>Feature sequence001 1590 1045 gene locus_tag LOCUS_00010 1590 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 2645 1854 gene locus_tag LOCUS_00020 2645 1854 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_00020 2748 3161 gene locus_tag LOCUS_00030 2748 3161 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878097.1 protein_id gnl|my_center|LOCUS_00030 3158 3499 gene locus_tag LOCUS_00040 3158 3499 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_00040 3619 4611 gene locus_tag LOCUS_00050 3619 4611 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867543.1 protein_id gnl|my_center|LOCUS_00050 4632 5447 gene locus_tag LOCUS_00060 4632 5447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5444 6244 gene locus_tag LOCUS_00070 5444 6244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00070 7554 6241 gene locus_tag LOCUS_00080 7554 6241 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081357.1 protein_id gnl|my_center|LOCUS_00080 8294 7551 gene locus_tag LOCUS_00090 8294 7551 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250288.1 protein_id gnl|my_center|LOCUS_00090 8399 9010 gene locus_tag LOCUS_00100 8399 9010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00100 9064 10197 gene locus_tag LOCUS_00110 gene hypD 9064 10197 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240243.1 protein_id gnl|my_center|LOCUS_00110 11025 10510 gene locus_tag LOCUS_00120 11025 10510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 11524 11033 gene locus_tag LOCUS_00130 11524 11033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 12551 11538 gene locus_tag LOCUS_00140 12551 11538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 12700 13191 gene locus_tag LOCUS_00150 12700 13191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240450.1 protein_id gnl|my_center|LOCUS_00150 13205 14146 gene locus_tag LOCUS_00160 gene csm3 13205 14146 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763274.1 protein_id gnl|my_center|LOCUS_00160 14182 15228 gene locus_tag LOCUS_00170 14182 15228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763273.1 protein_id gnl|my_center|LOCUS_00170 15244 16398 gene locus_tag LOCUS_00180 gene csm5 15244 16398 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209319994.1 protein_id gnl|my_center|LOCUS_00180 16371 19520 gene locus_tag LOCUS_00190 16371 19520 CDS product HD superfamily hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763271.1 protein_id gnl|my_center|LOCUS_00190 21009 19534 gene locus_tag LOCUS_00200 21009 19534 CDS product DUF2139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867326.1 protein_id gnl|my_center|LOCUS_00200 24378 21217 gene locus_tag LOCUS_00210 24378 21217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22996 23005 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 24825 30191 gene locus_tag LOCUS_00220 24825 30191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 30344 32497 gene locus_tag LOCUS_00230 30344 32497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 33169 32528 gene locus_tag LOCUS_00240 33169 32528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 35013 33250 gene locus_tag LOCUS_00250 35013 33250 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146626.1 protein_id gnl|my_center|LOCUS_00250 35483 38419 gene locus_tag LOCUS_00260 35483 38419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 38425 40824 gene locus_tag LOCUS_00270 38425 40824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 40841 41725 gene locus_tag LOCUS_00280 40841 41725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 41736 42956 gene locus_tag LOCUS_00290 41736 42956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 43429 43082 gene locus_tag LOCUS_00300 43429 43082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 43583 43359 gene locus_tag LOCUS_00310 43583 43359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 44422 43946 gene locus_tag LOCUS_00320 44422 43946 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761998.1 protein_id gnl|my_center|LOCUS_00320 44739 44551 gene locus_tag LOCUS_00330 44739 44551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 45594 45097 gene locus_tag LOCUS_00340 45594 45097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 45862 45602 gene locus_tag LOCUS_00350 45862 45602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 46296 45961 gene locus_tag LOCUS_00360 46296 45961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00360 46613 47611 gene locus_tag LOCUS_00370 46613 47611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 47608 48279 gene locus_tag LOCUS_00380 47608 48279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 49030 48326 gene locus_tag LOCUS_00390 49030 48326 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011836295.1 protein_id gnl|my_center|LOCUS_00390 49857 49027 gene locus_tag LOCUS_00400 49857 49027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 50581 50739 gene locus_tag LOCUS_00410 50581 50739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00410 50714 51172 gene locus_tag LOCUS_00420 50714 51172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 51473 51610 gene locus_tag LOCUS_00430 51473 51610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 >Feature sequence002 39 458 gene locus_tag LOCUS_00440 39 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 523 972 gene locus_tag LOCUS_00450 523 972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 991 1305 gene locus_tag LOCUS_00460 991 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 1330 1710 gene locus_tag LOCUS_00470 1330 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2093 1830 gene locus_tag LOCUS_00480 2093 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 4329 2116 gene locus_tag LOCUS_00490 4329 2116 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429724.1 protein_id gnl|my_center|LOCUS_00490 4717 4445 gene locus_tag LOCUS_00500 4717 4445 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978151.1 protein_id gnl|my_center|LOCUS_00500 4954 4736 gene locus_tag LOCUS_00510 4954 4736 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978150.1 protein_id gnl|my_center|LOCUS_00510 5080 5442 gene locus_tag LOCUS_00520 gene pth2 5080 5442 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146590.1 protein_id gnl|my_center|LOCUS_00520 5439 6545 gene locus_tag LOCUS_00530 gene truD 5439 6545 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156004996.1 protein_id gnl|my_center|LOCUS_00530 7152 6610 gene locus_tag LOCUS_00540 7152 6610 CDS product transcription elongation factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978145.1 protein_id gnl|my_center|LOCUS_00540 7800 7531 gene locus_tag LOCUS_00550 7800 7531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 8011 7769 gene locus_tag LOCUS_00560 8011 7769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 8184 8107 gene locus_tag LOCUS_t00010 8184 8107 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 8356 8553 gene locus_tag LOCUS_00570 8356 8553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 8644 9060 gene locus_tag LOCUS_00580 8644 9060 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_00580 10117 9209 gene locus_tag LOCUS_00590 10117 9209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 11390 10458 gene locus_tag LOCUS_00600 11390 10458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 12233 11631 gene locus_tag LOCUS_00610 12233 11631 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 protein_id gnl|my_center|LOCUS_00610 13024 12206 gene locus_tag LOCUS_00620 13024 12206 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846354.1 protein_id gnl|my_center|LOCUS_00620 13359 13021 gene locus_tag LOCUS_00630 13359 13021 CDS product translation initiation factor aIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846355.1 protein_id gnl|my_center|LOCUS_00630 14447 13374 gene locus_tag LOCUS_00640 14447 13374 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868106.1 protein_id gnl|my_center|LOCUS_00640 14787 14452 gene locus_tag LOCUS_00650 14787 14452 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868107.1 protein_id gnl|my_center|LOCUS_00650 15316 14888 gene locus_tag LOCUS_00660 15316 14888 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250572.1 protein_id gnl|my_center|LOCUS_00660 15469 16755 gene locus_tag LOCUS_00670 15469 16755 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011277826.1 protein_id gnl|my_center|LOCUS_00670 17590 16766 gene locus_tag LOCUS_00680 17590 16766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 18238 17594 gene locus_tag LOCUS_00690 18238 17594 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404988.1 protein_id gnl|my_center|LOCUS_00690 19708 18275 gene locus_tag LOCUS_00700 19708 18275 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867494.1 protein_id gnl|my_center|LOCUS_00700 21789 19843 gene locus_tag LOCUS_00710 21789 19843 CDS product peptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184203568.1 protein_id gnl|my_center|LOCUS_00710 23950 21911 gene locus_tag LOCUS_00720 23950 21911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 28471 24056 gene locus_tag LOCUS_00730 28471 24056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 30413 28593 gene locus_tag LOCUS_00740 30413 28593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 30853 30509 gene locus_tag LOCUS_00750 30853 30509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 31702 30860 gene locus_tag LOCUS_00760 31702 30860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 32091 31699 gene locus_tag LOCUS_00770 32091 31699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 33696 32095 gene locus_tag LOCUS_00780 33696 32095 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846917.1 protein_id gnl|my_center|LOCUS_00780 35671 33731 gene locus_tag LOCUS_00790 35671 33731 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867300.1 protein_id gnl|my_center|LOCUS_00790 37288 35738 gene locus_tag LOCUS_00800 37288 35738 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762720.1 protein_id gnl|my_center|LOCUS_00800 38834 37374 gene locus_tag LOCUS_00810 38834 37374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 39348 38836 gene locus_tag LOCUS_00820 39348 38836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 40740 39481 gene locus_tag LOCUS_00830 40740 39481 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978513.1 protein_id gnl|my_center|LOCUS_00830 41480 40737 gene locus_tag LOCUS_00840 41480 40737 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146593.1 protein_id gnl|my_center|LOCUS_00840 >Feature sequence003 541 906 gene locus_tag LOCUS_00850 541 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 903 1991 gene locus_tag LOCUS_00860 gene cas7a 903 1991 CDS product type I-A CRISPR-associated protein Cas7/Csa2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846126.1 protein_id gnl|my_center|LOCUS_00860 2003 2929 gene locus_tag LOCUS_00870 2003 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00870 2919 4121 gene locus_tag LOCUS_00880 2919 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 4133 5965 gene locus_tag LOCUS_00890 4133 5965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 5952 6884 gene locus_tag LOCUS_00900 5952 6884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 6881 7765 gene locus_tag LOCUS_00910 gene cas6 6881 7765 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162309142.1 protein_id gnl|my_center|LOCUS_00910 7848 8498 gene locus_tag LOCUS_00920 7848 8498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 10158 8623 gene locus_tag LOCUS_00930 gene gapN 10158 8623 CDS product NADP-dependent glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980562.1 protein_id gnl|my_center|LOCUS_00930 10745 10410 gene locus_tag LOCUS_00940 10745 10410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 11442 10846 gene locus_tag LOCUS_00950 11442 10846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 11571 12506 gene locus_tag LOCUS_00960 gene mtgA 11571 12506 CDS product methylcobalamin--tetrahydrofolate methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816523.1 protein_id gnl|my_center|LOCUS_00960 14151 12499 gene locus_tag LOCUS_00970 14151 12499 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583098.1 protein_id gnl|my_center|LOCUS_00970 14810 14148 gene locus_tag LOCUS_00980 14810 14148 CDS product corrinoid protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583097.1 protein_id gnl|my_center|LOCUS_00980 14914 15891 gene locus_tag LOCUS_00990 14914 15891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 16581 15883 gene locus_tag LOCUS_01000 16581 15883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 16738 17553 gene locus_tag LOCUS_01010 16738 17553 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980255.1 protein_id gnl|my_center|LOCUS_01010 17618 18133 gene locus_tag LOCUS_01020 17618 18133 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846827.1 protein_id gnl|my_center|LOCUS_01020 18924 19097 gene locus_tag LOCUS_01030 18924 19097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 19256 19426 gene locus_tag LOCUS_01040 19256 19426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 19944 19429 gene locus_tag LOCUS_01050 gene pfpI 19944 19429 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867593.1 protein_id gnl|my_center|LOCUS_01050 20029 20838 gene locus_tag LOCUS_01060 20029 20838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 20994 22109 gene locus_tag LOCUS_01070 20994 22109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 22151 23584 gene locus_tag LOCUS_01080 