0629 <1 757 gene locus_tag LOCUS_24730 <1 757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941119.1:ATP-binding protein >Feature sequence0630 189 1163 gene locus_tag LOCUS_24740 189 1163 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_24740 1368 1610 gene locus_tag LOCUS_24750 1368 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24750 1985 2494 gene locus_tag LOCUS_24760 1985 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24760 2722 3387 gene locus_tag LOCUS_24770 2722 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24770 >Feature sequence0631 159 1859 gene locus_tag LOCUS_24780 159 1859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24780 2101 2679 gene locus_tag LOCUS_24790 2101 2679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24790 2679 3314 gene locus_tag LOCUS_24800 2679 3314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24800 >Feature sequence0632 1533 298 gene locus_tag LOCUS_24810 1533 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24810 2658 2062 gene locus_tag LOCUS_24820 2658 2062 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_24820 2801 2673 gene locus_tag LOCUS_24830 2801 2673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24830 >Feature sequence0633 1024 320 gene locus_tag LOCUS_24840 1024 320 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015705973.1 protein_id gnl|my_center|LOCUS_24840 1343 1113 gene locus_tag LOCUS_24850 1343 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24850 2029 1295 gene locus_tag LOCUS_24860 2029 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_24860 2801 2004 gene locus_tag LOCUS_24870 2801 2004 CDS product type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011144320.1 protein_id gnl|my_center|LOCUS_24870 >Feature sequence0634 696 31 gene locus_tag LOCUS_24880 696 31 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011837310.1 protein_id gnl|my_center|LOCUS_24880 1463 696 gene locus_tag LOCUS_24890 1463 696 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964165.1 protein_id gnl|my_center|LOCUS_24890 <3410 1678 gene locus_tag LOCUS_24900 <3410 1678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763369.1:M1 family metallopeptidase >Feature sequence0635 1931 2164 gene locus_tag LOCUS_24910 1931 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24910 2161 2565 gene locus_tag LOCUS_24920 2161 2565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24920 2735 2902 gene locus_tag LOCUS_24930 2735 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24930 >Feature sequence0636 363 19 gene locus_tag LOCUS_24940 363 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24940 1920 517 gene locus_tag LOCUS_24950 1920 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24950 2552 2028 gene locus_tag LOCUS_24960 2552 2028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24960 <3403 2568 gene locus_tag LOCUS_24970 <3403 2568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108080.1:RHS repeat-associated core domain-containing protein >Feature sequence0637 1989 1036 gene locus_tag LOCUS_24980 1989 1036 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_24980 2198 2398 gene locus_tag LOCUS_24990 2198 2398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_24990 2389 2643 gene locus_tag LOCUS_25000 2389 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25000 >Feature sequence0638 >Feature sequence0639 <1 621 gene locus_tag LOCUS_25010 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963237.1:MBL fold metallo-hydrolase 2168 840 gene locus_tag LOCUS_25020 gene xylA 2168 840 CDS product xylose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039169.1 protein_id gnl|my_center|LOCUS_25020 <3393 2196 gene locus_tag LOCUS_25030 <3393 2196 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765651.1:FGGY-family carbohydrate kinase >Feature sequence0640 2496 1021 gene locus_tag LOCUS_25040 2496 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25040 3197 2634 gene locus_tag LOCUS_25050 3197 2634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25050 >Feature sequence0641 2380 1232 gene locus_tag LOCUS_25060 2380 1232 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035257480.1 protein_id gnl|my_center|LOCUS_25060 3198 2383 gene locus_tag LOCUS_25070 3198 2383 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067536.1 protein_id gnl|my_center|LOCUS_25070 >Feature sequence0642 2633 1422 gene locus_tag LOCUS_25080 2633 1422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25080 <3386 2639 gene locus_tag LOCUS_25090 <3386 2639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706832.1:MoxR family ATPase >Feature sequence0643 1104 331 gene locus_tag LOCUS_25100 1104 331 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203723.1 protein_id gnl|my_center|LOCUS_25100 1293 2072 gene locus_tag LOCUS_25110 1293 2072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25110 3193 2069 gene locus_tag LOCUS_25120 3193 2069 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257788.1 protein_id gnl|my_center|LOCUS_25120 >Feature sequence0644 1431 232 gene locus_tag LOCUS_25130 1431 232 CDS product lipopolysaccharide biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066597.1 protein_id gnl|my_center|LOCUS_25130 2884 1808 gene locus_tag LOCUS_25140 2884 1808 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964112.1 protein_id gnl|my_center|LOCUS_25140 <3384 2814 gene locus_tag LOCUS_25150 <3384 2814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765197.1:polyribonucleotide nucleotidyltransferase >Feature sequence0645 >Feature sequence0646 479 1081 gene locus_tag LOCUS_25160 479 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25160 1096 2304 gene locus_tag LOCUS_25170 1096 2304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25170 >Feature sequence0647 <1 870 gene locus_tag LOCUS_25180 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030935.1:glycoside hydrolase family 2 TIM barrel-domain containing protein >Feature sequence0648 3004 3342 gene locus_tag LOCUS_25190 3004 3342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25190 >Feature sequence0649 896 405 gene locus_tag LOCUS_25200 896 405 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963844.1 protein_id gnl|my_center|LOCUS_25200 1064 2833 gene locus_tag LOCUS_25210 1064 2833 CDS product aromatic amino acid hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964058.1 protein_id gnl|my_center|LOCUS_25210 >Feature sequence0650 <1 1093 gene locus_tag LOCUS_25220 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_046312529.1:M48 family metalloprotease 2693 1164 gene locus_tag LOCUS_25230 2693 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25230 3368 3084 gene locus_tag LOCUS_25240 3368 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25240 >Feature sequence0651 1523 81 gene locus_tag LOCUS_25250 1523 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25250 2926 2015 gene locus_tag LOCUS_25260 2926 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393170.1 protein_id gnl|my_center|LOCUS_25260 >Feature sequence0652 1438 188 gene locus_tag LOCUS_25270 1438 188 CDS product gliding motility-associated protein GldE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795192.1 protein_id gnl|my_center|LOCUS_25270 2169 1666 gene locus_tag LOCUS_25280 2169 1666 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000168289.1 protein_id gnl|my_center|LOCUS_25280 3167 2151 gene locus_tag LOCUS_25290 gene mutY 3167 2151 CDS product A/G-specific adenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243838.1 protein_id gnl|my_center|LOCUS_25290 >Feature sequence0653 897 457 gene locus_tag LOCUS_25300 897 457 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838350.1 protein_id gnl|my_center|LOCUS_25300 1180 2076 gene locus_tag LOCUS_25310 gene moaA 1180 2076 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546124.1 protein_id gnl|my_center|LOCUS_25310 >Feature sequence0654 1890 1276 gene locus_tag LOCUS_25320 1890 1276 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008770002.1 protein_id gnl|my_center|LOCUS_25320 3293 1920 gene locus_tag LOCUS_25330 3293 1920 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921626.1 protein_id gnl|my_center|LOCUS_25330 >Feature sequence0655 2843 702 gene locus_tag LOCUS_25340 2843 702 CDS product 3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012639873.1 protein_id gnl|my_center|LOCUS_25340 >Feature sequence0656 108 1181 gene locus_tag LOCUS_25350 gene rfbG 108 1181 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005167723.1 protein_id gnl|my_center|LOCUS_25350 1188 1718 gene locus_tag LOCUS_25360 gene rfbC 1188 1718 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_25360 2435 2665 gene locus_tag LOCUS_25370 2435 2665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25370 >Feature sequence0657 358 717 gene locus_tag LOCUS_25380 358 717 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791690.1 protein_id gnl|my_center|LOCUS_25380 836 2119 gene locus_tag LOCUS_25390 836 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25390 >Feature sequence0658 310 1155 gene locus_tag LOCUS_25400 310 1155 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975564.1 protein_id gnl|my_center|LOCUS_25400 2356 1583 gene locus_tag LOCUS_25410 2356 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25410 2779 3120 gene locus_tag LOCUS_25420 2779 3120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25420 >Feature sequence0659 2 289 gene locus_tag LOCUS_25430 2 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25430 293 739 gene locus_tag LOCUS_25440 gene rplI 293 739 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_25440 1793 1026 gene locus_tag LOCUS_25450 1793 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25450 1896 2252 gene locus_tag LOCUS_25460 1896 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25460 2586 2900 gene locus_tag LOCUS_25470 2586 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25470 >Feature sequence0660 3043 1982 gene locus_tag LOCUS_25480 3043 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25480 >Feature sequence0661 970 467 gene locus_tag LOCUS_25490 970 467 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179084.1 protein_id gnl|my_center|LOCUS_25490 1144 1548 gene locus_tag LOCUS_25500 1144 1548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962191.1 protein_id gnl|my_center|LOCUS_25500 1624 2343 gene locus_tag LOCUS_25510 1624 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25510 >Feature sequence0662 <3337 2606 gene locus_tag LOCUS_25520 <3337 2606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005802230.1:lysine--tRNA ligase >Feature sequence0663 437 1300 gene locus_tag LOCUS_25530 437 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25530 1297 2733 gene locus_tag LOCUS_25540 1297 2733 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963532.1 protein_id gnl|my_center|LOCUS_25540 >Feature sequence0664 1877 483 gene locus_tag LOCUS_25550 1877 483 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461043.1 protein_id gnl|my_center|LOCUS_25550 3119 1893 gene locus_tag LOCUS_25560 3119 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25560 >Feature sequence0665 1548 169 gene locus_tag LOCUS_25570 1548 169 CDS product PhoX family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919252.1 protein_id gnl|my_center|LOCUS_25570 2561 1626 gene locus_tag LOCUS_25580 2561 1626 CDS product PmoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919405.1 protein_id gnl|my_center|LOCUS_25580 >Feature sequence0666 <1 1097 gene locus_tag LOCUS_25590 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202132.1:carboxypeptidase-like regulatory domain-containing protein 1094 2287 gene locus_tag LOCUS_25600 1094 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25600 >Feature sequence0667 463 1227 gene locus_tag LOCUS_25610 463 1227 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255354.1 protein_id gnl|my_center|LOCUS_25610 3045 1453 gene locus_tag LOCUS_25620 3045 1453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25620 >Feature sequence0668 >Feature sequence0669 131 1777 gene locus_tag LOCUS_25630 131 1777 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_25630 1783 2631 gene locus_tag LOCUS_25640 1783 2631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25640 2793 3293 gene locus_tag LOCUS_25650 2793 3293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25650 >Feature sequence0670 543 1112 gene locus_tag LOCUS_25660 543 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25660 1199 3034 gene locus_tag LOCUS_25670 1199 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25670 >Feature sequence0671 <1 826 gene locus_tag LOCUS_25680 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233099.1:exonuclease SbcCD subunit D 1619 1017 gene locus_tag LOCUS_25690 1619 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25690 1851 2420 gene locus_tag LOCUS_25700 1851 2420 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919148.1 protein_id gnl|my_center|LOCUS_25700 >Feature sequence0672 565 20 gene locus_tag LOCUS_25710 565 20 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_25710 852 544 gene locus_tag LOCUS_25720 gene mnhG 852 544 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902380.1 protein_id gnl|my_center|LOCUS_25720 1142 834 gene locus_tag LOCUS_25730 1142 834 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389330.1 protein_id gnl|my_center|LOCUS_25730 1647 1474 gene locus_tag LOCUS_25740 1647 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25740 1804 2394 gene locus_tag LOCUS_25750 1804 2394 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003398109.1 protein_id gnl|my_center|LOCUS_25750 >Feature sequence0673 1080 427 gene locus_tag LOCUS_25760 1080 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25760 <3303 1163 gene locus_tag LOCUS_25770 <3303 1163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011120353.1:DEAD/DEAH box helicase >Feature sequence0674 1813 2388 gene locus_tag LOCUS_25780 1813 2388 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972895.1 protein_id gnl|my_center|LOCUS_25780 >Feature sequence0675 1160 681 gene locus_tag LOCUS_25790 1160 681 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228619.1 protein_id gnl|my_center|LOCUS_25790 1290 1108 gene locus_tag LOCUS_25800 1290 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25800 1611 1348 gene locus_tag LOCUS_25810 1611 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25810 3225 1669 gene locus_tag LOCUS_25820 3225 1669 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010882938.1 protein_id gnl|my_center|LOCUS_25820 >Feature sequence0676 987 10 gene locus_tag LOCUS_25830 987 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_25830 1143 988 gene locus_tag LOCUS_25840 1143 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25840 1518 2360 gene locus_tag LOCUS_25850 1518 2360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25850 3029 2421 gene locus_tag LOCUS_25860 3029 2421 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964472.1 protein_id gnl|my_center|LOCUS_25860 >Feature sequence0677 <1 533 gene locus_tag LOCUS_25870 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902507.1:DUF1684 domain-containing protein 674 1822 gene locus_tag LOCUS_25880 674 1822 CDS product acyl-CoA desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962582.1 protein_id gnl|my_center|LOCUS_25880 >Feature sequence0678 1774 314 gene locus_tag LOCUS_25890 1774 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25890 1928 2386 gene locus_tag LOCUS_25900 1928 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25900 >Feature sequence0679 308 991 gene locus_tag LOCUS_25910 308 991 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_25910 2421 1105 gene locus_tag LOCUS_25920 2421 1105 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404646.1 protein_id gnl|my_center|LOCUS_25920 <3274 2472 gene locus_tag LOCUS_25930 <3274 2472 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404645.1:amidohydrolase family protein >Feature sequence0680 2394 448 gene locus_tag LOCUS_25940 2394 448 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108986.1 protein_id gnl|my_center|LOCUS_25940 >Feature sequence0681 3 587 gene locus_tag LOCUS_25950 3 587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25950 732 2255 gene locus_tag LOCUS_25960 732 2255 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839858.1 protein_id gnl|my_center|LOCUS_25960 2604 2389 gene locus_tag LOCUS_25970 2604 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_25970 >Feature sequence0682 1648 554 gene locus_tag LOCUS_25980 gene rfbG 1648 554 CDS product CDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107729.1 protein_id gnl|my_center|LOCUS_25980 2871 1699 gene locus_tag LOCUS_25990 gene pseC 2871 1699 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_25990 >Feature sequence0683 199 540 gene locus_tag LOCUS_26000 199 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26000 546 3029 gene locus_tag LOCUS_26010 546 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26010 >Feature sequence0684 987 1409 gene locus_tag LOCUS_26020 987 1409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26020 1658 2659 gene locus_tag LOCUS_26030 1658 2659 CDS product 4-hydroxyproline epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529091.1 protein_id gnl|my_center|LOCUS_26030 >Feature sequence0685 >Feature sequence0686 >Feature sequence0687 726 2504 gene locus_tag LOCUS_26040 726 2504 CDS product Na+:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119973.1 protein_id gnl|my_center|LOCUS_26040 >Feature sequence0688 55 1110 gene locus_tag LOCUS_26050 55 1110 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_100003378.1 protein_id gnl|my_center|LOCUS_26050 <3241 1103 gene locus_tag LOCUS_26060 <3241 1103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838916.1:M14 family metallopeptidase >Feature sequence0689 >Feature sequence0690 562 1008 gene locus_tag LOCUS_26070 562 1008 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765470.1 protein_id gnl|my_center|LOCUS_26070 1950 1015 gene locus_tag LOCUS_26080 1950 1015 CDS product HipA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027224428.1 protein_id gnl|my_center|LOCUS_26080 2233 1943 gene locus_tag LOCUS_26090 2233 1943 CDS product HipA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948073.1 protein_id gnl|my_center|LOCUS_26090 2465 2226 gene locus_tag LOCUS_26100 2465 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26100 >Feature sequence0691 153 971 gene locus_tag LOCUS_26110 153 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26110 955 2826 gene locus_tag LOCUS_26120 955 2826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26120 >Feature sequence0692 3165 184 gene locus_tag LOCUS_26130 3165 184 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107158.1 protein_id gnl|my_center|LOCUS_26130 >Feature sequence0693 1620 847 gene locus_tag LOCUS_26140 1620 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26140 2050 2772 gene locus_tag LOCUS_26150 2050 2772 CDS product glucose-1-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142182.1 protein_id gnl|my_center|LOCUS_26150 >Feature sequence0694 413 622 gene locus_tag LOCUS_26160 413 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26160 1149 700 gene locus_tag LOCUS_26170 1149 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26170 1452 1156 gene locus_tag LOCUS_26180 1452 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26180 1685 1452 gene locus_tag LOCUS_26190 1685 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26190 1825 1682 gene locus_tag LOCUS_26200 1825 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26200 2051 1848 gene locus_tag LOCUS_26210 2051 1848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26210 >Feature sequence0695 <1 750 gene locus_tag LOCUS_26220 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921945.1:Gfo/Idh/MocA family oxidoreductase 2414 855 gene locus_tag LOCUS_26230 gene abfD 2414 855 CDS product 4-hydroxybutyryl-CoA dehydratase/vinylacetyl-CoA-Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430738.1 protein_id gnl|my_center|LOCUS_26230 >Feature sequence0696 <1 506 gene locus_tag LOCUS_26240 <1 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403533.1:M20 family metallopeptidase 748 2208 gene locus_tag LOCUS_26250 748 2208 CDS product CoA-acylating methylmalonate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098259.1 protein_id gnl|my_center|LOCUS_26250 2343 2564 gene locus_tag LOCUS_26260 2343 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26260 2858 2781 gene locus_tag LOCUS_t00170 2858 2781 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0697 1212 970 gene locus_tag LOCUS_26270 gene moaD 1212 970 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880693.1 protein_id gnl|my_center|LOCUS_26270 1309 2187 gene locus_tag LOCUS_26280 gene fdhD 1309 2187 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031006.1 protein_id gnl|my_center|LOCUS_26280 >Feature sequence0698 1704 571 gene locus_tag LOCUS_26290 gene hppD 1704 571 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_26290 >Feature sequence0699 1327 1551 gene locus_tag LOCUS_26300 1327 1551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26300 >Feature sequence0700 2066 1617 gene locus_tag LOCUS_26310 2066 1617 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948529.1 protein_id gnl|my_center|LOCUS_26310 2760 2548 gene locus_tag LOCUS_26320 2760 2548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26320 >Feature sequence0701 1440 361 gene locus_tag LOCUS_26330 gene pdxA 1440 361 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760044.1 protein_id gnl|my_center|LOCUS_26330 2893 1433 gene locus_tag LOCUS_26340 2893 1433 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259178.1 protein_id gnl|my_center|LOCUS_26340 >Feature sequence0702 606 1157 gene locus_tag LOCUS_26350 606 1157 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_26350 1210 2037 gene locus_tag LOCUS_26360 1210 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26360 2034 2900 gene locus_tag LOCUS_26370 2034 2900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26370 >Feature sequence0703 624 298 gene locus_tag LOCUS_26380 624 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26380 1042 683 gene locus_tag LOCUS_26390 1042 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26390 >Feature sequence0704 >Feature sequence0705 1852 1289 gene locus_tag LOCUS_26400 1852 1289 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_26400 <3180 2039 gene locus_tag LOCUS_26410 <3180 2039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065773.1:PKD domain-containing protein >Feature sequence0706 <1 1837 gene locus_tag LOCUS_26420 <1 1837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_102756879.1:BspA family leucine-rich repeat surface protein 1937 2653 gene locus_tag LOCUS_26430 1937 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26430 >Feature sequence0707 >Feature sequence0708 1877 423 gene locus_tag LOCUS_26440 1877 423 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538536.1 protein_id gnl|my_center|LOCUS_26440 >Feature sequence0709 <1 545 gene locus_tag LOCUS_26450 <1 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202953.1:ATP-binding cassette domain-containing protein 1048 1773 gene locus_tag LOCUS_26460 1048 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26460 1798 2904 gene locus_tag LOCUS_26470 1798 2904 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202952.1 protein_id gnl|my_center|LOCUS_26470 >Feature sequence0710 115 41 gene locus_tag LOCUS_t00180 115 41 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1132 194 gene locus_tag LOCUS_26480 1132 194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26480 1303 2391 gene locus_tag LOCUS_26490 1303 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26490 >Feature sequence0711 <1 2327 gene locus_tag LOCUS_26500 <1 2327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016207.1:ankyrin repeat domain-containing protein <3169 2320 gene locus_tag LOCUS_26510 <3169 2320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_017260027.1:T9SS type A sorting domain-containing protein >Feature sequence0712 1619 1062 gene locus_tag LOCUS_26520 1619 1062 CDS product DUF2911 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404444.1 protein_id gnl|my_center|LOCUS_26520 2588 1680 gene locus_tag LOCUS_26530 2588 1680 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389819.1 protein_id gnl|my_center|LOCUS_26530 >Feature sequence0713 89 487 gene locus_tag LOCUS_26540 gene apaG 89 487 CDS product Co2+/Mg2+ efflux protein ApaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095539.1 protein_id gnl|my_center|LOCUS_26540 2361 1141 gene locus_tag LOCUS_26550 2361 1141 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208114.1 protein_id gnl|my_center|LOCUS_26550 >Feature sequence0714 1761 259 gene locus_tag LOCUS_26560 1761 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26560 <3166 1765 gene locus_tag LOCUS_26570 <3166 1765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398644.1:manganese ABC transporter ATP-binding protein MntB >Feature sequence0715 1860 103 gene locus_tag LOCUS_26580 1860 103 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976109.1 protein_id gnl|my_center|LOCUS_26580 2775 1861 gene locus_tag LOCUS_26590 2775 1861 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546558.1 protein_id gnl|my_center|LOCUS_26590 >Feature sequence0716 2721 1294 gene locus_tag LOCUS_26600 2721 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26600 >Feature sequence0717 81 1196 gene locus_tag LOCUS_26610 81 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26610 1139 1846 gene locus_tag LOCUS_26620 1139 1846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26620 1850 2308 gene locus_tag LOCUS_26630 1850 2308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26630 2401 2736 gene locus_tag LOCUS_26640 2401 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26640 >Feature sequence0718 1318 2052 gene locus_tag LOCUS_26650 gene kdsB 1318 2052 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_26650 2139 2654 gene locus_tag LOCUS_26660 2139 2654 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_26660 2724 3038 gene locus_tag LOCUS_26670 gene nuoK 2724 3038 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404194.1 protein_id gnl|my_center|LOCUS_26670 >Feature sequence0719 508 1089 gene locus_tag LOCUS_26680 508 1089 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_26680 1086 2093 gene locus_tag LOCUS_26690 1086 2093 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272541.1 protein_id gnl|my_center|LOCUS_26690 2773 2339 gene locus_tag LOCUS_26700 2773 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26700 >Feature sequence0720 126 1019 gene locus_tag LOCUS_26710 126 1019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26710 2665 1235 gene locus_tag LOCUS_26720 2665 1235 CDS product M14 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962998.1 protein_id gnl|my_center|LOCUS_26720 >Feature sequence0721 <1 875 gene locus_tag LOCUS_26730 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000148547.1:sigma-54-dependent response regulator transcription factor ZraR 2482 953 gene locus_tag LOCUS_26740 2482 953 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986679.1 protein_id gnl|my_center|LOCUS_26740 2640 2897 gene locus_tag LOCUS_26750 2640 2897 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038339.1 protein_id gnl|my_center|LOCUS_26750 >Feature sequence0722 229 41 gene locus_tag LOCUS_26760 gene rpmD 229 41 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356220.1 protein_id gnl|my_center|LOCUS_26760 810 292 gene locus_tag LOCUS_26770 gene rpsE 810 292 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_26770 1119 820 gene locus_tag LOCUS_26780 gene rplR 1119 820 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829747.1 protein_id gnl|my_center|LOCUS_26780 1758 1207 gene locus_tag LOCUS_26790 gene rplF 1758 1207 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765429.1 protein_id gnl|my_center|LOCUS_26790 2166 1768 gene locus_tag LOCUS_26800 gene rpsH 2166 1768 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762043.1 protein_id gnl|my_center|LOCUS_26800 2437 2168 gene locus_tag LOCUS_26810 gene rpsN 2437 2168 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_26810 3008 2454 gene locus_tag LOCUS_26820 gene rplE 3008 2454 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_26820 >Feature sequence0723 2617 977 gene locus_tag LOCUS_26830 2617 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26830 >Feature sequence0724 636 331 gene locus_tag LOCUS_26840 gene raiA 636 331 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762025.1 protein_id gnl|my_center|LOCUS_26840 1550 633 gene locus_tag LOCUS_26850 gene xerC 1550 633 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_26850 >Feature sequence0725 418 783 gene locus_tag LOCUS_26860 418 783 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438466.1 protein_id gnl|my_center|LOCUS_26860 1194 778 gene locus_tag LOCUS_26870 1194 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26870 1665 1342 gene locus_tag LOCUS_26880 1665 1342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26880 <3151 2247 gene locus_tag LOCUS_26890 <3151 2247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108702.1:DUF6443 domain-containing protein >Feature sequence0726 >Feature sequence0727 <1 682 gene locus_tag LOCUS_26900 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962407.1:zinc-dependent metalloprotease family protein >Feature sequence0728 <1 937 gene locus_tag LOCUS_26910 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760930.1:ATP-binding protein 980 2509 gene locus_tag LOCUS_26920 980 2509 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202160.1 protein_id gnl|my_center|LOCUS_26920 >Feature sequence0729 126 494 gene locus_tag LOCUS_26930 126 494 CDS product DUF1304 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529121.1 protein_id gnl|my_center|LOCUS_26930 626 1738 gene locus_tag LOCUS_26940 626 1738 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922549.1 protein_id gnl|my_center|LOCUS_26940 3144 1759 gene locus_tag LOCUS_26950 3144 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26950 >Feature sequence0730 528 55 gene locus_tag LOCUS_26960 528 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26960 1296 577 gene locus_tag LOCUS_26970 1296 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26970 1850 1302 gene locus_tag LOCUS_26980 1850 1302 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_26980 2271 2687 gene locus_tag LOCUS_26990 2271 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_26990 >Feature sequence0731 561 941 gene locus_tag LOCUS_27000 561 941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27000 1245 1454 gene locus_tag LOCUS_27010 1245 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27010 1919 1557 gene locus_tag LOCUS_27020 1919 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27020 3071 2046 gene locus_tag LOCUS_27030 3071 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27030 >Feature sequence0732 >Feature sequence0733 <1 563 gene locus_tag LOCUS_27040 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206627.1:IscS subfamily cysteine desulfurase 1662 574 gene locus_tag LOCUS_27050 1662 574 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_27050 2204 1659 gene locus_tag LOCUS_27060 2204 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27060 >Feature sequence0734 1837 815 gene locus_tag LOCUS_27070 1837 815 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963997.1 protein_id gnl|my_center|LOCUS_27070 1983 2402 gene locus_tag LOCUS_27080 1983 2402 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_27080 >Feature sequence0735 2342 1347 gene locus_tag LOCUS_27090 2342 1347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27090 <3129 2577 gene locus_tag LOCUS_27100 <3129 2577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766891.1:sigma-70 family RNA polymerase sigma factor >Feature sequence0736 349 2145 gene locus_tag LOCUS_27110 349 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27110 >Feature sequence0737 >Feature sequence0738 1085 741 gene locus_tag LOCUS_27120 1085 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962304.1 protein_id gnl|my_center|LOCUS_27120 1850 1086 gene locus_tag LOCUS_27130 1850 1086 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947453.1 protein_id gnl|my_center|LOCUS_27130 2263 1961 gene locus_tag LOCUS_27140 2263 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27140 >Feature sequence0739 1512 2219 gene locus_tag LOCUS_27150 1512 2219 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_27150 >Feature sequence0740 1089 808 gene locus_tag LOCUS_27160 1089 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27160 <3116 1086 gene locus_tag LOCUS_27170 <3116 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_167441479.1:amidohydrolase family protein >Feature sequence0741 1094 1381 gene locus_tag LOCUS_27180 1094 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27180 2148 1471 gene locus_tag LOCUS_27190 2148 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27190 >Feature sequence0742 141 698 gene locus_tag LOCUS_27200 141 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27200 >Feature sequence0743 1467 157 gene locus_tag LOCUS_27210 1467 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27210 <3111 2108 gene locus_tag LOCUS_27220 <3111 2108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199111712.1:T9SS type A sorting domain-containing protein >Feature sequence0744 131 496 gene locus_tag LOCUS_27230 131 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27230 2207 735 gene locus_tag LOCUS_27240 2207 735 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763947.1 protein_id gnl|my_center|LOCUS_27240 >Feature sequence0745 254 1141 gene locus_tag LOCUS_27250 254 1141 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066267.1 protein_id gnl|my_center|LOCUS_27250 1482 2351 gene locus_tag LOCUS_27260 1482 2351 CDS product phosphoenolpyruvate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086165.1 protein_id gnl|my_center|LOCUS_27260 >Feature sequence0746 <1 2591 gene locus_tag LOCUS_27270 <1 2591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169313288.1:Calx-beta domain-containing protein 2730 2963 gene locus_tag LOCUS_27280 2730 2963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27280 >Feature sequence0747 1196 231 gene locus_tag LOCUS_27290 1196 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27290 1939 1214 gene locus_tag LOCUS_27300 1939 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27300 2538 2960 gene locus_tag LOCUS_27310 2538 2960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27310 >Feature sequence0748 2266 887 gene locus_tag LOCUS_27320 gene glmM 2266 887 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963010.1 protein_id gnl|my_center|LOCUS_27320 >Feature sequence0749 >Feature sequence0750 860 447 gene locus_tag LOCUS_27330 860 447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27330 1383 952 gene locus_tag LOCUS_27340 1383 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27340 1405 1887 gene locus_tag LOCUS_27350 1405 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27350 >Feature sequence0751 >Feature sequence0752 1035 715 gene locus_tag LOCUS_27360 1035 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27360 1988 1200 gene locus_tag LOCUS_27370 1988 1200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27370 <3074 2182 gene locus_tag LOCUS_27380 <3074 2182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970029.1:MBL fold metallo-hydrolase >Feature sequence0753 <1 1064 gene locus_tag LOCUS_27390 <1 1064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203753.1:leucine--tRNA ligase <3074 1139 gene locus_tag LOCUS_27400 <3074 1139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839793.1:zinc-dependent metalloprotease >Feature sequence0754 2940 1690 gene locus_tag LOCUS_27410 2940 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27410 >Feature sequence0755 1225 1566 gene locus_tag LOCUS_27420 1225 1566 CDS product iron-sulfur cluster assembly accessory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404070.1 protein_id gnl|my_center|LOCUS_27420 1599 1763 gene locus_tag LOCUS_27430 1599 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27430 2648 1743 gene locus_tag LOCUS_27440 2648 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27440 >Feature sequence0756 105 791 gene locus_tag LOCUS_27450 105 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27450 2046 1009 gene locus_tag LOCUS_27460 2046 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27460 >Feature sequence0757 >Feature sequence0758 <1 1113 gene locus_tag LOCUS_27470 <1 1113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808599.1:aryl-sulfate sulfotransferase >Feature sequence0759 1023 1622 gene locus_tag LOCUS_27480 1023 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27480 2619 1654 gene locus_tag LOCUS_27490 2619 1654 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962368.1 protein_id gnl|my_center|LOCUS_27490 >Feature sequence0760 95 1372 gene locus_tag LOCUS_27500 gene hisS 95 1372 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942303.1 protein_id gnl|my_center|LOCUS_27500 1591 1941 gene locus_tag LOCUS_27510 1591 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27510 >Feature sequence0761 2283 754 gene locus_tag LOCUS_27520 2283 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27520 >Feature sequence0762 2617 1568 gene locus_tag LOCUS_27530 2617 1568 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963929.1 protein_id gnl|my_center|LOCUS_27530 >Feature sequence0763 1334 2626 gene locus_tag LOCUS_27540 1334 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27540 >Feature sequence0764 765 2060 gene locus_tag LOCUS_27550 765 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27550 >Feature sequence0765 >Feature sequence0766 1080 2060 gene locus_tag LOCUS_27560 1080 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27560 2070 2924 gene locus_tag LOCUS_27570 2070 2924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27570 >Feature sequence0767 1632 781 gene locus_tag LOCUS_27580 1632 781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27580 2545 1640 gene locus_tag LOCUS_27590 2545 1640 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_27590 >Feature sequence0768 <1 2179 gene locus_tag LOCUS_27600 <1 2179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0769 1 606 gene locus_tag LOCUS_27610 1 606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921523.1 protein_id gnl|my_center|LOCUS_27610 2139 628 gene locus_tag LOCUS_27620 2139 628 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963016.1 protein_id gnl|my_center|LOCUS_27620 2468 2166 gene locus_tag LOCUS_27630 2468 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27630 >Feature sequence0770 >Feature sequence0771 <1 792 gene locus_tag LOCUS_27640 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813988.1:CaiB/BaiF CoA-transferase family protein 1090 1749 gene locus_tag LOCUS_27650 1090 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000682106.1 protein_id gnl|my_center|LOCUS_27650 2015 2977 gene locus_tag LOCUS_27660 2015 2977 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_27660 >Feature sequence0772 1 798 gene locus_tag LOCUS_27670 1 798 CDS product tryptophan 2,3-dioxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036406.1 protein_id gnl|my_center|LOCUS_27670 795 2240 gene locus_tag LOCUS_27680 795 2240 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257240.1 protein_id gnl|my_center|LOCUS_27680 2387 2911 gene locus_tag LOCUS_27690 2387 2911 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_27690 >Feature sequence0773 1209 2138 gene locus_tag LOCUS_27700 1209 2138 CDS product ADP-ribosylglycohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038051.1 protein_id gnl|my_center|LOCUS_27700 >Feature sequence0774 153 758 gene locus_tag LOCUS_27710 153 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27710 2021 966 gene locus_tag LOCUS_27720 2021 966 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922169.1 protein_id gnl|my_center|LOCUS_27720 2566 2057 gene locus_tag LOCUS_27730 gene def 2566 2057 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000116243.1 protein_id gnl|my_center|LOCUS_27730 >Feature sequence0775 1927 2127 gene locus_tag LOCUS_27740 1927 2127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27740 2130 2339 gene