22151 23584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 23708 24013 gene locus_tag LOCUS_01090 23708 24013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 >Feature sequence004 917 270 gene locus_tag LOCUS_01100 917 270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 2162 936 gene locus_tag LOCUS_01110 2162 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 3213 2176 gene locus_tag LOCUS_01120 3213 2176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 4397 3219 gene locus_tag LOCUS_01130 4397 3219 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_01130 4506 5933 gene locus_tag LOCUS_01140 4506 5933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 6450 5920 gene locus_tag LOCUS_01150 6450 5920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 6959 6456 gene locus_tag LOCUS_01160 6959 6456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 7411 6956 gene locus_tag LOCUS_01170 7411 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 9097 7421 gene locus_tag LOCUS_01180 9097 7421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 10767 9097 gene locus_tag LOCUS_01190 10767 9097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 11638 10757 gene locus_tag LOCUS_01200 11638 10757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 13557 11635 gene locus_tag LOCUS_01210 13557 11635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 13811 13557 gene locus_tag LOCUS_01220 13811 13557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 14500 13808 gene locus_tag LOCUS_01230 14500 13808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 15183 14476 gene locus_tag LOCUS_01240 15183 14476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 16165 15200 gene locus_tag LOCUS_01250 16165 15200 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_01250 16433 17386 gene locus_tag LOCUS_01260 16433 17386 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_01260 17464 18018 gene locus_tag LOCUS_01270 17464 18018 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582541.1 protein_id gnl|my_center|LOCUS_01270 18165 18596 gene locus_tag LOCUS_01280 18165 18596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 19367 18606 gene locus_tag LOCUS_01290 19367 18606 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680085.1 protein_id gnl|my_center|LOCUS_01290 20336 19383 gene locus_tag LOCUS_01300 20336 19383 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903688.1 protein_id gnl|my_center|LOCUS_01300 21466 20336 gene locus_tag LOCUS_01310 21466 20336 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867634.1 protein_id gnl|my_center|LOCUS_01310 21593 22387 gene locus_tag LOCUS_01320 21593 22387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 22400 23221 gene locus_tag LOCUS_01330 gene dph5 22400 23221 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249061.1 protein_id gnl|my_center|LOCUS_01330 23877 23137 gene locus_tag LOCUS_01340 23877 23137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 27471 23884 gene locus_tag LOCUS_01350 27471 23884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 27552 28355 gene locus_tag LOCUS_01360 27552 28355 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869535.1 protein_id gnl|my_center|LOCUS_01360 28780 28352 gene locus_tag LOCUS_01370 28780 28352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 28804 29112 gene locus_tag LOCUS_01380 28804 29112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 29182 29691 gene locus_tag LOCUS_01390 29182 29691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 30820 29684 gene locus_tag LOCUS_01400 30820 29684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 30917 31921 gene locus_tag LOCUS_01410 30917 31921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 32253 33701 gene locus_tag LOCUS_01420 32253 33701 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870173.1 protein_id gnl|my_center|LOCUS_01420 33714 34865 gene locus_tag LOCUS_01430 33714 34865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 35131 34868 gene locus_tag LOCUS_01440 35131 34868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 36638 35205 gene locus_tag LOCUS_01450 gene cysS 36638 35205 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847028.1 protein_id gnl|my_center|LOCUS_01450 37197 36712 gene locus_tag LOCUS_01460 37197 36712 CDS product PaREP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979107.1 protein_id gnl|my_center|LOCUS_01460 37967 37230 gene locus_tag LOCUS_01470 37967 37230 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978977.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence005 263 1153 gene locus_tag LOCUS_01480 263 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 2143 1160 gene locus_tag LOCUS_01490 2143 1160 CDS product bifunctional phosphoglucose/phosphomannose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880453.1 protein_id gnl|my_center|LOCUS_01490 2249 2893 gene locus_tag LOCUS_01500 2249 2893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 3000 3404 gene locus_tag LOCUS_01510 3000 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 3920 3453 gene locus_tag LOCUS_01520 3920 3453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240220.1 protein_id gnl|my_center|LOCUS_01520 4168 3923 gene locus_tag LOCUS_01530 4168 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 4255 5130 gene locus_tag LOCUS_01540 4255 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 5127 5849 gene locus_tag LOCUS_01550 5127 5849 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867247.1 protein_id gnl|my_center|LOCUS_01550 6809 5841 gene locus_tag LOCUS_01560 6809 5841 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763133.1 protein_id gnl|my_center|LOCUS_01560 7004 8002 gene locus_tag LOCUS_01570 7004 8002 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979438.1 protein_id gnl|my_center|LOCUS_01570 8076 9140 gene locus_tag LOCUS_01580 8076 9140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 9607 9137 gene locus_tag LOCUS_01590 9607 9137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 9680 11290 gene locus_tag LOCUS_01600 9680 11290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 11354 12802 gene locus_tag LOCUS_01610 gene proS 11354 12802 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868093.1 protein_id gnl|my_center|LOCUS_01610 12864 13109 gene locus_tag LOCUS_01620 12864 13109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 13832 13155 gene locus_tag LOCUS_01630 13832 13155 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980120.1 protein_id gnl|my_center|LOCUS_01630 14118 14420 gene locus_tag LOCUS_01640 14118 14420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 14772 14509 gene locus_tag LOCUS_01650 14772 14509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 14988 15251 gene locus_tag LOCUS_01660 14988 15251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 16263 16045 gene locus_tag LOCUS_01670 16263 16045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 16712 16260 gene locus_tag LOCUS_01680 16712 16260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 16787 16969 gene locus_tag LOCUS_01690 16787 16969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 16969 17682 gene locus_tag LOCUS_01700 16969 17682 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024284.1 protein_id gnl|my_center|LOCUS_01700 17697 18284 gene locus_tag LOCUS_01710 17697 18284 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892716.1 protein_id gnl|my_center|LOCUS_01710 19691 18288 gene locus_tag LOCUS_01720 19691 18288 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147353.1 protein_id gnl|my_center|LOCUS_01720 23052 19693 gene locus_tag LOCUS_01730 23052 19693 CDS product V-type ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868880.1 protein_id gnl|my_center|LOCUS_01730 23433 23098 gene locus_tag LOCUS_01740 23433 23098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 24401 23430 gene locus_tag LOCUS_01750 24401 23430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 25005 24406 gene locus_tag LOCUS_01760 25005 24406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 25456 24998 gene locus_tag LOCUS_01770 25456 24998 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675599.1 protein_id gnl|my_center|LOCUS_01770 27506 25548 gene locus_tag LOCUS_01780 27506 25548 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250548.1 protein_id gnl|my_center|LOCUS_01780 27805 27506 gene locus_tag LOCUS_01790 27805 27506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 28244 27828 gene locus_tag LOCUS_01800 28244 27828 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250746.1 protein_id gnl|my_center|LOCUS_01800 28867 28241 gene locus_tag LOCUS_01810 28867 28241 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868878.1 protein_id gnl|my_center|LOCUS_01810 29126 28962 gene locus_tag LOCUS_01820 29126 28962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 29582 29241 gene locus_tag LOCUS_01830 29582 29241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 30130 29582 gene locus_tag LOCUS_01840 30130 29582 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980232.1 protein_id gnl|my_center|LOCUS_01840 30309 31616 gene locus_tag LOCUS_01850 30309 31616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 31650 32780 gene locus_tag LOCUS_01860 31650 32780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 >Feature sequence006 608 402 gene locus_tag LOCUS_01870 608 402 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978342.1 protein_id gnl|my_center|LOCUS_01870 1188 634 gene locus_tag LOCUS_01880 1188 634 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978343.1 protein_id gnl|my_center|LOCUS_01880 1711 1289 gene locus_tag LOCUS_01890 1711 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156005204.1 protein_id gnl|my_center|LOCUS_01890 2934 1681 gene locus_tag LOCUS_01900 gene eif2g 2934 1681 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846878.1 protein_id gnl|my_center|LOCUS_01900 3665 3015 gene locus_tag LOCUS_01910 3665 3015 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978346.1 protein_id gnl|my_center|LOCUS_01910 3842 5659 gene locus_tag LOCUS_01920 gene infB 3842 5659 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978230.1 protein_id gnl|my_center|LOCUS_01920 6087 5662 gene locus_tag LOCUS_01930 gene ndk 6087 5662 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846241.1 protein_id gnl|my_center|LOCUS_01930 6346 6158 gene locus_tag LOCUS_01940 6346 6158 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978232.1 protein_id gnl|my_center|LOCUS_01940 6495 6764 gene locus_tag LOCUS_01950 6495 6764 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978233.1 protein_id gnl|my_center|LOCUS_01950 7203 6817 gene locus_tag LOCUS_01960 gene rpl7ae 7203 6817 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_01960 7453 7725 gene locus_tag LOCUS_01970 7453 7725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 8124 8741 gene locus_tag LOCUS_01980 8124 8741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 8901 9131 gene locus_tag LOCUS_01990 8901 9131 CDS product type II toxin-antitoxin system CcdA family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979989.1 protein_id gnl|my_center|LOCUS_01990 9135 9551 gene locus_tag LOCUS_02000 9135 9551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 10853 9765 gene locus_tag LOCUS_02010 10853 9765 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868419.1 protein_id gnl|my_center|LOCUS_02010 12902 11142 gene locus_tag LOCUS_02020 12902 11142 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762126.1 protein_id gnl|my_center|LOCUS_02020 13386 12865 gene locus_tag LOCUS_02030 13386 12865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 14501 13383 gene locus_tag LOCUS_02040 gene fni 14501 13383 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980133.1 protein_id gnl|my_center|LOCUS_02040 15429 14557 gene locus_tag LOCUS_02050 gene amrB 15429 14557 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_02050 16082 15438 gene locus_tag LOCUS_02060 gene rpsB 16082 15438 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980137.1 protein_id gnl|my_center|LOCUS_02060 16305 16105 gene locus_tag LOCUS_02070 16305 16105 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980138.1 protein_id gnl|my_center|LOCUS_02070 16741 16313 gene locus_tag LOCUS_02080 16741 16313 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762448.1 protein_id gnl|my_center|LOCUS_02080 17190 16738 gene locus_tag LOCUS_02090 17190 16738 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980140.1 protein_id gnl|my_center|LOCUS_02090 17558 17196 gene locus_tag LOCUS_02100 17558 17196 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250453.1 protein_id gnl|my_center|LOCUS_02100 18436 17555 gene locus_tag LOCUS_02110 18436 17555 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980142.1 protein_id gnl|my_center|LOCUS_02110 18862 18461 gene locus_tag LOCUS_02120 18862 18461 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250455.1 protein_id gnl|my_center|LOCUS_02120 19377 18865 gene locus_tag LOCUS_02130 19377 18865 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980144.1 protein_id gnl|my_center|LOCUS_02130 19836 19384 gene locus_tag LOCUS_02140 19836 19384 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980145.1 protein_id gnl|my_center|LOCUS_02140 20461 20081 gene locus_tag LOCUS_02150 20461 20081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 20544 20729 gene locus_tag LOCUS_02160 20544 20729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 21009 20924 gene locus_tag LOCUS_t00020 21009 20924 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 21447 21136 gene locus_tag LOCUS_02170 gene rpsJ 21447 21136 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978218.1 protein_id gnl|my_center|LOCUS_02170 22930 21611 gene locus_tag LOCUS_02180 gene tuf 22930 21611 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978219.1 protein_id gnl|my_center|LOCUS_02180 23673 23077 gene locus_tag LOCUS_02190 23673 23077 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_02190 23851 24387 gene locus_tag LOCUS_02200 23851 24387 CDS product DUF151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978221.1 protein_id gnl|my_center|LOCUS_02200 24860 24417 gene locus_tag LOCUS_02210 24860 24417 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_02210 25389 24940 gene locus_tag LOCUS_02220 25389 24940 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_02220 25711 25397 gene locus_tag LOCUS_02230 25711 25397 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870557.1 protein_id gnl|my_center|LOCUS_02230 26991 25711 gene locus_tag LOCUS_02240 gene rpoA2 26991 25711 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846867.1 protein_id gnl|my_center|LOCUS_02240 26540 26549 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 29633 26979 gene locus_tag LOCUS_02250 gene rpoA1 29633 26979 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846236.1 protein_id gnl|my_center|LOCUS_02250 >Feature sequence007 586 1077 gene locus_tag LOCUS_02260 586 1077 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979561.1 protein_id gnl|my_center|LOCUS_02260 1417 1082 gene locus_tag LOCUS_02270 1417 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 1757 1452 gene locus_tag LOCUS_02280 1757 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 2292 1873 gene locus_tag LOCUS_02290 2292 1873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 2522 2295 gene locus_tag LOCUS_02300 2522 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 2751 2993 gene locus_tag LOCUS_02310 2751 2993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 3097 3291 gene locus_tag LOCUS_02320 3097 3291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 3911 3264 gene locus_tag LOCUS_02330 3911 3264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 4470 3958 gene locus_tag LOCUS_02340 4470 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 3964 3973 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5196 4567 gene locus_tag LOCUS_02350 5196 4567 CDS product IS607 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146551.1 protein_id gnl|my_center|LOCUS_02350 5316 5504 gene locus_tag LOCUS_02360 5316 5504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 5634 5993 gene locus_tag LOCUS_02370 5634 5993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846518.1 protein_id gnl|my_center|LOCUS_02370 5990 6634 gene locus_tag LOCUS_02380 5990 6634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6959 6639 gene locus_tag LOCUS_02390 6959 6639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 8356 7088 gene locus_tag LOCUS_02400 8356 7088 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871009.1 protein_id gnl|my_center|LOCUS_02400 8525 8821 gene locus_tag LOCUS_02410 8525 8821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979274.1 protein_id gnl|my_center|LOCUS_02410 9511 8801 gene locus_tag LOCUS_02420 9511 8801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 9660 10337 gene locus_tag LOCUS_02430 9660 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 10350 11084 gene locus_tag LOCUS_02440 10350 11084 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763546.1 protein_id gnl|my_center|LOCUS_02440 11372 11070 gene locus_tag LOCUS_02450 11372 11070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 11543 11878 gene locus_tag LOCUS_02460 11543 11878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 12635 11871 gene locus_tag LOCUS_02470 12635 11871 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146518.1 protein_id gnl|my_center|LOCUS_02470 12766 13170 gene locus_tag LOCUS_02480 12766 13170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 13469 13167 gene locus_tag LOCUS_02490 13469 13167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 14162 13536 gene locus_tag LOCUS_02500 14162 13536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 15266 14265 gene locus_tag LOCUS_02510 15266 14265 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980350.1 protein_id gnl|my_center|LOCUS_02510 15934 15293 gene locus_tag LOCUS_02520 15934 15293 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015966.1 protein_id gnl|my_center|LOCUS_02520 16025 17173 gene locus_tag LOCUS_02530 gene prf1 16025 17173 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742617.1 protein_id gnl|my_center|LOCUS_02530 17738 17199 gene locus_tag LOCUS_02540 17738 17199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 17988 17827 gene locus_tag LOCUS_02550 17988 17827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 18211 18492 gene locus_tag LOCUS_02560 18211 18492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 18803 19249 gene locus_tag LOCUS_02570 18803 19249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 19470 20501 gene locus_tag LOCUS_02580 19470 20501 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020910.1 protein_id gnl|my_center|LOCUS_02580 20594 22294 gene locus_tag LOCUS_02590 20594 22294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 22773 22297 gene locus_tag LOCUS_02600 22773 22297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 24661 23066 gene locus_tag LOCUS_02610 24661 23066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 25103 24741 gene locus_tag LOCUS_02620 25103 24741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 26369 25116 gene locus_tag LOCUS_02630 26369 25116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 26509 27306 gene locus_tag LOCUS_02640 26509 27306 CDS product extragenic suppressor protein suhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978527.1 protein_id gnl|my_center|LOCUS_02640 28423 27311 gene locus_tag LOCUS_02650 28423 27311 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979428.1 protein_id gnl|my_center|LOCUS_02650 28546 28770 gene locus_tag LOCUS_02660 28546 28770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 >Feature sequence008 <1 793 gene locus_tag LOCUS_02670 <1 793 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496764.1:methyltransferase domain-containing protein 1142 786 gene locus_tag LOCUS_02680 1142 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 2106 1153 gene locus_tag LOCUS_02690 2106 1153 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762696.1 protein_id gnl|my_center|LOCUS_02690 2194 2682 gene locus_tag LOCUS_02700 2194 2682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 2695 3033 gene locus_tag LOCUS_02710 2695 3033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 3236 3006 gene locus_tag LOCUS_02720 3236 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 3367 4485 gene locus_tag LOCUS_02730 3367 4485 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762739.1 protein_id gnl|my_center|LOCUS_02730 5495 4515 gene locus_tag LOCUS_02740 5495 4515 CDS product dihydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878138.1 protein_id gnl|my_center|LOCUS_02740 5966 7138 gene locus_tag LOCUS_02750 5966 7138 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978564.1 protein_id gnl|my_center|LOCUS_02750 7323 7712 gene locus_tag LOCUS_02760 gene speD 7323 7712 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650921.1 protein_id gnl|my_center|LOCUS_02760 7735 8826 gene locus_tag LOCUS_02770 7735 8826 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868730.1 protein_id gnl|my_center|LOCUS_02770 8878 9771 gene locus_tag LOCUS_02780 8878 9771 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762701.1 protein_id gnl|my_center|LOCUS_02780 9795 10415 gene locus_tag LOCUS_02790 9795 10415 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_02790 10442 12397 gene locus_tag LOCUS_02800 10442 12397 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011018621.1 protein_id gnl|my_center|LOCUS_02800 12398 12814 gene locus_tag LOCUS_02810 12398 12814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 12811 13713 gene locus_tag LOCUS_02820 12811 13713 CDS product F420-nonreducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496953.1 protein_id gnl|my_center|LOCUS_02820 13714 15009 gene locus_tag LOCUS_02830 gene hydA 13714 15009 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867988.1 protein_id gnl|my_center|LOCUS_02830 15002 15376 gene locus_tag LOCUS_02840 15002 15376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 15384 16262 gene locus_tag LOCUS_02850 15384 16262 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940768.1 protein_id gnl|my_center|LOCUS_02850 16259 16990 gene locus_tag LOCUS_02860 16259 16990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02860 17005 18669 gene locus_tag LOCUS_02870 17005 18669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 18722 20059 gene locus_tag LOCUS_02880 18722 20059 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763417.1 protein_id gnl|my_center|LOCUS_02880 20564 20043 gene locus_tag LOCUS_02890 20564 20043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 21668 20610 gene locus_tag LOCUS_02900 21668 20610 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_02900 22944 21688 gene locus_tag LOCUS_02910 gene porA 22944 21688 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082460.1 protein_id gnl|my_center|LOCUS_02910 23237 22959 gene locus_tag LOCUS_02920 23237 22959 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582672.1 protein_id gnl|my_center|LOCUS_02920 23802 23242 gene locus_tag LOCUS_02930 23802 23242 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_02930 23989 24372 gene locus_tag LOCUS_02940 23989 24372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 24444 24689 gene locus_tag LOCUS_02950 24444 24689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 24695 25009 gene locus_tag LOCUS_02960 24695 25009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 25850 25011 gene locus_tag LOCUS_02970 25850 25011 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926022.1 protein_id gnl|my_center|LOCUS_02970 26787 25840 gene locus_tag LOCUS_02980 gene ttuA 26787 25840 CDS product tRNA-5-methyluridine(54) 2-sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082849.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence009 <1 238 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq atttcagttttatttgttttctact 981 520 gene locus_tag LOCUS_02990 981 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 1261 968 gene locus_tag LOCUS_03000 1261 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 1668 1393 gene locus_tag LOCUS_03010 1668 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 1783 1610 gene locus_tag LOCUS_03020 1783 1610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03020 2006 1761 gene locus_tag LOCUS_03030 2006 1761 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980272.1 protein_id gnl|my_center|LOCUS_03030 2354 2605 gene locus_tag LOCUS_03040 2354 2605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 3648 2629 gene locus_tag LOCUS_03050 3648 2629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 4167 4091 gene locus_tag LOCUS_t00030 4167 4091 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6110 4230 gene locus_tag LOCUS_03060 6110 4230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 6475 7173 gene locus_tag LOCUS_03070 6475 7173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 8341 7181 gene locus_tag LOCUS_03080 8341 7181 CDS product YgeY family selenium metabolism-linked hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392231.1 protein_id gnl|my_center|LOCUS_03080 8431 9825 gene locus_tag LOCUS_03090 8431 9825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 10551 9961 gene locus_tag LOCUS_03100 10551 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763219.1 protein_id gnl|my_center|LOCUS_03100 11564 10548 gene locus_tag LOCUS_03110 11564 10548 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827664.1 protein_id gnl|my_center|LOCUS_03110 13306 11630 gene locus_tag LOCUS_03120 13306 11630 CDS product ABC-ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228055.1 protein_id gnl|my_center|LOCUS_03120 13382 14239 gene locus_tag LOCUS_03130 13382 14239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 14790 14611 gene locus_tag LOCUS_03140 14790 14611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 15289 14876 gene locus_tag LOCUS_03150 15289 14876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 16416 15310 gene locus_tag LOCUS_03160 16416 15310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 17509 16496 gene locus_tag LOCUS_03170 17509 16496 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867993.1 protein_id gnl|my_center|LOCUS_03170 18176 17745 gene locus_tag LOCUS_03180 18176 17745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 18943 18173 gene locus_tag LOCUS_03190 18943 18173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 19119 20318 gene locus_tag LOCUS_03200 19119 20318 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978090.1 protein_id gnl|my_center|LOCUS_03200 20342 21031 gene locus_tag LOCUS_03210 20342 21031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 21993 21103 gene locus_tag LOCUS_03220 21993 21103 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429779.1 protein_id gnl|my_center|LOCUS_03220 22409 22056 gene locus_tag LOCUS_03230 22409 