locus_tag LOCUS_27750 2130 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27750 >Feature sequence0776 1727 138 gene locus_tag LOCUS_27760 gene rny 1727 138 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963284.1 protein_id gnl|my_center|LOCUS_27760 2217 1915 gene locus_tag LOCUS_27770 2217 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27770 2534 2247 gene locus_tag LOCUS_27780 2534 2247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27780 >Feature sequence0777 1265 1191 gene locus_tag LOCUS_t00190 1265 1191 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0778 662 1906 gene locus_tag LOCUS_27790 662 1906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27790 >Feature sequence0779 <1 597 gene locus_tag LOCUS_27800 <1 597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964505.1:rod shape-determining protein 740 1522 gene locus_tag LOCUS_27810 gene mreC 740 1522 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792052.1 protein_id gnl|my_center|LOCUS_27810 1547 2053 gene locus_tag LOCUS_27820 1547 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27820 >Feature sequence0780 1019 2050 gene locus_tag LOCUS_27830 1019 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27830 >Feature sequence0781 713 300 gene locus_tag LOCUS_27840 713 300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27840 1643 789 gene locus_tag LOCUS_27850 1643 789 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964207.1 protein_id gnl|my_center|LOCUS_27850 2374 1745 gene locus_tag LOCUS_27860 2374 1745 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964206.1 protein_id gnl|my_center|LOCUS_27860 <2946 2427 gene locus_tag LOCUS_27870 <2946 2427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964205.1:heme o synthase >Feature sequence0782 494 1030 gene locus_tag LOCUS_27880 gene infC 494 1030 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768315.1 protein_id gnl|my_center|LOCUS_27880 2172 1135 gene locus_tag LOCUS_27890 2172 1135 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_27890 <2941 2223 gene locus_tag LOCUS_27900 <2941 2223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016268654.1:biotin--[acetyl-CoA-carboxylase] ligase >Feature sequence0783 >Feature sequence0784 2047 575 gene locus_tag LOCUS_27910 2047 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27910 >Feature sequence0785 938 2179 gene locus_tag LOCUS_27920 938 2179 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000939580.1 protein_id gnl|my_center|LOCUS_27920 >Feature sequence0786 >Feature sequence0787 1183 443 gene locus_tag LOCUS_27930 1183 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27930 2876 1626 gene locus_tag LOCUS_27940 2876 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_27940 >Feature sequence0788 <1 1150 gene locus_tag LOCUS_27950 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 1252 2265 gene locus_tag LOCUS_27960 1252 2265 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038032.1 protein_id gnl|my_center|LOCUS_27960 2325 2627 gene locus_tag LOCUS_27970 2325 2627 CDS product HigA family addiction module antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011039258.1 protein_id gnl|my_center|LOCUS_27970 >Feature sequence0789 827 171 gene locus_tag LOCUS_27980 827 171 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061971.1 protein_id gnl|my_center|LOCUS_27980 1024 1962 gene locus_tag LOCUS_27990 1024 1962 CDS product CPBP family intramembrane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235045008.1 protein_id gnl|my_center|LOCUS_27990 2101 2481 gene locus_tag LOCUS_28000 2101 2481 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064254348.1 protein_id gnl|my_center|LOCUS_28000 >Feature sequence0790 446 228 gene locus_tag LOCUS_28010 446 228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28010 635 450 gene locus_tag LOCUS_28020 635 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28020 1033 881 gene locus_tag LOCUS_28030 1033 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28030 1323 1030 gene locus_tag LOCUS_28040 1323 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28040 1492 1280 gene locus_tag LOCUS_28050 1492 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28050 1708 1520 gene locus_tag LOCUS_28060 1708 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28060 2022 1807 gene locus_tag LOCUS_28070 2022 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28070 >Feature sequence0791 2085 2552 gene locus_tag LOCUS_28080 2085 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28080 >Feature sequence0792 1622 2344 gene locus_tag LOCUS_28090 1622 2344 CDS product peptidyl-alpha-hydroxyglycine alpha-amidating lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965351.1 protein_id gnl|my_center|LOCUS_28090 <2921 2361 gene locus_tag LOCUS_28100 <2921 2361 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267697.1:phosphotransferase family protein >Feature sequence0793 188 1435 gene locus_tag LOCUS_28110 gene odhB 188 1435 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964497.1 protein_id gnl|my_center|LOCUS_28110 >Feature sequence0794 236 1669 gene locus_tag LOCUS_28120 236 1669 CDS product tagaturonate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245710.1 protein_id gnl|my_center|LOCUS_28120 1687 2511 gene locus_tag LOCUS_28130 1687 2511 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861584.1 protein_id gnl|my_center|LOCUS_28130 >Feature sequence0795 748 1011 gene locus_tag LOCUS_28140 748 1011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28140 1415 2296 gene locus_tag LOCUS_28150 1415 2296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28150 >Feature sequence0796 <2916 325 gene locus_tag LOCUS_28160 <2916 325 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765303.1:protein translocase subunit SecDF >Feature sequence0797 2734 1382 gene locus_tag LOCUS_28170 2734 1382 CDS product sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202701.1 protein_id gnl|my_center|LOCUS_28170 >Feature sequence0798 91 720 gene locus_tag LOCUS_28180 91 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28180 801 1583 gene locus_tag LOCUS_28190 801 1583 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_28190 1597 1929 gene locus_tag LOCUS_28200 1597 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28200 <2912 1935 gene locus_tag LOCUS_28210 <2912 1935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107495.1:TolC family protein >Feature sequence0799 >Feature sequence0800 1572 1096 gene locus_tag LOCUS_28220 1572 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28220 <2909 1702 gene locus_tag LOCUS_28230 <2909 1702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528753.1:amidohydrolase/deacetylase family metallohydrolase >Feature sequence0801 <2908 167 gene locus_tag LOCUS_28240 <2908 167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404656.1:TonB-dependent receptor >Feature sequence0802 <1 563 gene locus_tag LOCUS_28250 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203328.1:sialate O-acetylesterase 1840 821 gene locus_tag LOCUS_28260 1840 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28260 2753 1911 gene locus_tag LOCUS_28270 gene kdsA 2753 1911 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_28270 >Feature sequence0803 2834 1368 gene locus_tag LOCUS_28280 2834 1368 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202491.1 protein_id gnl|my_center|LOCUS_28280 >Feature sequence0804 172 1320 gene locus_tag LOCUS_28290 172 1320 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_28290 1324 2163 gene locus_tag LOCUS_28300 1324 2163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28300 2785 2180 gene locus_tag LOCUS_28310 2785 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28310 >Feature sequence0805 1411 1046 gene locus_tag LOCUS_28320 1411 1046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28320 2205 1423 gene locus_tag LOCUS_28330 2205 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28330 2572 2820 gene locus_tag LOCUS_28340 2572 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28340 >Feature sequence0806 <1 818 gene locus_tag LOCUS_28350 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986679.1:AAA family ATPase 856 1368 gene locus_tag LOCUS_28360 856 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28360 1401 2663 gene locus_tag LOCUS_28370 1401 2663 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003117687.1 protein_id gnl|my_center|LOCUS_28370 >Feature sequence0807 2755 293 gene locus_tag LOCUS_28380 2755 293 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763956.1 protein_id gnl|my_center|LOCUS_28380 >Feature sequence0808 579 2444 gene locus_tag LOCUS_28390 579 2444 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405108.1 protein_id gnl|my_center|LOCUS_28390 >Feature sequence0809 476 1585 gene locus_tag LOCUS_28400 gene mtnA 476 1585 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970692.1 protein_id gnl|my_center|LOCUS_28400 1870 2166 gene locus_tag LOCUS_28410 1870 2166 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920115.1 protein_id gnl|my_center|LOCUS_28410 >Feature sequence0810 779 144 gene locus_tag LOCUS_28420 779 144 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932402.1 protein_id gnl|my_center|LOCUS_28420 833 1216 gene locus_tag LOCUS_28430 833 1216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28430 1317 2714 gene locus_tag LOCUS_28440 1317 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28440 >Feature sequence0811 <1 1005 gene locus_tag LOCUS_28450 <1 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763955.1:FecR domain-containing protein >Feature sequence0812 >Feature sequence0813 >Feature sequence0814 <1 943 gene locus_tag LOCUS_28460 <1 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460406.1:ATP-binding protein 1102 2139 gene locus_tag LOCUS_28470 1102 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28470 2176 2406 gene locus_tag LOCUS_28480 2176 2406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28480 >Feature sequence0815 1916 999 gene locus_tag LOCUS_28490 gene csm3 1916 999 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082356.1 protein_id gnl|my_center|LOCUS_28490 2365 1898 gene locus_tag LOCUS_28500 2365 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28500 >Feature sequence0816 1838 501 gene locus_tag LOCUS_28510 1838 501 CDS product Xaa-Pro dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640554.1 protein_id gnl|my_center|LOCUS_28510 2576 2067 gene locus_tag LOCUS_28520 2576 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28520 >Feature sequence0817 435 1541 gene locus_tag LOCUS_28530 435 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28530 >Feature sequence0818 841 161 gene locus_tag LOCUS_28540 841 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28540 1777 1187 gene locus_tag LOCUS_28550 1777 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28550 2449 1826 gene locus_tag LOCUS_28560 2449 1826 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479661.1 protein_id gnl|my_center|LOCUS_28560 >Feature sequence0819 188 403 gene locus_tag LOCUS_28570 188 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28570 466 798 gene locus_tag LOCUS_28580 466 798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28580 795 1499 gene locus_tag LOCUS_28590 795 1499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28590 2333 2034 gene locus_tag LOCUS_28600 2333 2034 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_28600 2581 2333 gene locus_tag LOCUS_28610 2581 2333 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409899.1 protein_id gnl|my_center|LOCUS_28610 >Feature sequence0820 103 234 gene locus_tag LOCUS_28620 103 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28620 280 501 gene locus_tag LOCUS_28630 280 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28630 512 2617 gene locus_tag LOCUS_28640 512 2617 CDS product acylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421589.1 protein_id gnl|my_center|LOCUS_28640 >Feature sequence0821 273 1001 gene locus_tag LOCUS_28650 273 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28650 1483 1274 gene locus_tag LOCUS_28660 1483 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_28660 >Feature sequence0822 1736 162 gene locus_tag LOCUS_28670 1736 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28670 <2838 1832 gene locus_tag LOCUS_28680 <2838 1832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962848.1:immunoglobulin domain-containing protein >Feature sequence0823 >Feature sequence0824 <2835 1648 gene locus_tag LOCUS_28690 <2835 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_184173497.1:VCBS repeat-containing protein >Feature sequence0825 2172 1306 gene locus_tag LOCUS_28700 2172 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28700 2481 2185 gene locus_tag LOCUS_28710 2481 2185 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963778.1 protein_id gnl|my_center|LOCUS_28710 >Feature sequence0826 1296 46 gene locus_tag LOCUS_28720 1296 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28720 1425 1907 gene locus_tag LOCUS_28730 1425 1907 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920697.1 protein_id gnl|my_center|LOCUS_28730 2031 2258 gene locus_tag LOCUS_28740 2031 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28740 >Feature sequence0827 >Feature sequence0828 511 645 gene locus_tag LOCUS_28750 511 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28750 1252 2409 gene locus_tag LOCUS_28760 1252 2409 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940160.1 protein_id gnl|my_center|LOCUS_28760 >Feature sequence0829 1076 348 gene locus_tag LOCUS_28770 gene clpP 1076 348 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297164.1 protein_id gnl|my_center|LOCUS_28770 >Feature sequence0830 522 998 gene locus_tag LOCUS_28780 522 998 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100451.1 protein_id gnl|my_center|LOCUS_28780 1022 1516 gene locus_tag LOCUS_28790 1022 1516 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906354.1 protein_id gnl|my_center|LOCUS_28790 >Feature sequence0831 1525 323 gene locus_tag LOCUS_28800 gene uxuA 1525 323 CDS product mannonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107776.1 protein_id gnl|my_center|LOCUS_28800 1708 2484 gene locus_tag LOCUS_28810 1708 2484 CDS product 3-ketoacyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970553.1 protein_id gnl|my_center|LOCUS_28810 >Feature sequence0832 700 2046 gene locus_tag LOCUS_28820 700 2046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28820 >Feature sequence0833 <2805 775 gene locus_tag LOCUS_28830 <2805 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963824.1:endopeptidase La >Feature sequence0834 >Feature sequence0835 1850 879 gene locus_tag LOCUS_28840 1850 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28840 >Feature sequence0836 1107 106 gene locus_tag LOCUS_28850 1107 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28850 2278 1466 gene locus_tag LOCUS_28860 2278 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28860 >Feature sequence0837 >Feature sequence0838 1323 70 gene locus_tag LOCUS_28870 1323 70 CDS product DUF5103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404472.1 protein_id gnl|my_center|LOCUS_28870 1452 1598 gene locus_tag LOCUS_28880 1452 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28880 1576 2316 gene locus_tag LOCUS_28890 1576 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_28890 >Feature sequence0839 3 575 gene locus_tag LOCUS_28900 3 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28900 >Feature sequence0840 2294 222 gene locus_tag LOCUS_28910 2294 222 CDS product BatA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839782.1 protein_id gnl|my_center|LOCUS_28910 >Feature sequence0841 1785 1549 gene locus_tag LOCUS_28920 1785 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28920 >Feature sequence0842 <2771 1188 gene locus_tag LOCUS_28930 <2771 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009934486.1:PAS domain S-box protein >Feature sequence0843 <2764 1233 gene locus_tag LOCUS_28940 <2764 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203355.1:efflux RND transporter permease subunit >Feature sequence0844 1582 173 gene locus_tag LOCUS_28950 1582 173 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001005173.1 protein_id gnl|my_center|LOCUS_28950 >Feature sequence0845 <1 2195 gene locus_tag LOCUS_28960 <1 2195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024768457.1:VCBS repeat-containing protein >Feature sequence0846 598 407 gene locus_tag LOCUS_28970 598 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_28970 1102 2202 gene locus_tag LOCUS_28980 1102 2202 CDS product putative urea ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151613280.1 protein_id gnl|my_center|LOCUS_28980 >Feature sequence0847 >Feature sequence0848 <2750 329 gene locus_tag LOCUS_28990 <2750 329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946759.1:copper-translocating P-type ATPase >Feature sequence0849 >Feature sequence0850 1380 850 gene locus_tag LOCUS_29000 1380 850 CDS product 3-hydroxyanthranilate 3,4-dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036739.1 protein_id gnl|my_center|LOCUS_29000 2542 1391 gene locus_tag LOCUS_29010 gene hppD 2542 1391 CDS product 4-hydroxyphenylpyruvate dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962402.1 protein_id gnl|my_center|LOCUS_29010 >Feature sequence0851 >Feature sequence0852 >Feature sequence0853 802 191 gene locus_tag LOCUS_29020 802 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29020 <2738 1042 gene locus_tag LOCUS_29030 <2738 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963280.1:carboxypeptidase-like regulatory domain-containing protein >Feature sequence0854 >Feature sequence0855 <1 894 gene locus_tag LOCUS_29040 <1 894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784442.1:ABC transporter permease 895 2034 gene locus_tag LOCUS_29050 895 2034 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005801569.1 protein_id gnl|my_center|LOCUS_29050 2467 2048 gene locus_tag LOCUS_29060 2467 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29060 >Feature sequence0856 275 2704 gene locus_tag LOCUS_29070 275 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29070 >Feature sequence0857 2135 783 gene locus_tag LOCUS_29080 2135 783 CDS product sugar porter family MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122710.1 protein_id gnl|my_center|LOCUS_29080 2460 2179 gene locus_tag LOCUS_29090 2460 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29090 >Feature sequence0858 609 415 gene locus_tag LOCUS_29100 609 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_29100 1238 630 gene locus_tag LOCUS_29110 1238 630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29110 >Feature sequence0859 >Feature sequence0860 595 1941 gene locus_tag LOCUS_29120 595 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615918.1 protein_id gnl|my_center|LOCUS_29120 >Feature sequence0861 <1 685 gene locus_tag LOCUS_29130 <1 685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_016362027.1:DUF3078 domain-containing protein 1058 1528 gene locus_tag LOCUS_29140 1058 1528 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771036.1 protein_id gnl|my_center|LOCUS_29140 >Feature sequence0862 560 895 gene locus_tag LOCUS_29150 560 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29150 1727 1071 gene locus_tag LOCUS_29160 1727 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29160 <2715 1727 gene locus_tag LOCUS_29170 <2715 1727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303086.1:JAB-like toxin 1 domain-containing protein >Feature sequence0863 <1 2109 gene locus_tag LOCUS_29180 <1 2109 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011114777.1:ankyrin repeat domain-containing protein 2061 2576 gene locus_tag LOCUS_29190 2061 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29190 >Feature sequence0864 1338 787 gene locus_tag LOCUS_29200 1338 787 CDS product thioredoxin fold domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964425.1 protein_id gnl|my_center|LOCUS_29200 <2710 1462 gene locus_tag LOCUS_29210 <2710 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108085.