22056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 23414 22500 gene locus_tag LOCUS_03240 23414 22500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 24208 23384 gene locus_tag LOCUS_03250 24208 23384 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846346.1 protein_id gnl|my_center|LOCUS_03250 25820 24681 gene locus_tag LOCUS_03260 25820 24681 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_03260 >Feature sequence010 121 1239 gene locus_tag LOCUS_03270 121 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 1239 2384 gene locus_tag LOCUS_03280 gene mfnA 1239 2384 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496377.1 protein_id gnl|my_center|LOCUS_03280 3023 2388 gene locus_tag LOCUS_03290 3023 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 4405 3020 gene locus_tag LOCUS_03300 4405 3020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 5453 4452 gene locus_tag LOCUS_03310 5453 4452 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240278.1 protein_id gnl|my_center|LOCUS_03310 6184 5465 gene locus_tag LOCUS_03320 gene alaXM 6184 5465 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_03320 6315 6221 gene locus_tag LOCUS_t00040 6315 6221 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 6497 7423 gene locus_tag LOCUS_03330 6497 7423 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_03330 7816 7499 gene locus_tag LOCUS_03340 gene yciH 7816 7499 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978313.1 protein_id gnl|my_center|LOCUS_03340 7932 8075 gene locus_tag LOCUS_03350 7932 8075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 8846 8058 gene locus_tag LOCUS_03360 gene speB 8846 8058 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393315.1 protein_id gnl|my_center|LOCUS_03360 9052 10824 gene locus_tag LOCUS_03370 gene glyS 9052 10824 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978316.1 protein_id gnl|my_center|LOCUS_03370 11066 11467 gene locus_tag LOCUS_03380 11066 11467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978317.1 protein_id gnl|my_center|LOCUS_03380 11476 11856 gene locus_tag LOCUS_03390 11476 11856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 13478 11862 gene locus_tag LOCUS_03400 13478 11862 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871145.1 protein_id gnl|my_center|LOCUS_03400 13586 14254 gene locus_tag LOCUS_03410 13586 14254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 14503 14793 gene locus_tag LOCUS_03420 14503 14793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 14922 15353 gene locus_tag LOCUS_03430 14922 15353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 15943 15329 gene locus_tag LOCUS_03440 15943 15329 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429728.1 protein_id gnl|my_center|LOCUS_03440 16078 16353 gene locus_tag LOCUS_03450 16078 16353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 16373 17206 gene locus_tag LOCUS_03460 16373 17206 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_03460 19665 17203 gene locus_tag LOCUS_03470 19665 17203 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763175.1 protein_id gnl|my_center|LOCUS_03470 21887 19665 gene locus_tag LOCUS_03480 21887 19665 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762291.1 protein_id gnl|my_center|LOCUS_03480 22039 22800 gene locus_tag LOCUS_03490 22039 22800 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250541.1 protein_id gnl|my_center|LOCUS_03490 23224 23233 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence011 <1 2127 gene locus_tag LOCUS_03500 <1 2127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867994.1:leucine--tRNA ligase 2347 2640 gene locus_tag LOCUS_03510 2347 2640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 2780 4069 gene locus_tag LOCUS_03520 2780 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250381.1 protein_id gnl|my_center|LOCUS_03520 4163 4459 gene locus_tag LOCUS_03530 4163 4459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4467 6245 gene locus_tag LOCUS_03540 4467 6245 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545733.1 protein_id gnl|my_center|LOCUS_03540 6242 7120 gene locus_tag LOCUS_03550 6242 7120 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_03550 7319 7942 gene locus_tag LOCUS_03560 7319 7942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 8157 9797 gene locus_tag LOCUS_03570 8157 9797 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459110.1 protein_id gnl|my_center|LOCUS_03570 9800 10828 gene locus_tag LOCUS_03580 9800 10828 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000145111.1 protein_id gnl|my_center|LOCUS_03580 10828 11727 gene locus_tag LOCUS_03590 10828 11727 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583498.1 protein_id gnl|my_center|LOCUS_03590 11718 12695 gene locus_tag LOCUS_03600 11718 12695 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080229.1 protein_id gnl|my_center|LOCUS_03600 12959 14341 gene locus_tag LOCUS_03610 12959 14341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 14474 15013 gene locus_tag LOCUS_03620 14474 15013 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_03620 15148 15870 gene locus_tag LOCUS_03630 gene yknY 15148 15870 CDS product ABC transporter ATP-binding protein YknY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232356.1 protein_id gnl|my_center|LOCUS_03630 15930 16628 gene locus_tag LOCUS_03640 15930 16628 CDS product acylneuraminate cytidylyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000132016.1 protein_id gnl|my_center|LOCUS_03640 16701 17747 gene locus_tag LOCUS_03650 gene neuB 16701 17747 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392277.1 protein_id gnl|my_center|LOCUS_03650 17744 18877 gene locus_tag LOCUS_03660 gene neuC 17744 18877 CDS product UDP-N-acetylglucosamine 2-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000823150.1 protein_id gnl|my_center|LOCUS_03660 18976 20355 gene locus_tag LOCUS_03670 18976 20355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 20400 25085 gene locus_tag LOCUS_03680 20400 25085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence012 <1 812 gene locus_tag LOCUS_03690 <1 812 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762742.1:molybdopterin molybdotransferase MoeA 902 1309 gene locus_tag LOCUS_03700 gene cdd 902 1309 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240361.1 protein_id gnl|my_center|LOCUS_03700 1331 3601 gene locus_tag LOCUS_03710 1331 3601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 5038 4172 gene locus_tag LOCUS_03720 5038 4172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 5424 5984 gene locus_tag LOCUS_03730 5424 5984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 6056 6733 gene locus_tag LOCUS_03740 6056 6733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03740 6804 8003 gene locus_tag LOCUS_03750 6804 8003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 8000 9025 gene locus_tag LOCUS_03760 8000 9025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 9043 9537 gene locus_tag LOCUS_03770 9043 9537 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121529.1 protein_id gnl|my_center|LOCUS_03770 9562 9690 gene locus_tag LOCUS_03780 9562 9690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 11714 9768 gene locus_tag LOCUS_03790 11714 9768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 11824 12948 gene locus_tag LOCUS_03800 11824 12948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 12958 14136 gene locus_tag LOCUS_03810 12958 14136 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868335.1 protein_id gnl|my_center|LOCUS_03810 15911 14238 gene locus_tag LOCUS_03820 gene pheT 15911 14238 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249876.1 protein_id gnl|my_center|LOCUS_03820 17612 15981 gene locus_tag LOCUS_03830 17612 15981 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146467.1 protein_id gnl|my_center|LOCUS_03830 18361 17717 gene locus_tag LOCUS_03840 18361 17717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 18700 18404 gene locus_tag LOCUS_03850 18700 18404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 19252 18704 gene locus_tag LOCUS_03860 19252 18704 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879824.1 protein_id gnl|my_center|LOCUS_03860 19409 20929 gene locus_tag LOCUS_03870 19409 20929 CDS product glycogen/starch/alpha-glucan phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762722.1 protein_id gnl|my_center|LOCUS_03870 21006 21326 gene locus_tag LOCUS_03880 21006 21326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 22112 21294 gene locus_tag LOCUS_03890 22112 21294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 24479 22125 gene locus_tag LOCUS_03900 24479 22125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 >Feature sequence013 721 5865 gene locus_tag LOCUS_03910 721 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 6725 5880 gene locus_tag LOCUS_03920 6725 5880 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064408.1 protein_id gnl|my_center|LOCUS_03920 7444 6725 gene locus_tag LOCUS_03930 7444 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 7589 7942 gene locus_tag LOCUS_03940 7589 7942 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240352.1 protein_id gnl|my_center|LOCUS_03940 7935 8150 gene locus_tag LOCUS_03950 7935 8150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 8214 8489 gene locus_tag LOCUS_03960 8214 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 9235 8486 gene locus_tag LOCUS_03970 9235 8486 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867188.1 protein_id gnl|my_center|LOCUS_03970 9284 9481 gene locus_tag LOCUS_03980 9284 9481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 9390 11642 gene locus_tag LOCUS_03990 9390 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 12442 11651 gene locus_tag LOCUS_04000 12442 11651 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979496.1 protein_id gnl|my_center|LOCUS_04000 13038 12445 gene locus_tag LOCUS_04010 13038 12445 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870563.1 protein_id gnl|my_center|LOCUS_04010 14290 12983 gene locus_tag LOCUS_04020 14290 12983 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867839.1 protein_id gnl|my_center|LOCUS_04020 14519 16213 gene locus_tag LOCUS_04030 14519 16213 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978239.1 protein_id gnl|my_center|LOCUS_04030 16520 16251 gene locus_tag LOCUS_04040 16520 16251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 16793 16867 gene locus_tag LOCUS_t00050 16793 16867 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 16987 17358 gene locus_tag LOCUS_04050 16987 17358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 17992 17411 gene locus_tag LOCUS_04060 17992 17411 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250983.1 protein_id gnl|my_center|LOCUS_04060 19157 17976 gene locus_tag LOCUS_04070 19157 17976 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978258.1 protein_id gnl|my_center|LOCUS_04070 19408 20259 gene locus_tag LOCUS_04080 19408 20259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 20246 21484 gene locus_tag LOCUS_04090 20246 21484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 21582 21670 gene locus_tag LOCUS_t00060 21582 21670 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 21861 22154 gene locus_tag LOCUS_04100 21861 22154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence014 913 149 gene locus_tag LOCUS_04110 913 149 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083143.1 protein_id gnl|my_center|LOCUS_04110 1486 929 gene locus_tag LOCUS_04120 1486 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 1641 2048 gene locus_tag LOCUS_04130 1641 2048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 2069 3997 gene locus_tag LOCUS_04140 2069 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 4114 4839 gene locus_tag LOCUS_04150 4114 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 4889 5368 gene locus_tag LOCUS_04160 4889 5368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 5445 6395 gene locus_tag LOCUS_04170 5445 6395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 6513 10565 gene locus_tag LOCUS_04180 6513 10565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 10659 11135 gene locus_tag LOCUS_04190 10659 11135 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_04190 11203 11745 gene locus_tag LOCUS_04200 11203 11745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 11841 12632 gene locus_tag LOCUS_04210 11841 12632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 12611 12620 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 12629 13573 gene locus_tag LOCUS_04220 12629 13573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 13631 14647 gene locus_tag LOCUS_04230 13631 14647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 14922 16040 gene locus_tag LOCUS_04240 14922 16040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 16123 17064 gene locus_tag LOCUS_04250 16123 17064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 18349 17021 gene locus_tag LOCUS_04260 18349 17021 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978478.1 protein_id gnl|my_center|LOCUS_04260 20642 18366 gene locus_tag LOCUS_04270 20642 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 21109 20825 gene locus_tag LOCUS_04280 21109 20825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 21205 21690 gene locus_tag LOCUS_04290 21205 21690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 21822 22253 gene locus_tag LOCUS_04300 21822 22253 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978480.1 