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence0865 1054 809 gene locus_tag LOCUS_29220 1054 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29220 <2709 1181 gene locus_tag LOCUS_29230 <2709 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108484.1:YfhO family protein >Feature sequence0866 <1 1041 gene locus_tag LOCUS_29240 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962236.1:methionine--tRNA ligase 1258 2442 gene locus_tag LOCUS_29250 1258 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29250 >Feature sequence0867 <1 764 gene locus_tag LOCUS_29260 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962910.1:putative LPS assembly protein LptD 1145 867 gene locus_tag LOCUS_29270 1145 867 CDS product Txe/YoeB family addiction module toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002296560.1 protein_id gnl|my_center|LOCUS_29270 1393 1142 gene locus_tag LOCUS_29280 1393 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29280 <2708 1606 gene locus_tag LOCUS_29290 <2708 1606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034099187.1:chromosomal replication initiator protein DnaA >Feature sequence0868 1108 347 gene locus_tag LOCUS_29300 1108 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29300 2270 1089 gene locus_tag LOCUS_29310 2270 1089 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942621.1 protein_id gnl|my_center|LOCUS_29310 >Feature sequence0869 >Feature sequence0870 >Feature sequence0871 753 346 gene locus_tag LOCUS_29320 gene ruvX 753 346 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_29320 2055 955 gene locus_tag LOCUS_29330 2055 955 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404921.1 protein_id gnl|my_center|LOCUS_29330 <2683 2165 gene locus_tag LOCUS_29340 <2683 2165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964090.1:ion channel >Feature sequence0872 69 2441 gene locus_tag LOCUS_29350 69 2441 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008671701.1 protein_id gnl|my_center|LOCUS_29350 >Feature sequence0873 <1 708 gene locus_tag LOCUS_29360 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791757.1:pseudouridine synthase 1101 2009 gene locus_tag LOCUS_29370 1101 2009 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792006.1 protein_id gnl|my_center|LOCUS_29370 >Feature sequence0874 1 273 gene locus_tag LOCUS_29380 1 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29380 313 1035 gene locus_tag LOCUS_29390 313 1035 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107709.1 protein_id gnl|my_center|LOCUS_29390 1040 1171 gene locus_tag LOCUS_29400 1040 1171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29400 1359 1781 gene locus_tag LOCUS_29410 1359 1781 CDS product avidin/streptavidin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201432.1 protein_id gnl|my_center|LOCUS_29410 <2671 2041 gene locus_tag LOCUS_29420 <2671 2041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_099259466.1:Gfo/Idh/MocA family oxidoreductase >Feature sequence0875 364 1167 gene locus_tag LOCUS_29430 364 1167 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759864.1 protein_id gnl|my_center|LOCUS_29430 1183 2439 gene locus_tag LOCUS_29440 1183 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29440 >Feature sequence0876 <2669 654 gene locus_tag LOCUS_29450 <2669 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404583.1:outer membrane protein assembly factor BamA >Feature sequence0877 <1 1178 gene locus_tag LOCUS_29460 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767240.1:TonB-dependent receptor >Feature sequence0878 456 1661 gene locus_tag LOCUS_29470 456 1661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29470 2464 1844 gene locus_tag LOCUS_29480 2464 1844 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461136.1 protein_id gnl|my_center|LOCUS_29480 >Feature sequence0879 625 1407 gene locus_tag LOCUS_29490 625 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29490 2212 1391 gene locus_tag LOCUS_29500 2212 1391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29500 >Feature sequence0880 <1 1057 gene locus_tag LOCUS_29510 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000790938.1:S8 family peptidase 1425 1117 gene locus_tag LOCUS_29520 gene lsrG 1425 1117 CDS product (4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001543603.1 protein_id gnl|my_center|LOCUS_29520 1573 2175 gene locus_tag LOCUS_29530 1573 2175 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096354.1 protein_id gnl|my_center|LOCUS_29530 >Feature sequence0881 597 217 gene locus_tag LOCUS_29540 597 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29540 1053 1229 gene locus_tag LOCUS_29550 1053 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29550 2314 1388 gene locus_tag LOCUS_29560 2314 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29560 >Feature sequence0882 <1 1703 gene locus_tag LOCUS_29570 <1 1703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001976156.1:leucine-rich repeat domain-containing protein >Feature sequence0883 <1 1632 gene locus_tag LOCUS_29580 <1 1632 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928870.1:integrin alpha 1945 2367 gene locus_tag LOCUS_29590 1945 2367 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887376.1 protein_id gnl|my_center|LOCUS_29590 >Feature sequence0884 682 2211 gene locus_tag LOCUS_29600 682 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29600 >Feature sequence0885 1561 431 gene locus_tag LOCUS_29610 1561 431 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065537.1 protein_id gnl|my_center|LOCUS_29610 <2643 1622 gene locus_tag LOCUS_29620 <2643 1622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119131.1:glycoside hydrolase family 130 protein >Feature sequence0886 591 2162 gene locus_tag LOCUS_29630 591 2162 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963630.1 protein_id gnl|my_center|LOCUS_29630 >Feature sequence0887 1974 154 gene locus_tag LOCUS_29640 1974 154 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_29640 >Feature sequence0888 >Feature sequence0889 943 134 gene locus_tag LOCUS_29650 gene argB 943 134 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767599.1 protein_id gnl|my_center|LOCUS_29650 2055 1099 gene locus_tag LOCUS_29660 2055 1099 CDS product acetylornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762653.1 protein_id gnl|my_center|LOCUS_29660 >Feature sequence0890 >Feature sequence0891 >Feature sequence0892 811 62 gene locus_tag LOCUS_29670 gene radC 811 62 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963482.1 protein_id gnl|my_center|LOCUS_29670 1080 1838 gene locus_tag LOCUS_29680 1080 1838 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_29680 <2630 1821 gene locus_tag LOCUS_29690 <2630 1821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073991.1:winged helix DNA-binding domain-containing protein >Feature sequence0893 <2629 871 gene locus_tag LOCUS_29700 <2629 871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:OmpA family protein >Feature sequence0894 254 1006 gene locus_tag LOCUS_29710 gene sufC 254 1006 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964481.1 protein_id gnl|my_center|LOCUS_29710 1022 2326 gene locus_tag LOCUS_29720 gene sufD 1022 2326 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404137.1 protein_id gnl|my_center|LOCUS_29720 >Feature sequence0895 492 1265 gene locus_tag LOCUS_29730 492 1265 CDS product XdhC/CoxI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386049.1 protein_id gnl|my_center|LOCUS_29730 >Feature sequence0896 >Feature sequence0897 475 89 gene locus_tag LOCUS_29740 475 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29740 2051 660 gene locus_tag LOCUS_29750 2051 660 CDS product exonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964019.1 protein_id gnl|my_center|LOCUS_29750 >Feature sequence0898 >Feature sequence0899 >Feature sequence0900 826 89 gene locus_tag LOCUS_29760 gene istB 826 89 CDS product IS21-like element ISRel16 family helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007539334.1 protein_id gnl|my_center|LOCUS_29760 2400 847 gene locus_tag LOCUS_29770 gene istA 2400 847 CDS product IS21 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007536916.1 protein_id gnl|my_center|LOCUS_29770 >Feature sequence0901 <1 693 gene locus_tag LOCUS_29780 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797949.1:4-hydroxy-3-methylbut-2-enyl diphosphate reductase 1553 792 gene locus_tag LOCUS_29790 1553 792 CDS product S1/P1 nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062784820.1 protein_id gnl|my_center|LOCUS_29790 1848 1609 gene locus_tag LOCUS_29800 1848 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29800 2312 1980 gene locus_tag LOCUS_29810 2312 1980 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_29810 >Feature sequence0902 >Feature sequence0903 <1 1138 gene locus_tag LOCUS_29820 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964044.1:methylmalonyl-CoA mutase family protein <2592 1625 gene locus_tag LOCUS_29830 <2592 1625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000323161.1:SLC13 family permease >Feature sequence0904 301 1956 gene locus_tag LOCUS_29840 301 1956 CDS product amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_076056374.1 protein_id gnl|my_center|LOCUS_29840 >Feature sequence0905 501 1289 gene locus_tag LOCUS_29850 501 1289 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648604.1 protein_id gnl|my_center|LOCUS_29850 >Feature sequence0906 1718 243 gene locus_tag LOCUS_29860 gene dacB 1718 243 CDS product D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399303.1 protein_id gnl|my_center|LOCUS_29860 >Feature sequence0907 1790 438 gene locus_tag LOCUS_29870 1790 438 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073016.1 protein_id gnl|my_center|LOCUS_29870 >Feature sequence0908 1089 1628 gene locus_tag LOCUS_29880 gene hpt 1089 1628 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_29880 1854 2048 gene locus_tag LOCUS_29890 1854 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_29890 >Feature sequence0909 870 1670 gene locus_tag LOCUS_29900 870 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29900 >Feature sequence0910 239 1357 gene locus_tag LOCUS_29910 239 1357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29910 1526 2080 gene locus_tag LOCUS_29920 1526 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29920 2516 2139 gene locus_tag LOCUS_29930 gene rsfS 2516 2139 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_29930 >Feature sequence0911 1 714 gene locus_tag LOCUS_29940 1 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_29940 1612 698 gene locus_tag LOCUS_29950 1612 698 CDS product dihydrodipicolinate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761948.1 protein_id gnl|my_center|LOCUS_29950 <2572 1796 gene locus_tag LOCUS_29960 <2572 1796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051000371.1:PQQ-dependent methanol/ethanol family dehydrogenase >Feature sequence0912 1776 640 gene locus_tag LOCUS_29970 gene xseA 1776 640 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358983.1 protein_id gnl|my_center|LOCUS_29970 <2570 1780 gene locus_tag LOCUS_29980 <2570 1780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404591.1:dTDP-4-dehydrorhamnose reductase >Feature sequence0913 862 185 gene locus_tag LOCUS_29990 862 185 CDS product DUF1080 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338989.1 protein_id gnl|my_center|LOCUS_29990 <2568 1174 gene locus_tag LOCUS_30000 <2568 1174 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088683.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence0914 <2568 1651 gene locus_tag LOCUS_30010 <2568 1651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948373.1:ATP-binding protein >Feature sequence0915 661 278 gene locus_tag LOCUS_30020 661 278 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933714.1 protein_id gnl|my_center|LOCUS_30020 1953 736 gene locus_tag LOCUS_30030 1953 736 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037126.1 protein_id gnl|my_center|LOCUS_30030 <2567 1969 gene locus_tag LOCUS_30040 <2567 1969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584100.1:diguanylate cyclase >Feature sequence0916 <1 690 gene locus_tag LOCUS_30050 <1 690 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957475.1:uroporphyrinogen decarboxylase 769 2247 gene locus_tag LOCUS_30060 769 2247 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096621.1 protein_id gnl|my_center|LOCUS_30060 >Feature sequence0917 >Feature sequence0918 816 415 gene locus_tag LOCUS_30070 816 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30070 <2551 997 gene locus_tag LOCUS_30080 <2551 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793740.1:formylglycine-generating enzyme family protein >Feature sequence0919 85 1740 gene locus_tag LOCUS_30090 gene glpD 85 1740 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003233382.1 protein_id gnl|my_center|LOCUS_30090 >Feature sequence0920 1366 893 gene locus_tag LOCUS_30100 1366 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30100 >Feature sequence0921 <2539 1970 gene locus_tag LOCUS_30110 <2539 1970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_062542257.1:HAMP domain-containing sensor histidine kinase >Feature sequence0922 267 1514 gene locus_tag LOCUS_30120 267 1514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30120 1520 2284 gene locus_tag LOCUS_30130 1520 2284 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000922020.1 protein_id gnl|my_center|LOCUS_30130 >Feature sequence0923 1745 357 gene locus_tag LOCUS_30140 1745 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30140 <2533 1900 gene locus_tag LOCUS_30150 <2533 1900 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339261.1:quinone oxidoreductase >Feature sequence0924 <2531 417 gene locus_tag LOCUS_30160 <2531 417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262585.1:response regulator >Feature sequence0925 <1 945 gene locus_tag LOCUS_30170 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405216.1:DUF445 family protein >Feature sequence0926 700 831 gene locus_tag LOCUS_30180 700 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30180 822 1289 gene locus_tag LOCUS_30190 822 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30190 1383 1805 gene locus_tag LOCUS_30200 1383 1805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30200 2006 2422 gene locus_tag LOCUS_30210 2006 2422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30210 >Feature sequence0927 <1 1756 gene locus_tag LOCUS_30220 <1 1756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259543.1:galactokinase 1906 2214 gene locus_tag LOCUS_30230 1906 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_30230 >Feature sequence0928 471 1280 gene locus_tag LOCUS_30240 471 1280 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143772.1 protein_id gnl|my_center|LOCUS_30240 1302 2066 gene locus_tag LOCUS_30250 1302 2066 CDS product aldolase/citrate lyase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001012068.1 protein_id gnl|my_center|LOCUS_30250 >Feature sequence0929 674 1039 gene locus_tag LOCUS_30260 674 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30260 1109 1648 gene locus_tag LOCUS_30270 1109 1648 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011084272.1 protein_id gnl|my_center|LOCUS_30270 >Feature sequence0930 >Feature sequence0931 443 1018 gene locus_tag LOCUS_30280 443 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30280 993 2036 gene locus_tag LOCUS_30290 gene pseI 993 2036 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965486.1 protein_id gnl|my_center|LOCUS_30290 >Feature sequence0932 1240 257 gene locus_tag LOCUS_30300 1240 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30300 2356 1247 gene locus_tag LOCUS_30310 2356 1247 CDS product DUF3696 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202566.1 protein_id gnl|my_center|LOCUS_30310 >Feature sequence0933 446 1063 gene locus_tag LOCUS_30320 446 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30320 2507 1071 gene locus_tag LOCUS_30330 2507 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30330 >Feature sequence0934 >Feature sequence0935 1005 1307 gene locus_tag LOCUS_30340 1005 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30340 1326 1628 gene locus_tag LOCUS_30350 1326 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30350 1638 1928 gene locus_tag LOCUS_30360 1638 1928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30360 >Feature sequence0936 1418 390 gene locus_tag LOCUS_30370 1418 390 CDS product Rpn family recombination-promoting nuclease/putative transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812827.1 protein_id gnl|my_center|LOCUS_30370 <2502 1470 gene locus_tag LOCUS_30380 <2502 1470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765300.1:FtsX-like permease family protein >Feature sequence0937 <2501 505 gene locus_tag LOCUS_30390 <2501 505 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459235.1:RecQ family ATP-dependent DNA helicase >Feature sequence0938 3 2051 gene locus_tag LOCUS_30400 gene thrA 3 2051 CDS product bifunctional aspartate kinase/homoserine dehydrogenase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933685.1 protein_id gnl|my_center|LOCUS_30400 >Feature sequence0939 658 1875 gene locus_tag LOCUS_30410 gene eboE 658 1875 CDS product metabolite traffic protein EboE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013368548.1 protein_id gnl|my_center|LOCUS_30410 >Feature sequence0940 1477 821 gene locus_tag LOCUS_30420 1477 821 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964236.1 protein_id gnl|my_center|LOCUS_30420 >Feature sequence0941 2362 38 gene locus_tag LOCUS_30430 gene hypF 2362 38 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880400.1 protein_id gnl|my_center|LOCUS_30430 >Feature sequence0942 2453 846 gene locus_tag LOCUS_30440 2453 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30440 >Feature sequence0943 <2484 777 gene locus_tag LOCUS_30450 <2484 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169313288.1:Calx-beta domain-containing protein >Feature sequence0944 1109 1294 gene locus_tag LOCUS_30460 gene rpmG 1109 1294 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761579.1 protein_id gnl|my_center|LOCUS_30460 1396 1557 gene locus_tag LOCUS_30470 1396 1557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30470 <2483 1646 gene locus_tag LOCUS_30480 <2483 1646 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081158863.1:DUF3604 domain-containing protein >Feature sequence0945 >Feature sequence0946 <1 799 gene locus_tag LOCUS_30490 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000635999.1:family 10 glycosylhydrolase 1076 2299 gene locus_tag LOCUS_30500 1076 2299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30500 >Feature sequence0947 >Feature sequence0948 >Feature sequence0949 >Feature sequence0950 1600 218 gene locus_tag LOCUS_30510 1600 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30510 >Feature sequence0951 <2472 544 gene locus_tag LOCUS_30520 <2472 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925729.1:DUF5916 domain-containing protein >Feature sequence0952 1877 1164 gene locus_tag LOCUS_30530 1877 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30530 >Feature sequence0953 544 1029 gene locus_tag LOCUS_30540 544 1029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30540 2127 1060 gene locus_tag LOCUS_30550 2127 1060 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244231.1 protein_id gnl|my_center|LOCUS_30550 >Feature sequence0954 3 1064 gene locus_tag LOCUS_30560 3 1064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30560 1401 1892 gene locus_tag LOCUS_30570 1401 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30570 2318 1983 gene locus_tag LOCUS_30580 2318 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30580 >Feature sequence0955 191 1708 gene locus_tag LOCUS_30590 191 1708 CDS product SusD/RagB family nutrient-binding outer membrane lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150090626.1 protein_id gnl|my_center|LOCUS_30590 >Feature sequence0956 1231 263 gene locus_tag LOCUS_30600 gene rsgA 1231 263 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962423.1 protein_id gnl|my_center|LOCUS_30600 <2462 1231 gene locus_tag LOCUS_30610 <2462 1231 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766109.1:ATP-binding protein >Feature sequence0957 216 1892 gene locus_tag LOCUS_30620 