protein_id gnl|my_center|LOCUS_04300 22289 22615 gene locus_tag LOCUS_04310 22289 22615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence015 1040 2470 gene locus_tag LOCUS_04320 1040 2470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 2448 3425 gene locus_tag LOCUS_04330 2448 3425 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_04330 3422 4774 gene locus_tag LOCUS_04340 3422 4774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 4785 5957 gene locus_tag LOCUS_04350 4785 5957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 5961 6191 gene locus_tag LOCUS_04360 5961 6191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04360 6369 7433 gene locus_tag LOCUS_04370 6369 7433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 8275 7448 gene locus_tag LOCUS_04380 8275 7448 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867130.1 protein_id gnl|my_center|LOCUS_04380 8368 9036 gene locus_tag LOCUS_04390 8368 9036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979538.1 protein_id gnl|my_center|LOCUS_04390 10183 9017 gene locus_tag LOCUS_04400 gene thiI 10183 9017 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877292.1 protein_id gnl|my_center|LOCUS_04400 10271 10603 gene locus_tag LOCUS_04410 gene metG 10271 10603 CDS product methionine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762104.1 protein_id gnl|my_center|LOCUS_04410 12002 10614 gene locus_tag LOCUS_04420 gene acdAI 12002 10614 CDS product acetate--CoA ligase II subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867767.1 protein_id gnl|my_center|LOCUS_04420 13921 12104 gene locus_tag LOCUS_04430 13921 12104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 14891 14010 gene locus_tag LOCUS_04440 14891 14010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870975.1 protein_id gnl|my_center|LOCUS_04440 15580 15005 gene locus_tag LOCUS_04450 15580 15005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 16578 15583 gene locus_tag LOCUS_04460 16578 15583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 16577 17245 gene locus_tag LOCUS_04470 16577 17245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 19098 17260 gene locus_tag LOCUS_04480 19098 17260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 >Feature sequence016 498 1283 gene locus_tag LOCUS_04490 498 1283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 1267 2049 gene locus_tag LOCUS_04500 1267 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 2757 1987 gene locus_tag LOCUS_04510 2757 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 3937 2837 gene locus_tag LOCUS_04520 gene twy1 3937 2837 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979301.1 protein_id gnl|my_center|LOCUS_04520 4029 4742 gene locus_tag LOCUS_04530 4029 4742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 5257 4730 gene locus_tag LOCUS_04540 5257 4730 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_04540 5425 7929 gene locus_tag LOCUS_04550 5425 7929 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583779.1 protein_id gnl|my_center|LOCUS_04550 8009 8722 gene locus_tag LOCUS_04560 8009 8722 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966771.1 protein_id gnl|my_center|LOCUS_04560 8732 9991 gene locus_tag LOCUS_04570 8732 9991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 10725 9994 gene locus_tag LOCUS_04580 10725 9994 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979298.1 protein_id gnl|my_center|LOCUS_04580 11193 11396 gene locus_tag LOCUS_04590 11193 11396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 11378 11809 gene locus_tag LOCUS_04600 11378 11809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 13015 11963 gene locus_tag LOCUS_04610 13015 11963 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979396.1 protein_id gnl|my_center|LOCUS_04610 14325 13093 gene locus_tag LOCUS_04620 14325 13093 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979397.1 protein_id gnl|my_center|LOCUS_04620 14851 14480 gene locus_tag LOCUS_04630 14851 14480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 15791 15084 gene locus_tag LOCUS_04640 15791 15084 CDS product B3/4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979569.1 protein_id gnl|my_center|LOCUS_04640 16481 15915 gene locus_tag LOCUS_04650 16481 15915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 16816 17643 gene locus_tag LOCUS_04660 16816 17643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 18882 17665 gene locus_tag LOCUS_04670 18882 17665 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009891591.1 protein_id gnl|my_center|LOCUS_04670 19272 19075 gene locus_tag LOCUS_04680 19272 19075 CDS product chromatin protein Cren7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846948.1 protein_id gnl|my_center|LOCUS_04680 20813 19428 gene locus_tag LOCUS_04690 gene ssnA 20813 19428 CDS product putative aminohydrolase SsnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393455.1 protein_id gnl|my_center|LOCUS_04690 21610 20933 gene locus_tag LOCUS_04700 21610 20933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence017 671 120 gene locus_tag LOCUS_04710 671 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 892 805 gene locus_tag LOCUS_t00070 892 805 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2352 931 gene locus_tag LOCUS_04720 2352 931 CDS product ribonuclease E/G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146488.1 protein_id gnl|my_center|LOCUS_04720 2653 2381 gene locus_tag LOCUS_04730 2653 2381 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_04730 2776 3135 gene locus_tag LOCUS_04740 2776 3135 CDS product Sjogren's syndrome/scleroderma autoantigen 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978437.1 protein_id gnl|my_center|LOCUS_04740 3727 3116 gene locus_tag LOCUS_04750 gene tmk 3727 3116 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867602.1 protein_id gnl|my_center|LOCUS_04750 4103 3711 gene locus_tag LOCUS_04760 4103 3711 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_04760 5280 4108 gene locus_tag LOCUS_04770 5280 4108 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147112.1 protein_id gnl|my_center|LOCUS_04770 6554 5280 gene locus_tag LOCUS_04780 6554 5280 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762608.1 protein_id gnl|my_center|LOCUS_04780 7822 6572 gene locus_tag LOCUS_04790 7822 6572 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496787.1 protein_id gnl|my_center|LOCUS_04790 8422 7826 gene locus_tag LOCUS_04800 8422 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 8592 9227 gene locus_tag LOCUS_04810 8592 9227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 9211 9723 gene locus_tag LOCUS_04820 9211 9723 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978442.1 protein_id gnl|my_center|LOCUS_04820 9810 10097 gene locus_tag LOCUS_04830 9810 10097 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978937.1 protein_id gnl|my_center|LOCUS_04830 10100 10309 gene locus_tag LOCUS_04840 10100 10309 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978936.1 protein_id gnl|my_center|LOCUS_04840 10986 10324 gene locus_tag LOCUS_04850 10986 10324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 protein_id gnl|my_center|LOCUS_04850 11365 11126 gene locus_tag LOCUS_04860 11365 11126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 11253 11720 gene locus_tag LOCUS_04870 11253 11720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 11781 12644 gene locus_tag LOCUS_04880 11781 12644 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583214.1 protein_id gnl|my_center|LOCUS_04880 13002 12661 gene locus_tag LOCUS_04890 13002 12661 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867887.1 protein_id gnl|my_center|LOCUS_04890 14044 13043 gene locus_tag LOCUS_04900 14044 13043 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867986.1 protein_id gnl|my_center|LOCUS_04900 14928 14041 gene locus_tag LOCUS_04910 14928 14041 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867985.1 protein_id gnl|my_center|LOCUS_04910 15329 14943 gene locus_tag LOCUS_04920 15329 14943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 16760 15690 gene locus_tag LOCUS_04930 16760 15690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 17363 17551 gene locus_tag LOCUS_04940 17363 17551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 18634 17885 gene locus_tag LOCUS_04950 gene serK 18634 17885 CDS product L-serine kinase SerK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249333.1 protein_id gnl|my_center|LOCUS_04950 19651 18722 gene locus_tag LOCUS_04960 19651 18722 CDS product hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250916.1 protein_id gnl|my_center|LOCUS_04960 20956 19814 gene locus_tag LOCUS_04970 20956 19814 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867962.1 protein_id gnl|my_center|LOCUS_04970 21166 21489 gene locus_tag LOCUS_04980 21166 21489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 >Feature sequence018 1443 19 gene locus_tag LOCUS_04990 gene cca 1443 19 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978948.1 protein_id gnl|my_center|LOCUS_04990 2012 1440 gene locus_tag LOCUS_05000 gene thpR 2012 1440 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_05000 2092 2670 gene locus_tag LOCUS_05010 2092 2670 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870916.1 protein_id gnl|my_center|LOCUS_05010 2630 3106 gene locus_tag LOCUS_05020 2630 3106 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978945.1 protein_id gnl|my_center|LOCUS_05020 3874 3110 gene locus_tag LOCUS_05030 gene rnz 3874 3110 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978944.1 protein_id gnl|my_center|LOCUS_05030 4766 3888 gene locus_tag LOCUS_05040 4766 3888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 5781 4876 gene locus_tag LOCUS_05050 5781 4876 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_05050 5870 6952 gene locus_tag LOCUS_05060 gene amrS 5870 6952 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867880.1 protein_id gnl|my_center|LOCUS_05060 6988 7770 gene locus_tag LOCUS_05070 6988 7770 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_05070 7844 9247 gene locus_tag LOCUS_05080 7844 9247 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867476.1 protein_id gnl|my_center|LOCUS_05080 9247 9945 gene locus_tag LOCUS_05090 9247 9945 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_05090 10046 10972 gene locus_tag LOCUS_05100 10046 10972 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251107.1 protein_id gnl|my_center|LOCUS_05100 10938 12056 gene locus_tag LOCUS_05110 10938 12056 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846947.1 protein_id gnl|my_center|LOCUS_05110 12849 12061 gene locus_tag LOCUS_05120 gene uppS 12849 12061 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978127.1 protein_id gnl|my_center|LOCUS_05120 12981 13508 gene locus_tag LOCUS_05130 gene yjjX 12981 13508 CDS product inosine/xanthosine triphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496441.1 protein_id gnl|my_center|LOCUS_05130 13567 13959 gene locus_tag LOCUS_05140 13567 13959 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978126.1 protein_id gnl|my_center|LOCUS_05140 14042 14332 gene locus_tag LOCUS_05150 gene srp19 14042 14332 CDS product signal recognition particle SRP19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878753.1 protein_id gnl|my_center|LOCUS_05150 14534 14845 gene locus_tag LOCUS_05160 14534 14845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 14864 15757 gene locus_tag LOCUS_05170 14864 15757 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846945.1 protein_id gnl|my_center|LOCUS_05170 15922 16344 gene locus_tag LOCUS_05180 15922 16344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 17509 16331 gene locus_tag LOCUS_05190 17509 16331 CDS product tRNA (guanine(26)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979289.1 protein_id gnl|my_center|LOCUS_05190 18100 17537 gene locus_tag LOCUS_05200 18100 17537 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846731.1 protein_id gnl|my_center|LOCUS_05200 19007 18126 gene locus_tag LOCUS_05210 19007 18126 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763382.1 protein_id gnl|my_center|LOCUS_05210 19805 19098 gene locus_tag LOCUS_05220 19805 19098 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762156.1 protein_id gnl|my_center|LOCUS_05220 21049 19811 gene locus_tag LOCUS_05230 21049 19811 CDS product C/D box methylation guide ribonucleoprotein complex aNOP56 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014546.1 protein_id gnl|my_center|LOCUS_05230 21198 21365 gene locus_tag LOCUS_05240 21198 21365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 21558 21725 gene locus_tag LOCUS_05250 21558 21725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 >Feature sequence019 930 1229 gene locus_tag LOCUS_05260 930 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 1236 1532 gene locus_tag LOCUS_05270 1236 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1781 1539 gene locus_tag LOCUS_05280 1781 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 1910 3292 gene locus_tag LOCUS_05290 1910 3292 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867839.1 protein_id gnl|my_center|LOCUS_05290 3316 4086 gene locus_tag LOCUS_05300 3316 4086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 4543 4154 gene locus_tag LOCUS_05310 4543 4154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 5372 4653 gene locus_tag LOCUS_05320 5372 4653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 5997 5476 gene locus_tag LOCUS_05330 5997 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05330 6384 6022 gene locus_tag LOCUS_05340 6384 6022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 7387 6545 gene locus_tag LOCUS_05350 7387 6545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 7658 9616 gene locus_tag LOCUS_05360 7658 9616 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867777.1 protein_id gnl|my_center|LOCUS_05360 9613 10179 gene locus_tag LOCUS_05370 9613 10179 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763573.1 protein_id gnl|my_center|LOCUS_05370 10212 10868 gene locus_tag LOCUS_05380 10212 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 10834 11475 gene locus_tag LOCUS_05390 10834 11475 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583757.1 protein_id gnl|my_center|LOCUS_05390 11429 12571 gene locus_tag LOCUS_05400 11429 12571 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762578.1 protein_id gnl|my_center|LOCUS_05400 12618 13010 gene locus_tag LOCUS_05410 12618 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 13056 13964 gene locus_tag LOCUS_05420 13056 13964 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867387.1 protein_id gnl|my_center|LOCUS_05420 13981 15282 gene locus_tag LOCUS_05430 13981 15282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 16611 15205 gene locus_tag LOCUS_05440 16611 15205 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_05440 16732 19182 gene locus_tag LOCUS_05450 16732 19182 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_05450 19318 20421 gene locus_tag LOCUS_05460 19318 20421 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762155.1 protein_id gnl|my_center|LOCUS_05460 21119 20418 gene locus_tag LOCUS_05470 21119 20418 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979262.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence020 677 1420 gene locus_tag LOCUS_05480 677 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 1395 2714 gene locus_tag LOCUS_05490 1395 2714 CDS product energy-coupling factor ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010715021.1 protein_id gnl|my_center|LOCUS_05490 2849 3424 gene locus_tag LOCUS_05500 2849 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 4691 3399 gene locus_tag LOCUS_05510 4691 3399 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121171.1 protein_id gnl|my_center|LOCUS_05510 4812 5636 gene locus_tag LOCUS_05520 4812 5636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 6023 5637 gene locus_tag LOCUS_05530 6023 5637 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879882.1 protein_id gnl|my_center|LOCUS_05530 6812 6027 gene locus_tag LOCUS_05540 6812 6027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 6865 6874 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7002 8327 gene locus_tag LOCUS_05550 7002 8327 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_05550 9713 8334 gene locus_tag LOCUS_05560 9713 8334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 10481 9780 gene locus_tag LOCUS_05570 10481 9780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 12084 10693 gene locus_tag LOCUS_05580 gene mgtE 12084 10693 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986205.1 protein_id gnl|my_center|LOCUS_05580 12240 13010 gene locus_tag LOCUS_05590 12240 13010 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250014.1 protein_id gnl|my_center|LOCUS_05590 13126 14283 gene locus_tag LOCUS_05600 13126 14283 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763330.1 protein_id gnl|my_center|LOCUS_05600 14604 14284 gene locus_tag LOCUS_05610 14604 14284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 14687 15964 gene locus_tag LOCUS_05620 14687 15964 CDS product hydroxymethylglutaryl-CoA reductase, degradative inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012966033.1 protein_id gnl|my_center|LOCUS_05620 19505 15987 gene locus_tag LOCUS_05630 19505 15987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 19594 20337 gene locus_tag LOCUS_05640 19594 20337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 >Feature sequence021 1286 504 gene locus_tag LOCUS_05650 1286 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 1954 1274 gene locus_tag LOCUS_05660 1954 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3086 1938 gene locus_tag LOCUS_05670 3086 1938 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251228.1 protein_id gnl|my_center|LOCUS_05670 3440 3093 gene locus_tag LOCUS_05680 3440 3093 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_05680 4929 3673 gene locus_tag LOCUS_05690 gene aspS 4929 3673 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_05690 5380 6087 gene locus_tag LOCUS_05700 5380 6087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 7333 6095 gene locus_tag LOCUS_05710 7333 6095 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868852.1 protein_id gnl|my_center|LOCUS_05710 7614 7477 gene locus_tag LOCUS_05720 7614 7477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 7613 8053 gene locus_tag LOCUS_05730 7613 8053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 8358 8152 gene locus_tag LOCUS_05740 8358 8152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 8550 9614 gene locus_tag LOCUS_05750 8550 9614 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979004.1 protein_id gnl|my_center|LOCUS_05750 12210 9712 gene locus_tag LOCUS_05760 12210 9712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 12392 13648 gene locus_tag LOCUS_05770 12392 13648 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228877.1 protein_id gnl|my_center|LOCUS_05770 13687 13923 gene locus_tag LOCUS_05780 13687 13923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 13979 14923 gene locus_tag LOCUS_05790 13979 14923 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250638.1 protein_id gnl|my_center|LOCUS_05790 16204 14906 gene locus_tag LOCUS_05800 16204 14906 CDS product sulfatase-like hydrolase/transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010901994.1 protein_id gnl|my_center|LOCUS_05800 16356 17750 gene locus_tag LOCUS_05810 16356 17750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 18139 17837 gene locus_tag LOCUS_05820 18139 17837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 18443 18132 gene locus_tag LOCUS_05830 18443 18132 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022869.1 protein_id gnl|my_center|LOCUS_05830 18859 18593 gene locus_tag LOCUS_05840 18859 18593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 18981 19343 gene locus_tag LOCUS_05850 18981 19343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 19506 19733 gene locus_tag LOCUS_05860 19506 19733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence022 3826 755 gene locus_tag LOCUS_05870 3826 755 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868870.1 protein_id gnl|my_center|LOCUS_05870 5673 4015 gene locus_tag LOCUS_05880 5673 4015 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250753.1 protein_id gnl|my_center|LOCUS_05880 7044 5698 gene locus_tag LOCUS_05890 7044 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 7229 7699 gene locus_tag LOCUS_05900 7229 7699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 8845 7706 gene locus_tag LOCUS_05910 8845 7706 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 protein_id gnl|my_center|LOCUS_05910 9830 8862 gene locus_tag LOCUS_05920 9830 8862 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868867.1 protein_id gnl|my_center|LOCUS_05920 9971 11020 gene locus_tag LOCUS_05930 9971 11020 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867675.1 protein_id gnl|my_center|LOCUS_05930 11163 12092 gene locus_tag LOCUS_05940 11163 12092 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979296.1 protein_id gnl|my_center|LOCUS_05940 13104 12076 gene locus_tag LOCUS_05950 13104 12076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 13716 13276 gene locus_tag LOCUS_05960 13716 13276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 14466 13876 gene locus_tag LOCUS_05970 14466 13876 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_05970 14612 15241 gene locus_tag LOCUS_05980 gene udg 14612 15241 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147255.1 protein_id gnl|my_center|LOCUS_05980 16940 15213 gene locus_tag LOCUS_05990 16940 15213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 17098 18921 gene locus_tag LOCUS_06000 17098 18921 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978165.1 protein_id gnl|my_center|LOCUS_06000 19009 19782 gene locus_tag LOCUS_06010 19009 19782 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240509.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence023 1628 795 gene locus_tag LOCUS_06020 1628 795 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763580.1 protein_id gnl|my_center|LOCUS_06020 1984 1646 gene locus_tag LOCUS_06030 1984 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 2052 2486 gene locus_tag LOCUS_06040 2052 2486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 2493 3257 gene locus_tag LOCUS_06050 2493 3257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5221 3254 gene locus_tag LOCUS_06060 5221 3254 CDS product molybdopterin biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762741.1 protein_id gnl|my_center|LOCUS_06060 5329 7491 gene locus_tag LOCUS_06070 5329 7491 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_06070 8452 7493 gene locus_tag LOCUS_06080 8452 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 11468 8454 gene locus_tag LOCUS_06090 11468 8454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 11664 13061 gene locus_tag LOCUS_06100 11664 13061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 13180 14751 gene locus_tag LOCUS_06110 13180 14751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 14794 16344 gene locus_tag LOCUS_06120 14794 16344 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762431.1 protein_id gnl|my_center|LOCUS_06120 18054 16339 gene locus_tag LOCUS_06130 gene speA 18054 16339 CDS product arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943173.1 protein_id gnl|my_center|LOCUS_06130 18136 18561 gene locus_tag LOCUS_06140 18136 18561 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979395.1 protein_id gnl|my_center|LOCUS_06140 18954 18562 gene locus_tag LOCUS_06150 18954 18562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence024 140 1360 gene locus_tag LOCUS_06160 140 1360 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979004.1 protein_id gnl|my_center|LOCUS_06160 1432 2043 gene locus_tag LOCUS_06170 1432 2043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 2036 2656 gene locus_tag LOCUS_06180 2036 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867709.1 protein_id gnl|my_center|LOCUS_06180 2932 2645 gene locus_tag LOCUS_06190 2932 2645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 3043 5040 gene locus_tag LOCUS_06200 gene rqcH 3043 5040 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650963.1 protein_id gnl|my_center|LOCUS_06200 5121 6344 gene locus_tag LOCUS_06210 5121 6344 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978176.1 protein_id gnl|my_center|LOCUS_06210 7996 6350 gene locus_tag LOCUS_06220 7996 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06220 8402 7998 gene locus_tag LOCUS_06230 8402 7998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06230 8022 8031 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9282 8386 gene locus_tag LOCUS_06240 9282 8386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978174.1 protein_id gnl|my_center|LOCUS_06240 9482 9811 gene locus_tag LOCUS_06250 9482 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 11186 9828 gene locus_tag LOCUS_06260 11186 9828 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978554.1 protein_id gnl|my_center|LOCUS_06260 11404 12294 gene locus_tag LOCUS_06270 11404 12294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 12383 12856 gene locus_tag LOCUS_06280 12383 12856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978183.1 protein_id gnl|my_center|LOCUS_06280 13270 12869 gene locus_tag LOCUS_06290 13270 12869 CDS product DUF2153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846228.1 protein_id gnl|my_center|LOCUS_06290 13849 13460 gene locus_tag LOCUS_06300 13849 13460 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978185.1 protein_id gnl|my_center|LOCUS_06300 15219 13852 gene locus_tag LOCUS_06310 gene glmM 15219 13852 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978186.1 protein_id gnl|my_center|LOCUS_06310 15724 15347 gene locus_tag LOCUS_06320 15724 15347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 15827 16153 gene locus_tag LOCUS_06330 15827 16153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 16199 17011 gene locus_tag LOCUS_06340 16199 17011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 >Feature sequence025 <1 1948 gene locus_tag LOCUS_06350 <1 1948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846772.1:DEAD/DEAH box helicase 2812 2033 gene locus_tag LOCUS_06360 2812 2033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 3186 2905 gene locus_tag LOCUS_06370 3186 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 3356 3634 gene locus_tag LOCUS_06380 3356 3634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4377 3646 gene locus_tag LOCUS_06390 4377 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5467 4388 gene locus_tag LOCUS_06400 5467 4388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 5598 7229 gene locus_tag LOCUS_06410 5598 7229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 7307 7642 gene locus_tag LOCUS_06420 7307 7642 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 