216 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30620 >Feature sequence0958 >Feature sequence0959 1477 788 gene locus_tag LOCUS_30630 gene truB 1477 788 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762820.1 protein_id gnl|my_center|LOCUS_30630 1707 1567 gene locus_tag LOCUS_30640 1707 1567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30640 2043 2330 gene locus_tag LOCUS_30650 2043 2330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30650 >Feature sequence0960 <1 1711 gene locus_tag LOCUS_30660 <1 1711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403467.1:ABC transporter permease >Feature sequence0961 <2446 1066 gene locus_tag LOCUS_30670 <2446 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764149.1:S8 family serine peptidase >Feature sequence0962 439 2184 gene locus_tag LOCUS_30680 439 2184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30680 >Feature sequence0963 468 244 gene locus_tag LOCUS_30690 468 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30690 702 2087 gene locus_tag LOCUS_30700 702 2087 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122187.1 protein_id gnl|my_center|LOCUS_30700 >Feature sequence0964 2350 479 gene locus_tag LOCUS_30710 2350 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30710 >Feature sequence0965 <1 675 gene locus_tag LOCUS_30720 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963774.1:T9SS type B sorting domain-containing protein 1405 1076 gene locus_tag LOCUS_30730 1405 1076 CDS product BrnA antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389752.1 protein_id gnl|my_center|LOCUS_30730 1652 1386 gene locus_tag LOCUS_30740 1652 1386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30740 >Feature sequence0966 1429 575 gene locus_tag LOCUS_30750 1429 575 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668002.1 protein_id gnl|my_center|LOCUS_30750 2410 1790 gene locus_tag LOCUS_30760 2410 1790 CDS product protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615927.1 protein_id gnl|my_center|LOCUS_30760 >Feature sequence0967 >Feature sequence0968 1865 882 gene locus_tag LOCUS_30770 1865 882 CDS product pyruvate dehydrogenase complex E1 component subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028525108.1 protein_id gnl|my_center|LOCUS_30770 >Feature sequence0969 >Feature sequence0970 1654 2145 gene locus_tag LOCUS_30780 1654 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30780 >Feature sequence0971 <2432 997 gene locus_tag LOCUS_30790 <2432 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002273870.1:type I pullulanase >Feature sequence0972 215 1069 gene locus_tag LOCUS_30800 215 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30800 2129 1293 gene locus_tag LOCUS_30810 2129 1293 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254425.1 protein_id gnl|my_center|LOCUS_30810 >Feature sequence0973 2255 366 gene locus_tag LOCUS_30820 2255 366 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103655.1 protein_id gnl|my_center|LOCUS_30820 >Feature sequence0974 693 241 gene locus_tag LOCUS_30830 693 241 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_30830 1218 694 gene locus_tag LOCUS_30840 1218 694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30840 >Feature sequence0975 <1 996 gene locus_tag LOCUS_30850 <1 996 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762102.1:sulfatase >Feature sequence0976 <1 868 gene locus_tag LOCUS_30860 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963757.1:COX15/CtaA family protein 1444 1010 gene locus_tag LOCUS_30870 gene moaC 1444 1010 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705487.1 protein_id gnl|my_center|LOCUS_30870 >Feature sequence0977 >Feature sequence0978 >Feature sequence0979 881 309 gene locus_tag LOCUS_30880 881 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30880 1381 2040 gene locus_tag LOCUS_30890 1381 2040 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964336.1 protein_id gnl|my_center|LOCUS_30890 >Feature sequence0980 696 1 gene locus_tag LOCUS_30900 696 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30900 >Feature sequence0981 2103 1081 gene locus_tag LOCUS_30910 2103 1081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30910 >Feature sequence0982 1490 234 gene locus_tag LOCUS_30920 1490 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30920 >Feature sequence0983 <2392 917 gene locus_tag LOCUS_30930 <2392 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107334.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence0984 378 1850 gene locus_tag LOCUS_30940 378 1850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30940 1904 2332 gene locus_tag LOCUS_30950 1904 2332 CDS product phage tail protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941643.1 protein_id gnl|my_center|LOCUS_30950 >Feature sequence0985 135 734 gene locus_tag LOCUS_30960 135 734 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790385.1 protein_id gnl|my_center|LOCUS_30960 727 2007 gene locus_tag LOCUS_30970 727 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30970 >Feature sequence0986 >Feature sequence0987 79 2100 gene locus_tag LOCUS_30980 79 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_30980 >Feature sequence0988 81 1670 gene locus_tag LOCUS_30990 81 1670 CDS product aldehyde dehydrogenase (NADP(+)) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206892.1 protein_id gnl|my_center|LOCUS_30990 >Feature sequence0989 24 314 gene locus_tag LOCUS_31000 24 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31000 319 981 gene locus_tag LOCUS_31010 gene ccmA 319 981 CDS product heme ABC exporter ATP-binding protein CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256831.1 protein_id gnl|my_center|LOCUS_31010 >Feature sequence0990 1876 716 gene locus_tag LOCUS_31020 gene hisC 1876 716 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_31020 >Feature sequence0991 <1 2033 gene locus_tag LOCUS_31030 <1 2033 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203489.1:TonB-dependent receptor >Feature sequence0992 1305 970 gene locus_tag LOCUS_31040 1305 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31040 2317 1451 gene locus_tag LOCUS_31050 2317 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31050 >Feature sequence0993 >Feature sequence0994 1606 11 gene locus_tag LOCUS_31060 1606 11 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258626.1 protein_id gnl|my_center|LOCUS_31060 <2366 1644 gene locus_tag LOCUS_31070 <2366 1644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003893633.1:hydrogenase >Feature sequence0995 967 623 gene locus_tag LOCUS_31080 967 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31080 2028 1105 gene locus_tag LOCUS_31090 2028 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31090 >Feature sequence0996 1262 1642 gene locus_tag LOCUS_31100 1262 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31100 >Feature sequence0997 2 1945 gene locus_tag LOCUS_31110 2 1945 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_31110 >Feature sequence0998 <1 682 gene locus_tag LOCUS_31120 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784016.1:16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH 788 1138 gene locus_tag LOCUS_31130 788 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31130 >Feature sequence0999 1432 851 gene locus_tag LOCUS_31140 1432 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31140 >Feature sequence1000 953 354 gene locus_tag LOCUS_31150 953 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31150 1322 1050 gene locus_tag LOCUS_31160 1322 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31160 1668 1444 gene locus_tag LOCUS_31170 1668 1444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31170 2166 1810 gene locus_tag LOCUS_31180 2166 1810 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_31180 >Feature sequence1001 2097 721 gene locus_tag LOCUS_31190 2097 721 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013230189.1 protein_id gnl|my_center|LOCUS_31190 >Feature sequence1002 >Feature sequence1003 505 2121 gene locus_tag LOCUS_31200 505 2121 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002681436.1 protein_id gnl|my_center|LOCUS_31200 >Feature sequence1004 1983 847 gene locus_tag LOCUS_31210 1983 847 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074000.1 protein_id gnl|my_center|LOCUS_31210 >Feature sequence1005 272 1594 gene locus_tag LOCUS_31220 272 1594 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963816.1 protein_id gnl|my_center|LOCUS_31220 >Feature sequence1006 <1 1099 gene locus_tag LOCUS_31230 <1 1099 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109057.1:alanine--tRNA ligase 1467 1733 gene locus_tag LOCUS_31240 1467 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31240 1730 2029 gene locus_tag LOCUS_31250 1730 2029 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918758.1 protein_id gnl|my_center|LOCUS_31250 >Feature sequence1007 84 1172 gene locus_tag LOCUS_31260 84 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31260 1305 1379 gene locus_tag LOCUS_t00200 1305 1379 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1008 >Feature sequence1009 1189 395 gene locus_tag LOCUS_31270 gene trpA 1189 395 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962671.1 protein_id gnl|my_center|LOCUS_31270 2323 1202 gene locus_tag LOCUS_31280 gene trpB 2323 1202 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962672.1 protein_id gnl|my_center|LOCUS_31280 >Feature sequence1010 >Feature sequence1011 >Feature sequence1012 1121 1660 gene locus_tag LOCUS_31290 1121 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31290 1708 2088 gene locus_tag LOCUS_31300 1708 2088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31300 >Feature sequence1013 985 407 gene locus_tag LOCUS_31310 985 407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31310 >Feature sequence1014 276 1613 gene locus_tag LOCUS_31320 276 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31320 1762 2292 gene locus_tag LOCUS_31330 1762 2292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268600.1 protein_id gnl|my_center|LOCUS_31330 >Feature sequence1015 800 931 gene locus_tag LOCUS_31340 800 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31340 >Feature sequence1016 <1 1513 gene locus_tag LOCUS_31350 <1 1513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028088.1:FdhF/YdeP family oxidoreductase >Feature sequence1017 1799 948 gene locus_tag LOCUS_31360 1799 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870576.1 protein_id gnl|my_center|LOCUS_31360 <2297 1777 gene locus_tag LOCUS_31370 <2297 1777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211232185.1:SDR family oxidoreductase >Feature sequence1018 <1 1716 gene locus_tag LOCUS_31380 <1 1716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005110557.1:DUF1446 domain-containing protein >Feature sequence1019 1183 8 gene locus_tag LOCUS_31390 1183 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31390 >Feature sequence1020 909 1526 gene locus_tag LOCUS_31400 909 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31400 <2295 1560 gene locus_tag LOCUS_31410 <2295 1560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964560.1:phosphoribosylamine--glycine ligase >Feature sequence1021 2115 388 gene locus_tag LOCUS_31420 2115 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31420 >Feature sequence1022 >Feature sequence1023 719 955 gene locus_tag LOCUS_31430 719 955 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004408502.1 protein_id gnl|my_center|LOCUS_31430 1868 990 gene locus_tag LOCUS_31440 1868 990 CDS product DUF808 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490863.1 protein_id gnl|my_center|LOCUS_31440 >Feature sequence1024 >Feature sequence1025 1545 265 gene locus_tag LOCUS_31450 1545 265 CDS product hydroxymethylglutaryl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_113594076.1 protein_id gnl|my_center|LOCUS_31450 >Feature sequence1026 414 124 gene locus_tag LOCUS_31460 414 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31460 1542 418 gene locus_tag LOCUS_31470 gene recF 1542 418 CDS product DNA replication/repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000470750.1 protein_id gnl|my_center|LOCUS_31470 <2282 1553 gene locus_tag LOCUS_31480 <2282 1553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402793.1:DNA polymerase III subunit beta >Feature sequence1027 1507 665 gene locus_tag LOCUS_31490 1507 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030062.1 protein_id gnl|my_center|LOCUS_31490 1698 1871 gene locus_tag LOCUS_31500 1698 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31500 >Feature sequence1028 <1 1739 gene locus_tag LOCUS_31510 <1 1739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962713.1:VWA domain-containing protein >Feature sequence1029 1616 615 gene locus_tag LOCUS_31520 1616 615 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941141.1 protein_id gnl|my_center|LOCUS_31520 >Feature sequence1030 332 1033 gene locus_tag LOCUS_31530 332 1033 CDS product DUF481 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071214.1 protein_id gnl|my_center|LOCUS_31530 1742 1125 gene locus_tag LOCUS_31540 1742 1125 CDS product N-acetylmuramoyl-L-alanine amidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764600.1 protein_id gnl|my_center|LOCUS_31540 >Feature sequence1031 >Feature sequence1032 1142 240 gene locus_tag LOCUS_31550 1142 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31550 <2276 1329 gene locus_tag LOCUS_31560 <2276 1329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007757189.1:JAB-like toxin 1 domain-containing protein >Feature sequence1033 <1 1462 gene locus_tag LOCUS_31570 <1 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199111712.1:T9SS type A sorting domain-containing protein >Feature sequence1034 1199 528 gene locus_tag LOCUS_31580 1199 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31580 2047 1214 gene locus_tag LOCUS_31590 2047 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31590 >Feature sequence1035 199 879 gene locus_tag LOCUS_31600 199 879 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761811.1 protein_id gnl|my_center|LOCUS_31600 1541 1137 gene locus_tag LOCUS_31610 1541 1137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31610 <2272 1730 gene locus_tag LOCUS_31620 <2272 1730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236615995.1:c-type cytochrome >Feature sequence1036 1422 604 gene locus_tag LOCUS_31630 1422 604 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073210.1 protein_id gnl|my_center|LOCUS_31630 <2272 1500 gene locus_tag LOCUS_31640 <2272 1500 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964439.1:flavin reductase family protein >Feature sequence1037 1240 677 gene locus_tag LOCUS_31650 1240 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31650 2270 1221 gene locus_tag LOCUS_31660 2270 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31660 >Feature sequence1038 330 563 gene locus_tag LOCUS_31670 330 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31670 >Feature sequence1039 >Feature sequence1040 >Feature sequence1041 388 1899 gene locus_tag LOCUS_31680 gene lysS 388 1899 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000003075.1 protein_id gnl|my_center|LOCUS_31680 >Feature sequence1042 1948 1112 gene locus_tag LOCUS_31690 1948 1112 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328056.1 protein_id gnl|my_center|LOCUS_31690 >Feature sequence1043 799 1230 gene locus_tag LOCUS_31700 799 1230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31700 >Feature sequence1044 <2258 1427 gene locus_tag LOCUS_31710 <2258 1427 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_074907579.1:tetratricopeptide repeat protein >Feature sequence1045 1322 1561 gene locus_tag LOCUS_31720 1322 1561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31720 >Feature sequence1046 1616 915 gene locus_tag LOCUS_31730 1616 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31730 >Feature sequence1047 1 1590 gene locus_tag LOCUS_31740 1 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31740 >Feature sequence1048 <2253 1596 gene locus_tag LOCUS_31750 <2253 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005784451.1:ROK family protein >Feature sequence1049 1288 599 gene locus_tag LOCUS_31760 1288 599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31760 1724 1482 gene locus_tag LOCUS_31770 1724 1482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31770 >Feature sequence1050 233 586 gene locus_tag LOCUS_31780 gene yciH 233 586 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422748.1 protein_id gnl|my_center|LOCUS_31780 750 1571 gene locus_tag LOCUS_31790 750 1571 CDS product ion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990820.1 protein_id gnl|my_center|LOCUS_31790 1735 1592 gene locus_tag LOCUS_31800 1735 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31800 >Feature sequence1051 2144 3 gene locus_tag LOCUS_31810 2144 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31810 >Feature sequence1052 188 1339 gene locus_tag LOCUS_31820 188 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31820 <2246 1410 gene locus_tag LOCUS_31830 <2246 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764795.1:Rpn family recombination-promoting nuclease/putative transposase >Feature sequence1053 472 687 gene locus_tag LOCUS_31840 472 687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31840 684 1106 gene locus_tag LOCUS_31850 684 1106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31850 1340 1762 gene locus_tag LOCUS_31860 1340 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31860 2035 1649 gene locus_tag LOCUS_31870 2035 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31870 >Feature sequence1054 71 1033 gene locus_tag LOCUS_31880 71 1033 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_31880 >Feature sequence1055 >Feature sequence1056 499 1578 gene locus_tag LOCUS_31890 499 1578 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010255239.1 protein_id gnl|my_center|LOCUS_31890 2038 1727 gene locus_tag LOCUS_31900 2038 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31900 >Feature sequence1057 >Feature sequence1058 <1 585 gene locus_tag LOCUS_31910 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762817.1:permease-like cell division protein FtsX 588 965 gene locus_tag LOCUS_31920 588 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31920 1183 1989 gene locus_tag LOCUS_31930 1183 1989 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783633.1 protein_id gnl|my_center|LOCUS_31930 >Feature sequence1059 2214 1252 gene locus_tag LOCUS_31940 2214 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_31940 >Feature sequence1060 <1 902 gene locus_tag LOCUS_31950 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000576912.1:membrane protein 1392 904 gene locus_tag LOCUS_31960 gene cdd 1392 904 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963514.1 protein_id gnl|my_center|LOCUS_31960 <2228 1393 gene locus_tag LOCUS_31970 <2228 1393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003245556.1:HslU--HslV peptidase ATPase subunit >Feature sequence1061 1696 401 gene locus_tag LOCUS_31980 1696 401 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024900539.1 protein_id gnl|my_center|LOCUS_31980 >Feature sequence1062 298 1830 gene locus_tag LOCUS_31990 298 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_31990 1945 2175 gene locus_tag LOCUS_32000 1945 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_32000 >Feature sequence1063 2 139 gene locus_tag LOCUS_32010 2 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32010 132 1058 gene locus_tag LOCUS_32020 132 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32020 1048 1779 gene locus_tag LOCUS_32030 1048 1779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32030 >Feature sequence1064 1277 144 gene locus_tag LOCUS_32040 1277 144 CDS product ISNCY family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011971071.1 protein_id gnl|my_center|LOCUS_32040 1466 1660 gene locus_tag LOCUS_32050 1466 1660 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943808.1 protein_id gnl|my_center|LOCUS_32050 >Feature sequence1065 1323 1102 gene locus_tag LOCUS_32060 1323 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_32060 1867 1370 gene locus_tag LOCUS_32070 1867 1370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_32070 >Feature sequence1066 480 1313 gene locus_tag LOCUS_32080 gene yhdJ 480 1313 CDS product adenine-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001258939.1 protein_id gnl|my_center|LOCUS_32080 <2216 1364 gene locus_tag LOCUS_32090 <2216 1364 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase >Feature sequence1067 1222 89 gene locus_tag LOCUS_32100 1222 89 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32100 >Feature sequence1068 927 241 gene locus_tag LOCUS_32110 927 241 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_32110 1096 1749 gene locus_tag LOCUS_32120 1096 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32120 >Feature sequence1069 <1 549 gene locus_tag LOCUS_32130 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964006.1:adenylosuccinate synthase 1803 577 gene locus_tag LOCUS_32140 1803 577 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963806.1 protein_id gnl|my_center|LOCUS_32140 >Feature sequence1070 300 740 gene locus_tag LOCUS_32150 300 740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32150 890 1093 gene locus_tag LOCUS_32160 gene csrA 890 1093 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460793.1 protein_id gnl|my_center|LOCUS_32160 >Feature sequence1071 1238 450 gene locus_tag LOCUS_32170 1238 450 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971313.1 protein_id gnl|my_center|LOCUS_32170 <2208 1261 gene locus_tag LOCUS_32180 <2208 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404001.1:Gldg family protein >Feature sequence1072 >Feature sequence1073 >Feature sequence1074 2087 63 gene locus_tag LOCUS_32190 2087 63 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967050.1 protein_id gnl|my_center|LOCUS_32190 >Feature sequence1075 114 1325 gene locus_tag LOCUS_32200 114 1325 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261736.1 protein_id gnl|my_center|LOCUS_32200 1340 2056 gene locus_tag LOCUS_32210 1340 2056 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261737.1 protein_id gnl|my_center|LOCUS_32210 >Feature sequence1076 1071 1649 gene locus_tag LOCUS_32220 1071 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32220 >Feature sequence1077 >Feature sequence1078 >Feature sequence1079 660 151 gene locus_tag LOCUS_32230 660 151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32230 2169 865 gene locus_tag LOCUS_32240 gene nuoD 2169 865 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403174.1 protein_id gnl|my_center|LOCUS_32240 >Feature sequence1080 <1 902 gene locus_tag LOCUS_32250 <1 902 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546476.1:DegT/DnrJ/EryC1/StrS family aminotransferase 892 1827 gene locus_tag LOCUS_32260 892 1827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32260 >Feature sequence1081 <1 819 gene locus_tag LOCUS_32270 <1 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404287.1:DNA polymerase IV 1014 1472 gene locus_tag LOCUS_32280 1014 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32280 1510 2007 gene locus_tag LOCUS_32290 1510 2007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32290 >Feature sequence1082 <2191 1516 gene locus_tag LOCUS_32300 <2191 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796048.1:GSCFA domain-containing protein >Feature sequence1083 385 765 gene locus_tag LOCUS_32310 gene gcvH 385 765 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_32310 >Feature sequence1084 2189 1275 gene locus_tag LOCUS_32320 2189 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32320 >Feature sequence1085 1602 1012 gene locus_tag LOCUS_32330 gene ruvA 1602 1012 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790555.1 protein_id gnl|my_center|LOCUS_32330 >Feature sequence1086 1460 555 gene locus_tag LOCUS_32340 1460 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32340 >Feature sequence1087 >Feature sequence1088 478 852 gene locus_tag LOCUS_32350 gene speH1 478 852 CDS product S-adenosylmethionine decarboxylase proenzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002003660.1 protein_id gnl|my_center|LOCUS_32350 1434 913 gene locus_tag LOCUS_32360 1434 913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32360 >Feature sequence1089 665 102 gene locus_tag LOCUS_32370 665 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32370 >Feature sequence1090 760 125 gene locus_tag LOCUS_32380 760 125 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_32380 2062 770 gene locus_tag LOCUS_32390 2062 770 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108756.1 protein_id gnl|my_center|LOCUS_32390 >Feature sequence1091 1290 193 gene locus_tag LOCUS_32400 1290 193 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_32400 <2178 1346 gene locus_tag LOCUS_32410 <2178 1346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962199.1:phosphoglycerate kinase >Feature sequence1092 236 394 gene locus_tag LOCUS_32420 236 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32420 1572 685 gene locus_tag LOCUS_32430 1572 685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32430 <2174 1600 gene locus_tag LOCUS_32440 <2174 1600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404822.1:methylenetetrahydrofolate reductase [NAD(P)H] >Feature sequence1093 545 1387 gene locus_tag LOCUS_32450 545 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32450 >Feature sequence1094 <2167 1166 gene locus_tag LOCUS_32460 <2167 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005898122.1:AAA family ATPase >Feature sequence1095 <1 1087 gene locus_tag LOCUS_32470 <1 1087 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013225314.1:amidohydrolase family protein <2167 1118 gene locus_tag LOCUS_32480 <2167 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458936.1:ATP-binding protein >Feature sequence1096 1039 863 gene locus_tag LOCUS_32490 1039 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32490 2031 1225 gene locus_tag LOCUS_32500 gene pyrF 2031 1225 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_32500 >Feature sequence1097 1498 542 gene locus_tag LOCUS_32510 1498 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32510 >Feature sequence1098 <1 591 gene locus_tag LOCUS_32520 <1 591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002079012.1:protein-glutamate O-methyltransferase CheR >Feature sequence1099 967 14 gene locus_tag LOCUS_32530 967 14 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880219.1 protein_id gnl|my_center|LOCUS_32530 1398 949 gene locus_tag LOCUS_32540 1398 949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32540 <2164 1521 gene locus_tag LOCUS_32550 <2164 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011462072.1:(Fe-S)-binding protein >Feature sequence1100 <2163 99 gene locus_tag LOCUS_32560 <2163 99 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141063.1:CHAT domain-containing protein >Feature sequence1101 >Feature sequence1102 269 141 gene locus_tag LOCUS_32570 269 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32570 902 2029 gene locus_tag LOCUS_32580 902 2029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32580 >Feature sequence1103 >Feature sequence1104 2151 967 gene locus_tag LOCUS_32590 2151 967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32590 >Feature sequence1105 785 1438 gene locus_tag LOCUS_32600 785 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32600 1657 2100 gene locus_tag LOCUS_32610 1657 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32610 >Feature sequence1106 2148 448 gene locus_tag LOCUS_32620 2148 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32620 >Feature sequence1107 192 70 gene locus_tag LOCUS_32630 192 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32630 500 261 gene locus_tag LOCUS_32640 500 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32640 1150 491 gene locus_tag LOCUS_32650 1150 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868125.1 protein_id gnl|my_center|LOCUS_32650 >Feature sequence1108 1159 1232 gene locus_tag LOCUS_t00210 1159 1232 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1233 2120 gene locus_tag LOCUS_32660 1233 2120 CDS product MYG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973334.1 protein_id gnl|my_center|LOCUS_32660 >Feature sequence1109 798 181 gene locus_tag LOCUS_32670 798 181 CDS product YceI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003724156.1 protein_id gnl|my_center|LOCUS_32670 <2143 1007 gene locus_tag LOCUS_32680 <2143 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870466.1:diphosphate--fructose-6-phosphate 1-phosphotransferase >Feature sequence1110 >Feature sequence1111 <1 1450 gene locus_tag LOCUS_32690 <1 1450 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005798729.1:efflux RND transporter permease subunit >Feature sequence1112 175 897 gene locus_tag LOCUS_32700 gene pgl 175 897 CDS product 6-phosphogluconolactonase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464630.1 protein_id gnl|my_center|LOCUS_32700 >Feature sequence1113 186 353 gene locus_tag LOCUS_32710 186 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32710 622 1293 gene locus_tag LOCUS_32720 622 1293 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_32720 1873 1244 gene locus_tag LOCUS_32730 1873 1244 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964039.1 protein_id gnl|my_center|LOCUS_32730 >Feature sequence1114 302 637 gene locus_tag LOCUS_32740 302 637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32740 829 1716 gene locus_tag LOCUS_32750 829 1716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32750 >Feature sequence1115 <2135 1068 gene locus_tag LOCUS_32760 <2135 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203575.1:6-bladed beta-propeller >Feature sequence1116 <1 642 gene locus_tag LOCUS_32770 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793937.1:glucuronate isomerase 661 1695 gene locus_tag LOCUS_32780 661 1695 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_32780 >Feature sequence1117 1072 1389 gene locus_tag LOCUS_32790 1072 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32790 1448 1936 gene locus_tag LOCUS_32800 1448 1936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32800 >Feature sequence1118 1122 1724 gene locus_tag LOCUS_32810 1122 1724 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_32810 >Feature sequence1119 >Feature sequence1120 814 1746 gene locus_tag LOCUS_32820 gene xerD 814 1746 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000204200.1 protein_id gnl|my_center|LOCUS_32820 >Feature sequence1121 >Feature sequence1122 212 1360 gene locus_tag LOCUS_32830 212 1360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32830 >Feature sequence1123 130 336 gene locus_tag LOCUS_32840 130 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32840 944 429 gene locus_tag LOCUS_32850 944 429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32850 1756 911 gene locus_tag LOCUS_32860 1756 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32860 >Feature sequence1124 >Feature sequence1125 30 962 gene locus_tag LOCUS_32870 30 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32870 >Feature sequence1126 474 716 gene locus_tag LOCUS_32880 474 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32880 701 1039 gene locus_tag LOCUS_32890 701 1039 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928563.1 protein_id gnl|my_center|LOCUS_32890 1221 1451 gene locus_tag LOCUS_32900 1221 1451 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_32900 1448 1861 gene locus_tag LOCUS_32910 1448 1861 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972683.1 protein_id gnl|my_center|LOCUS_32910 >Feature sequence1127 864 283 gene locus_tag LOCUS_32920 864 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32920 1588 902 gene locus_tag LOCUS_32930 1588 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32930 >Feature sequence1128 >Feature sequence1129 >Feature sequence1130 <1 767 gene locus_tag LOCUS_32940 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964380.1:1-acyl-sn-glycerol-3-phosphate acyltransferase 1278 871 gene locus_tag LOCUS_32950 1278 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32950 1467 2051 gene locus_tag LOCUS_32960 1467 2051 CDS product tRNA-(ms[2]io[6]A)-hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119755.1 protein_id gnl|my_center|LOCUS_32960 >Feature sequence1131 1 1044 gene locus_tag LOCUS_32970 1 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_32970 >Feature sequence1132 <2112 6 gene locus_tag LOCUS_32980 <2112 6 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962408.1:T9SS type A sorting domain-containing protein >Feature sequence1133 321 2069 gene locus_tag LOCUS_32990 321 2069 CDS product DUF885 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207976.1 protein_id gnl|my_center|LOCUS_32990 >Feature sequence1134 545 189 gene locus_tag LOCUS_33000 545 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33000 804 553 gene locus_tag LOCUS_33010 804 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33010 1961 876 gene locus_tag LOCUS_33020 1961 876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33020 >Feature sequence1135 <2107 977 gene locus_tag LOCUS_33030 <2107 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000221826.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence1136 <1 753 gene locus_tag LOCUS_33040 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_199111712.1:T9SS type A sorting domain-containing protein 963 1835 gene locus_tag LOCUS_33050 gene lgt 963 1835 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403744.1 protein_id gnl|my_center|LOCUS_33050 >Feature sequence1137 812 1642 gene locus_tag LOCUS_33060 812 1642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33060 >Feature sequence1138 <1 991 gene locus_tag LOCUS_33070 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940420.1:ABC transporter substrate-binding protein 1479 1973 gene locus_tag LOCUS_33080 1479 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33080 >Feature sequence1139 >Feature sequence1140 1094 801 gene locus_tag LOCUS_33090 1094 801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33090 <2093 1203 gene locus_tag LOCUS_33100 <2093 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791864.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence1141 1262 333 gene locus_tag LOCUS_33110 1262 333 CDS product NAD-dependent epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858299.1 protein_id gnl|my_center|LOCUS_33110 2090 1323 gene locus_tag LOCUS_33120 2090 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33120 >Feature sequence1142 1217 66 gene locus_tag LOCUS_33130 1217 66 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33130 2020 1214 gene locus_tag LOCUS_33140 2020 1214 CDS product CRISPR-associated endonuclease Cas3'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496479.1 protein_id gnl|my_center|LOCUS_33140 >Feature sequence1143 38 1960 gene locus_tag LOCUS_33150 38 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33150 >Feature sequence1144 >Feature sequence1145 946 1941 gene locus_tag LOCUS_33160 946 1941 CDS product YhdH/YhfP family quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087998.1 protein_id gnl|my_center|LOCUS_33160 >Feature sequence1146 368 649 gene locus_tag LOCUS_33170 368 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33170 2066 816 gene locus_tag LOCUS_33180 2066 816 CDS product pyridoxal-dependent decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047985.1 protein_id gnl|my_center|LOCUS_33180 >Feature sequence1147 1063 836 gene locus_tag LOCUS_33190 1063 836 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142391.1 protein_id gnl|my_center|LOCUS_33190 >Feature sequence1148 <2069 618 gene locus_tag LOCUS_33200 <2069 618 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073037.1:amidohydrolase family protein >Feature sequence1149 725 318 gene locus_tag LOCUS_33210 gene mce 725 318 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962412.1 protein_id gnl|my_center|LOCUS_33210 757 1443 gene locus_tag LOCUS_33220 757 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33220 >Feature sequence1150 1789 242 gene locus_tag LOCUS_33230 1789 242 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766109.1 protein_id gnl|my_center|LOCUS_33230 >Feature sequence1151 38 691 gene locus_tag LOCUS_33240 38 691 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000244073.1 protein_id gnl|my_center|LOCUS_33240 >Feature sequence1152 <2068 394 gene locus_tag LOCUS_33250 <2068 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765755.1:carboxypeptidase regulatory-like domain-containing protein >Feature sequence1153 677 883 gene locus_tag LOCUS_33260 677 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33260 <2067 1233 gene locus_tag LOCUS_33270 <2067 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403760.1:sulfotransferase >Feature sequence1154 556 1671 gene locus_tag LOCUS_33280 556 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33280 >Feature sequence1155 1391 2041 gene locus_tag LOCUS_33290 1391 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33290 >Feature sequence1156 >Feature sequence1157 1800 1582 gene locus_tag LOCUS_33300 1800 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33300 >Feature sequence1158 <1 1155 gene locus_tag LOCUS_33310 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454549.1:peptide MFS transporter >Feature sequence1159 >Feature sequence1160 1645 800 gene locus_tag LOCUS_33320 1645 800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33320 >Feature sequence1161 233 529 gene locus_tag LOCUS_33330 233 529 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813812.1 protein_id gnl|my_center|LOCUS_33330 522 1007 gene locus_tag LOCUS_33340 522 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33340 1010 1405 gene locus_tag LOCUS_33350 1010 1405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33350 >Feature sequence1162 >Feature sequence1163 1715 999 gene locus_tag LOCUS_33360 1715 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33360 >Feature sequence1164 >Feature sequence1165 324 1511 gene locus_tag LOCUS_33370 324 1511 CDS product phosphopentomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393009.1 protein_id gnl|my_center|LOCUS_33370 >Feature sequence1166 911 1933 gene locus_tag LOCUS_33380 911 1933 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108172.1 protein_id gnl|my_center|LOCUS_33380 >Feature sequence1167 134 1735 gene locus_tag LOCUS_33390 134 1735 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727106.1 protein_id gnl|my_center|LOCUS_33390 >Feature sequence1168 >Feature sequence1169 <1 1966 gene locus_tag LOCUS_33400 <1 1966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_113966250.1:T9SS type A sorting domain-containing protein >Feature sequence1170 <2027 490 gene locus_tag LOCUS_33410 <2027 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001089349.