protein_id gnl|my_center|LOCUS_06420 7771 8964 gene locus_tag LOCUS_06430 7771 8964 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053767.1 protein_id gnl|my_center|LOCUS_06430 9650 8985 gene locus_tag LOCUS_06440 9650 8985 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974832.1 protein_id gnl|my_center|LOCUS_06440 10289 9765 gene locus_tag LOCUS_06450 10289 9765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 11197 10358 gene locus_tag LOCUS_06460 11197 10358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 11465 11190 gene locus_tag LOCUS_06470 11465 11190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 12637 11447 gene locus_tag LOCUS_06480 12637 11447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 13175 12657 gene locus_tag LOCUS_06490 13175 12657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 13639 13205 gene locus_tag LOCUS_06500 13639 13205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 14517 13747 gene locus_tag LOCUS_06510 14517 13747 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249754.1 protein_id gnl|my_center|LOCUS_06510 14620 15627 gene locus_tag LOCUS_06520 14620 15627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 15620 16504 gene locus_tag LOCUS_06530 15620 16504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 16501 16890 gene locus_tag LOCUS_06540 16501 16890 CDS product CopG family ribbon-helix-helix protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763557.1 protein_id gnl|my_center|LOCUS_06540 >Feature sequence026 883 2643 gene locus_tag LOCUS_06550 gene oadA 883 2643 CDS product sodium-extruding oxaloacetate decarboxylase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249941.1 protein_id gnl|my_center|LOCUS_06550 2698 4149 gene locus_tag LOCUS_06560 2698 4149 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978525.1 protein_id gnl|my_center|LOCUS_06560 5426 4152 gene locus_tag LOCUS_06570 5426 4152 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101419.1 protein_id gnl|my_center|LOCUS_06570 5638 6162 gene locus_tag LOCUS_06580 5638 6162 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979914.1 protein_id gnl|my_center|LOCUS_06580 6217 7005 gene locus_tag LOCUS_06590 6217 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 7102 7974 gene locus_tag LOCUS_06600 7102 7974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8371 7949 gene locus_tag LOCUS_06610 8371 7949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 8592 9518 gene locus_tag LOCUS_06620 8592 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 9993 9529 gene locus_tag LOCUS_06630 9993 9529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06630 11088 9997 gene locus_tag LOCUS_06640 11088 9997 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868007.1 protein_id gnl|my_center|LOCUS_06640 11969 11118 gene locus_tag LOCUS_06650 11969 11118 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146582.1 protein_id gnl|my_center|LOCUS_06650 13421 11988 gene locus_tag LOCUS_06660 13421 11988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 15007 13511 gene locus_tag LOCUS_06670 gene metG 15007 13511 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930950.1 protein_id gnl|my_center|LOCUS_06670 16612 15092 gene locus_tag LOCUS_06680 16612 15092 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979518.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence027 1146 1796 gene locus_tag LOCUS_06690 1146 1796 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 1910 2656 gene locus_tag LOCUS_06700 1910 2656 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250348.1 protein_id gnl|my_center|LOCUS_06700 2729 3970 gene locus_tag LOCUS_06710 2729 3970 CDS product BMP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867576.1 protein_id gnl|my_center|LOCUS_06710 4084 5592 gene locus_tag LOCUS_06720 4084 5592 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867577.1 protein_id gnl|my_center|LOCUS_06720 5585 6673 gene locus_tag LOCUS_06730 5585 6673 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867578.1 protein_id gnl|my_center|LOCUS_06730 6670 7593 gene locus_tag LOCUS_06740 6670 7593 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867579.1 protein_id gnl|my_center|LOCUS_06740 7654 8514 gene locus_tag LOCUS_06750 7654 8514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 9519 8518 gene locus_tag LOCUS_06760 9519 8518 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763671.1 protein_id gnl|my_center|LOCUS_06760 9619 10341 gene locus_tag LOCUS_06770 9619 10341 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763301.1 protein_id gnl|my_center|LOCUS_06770 10435 11316 gene locus_tag LOCUS_06780 10435 11316 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869707.1 protein_id gnl|my_center|LOCUS_06780 11439 11768 gene locus_tag LOCUS_06790 11439 11768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 11746 13059 gene locus_tag LOCUS_06800 11746 13059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 13975 13073 gene locus_tag LOCUS_06810 13975 13073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 14079 14930 gene locus_tag LOCUS_06820 14079 14930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 14936 15979 gene locus_tag LOCUS_06830 14936 15979 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_06830 16004 16771 gene locus_tag LOCUS_06840 16004 16771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 >Feature sequence028 1022 195 gene locus_tag LOCUS_06850 gene rsmA 1022 195 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762159.1 protein_id gnl|my_center|LOCUS_06850 1690 1049 gene locus_tag LOCUS_06860 1690 1049 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978430.1 protein_id gnl|my_center|LOCUS_06860 2164 1799 gene locus_tag LOCUS_06870 2164 1799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 2485 2186 gene locus_tag LOCUS_06880 2485 2186 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978432.1 protein_id gnl|my_center|LOCUS_06880 3859 2555 gene locus_tag LOCUS_06890 3859 2555 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240295.1 protein_id gnl|my_center|LOCUS_06890 4415 3837 gene locus_tag LOCUS_06900 4415 3837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 5737 4412 gene locus_tag LOCUS_06910 5737 4412 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979319.1 protein_id gnl|my_center|LOCUS_06910 6416 5757 gene locus_tag LOCUS_06920 6416 5757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 6692 7735 gene locus_tag LOCUS_06930 gene trm14 6692 7735 CDS product tRNA (guanine(6)-N2)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064539.1 protein_id gnl|my_center|LOCUS_06930 7803 8327 gene locus_tag LOCUS_06940 7803 8327 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 protein_id gnl|my_center|LOCUS_06940 8389 9414 gene locus_tag LOCUS_06950 gene dph2 8389 9414 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980347.1 protein_id gnl|my_center|LOCUS_06950 10281 9421 gene locus_tag LOCUS_06960 10281 9421 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 protein_id gnl|my_center|LOCUS_06960 10320 10958 gene locus_tag LOCUS_06970 10320 10958 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868858.1 protein_id gnl|my_center|LOCUS_06970 10964 11533 gene locus_tag LOCUS_06980 10964 11533 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_06980 11538 12170 gene locus_tag LOCUS_06990 11538 12170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 12199 12474 gene locus_tag LOCUS_07000 12199 12474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 12548 12853 gene locus_tag LOCUS_07010 12548 12853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 12876 13223 gene locus_tag LOCUS_07020 12876 13223 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980344.1 protein_id gnl|my_center|LOCUS_07020 13220 13405 gene locus_tag LOCUS_07030 13220 13405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 13522 14229 gene locus_tag LOCUS_07040 13522 14229 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249490.1 protein_id gnl|my_center|LOCUS_07040 14222 15337 gene locus_tag LOCUS_07050 gene priS 14222 15337 CDS product DNA primase small subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978939.1 protein_id gnl|my_center|LOCUS_07050 15330 15830 gene locus_tag LOCUS_07060 15330 15830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 16199 15813 gene locus_tag LOCUS_07070 16199 15813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence029 154 1584 gene locus_tag LOCUS_07080 154 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1693 2436 gene locus_tag LOCUS_07090 1693 2436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2512 3690 gene locus_tag LOCUS_07100 2512 3690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 3743 3955 gene locus_tag LOCUS_07110 3743 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 3918 4517 gene locus_tag LOCUS_07120 3918 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 3938 3947 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4586 5488 gene locus_tag LOCUS_07130 4586 5488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 8660 5493 gene locus_tag LOCUS_07140 8660 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 8826 10598 gene locus_tag LOCUS_07150 8826 10598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 10598 11986 gene locus_tag LOCUS_07160 10598 11986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 11986 12495 gene locus_tag LOCUS_07170 11986 12495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 12492 13640 gene locus_tag LOCUS_07180 12492 13640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 13637 14026 gene locus_tag LOCUS_07190 13637 14026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 14023 15099 gene locus_tag LOCUS_07200 14023 15099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 15189 15596 gene locus_tag LOCUS_07210 15189 15596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 >Feature sequence030 1508 507 gene locus_tag LOCUS_07220 1508 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 3153 1576 gene locus_tag LOCUS_07230 3153 1576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3580 3813 gene locus_tag LOCUS_07240 3580 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 6055 3845 gene locus_tag LOCUS_07250 6055 3845 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846316.1 protein_id gnl|my_center|LOCUS_07250 7145 6135 gene locus_tag LOCUS_07260 7145 6135 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868629.1 protein_id gnl|my_center|LOCUS_07260 7416 7111 gene locus_tag LOCUS_07270 7416 7111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 7774 7409 gene locus_tag LOCUS_07280 7774 7409 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496690.1 protein_id gnl|my_center|LOCUS_07280 8016 7774 gene locus_tag LOCUS_07290 8016 7774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 8551 8006 gene locus_tag LOCUS_07300 8551 8006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 8837 8574 gene locus_tag LOCUS_07310 8837 8574 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978414.1 protein_id gnl|my_center|LOCUS_07310 9720 8851 gene locus_tag LOCUS_07320 gene rrp42 9720 8851 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978415.1 protein_id gnl|my_center|LOCUS_07320 10453 9725 gene locus_tag LOCUS_07330 gene rrp41 10453 9725 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846320.1 protein_id gnl|my_center|LOCUS_07330 11175 10456 gene locus_tag LOCUS_07340 gene rrp4 11175 10456 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978417.1 protein_id gnl|my_center|LOCUS_07340 11894 11199 gene locus_tag LOCUS_07350 11894 11199 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978418.1 protein_id gnl|my_center|LOCUS_07350 12744 11986 gene locus_tag LOCUS_07360 gene psmA 12744 11986 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846326.1 protein_id gnl|my_center|LOCUS_07360 13042 13051 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 13127 13294 gene locus_tag LOCUS_07370 13127 13294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 13257 13562 gene locus_tag LOCUS_07380 13257 13562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 14140 13649 gene locus_tag LOCUS_07390 14140 13649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 14754 14137 gene locus_tag LOCUS_07400 14754 14137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 15207 14758 gene locus_tag LOCUS_07410 15207 14758 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869709.1 protein_id gnl|my_center|LOCUS_07410 >Feature sequence031 193 888 gene locus_tag LOCUS_07420 193 888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 894 1355 gene locus_tag LOCUS_07430 894 1355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 2077 1352 gene locus_tag LOCUS_07440 2077 1352 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_07440 3092 2094 gene locus_tag LOCUS_07450 3092 2094 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_07450 3174 4736 gene locus_tag LOCUS_07460 3174 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 5718 4744 gene locus_tag LOCUS_07470 5718 4744 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870829.1 protein_id gnl|my_center|LOCUS_07470 6959 5715 gene locus_tag LOCUS_07480 6959 5715 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762514.1 protein_id gnl|my_center|LOCUS_07480 7620 6961 gene locus_tag LOCUS_07490 7620 6961 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880535.1 protein_id gnl|my_center|LOCUS_07490 9201 7642 gene locus_tag LOCUS_07500 9201 7642 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763291.1 protein_id gnl|my_center|LOCUS_07500 11366 