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence1171 <2023 125 gene locus_tag LOCUS_33420 <2023 125 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202856.1:NAD-dependent DNA ligase LigA >Feature sequence1172 >Feature sequence1173 739 215 gene locus_tag LOCUS_33430 739 215 CDS product DUF420 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964211.1 protein_id gnl|my_center|LOCUS_33430 1649 963 gene locus_tag LOCUS_33440 1649 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33440 2023 1760 gene locus_tag LOCUS_33450 2023 1760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33450 >Feature sequence1174 972 457 gene locus_tag LOCUS_33460 972 457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33460 >Feature sequence1175 <1 1545 gene locus_tag LOCUS_33470 <1 1545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000828556.1:methylmalonyl-CoA mutase 1789 1562 gene locus_tag LOCUS_33480 1789 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33480 >Feature sequence1176 158 628 gene locus_tag LOCUS_33490 158 628 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963415.1 protein_id gnl|my_center|LOCUS_33490 867 1052 gene locus_tag LOCUS_33500 gene rpsU 867 1052 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963322.1 protein_id gnl|my_center|LOCUS_33500 <2018 1403 gene locus_tag LOCUS_33510 <2018 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948373.1:ATP-binding protein >Feature sequence1177 510 860 gene locus_tag LOCUS_33520 510 860 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760952.1 protein_id gnl|my_center|LOCUS_33520 851 1417 gene locus_tag LOCUS_33530 851 1417 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769486.1 protein_id gnl|my_center|LOCUS_33530 1481 1942 gene locus_tag LOCUS_33540 1481 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33540 >Feature sequence1178 <1 967 gene locus_tag LOCUS_33550 <1 967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005796729.1:penicillin-binding protein >Feature sequence1179 >Feature sequence1180 <1 551 gene locus_tag LOCUS_33560 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963517.1:gliding motility lipoprotein GldJ <1997 1005 gene locus_tag LOCUS_33570 <1997 1005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963187.1:ATP-binding cassette domain-containing protein >Feature sequence1181 920 330 gene locus_tag LOCUS_33580 920 330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33580 1509 961 gene locus_tag LOCUS_33590 1509 961 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528254.1 protein_id gnl|my_center|LOCUS_33590 >Feature sequence1182 >Feature sequence1183 434 1435 gene locus_tag LOCUS_33600 434 1435 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444337.1 protein_id gnl|my_center|LOCUS_33600 >Feature sequence1184 >Feature sequence1185 3 1274 gene locus_tag LOCUS_33610 3 1274 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_33610 1349 1423 gene locus_tag LOCUS_t00220 1349 1423 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1186 >Feature sequence1187 >Feature sequence1188 >Feature sequence1189 <1 951 gene locus_tag LOCUS_33620 <1 951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455828.1:glucose-6-phosphate isomerase 1768 956 gene locus_tag LOCUS_33630 1768 956 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933475.1 protein_id gnl|my_center|LOCUS_33630 >Feature sequence1190 1601 189 gene locus_tag LOCUS_33640 1601 189 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011068591.1 protein_id gnl|my_center|LOCUS_33640 >Feature sequence1191 <1 888 gene locus_tag LOCUS_33650 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262908.1:DUF4832 domain-containing protein >Feature sequence1192 672 214 gene locus_tag LOCUS_33660 672 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33660 >Feature sequence1193 1760 792 gene locus_tag LOCUS_33670 gene rfaE1 1760 792 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583086.1 protein_id gnl|my_center|LOCUS_33670 >Feature sequence1194 <1 1816 gene locus_tag LOCUS_33680 <1 1816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203354.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence1195 217 1095 gene locus_tag LOCUS_33690 217 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33690 >Feature sequence1196 1494 277 gene locus_tag LOCUS_33700 1494 277 CDS product NupC/NupG family nucleoside CNT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356704.1 protein_id gnl|my_center|LOCUS_33700 1665 1877 gene locus_tag LOCUS_33710 1665 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33710 >Feature sequence1197 1418 750 gene locus_tag LOCUS_33720 1418 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33720 >Feature sequence1198 533 1102 gene locus_tag LOCUS_33730 533 1102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33730 >Feature sequence1199 <1 697 gene locus_tag LOCUS_33740 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957412.1:type I-F CRISPR-associated protein Csy3 707 1258 gene locus_tag LOCUS_33750 gene cas6f 707 1258 CDS product type I-F CRISPR-associated endoribonuclease Cas6/Csy4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769530.1 protein_id gnl|my_center|LOCUS_33750 >Feature sequence1200 742 77 gene locus_tag LOCUS_33760 742 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33760 1132 1278 gene locus_tag LOCUS_33770 1132 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33770 1292 1858 gene locus_tag LOCUS_33780 1292 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33780 >Feature sequence1201 <1948 607 gene locus_tag LOCUS_33790 <1948 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759576.1:SusC/RagA family TonB-linked outer membrane protein >Feature sequence1202 389 1744 gene locus_tag LOCUS_33800 389 1744 CDS product Nramp family divalent metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_142192546.1 protein_id gnl|my_center|LOCUS_33800 >Feature sequence1203 1032 112 gene locus_tag LOCUS_33810 1032 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33810 >Feature sequence1204 <1 918 gene locus_tag LOCUS_33820 <1 918 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence1205 1265 585 gene locus_tag LOCUS_33830 1265 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33830 >Feature sequence1206 1 684 gene locus_tag LOCUS_33840 1 684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33840 >Feature sequence1207 1579 479 gene locus_tag LOCUS_33850 1579 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33850 >Feature sequence1208 1580 1287 gene locus_tag LOCUS_33860 1580 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33860 >Feature sequence1209 >Feature sequence1210 1791 82 gene locus_tag LOCUS_33870 1791 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33870 >Feature sequence1211 762 1280 gene locus_tag LOCUS_33880 762 1280 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964526.1 protein_id gnl|my_center|LOCUS_33880 >Feature sequence1212 >Feature sequence1213 879 289 gene locus_tag LOCUS_33890 879 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33890 <1932 1061 gene locus_tag LOCUS_33900 <1932 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088177.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence1214 <1 566 gene locus_tag LOCUS_33910 <1 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107567.1:head GIN domain-containing protein 951 709 gene locus_tag LOCUS_33920 951 709 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403584.1 protein_id gnl|my_center|LOCUS_33920 <1927 1309 gene locus_tag LOCUS_33930 <1927 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880065.1:imidazole glycerol phosphate synthase subunit HisF >Feature sequence1215 <1 1770 gene locus_tag LOCUS_33940 <1 1770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024768457.1:VCBS repeat-containing protein >Feature sequence1216 149 910 gene locus_tag LOCUS_33950 149 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33950 916 1746 gene locus_tag LOCUS_33960 916 1746 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016055.1 protein_id gnl|my_center|LOCUS_33960 >Feature sequence1217 >Feature sequence1218 >Feature sequence1219 >Feature sequence1220 <1 1751 gene locus_tag LOCUS_33970 <1 1751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963131.1:helix-turn-helix domain-containing protein >Feature sequence1221 >Feature sequence1222 >Feature sequence1223 >Feature sequence1224 314 466 gene locus_tag LOCUS_33980 314 466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33980 1222 815 gene locus_tag LOCUS_33990 1222 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_33990 >Feature sequence1225 252 545 gene locus_tag LOCUS_34000 252 545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34000 809 585 gene locus_tag LOCUS_34010 809 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34010 <1901 769 gene locus_tag LOCUS_34020 <1901 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962917.1:glycoside hydrolase family 3 N-terminal domain-containing protein >Feature sequence1226 <1 1368 gene locus_tag LOCUS_34030 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005792044.1:bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase >Feature sequence1227 923 63 gene locus_tag LOCUS_34040 923 63 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34040 1829 951 gene locus_tag LOCUS_34050 1829 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34050 >Feature sequence1228 516 109 gene locus_tag LOCUS_34060 516 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34060 1896 1009 gene locus_tag LOCUS_34070 1896 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34070 >Feature sequence1229 <1 640 gene locus_tag LOCUS_34080 <1 640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_134204540.1:PKD domain-containing protein 749 1243 gene locus_tag LOCUS_34090 749 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_34090 >Feature sequence1230 943 1794 gene locus_tag LOCUS_34100 943 1794 CDS product neutral zinc metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011117757.1 protein_id gnl|my_center|LOCUS_34100 >Feature sequence1231 <1896 889 gene locus_tag LOCUS_34110 <1896 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122517.1:DUF1553 domain-containing protein >Feature sequence1232 1453 779 gene locus_tag LOCUS_34120 1453 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007333116.1 protein_id gnl|my_center|LOCUS_34120 >Feature sequence1233 234 743 gene locus_tag LOCUS_34130 234 743 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403994.1 protein_id gnl|my_center|LOCUS_34130 1894 1061 gene locus_tag LOCUS_34140 1894 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34140 >Feature sequence1234 741 1373 gene locus_tag LOCUS_34150 741 1373 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964492.1 protein_id gnl|my_center|LOCUS_34150 >Feature sequence1235 >Feature sequence1236 1817 717 gene locus_tag LOCUS_34160 gene dndB 1817 717 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_34160 >Feature sequence1237 <1 1026 gene locus_tag LOCUS_34170 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942602.1:polysaccharide deacetylase family protein >Feature sequence1238 938 30 gene locus_tag LOCUS_34180 938 30 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202693.1 protein_id gnl|my_center|LOCUS_34180 <1884 983 gene locus_tag LOCUS_34190 <1884 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001207193.1:CpsD/CapB family tyrosine-protein kinase >Feature sequence1239 <1883 1277 gene locus_tag LOCUS_34200 <1883 1277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921691.1:sulfatase >Feature sequence1240 >Feature sequence1241 1622 120 gene locus_tag LOCUS_34210 1622 120 CDS product IS1182-like element ISBf5 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203619.1 protein_id gnl|my_center|LOCUS_34210 >Feature sequence1242 <1 999 gene locus_tag LOCUS_34220 <1 999 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403392.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence1243 1553 1248 gene locus_tag LOCUS_34230 1553 1248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34230 >Feature sequence1244 >Feature sequence1245 675 1307 gene locus_tag LOCUS_34240 675 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34240 >Feature sequence1246 86 448 gene locus_tag LOCUS_34250 gene csa5 86 448 CDS product type I-A CRISPR-associated protein Csa5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053662.1 protein_id gnl|my_center|LOCUS_34250 454 1485 gene locus_tag LOCUS_34260 gene cas7a 454 1485 CDS product type I-A CRISPR-associated protein Cas7/Csa2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147281.1 protein_id gnl|my_center|LOCUS_34260 >Feature sequence1247 >Feature sequence1248 <1 1046 gene locus_tag LOCUS_34270 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964457.1:S9 family peptidase 1865 1140 gene locus_tag LOCUS_34280 1865 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34280 >Feature sequence1249 981 811 gene locus_tag LOCUS_34290 981 811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34290 >Feature sequence1250 <1 1321 gene locus_tag LOCUS_34300 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759975.1:glycosyltransferase family 4 protein >Feature sequence1251 1163 519 gene locus_tag LOCUS_34310 1163 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34310 >Feature sequence1252 845 579 gene locus_tag LOCUS_34320 845 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34320 1800 922 gene locus_tag LOCUS_34330 1800 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34330 >Feature sequence1253 <1 559 gene locus_tag LOCUS_34340 <1 559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_121811552.1:ABC transporter permease 487 756 gene locus_tag LOCUS_34350 487 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34350 1313 957 gene locus_tag LOCUS_34360 gene secG 1313 957 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785472.1 protein_id gnl|my_center|LOCUS_34360 >Feature sequence1254 166 1239 gene locus_tag LOCUS_34370 166 1239 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068712904.1 protein_id gnl|my_center|LOCUS_34370 >Feature sequence1255 >Feature sequence1256 <1 532 gene locus_tag LOCUS_34380 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027563.1:aldolase/citrate lyase family protein >Feature sequence1257 >Feature sequence1258 314 1270 gene locus_tag LOCUS_34390 314 1270 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919030.1 protein_id gnl|my_center|LOCUS_34390 >Feature sequence1259 <1 527 gene locus_tag LOCUS_34400 <1 527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008760550.1:polyprenol monophosphomannose synthase 587 856 gene locus_tag LOCUS_34410 587 856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34410 820 1371 gene locus_tag LOCUS_34420 820 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34420 >Feature sequence1260 >Feature sequence1261 844 1494 gene locus_tag LOCUS_34430 844 1494 CDS product SOS response-associated peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582974.1 protein_id gnl|my_center|LOCUS_34430 >Feature sequence1262 520 200 gene locus_tag LOCUS_34440 520 200 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256137.1 protein_id gnl|my_center|LOCUS_34440 1644 547 gene locus_tag LOCUS_34450 gene ychF 1644 547 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203749.1 protein_id gnl|my_center|LOCUS_34450 >Feature sequence1263 >Feature sequence1264 <1820 485 gene locus_tag LOCUS_34460 <1820 485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_174855351.1:lectin >Feature sequence1265 834 1106 gene locus_tag LOCUS_34470 834 1106 CDS product type II toxin-antitoxin system VapB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143214.1 protein_id gnl|my_center|LOCUS_34470 1103 1486 gene locus_tag LOCUS_34480 1103 1486 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143215.1 protein_id gnl|my_center|LOCUS_34480 >Feature sequence1266 <1817 128 gene locus_tag LOCUS_34490 <1817 128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_190697803.1:amylo-alpha-1,6-glucosidase >Feature sequence1267 >Feature sequence1268 <1812 747 gene locus_tag LOCUS_34500 <1812 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009195517.1:ABC transporter permease >Feature sequence1269 <1 1445 gene locus_tag LOCUS_34510 <1 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142843.1:SDR family NAD(P)-dependent oxidoreductase >Feature sequence1270 368 490 gene locus_tag LOCUS_34520 368 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34520 1004 507 gene locus_tag LOCUS_34530 1004 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34530 <1811 1094 gene locus_tag LOCUS_34540 <1811 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005789714.1:J domain-containing protein >Feature sequence1271 133 1380 gene locus_tag LOCUS_34550 133 1380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34550 >Feature sequence1272 817 1353 gene locus_tag LOCUS_34560 817 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34560 >Feature sequence1273 32 508 gene locus_tag LOCUS_34570 32 508 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030355.1 protein_id gnl|my_center|LOCUS_34570 632 1057 gene locus_tag LOCUS_34580 632 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34580 1054 1596 gene locus_tag LOCUS_34590 1054 1596 CDS product TIR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030355.1 protein_id gnl|my_center|LOCUS_34590 1706 1503 gene locus_tag LOCUS_34600 1706 1503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34600 >Feature sequence1274 <1 896 gene locus_tag LOCUS_34610 <1 896 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704479.1:DUF4832 domain-containing protein >Feature sequence1275 <1785 976 gene locus_tag LOCUS_34620 <1785 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545017.1:HAMP domain-containing sensor histidine kinase >Feature sequence1276 >Feature sequence1277 346 1455 gene locus_tag LOCUS_34630 346 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34630 >Feature sequence1278 1165 608 gene locus_tag LOCUS_34640 1165 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34640 >Feature sequence1279 1481 414 gene locus_tag LOCUS_34650 1481 414 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143092.1 protein_id gnl|my_center|LOCUS_34650 >Feature sequence1280 1485 961 gene locus_tag LOCUS_34660 1485 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34660 >Feature sequence1281 1775 918 gene locus_tag LOCUS_34670 1775 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34670 >Feature sequence1282 269 1003 gene locus_tag LOCUS_34680 gene gldF 269 1003 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_34680 >Feature sequence1283 167 1621 gene locus_tag LOCUS_34690 167 1621 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868271.1 protein_id gnl|my_center|LOCUS_34690 >Feature sequence1284 1577 660 gene locus_tag LOCUS_34700 1577 660 CDS product diacylglycerol kinase family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808357.1 protein_id gnl|my_center|LOCUS_34700 >Feature sequence1285 2 337 gene locus_tag LOCUS_34710 2 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34710 292 675 gene locus_tag LOCUS_34720 292 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_34720 651 962 gene locus_tag LOCUS_34730 651 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34730 <1771 970 gene locus_tag LOCUS_34740 <1771 970 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783832.1:GH3 auxin-responsive promoter family protein >Feature sequence1286 147 524 gene locus_tag LOCUS_34750 147 524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34750 517 882 gene locus_tag LOCUS_34760 517 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34760 1003 1233 gene locus_tag LOCUS_34770 1003 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34770 1233 1628 gene locus_tag LOCUS_34780 1233 1628 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679941.1 protein_id gnl|my_center|LOCUS_34780 >Feature sequence1287 >Feature sequence1288 359 883 gene locus_tag LOCUS_34790 359 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34790 >Feature sequence1289 106 987 gene locus_tag LOCUS_34800 106 987 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211477755.1 protein_id gnl|my_center|LOCUS_34800 <1764 997 gene locus_tag LOCUS_34810 <1764 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003419325.1:fatty acid desaturase >Feature sequence1290 >Feature sequence1291 <1 676 gene locus_tag LOCUS_34820 <1 676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003644570.1:oligosaccharide flippase family protein >Feature sequence1292 1039 683 gene locus_tag LOCUS_34830 1039 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34830 1270 1049 gene locus_tag LOCUS_34840 1270 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34840 1455 1273 gene locus_tag LOCUS_34850 1455 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34850 1667 1461 gene locus_tag LOCUS_34860 1667 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34860 >Feature sequence1293 <1761 514 gene locus_tag LOCUS_34870 <1761 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038966434.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence1294 >Feature sequence1295 185 1519 gene locus_tag LOCUS_34880 185 1519 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001443162.1 protein_id gnl|my_center|LOCUS_34880 >Feature sequence1296 <1 1521 gene locus_tag LOCUS_34890 <1 1521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141609.1:TonB-dependent receptor >Feature sequence1297 >Feature sequence1298 517 1368 gene locus_tag LOCUS_34900 517 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34900 >Feature sequence1299 >Feature sequence1300 <1 638 gene locus_tag LOCUS_34910 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867265.1:amidohydrolase family protein 1114 1536 gene locus_tag LOCUS_34920 1114 1536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34920 >Feature sequence1301 >Feature sequence1302 976 518 gene locus_tag LOCUS_34930 976 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34930 1740 1108 gene locus_tag LOCUS_34940 1740 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34940 >Feature sequence1303 <1 998 gene locus_tag LOCUS_34950 <1 998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963246.1:excinuclease ABC subunit UvrA <1740 1133 gene locus_tag LOCUS_34960 <1740 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162275150.1:isoaspartyl peptidase/L-asparaginase >Feature sequence1304 366 1718 gene locus_tag LOCUS_34970 366 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_34970 >Feature sequence1305 <1736 1107 gene locus_tag LOCUS_34980 <1736 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202132.1:carboxypeptidase-like regulatory domain-containing protein >Feature sequence1306 <1735 339 gene locus_tag LOCUS_34990 <1735 339 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963946.1:DNA repair protein RecN >Feature sequence1307 >Feature sequence1308 >Feature sequence1309 1070 174 gene locus_tag LOCUS_35000 1070 174 CDS product Bpu10I family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259288.1 protein_id gnl|my_center|LOCUS_35000 <1732 1051 gene locus_tag LOCUS_35010 <1732 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259289.1:DNA methyltransferase >Feature sequence1310 311 1189 gene locus_tag LOCUS_35020 311 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35020 >Feature sequence1311 >Feature sequence1312 >Feature sequence1313 <1 521 gene locus_tag LOCUS_35030 <1 521 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973790.1:GMC family oxidoreductase 1192 638 gene locus_tag LOCUS_35040 1192 638 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_35040 <1723 1182 gene locus_tag LOCUS_35050 <1723 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545699.1:DUF1015 domain-containing protein >Feature sequence1314 >Feature sequence1315 50 1552 gene locus_tag LOCUS_35060 50 1552 CDS product PhoPQ-activated protein PqaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004551161.1 protein_id gnl|my_center|LOCUS_35060 >Feature sequence1316 >Feature sequence1317 >Feature sequence1318 >Feature sequence1319 >Feature sequence1320 236 1030 gene locus_tag LOCUS_35070 236 1030 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089252.1 protein_id gnl|my_center|LOCUS_35070 1058 1576 gene locus_tag LOCUS_35080 1058 1576 CDS product dihydrofolate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531029.1 protein_id gnl|my_center|LOCUS_35080 >Feature sequence1321 <1 836 gene locus_tag LOCUS_35090 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933778.1:glycoside hydrolase family 3 protein <1708 934 gene locus_tag LOCUS_35100 <1708 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942324.1:AAA family ATPase >Feature sequence1322 1570 959 gene locus_tag LOCUS_35110 1570 959 CDS product Eco29kI family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689649.1 protein_id gnl|my_center|LOCUS_35110 >Feature sequence1323 880 509 gene locus_tag LOCUS_35120 gene ytxJ 880 509 CDS product bacillithiol system redox-active protein YtxJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963932.1 protein_id gnl|my_center|LOCUS_35120 >Feature sequence1324 <1 602 gene locus_tag LOCUS_35130 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957839.1:glycosyltransferase >Feature sequence1325 1631 120 gene locus_tag LOCUS_35140 1631 120 CDS product S10 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197480502.1 protein_id gnl|my_center|LOCUS_35140 >Feature sequence1326 <1 963 gene locus_tag LOCUS_35150 <1 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765451.1:MBOAT family protein <1699 960 gene locus_tag LOCUS_35160 <1699 960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932517.1:leucine-rich repeat domain-containing protein >Feature sequence1327 1462 101 gene locus_tag LOCUS_35170 1462 101 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005818018.1 protein_id gnl|my_center|LOCUS_35170 >Feature sequence1328 <1698 434 gene locus_tag LOCUS_35180 <1698 434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121095.1:sulfatase-like hydrolase/transferase >Feature sequence1329 >Feature sequence1330 >Feature sequence1331 <1 754 gene locus_tag LOCUS_35190 <1 754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164922462.1:formylglycine-generating enzyme family protein >Feature sequence1332 <1 713 gene locus_tag LOCUS_35200 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813548.1:1-acyl-sn-glycerol-3-phosphate acyltransferase <1693 743 gene locus_tag LOCUS_35210 <1693 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963770.1:nucleoid-associated protein >Feature sequence1333 <1 549 gene locus_tag LOCUS_35220 <1 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203489.1:TonB-dependent receptor <1690 741 gene locus_tag LOCUS_35230 <1690 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767657.1:DUF1080 domain-containing protein >Feature sequence1334 1630 896 gene locus_tag LOCUS_35240 1630 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35240 >Feature sequence1335 <1 613 gene locus_tag LOCUS_35250 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109265.1:VWA domain-containing protein 1212 808 gene locus_tag LOCUS_35260 1212 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35260 >Feature sequence1336 1066 368 gene locus_tag LOCUS_35270 gene rplA 1066 368 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004310894.1 protein_id gnl|my_center|LOCUS_35270 1572 1126 gene locus_tag LOCUS_35280 gene rplK 1572 1126 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963316.1 protein_id gnl|my_center|LOCUS_35280 >Feature sequence1337 >Feature sequence1338 108 1667 gene locus_tag LOCUS_35290 108 1667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35290 >Feature sequence1339 823 188 gene locus_tag LOCUS_35300 823 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35300 1267 1608 gene locus_tag LOCUS_35310 1267 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35310 >Feature sequence1340 131 1342 gene locus_tag LOCUS_35320 131 1342 CDS product DDE-type integrase/transposase/recombinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050754218.1 protein_id gnl|my_center|LOCUS_35320 >Feature sequence1341 784 497 gene locus_tag LOCUS_35330 784 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35330 992 774 gene locus_tag LOCUS_35340 992 774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35340 1081 1533 gene locus_tag LOCUS_35350 1081 1533 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963832.1 protein_id gnl|my_center|LOCUS_35350 >Feature sequence1342 1309 479 gene locus_tag LOCUS_35360 1309 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35360 >Feature sequence1343 <1667 1065 gene locus_tag LOCUS_35370 <1667 1065 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942081.1:ABC transporter permease >Feature sequence1344 >Feature sequence1345 >Feature sequence1346 1155 376 gene locus_tag LOCUS_35380 1155 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35380 >Feature sequence1347 383 622 gene locus_tag LOCUS_35390 383 622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35390 941 1165 gene locus_tag LOCUS_35400 gene tatA 941 1165 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760985.1 protein_id gnl|my_center|LOCUS_35400 >Feature sequence1348 <1659 545 gene locus_tag LOCUS_35410 <1659 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963272.1:GlmU family protein >Feature sequence1349 1500 97 gene locus_tag LOCUS_35420 1500 97 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35420 >Feature sequence1350 877 410 gene locus_tag LOCUS_35430 877 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35430 >Feature sequence1351 701 111 gene locus_tag LOCUS_35440 701 111 CDS product alpha-ketoglutarate-dependent dioxygenase AlkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000976220.1 protein_id gnl|my_center|LOCUS_35440 <1654 709 gene locus_tag LOCUS_35450 <1654 709 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963246.1:excinuclease ABC subunit UvrA >Feature sequence1352 535 996 gene locus_tag LOCUS_35460 535 996 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086244.1 protein_id gnl|my_center|LOCUS_35460 1134 1439 gene locus_tag LOCUS_35470 1134 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35470 >Feature sequence1353 374 1339 gene locus_tag LOCUS_35480 374 1339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35480 >Feature sequence1354 >Feature sequence1355 493 1452 gene locus_tag LOCUS_35490 493 1452 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108261.1 protein_id gnl|my_center|LOCUS_35490 >Feature sequence1356 >Feature sequence1357 <1 1066 gene locus_tag LOCUS_35500 <1 1066 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016444.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence1358 1091 687 gene locus_tag LOCUS_35510 1091 687 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943110.1 protein_id gnl|my_center|LOCUS_35510 1327 1091 gene locus_tag LOCUS_35520 1327 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35520 >Feature sequence1359 87 1319 gene locus_tag LOCUS_35530 87 1319 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784445.1 protein_id gnl|my_center|LOCUS_35530 >Feature sequence1360 >Feature sequence1361 >Feature sequence1362 548 141 gene locus_tag LOCUS_35540 548 141 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922377.1 protein_id gnl|my_center|LOCUS_35540 <1638 744 gene locus_tag LOCUS_35550 <1638 744 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817457.1:DNA topoisomerase 3 >Feature sequence1363 <1636 842 gene locus_tag LOCUS_35560 <1636 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036105.1:tetratricopeptide repeat protein >Feature sequence1364 924 208 gene locus_tag LOCUS_35570 gene pyrH 924 208 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962604.1 protein_id gnl|my_center|LOCUS_35570 >Feature sequence1365 >Feature sequence1366 313 1575 gene locus_tag LOCUS_35580 313 1575 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761338.1 protein_id gnl|my_center|LOCUS_35580 >Feature sequence1367 <1 1594 gene locus_tag LOCUS_35590 <1 1594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838180.1:hybrid sensor histidine kinase/response regulator >Feature sequence1368 <1 535 gene locus_tag LOCUS_35600 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097862.1:pseudaminic acid cytidylyltransferase 528 1571 gene locus_tag LOCUS_35610 gene pseG 528 1571 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965485.1 protein_id gnl|my_center|LOCUS_35610 >Feature sequence1369 657 908 gene locus_tag LOCUS_35620 657 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35620 1266 1562 gene locus_tag LOCUS_35630 1266 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35630 >Feature sequence1370 <1623 737 gene locus_tag LOCUS_35640 <1623 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108010.1:ATP-binding protein >Feature sequence1371 1409 417 gene locus_tag LOCUS_35650 1409 417 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932715.1 protein_id gnl|my_center|LOCUS_35650 >Feature sequence1372 720 247 gene locus_tag LOCUS_35660 720 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35660 1051 1611 gene locus_tag LOCUS_35670 1051 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35670 >Feature sequence1373 >Feature sequence1374 21 329 gene locus_tag LOCUS_35680 21 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35680 326 640 gene locus_tag LOCUS_35690 326 640 CDS product CopG family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958642.1 protein_id gnl|my_center|LOCUS_35690 693 1034 gene locus_tag LOCUS_35700 693 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35700 1424 1146 gene locus_tag LOCUS_35710 1424 1146 CDS product DUF2442 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391906.1 protein_id gnl|my_center|LOCUS_35710 >Feature sequence1375 687 1172 gene locus_tag LOCUS_35720 687 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35720 1243 1425 gene locus_tag LOCUS_35730 1243 1425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35730 >Feature sequence1376 <1 750 gene locus_tag LOCUS_35740 <1 750 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391981.1:DUF116 domain-containing protein >Feature sequence1377 613 17 gene locus_tag LOCUS_35750 613 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35750 1074 631 gene locus_tag LOCUS_35760 1074 631 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001223856.1 protein_id gnl|my_center|LOCUS_35760 >Feature sequence1378 <1 1312 gene locus_tag LOCUS_35770 <1 1312 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003566883.1:asparagine synthase (glutamine-hydrolyzing) >Feature sequence1379 <1602 578 gene locus_tag LOCUS_35780 <1602 578 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002262638.1:tRNA lysidine(34) synthetase TilS >Feature sequence1380 1468 410 gene locus_tag LOCUS_35790 gene galT 1468 410 CDS product galactose-1-phosphate uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693184.1 protein_id gnl|my_center|LOCUS_35790 >Feature sequence1381 >Feature sequence1382 >Feature sequence1383 >Feature sequence1384 <1 1288 gene locus_tag LOCUS_35800 <1 1288 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164929325.1:tetratricopeptide repeat protein >Feature sequence1385 <1 1168 gene locus_tag LOCUS_35810 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762954.1:cysteine--tRNA ligase >Feature sequence1386 >Feature sequence1387 >Feature sequence1388 1432 743 gene locus_tag LOCUS_35820 1432 743 CDS product formylglycine-generating enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793740.1 protein_id gnl|my_center|LOCUS_35820 >Feature sequence1389 813 556 gene locus_tag LOCUS_35830 813 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35830 840 1055 gene locus_tag LOCUS_35840 840 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35840 1238 1390 gene locus_tag LOCUS_35850 1238 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35850 >Feature sequence1390 98 757 gene locus_tag LOCUS_35860 98 757 CDS product DUF3800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868327.1 protein_id gnl|my_center|LOCUS_35860 >Feature sequence1391 <1570 354 gene locus_tag LOCUS_35870 <1570 354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009968448.1:thioredoxin domain-containing protein note possible pseudo, frameshifted >Feature sequence1392 554 3 gene locus_tag LOCUS_35880 554 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35880 1153 710 gene locus_tag LOCUS_35890 1153 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35890 >Feature sequence1393 871 176 gene locus_tag LOCUS_35900 871 176 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962520.1 protein_id gnl|my_center|LOCUS_35900 1163 966 gene locus_tag LOCUS_35910 1163 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35910 1491 1144 gene locus_tag LOCUS_35920 1491 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35920 >Feature sequence1394 80 1120 gene locus_tag LOCUS_35930 80 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35930 >Feature sequence1395 125 1564 gene locus_tag LOCUS_35940 125 1564 CDS product arylsulfatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_155594933.1 protein_id gnl|my_center|LOCUS_35940 >Feature sequence1396 1216 38 gene locus_tag LOCUS_35950 1216 38 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005479330.1 protein_id gnl|my_center|LOCUS_35950 >Feature sequence1397 1236 22 gene locus_tag LOCUS_35960 1236 22 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_35960 >Feature sequence1398 <1567 453 gene locus_tag LOCUS_35970 <1567 453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071650.1:N-6 DNA methylase >Feature sequence1399 133 1065 gene locus_tag LOCUS_35980 133 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_35980 >Feature sequence1400 >Feature sequence1401 >Feature sequence1402 <1554 625 gene locus_tag LOCUS_35990 <1554 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_213302689.1:DUF6443 domain-containing protein note possible pseudo, frameshifted >Feature sequence1403 240 1121 gene locus_tag LOCUS_36000 240 1121 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979498.1 protein_id gnl|my_center|LOCUS_36000 >Feature sequence1404 >Feature sequence1405 223 402 gene locus_tag LOCUS_36010 223 402 CDS product histone H1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404475.1 protein_id gnl|my_center|LOCUS_36010 1332 457 gene locus_tag LOCUS_36020 gene dapA 1332 457 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963941.1 protein_id gnl|my_center|LOCUS_36020 >Feature sequence1406 <1 1354 gene locus_tag LOCUS_36030 <1 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404763.1:S9 family peptidase >Feature sequence1407 >Feature sequence1408 835 344 gene locus_tag LOCUS_36040 835 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36040 1526 957 gene locus_tag LOCUS_36050 1526 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36050 >Feature sequence1409 175 720 gene locus_tag LOCUS_36060 175 720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36060 >Feature sequence1410 1015 1353 gene locus_tag LOCUS_36070 1015 1353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36070 >Feature sequence1411 <1541 127 gene locus_tag LOCUS_36080 <1541 127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011729624.1:methionine synthase >Feature sequence1412 >Feature sequence1413 1014 118 gene locus_tag LOCUS_36090 1014 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36090 >Feature sequence1414 485 90 gene locus_tag LOCUS_36100 485 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36100 1434 1078 gene locus_tag LOCUS_36110 1434 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36110 >Feature sequence1415 <1 1181 gene locus_tag LOCUS_36120 <1 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963036.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence1416 1487 864 gene locus_tag LOCUS_36130 gene recR 1487 864 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787270.1 protein_id gnl|my_center|LOCUS_36130 >Feature sequence1417 >Feature sequence1418 1101 175 gene locus_tag LOCUS_36140 1101 175 CDS product DUF4340 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404000.1 protein_id gnl|my_center|LOCUS_36140 >Feature sequence1419 333 722 gene locus_tag LOCUS_36150 333 722 CDS product PUR family DNA/RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962695.1 protein_id gnl|my_center|LOCUS_36150 >Feature sequence1420 111 1457 gene locus_tag LOCUS_36160 gene ffh 111 1457 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963594.1 protein_id gnl|my_center|LOCUS_36160 >Feature sequence1421 <1 1153 gene locus_tag LOCUS_36170 <1 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964580.1:glutamine--tRNA ligase/YqeY domain fusion protein >Feature sequence1422 546 277 gene locus_tag LOCUS_36180 546 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36180 <1520 706 gene locus_tag LOCUS_36190 <1520 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162303086.1:JAB-like toxin 1 domain-containing protein >Feature sequence1423 694 969 gene locus_tag LOCUS_36200 694 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36200 >Feature sequence1424 788 18 gene locus_tag LOCUS_36210 788 18 CDS product alpha/beta hydrolase-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764311.1 protein_id gnl|my_center|LOCUS_36210 >Feature sequence1425 >Feature sequence1426 >Feature sequence1427 386 733 gene locus_tag LOCUS_36220 386 733 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_36220 >Feature sequence1428 948 55 gene locus_tag LOCUS_36230 948 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_36230 >Feature sequence1429 <1 1042 gene locus_tag LOCUS_36240 <1 1042 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119295.1:c-type cytochrome >Feature sequence1430 329 1108 gene locus_tag LOCUS_36250 329 1108 CDS product cephalosporin hydroxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003526207.1 protein_id gnl|my_center|LOCUS_36250 >Feature sequence1431 <1504 302 gene locus_tag LOCUS_36260 <1504 302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_094146567.1:histidine kinase