9270 gene locus_tag LOCUS_07510 11366 9270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 12927 11431 gene locus_tag LOCUS_07520 12927 11431 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868688.1 protein_id gnl|my_center|LOCUS_07520 14975 13068 gene locus_tag LOCUS_07530 14975 13068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 15079 15279 gene locus_tag LOCUS_07540 15079 15279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 >Feature sequence032 803 387 gene locus_tag LOCUS_07550 803 387 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_07550 1533 874 gene locus_tag LOCUS_07560 1533 874 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496578.1 protein_id gnl|my_center|LOCUS_07560 1646 2200 gene locus_tag LOCUS_07570 1646 2200 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978534.1 protein_id gnl|my_center|LOCUS_07570 2275 2790 gene locus_tag LOCUS_07580 2275 2790 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_07580 2863 3738 gene locus_tag LOCUS_07590 gene udp 2863 3738 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_07590 3745 4689 gene locus_tag LOCUS_07600 3745 4689 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978553.1 protein_id gnl|my_center|LOCUS_07600 4679 5428 gene locus_tag LOCUS_07610 4679 5428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 7714 5432 gene locus_tag LOCUS_07620 7714 5432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 7835 8164 gene locus_tag LOCUS_07630 7835 8164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762039.1 protein_id gnl|my_center|LOCUS_07630 8651 8172 gene locus_tag LOCUS_07640 8651 8172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 8788 9801 gene locus_tag LOCUS_07650 8788 9801 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020209.1 protein_id gnl|my_center|LOCUS_07650 9807 10778 gene locus_tag LOCUS_07660 9807 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 10843 10852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10868 12010 gene locus_tag LOCUS_07670 gene sucC 10868 12010 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762775.1 protein_id gnl|my_center|LOCUS_07670 12015 12902 gene locus_tag LOCUS_07680 gene sucD 12015 12902 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762776.1 protein_id gnl|my_center|LOCUS_07680 12968 13390 gene locus_tag LOCUS_07690 12968 13390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 13485 14018 gene locus_tag LOCUS_07700 gene ppa 13485 14018 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846890.1 protein_id gnl|my_center|LOCUS_07700 14024 14710 gene locus_tag LOCUS_07710 14024 14710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence033 1599 349 gene locus_tag LOCUS_07720 1599 349 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209476615.1 protein_id gnl|my_center|LOCUS_07720 3054 1606 gene locus_tag LOCUS_07730 3054 1606 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250344.1 protein_id gnl|my_center|LOCUS_07730 3656 3186 gene locus_tag LOCUS_07740 3656 3186 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680818.1 protein_id gnl|my_center|LOCUS_07740 4037 5053 gene locus_tag LOCUS_07750 gene cysK 4037 5053 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393208.1 protein_id gnl|my_center|LOCUS_07750 5587 5072 gene locus_tag LOCUS_07760 5587 5072 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249721.1 protein_id gnl|my_center|LOCUS_07760 9821 5574 gene locus_tag LOCUS_07770 9821 5574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 11832 9955 gene locus_tag LOCUS_07780 11832 9955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 12034 12981 gene locus_tag LOCUS_07790 12034 12981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 13074 14786 gene locus_tag LOCUS_07800 13074 14786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 >Feature sequence034 675 394 gene locus_tag LOCUS_07810 675 394 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867436.1 protein_id gnl|my_center|LOCUS_07810 1142 657 gene locus_tag LOCUS_07820 1142 657 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867435.1 protein_id gnl|my_center|LOCUS_07820 2616 1132 gene locus_tag LOCUS_07830 2616 1132 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146532.1 protein_id gnl|my_center|LOCUS_07830 2887 3927 gene locus_tag LOCUS_07840 2887 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 4680 3964 gene locus_tag LOCUS_07850 4680 3964 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846565.1 protein_id gnl|my_center|LOCUS_07850 5134 4769 gene locus_tag LOCUS_07860 5134 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 5270 6313 gene locus_tag LOCUS_07870 5270 6313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 6319 7239 gene locus_tag LOCUS_07880 6319 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 7242 8216 gene locus_tag LOCUS_07890 7242 8216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 9052 8213 gene locus_tag LOCUS_07900 9052 8213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 9865 9056 gene locus_tag LOCUS_07910 9865 9056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 10745 9831 gene locus_tag LOCUS_07920 10745 9831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 11810 10764 gene locus_tag LOCUS_07930 11810 10764 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_07930 12674 11829 gene locus_tag LOCUS_07940 12674 11829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 12763 13647 gene locus_tag LOCUS_07950 12763 13647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 13742 14530 gene locus_tag LOCUS_07960 gene bacA 13742 14530 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014833310.1 protein_id gnl|my_center|LOCUS_07960 >Feature sequence035 29 1156 gene locus_tag LOCUS_07970 29 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 1455 1255 gene locus_tag LOCUS_07980 1455 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 1682 2857 gene locus_tag LOCUS_07990 1682 2857 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_07990 2888 4456 gene locus_tag LOCUS_08000 2888 4456 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978571.1 protein_id gnl|my_center|LOCUS_08000 5039 4458 gene locus_tag LOCUS_08010 5039 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 5795 5049 gene locus_tag LOCUS_08020 5795 5049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 5905 7311 gene locus_tag LOCUS_08030 gene glmM 5905 7311 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250728.1 protein_id gnl|my_center|LOCUS_08030 7516 7316 gene locus_tag LOCUS_08040 7516 7316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 9083 7509 gene locus_tag LOCUS_08050 9083 7509 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868194.1 protein_id gnl|my_center|LOCUS_08050 9216 9776 gene locus_tag LOCUS_08060 9216 9776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 9865 10398 gene locus_tag LOCUS_08070 9865 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 10429 10920 gene locus_tag LOCUS_08080 10429 10920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 11020 12546 gene locus_tag LOCUS_08090 11020 12546 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146577.1 protein_id gnl|my_center|LOCUS_08090 >Feature sequence036 1639 2217 gene locus_tag LOCUS_08100 1639 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 2205 2822 gene locus_tag LOCUS_08110 2205 2822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 3225 2878 gene locus_tag LOCUS_08120 3225 2878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 3970 3350 gene locus_tag LOCUS_08130 3970 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 5323 3986 gene locus_tag LOCUS_08140 5323 3986 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250885.1 protein_id gnl|my_center|LOCUS_08140 5474 6637 gene locus_tag LOCUS_08150 5474 6637 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583802.1 protein_id gnl|my_center|LOCUS_08150 7459 6641 gene locus_tag LOCUS_08160 7459 6641 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082270.1 protein_id gnl|my_center|LOCUS_08160 7538 8398 gene locus_tag LOCUS_08170 7538 8398 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763343.1 protein_id gnl|my_center|LOCUS_08170 9302 8367 gene locus_tag LOCUS_08180 9302 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867329.1 protein_id gnl|my_center|LOCUS_08180 9887 9363 gene locus_tag LOCUS_08190 9887 9363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 10302 9904 gene locus_tag LOCUS_08200 10302 9904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 10663 10289 gene locus_tag LOCUS_08210 10663 10289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 10978 11181 gene locus_tag LOCUS_08220 10978 11181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 11178 11627 gene locus_tag LOCUS_08230 11178 11627 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 protein_id gnl|my_center|LOCUS_08230 11679 12245 gene locus_tag LOCUS_08240 11679 12245 CDS product ADP-ribose-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880613.1 protein_id gnl|my_center|LOCUS_08240 12226 12492 gene locus_tag LOCUS_08250 12226 12492 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147008.1 protein_id gnl|my_center|LOCUS_08250 13202 12516 gene locus_tag LOCUS_08260 13202 12516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 <14141 13252 gene locus_tag LOCUS_08270 <14141 13252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979004.1:RNA-guided endonuclease TnpB family protein >Feature sequence037 181 1014 gene locus_tag LOCUS_08280 181 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 1171 5817 gene locus_tag LOCUS_08290 1171 5817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 5951 8155 gene locus_tag LOCUS_08300 5951 8155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 8252 8806 gene locus_tag LOCUS_08310 8252 8806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 8834 10861 gene locus_tag LOCUS_08320 8834 10861 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877664.1 protein_id gnl|my_center|LOCUS_08320 10926 12707 gene locus_tag LOCUS_08330 10926 12707 CDS product cation-translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011014176.1 protein_id gnl|my_center|LOCUS_08330 12970 13680 gene locus_tag LOCUS_08340 12970 13680 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978969.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence038 646 506 gene locus_tag LOCUS_08350 646 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 666 1673 gene locus_tag LOCUS_08360 666 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 2680 1670 gene locus_tag LOCUS_08370 2680 1670 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053875.1 protein_id gnl|my_center|LOCUS_08370 2837 3088 gene locus_tag LOCUS_08380 2837 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 3311 4882 gene locus_tag LOCUS_08390 3311 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 5192 4845 gene locus_tag LOCUS_08400 5192 4845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 5311 5577 gene locus_tag LOCUS_08410 5311 5577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 5574 5987 gene locus_tag LOCUS_08420 5574 5987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 5996 6421 gene locus_tag LOCUS_08430 5996 6421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 6378 7127 gene locus_tag LOCUS_08440 6378 7127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 7521 7120 gene locus_tag LOCUS_08450 7521 7120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 8176 7550 gene locus_tag LOCUS_08460 8176 7550 CDS product peptidase M50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846192.1 protein_id gnl|my_center|LOCUS_08460 8275 8829 gene locus_tag LOCUS_08470 8275 8829 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846254.1 protein_id gnl|my_center|LOCUS_08470 8898 9518 gene locus_tag LOCUS_08480 8898 9518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 9520 10440 gene locus_tag LOCUS_08490 9520 10440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 11823 10456 gene locus_tag LOCUS_08500 11823 10456 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065661.1 protein_id gnl|my_center|LOCUS_08500 13219 11825 gene locus_tag LOCUS_08510 13219 11825 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867352.1 protein_id gnl|my_center|LOCUS_08510 13387 13608 gene locus_tag LOCUS_08520 13387 13608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence039 1169 2581 gene locus_tag LOCUS_08530 gene sufB 1169 2581 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979219.1 protein_id gnl|my_center|LOCUS_08530 2584 3705 gene locus_tag LOCUS_08540 2584 3705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5034 3685 gene locus_tag LOCUS_08550 5034 3685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 5473 5129 gene locus_tag LOCUS_08560 5473 5129 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879110.1 protein_id gnl|my_center|LOCUS_08560 5862 5470 gene locus_tag LOCUS_08570 5862 5470 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978646.1 protein_id gnl|my_center|LOCUS_08570 5936 6892 gene locus_tag LOCUS_08580 5936 6892 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762659.1 protein_id gnl|my_center|LOCUS_08580 6889 7566 gene locus_tag LOCUS_08590 6889 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 8335 7583 gene locus_tag LOCUS_08600 8335 7583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 8451 9053 gene locus_tag LOCUS_08610 8451 9053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 9050 10495 gene locus_tag LOCUS_08620 9050 10495 CDS product UxaA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898047.1 protein_id gnl|my_center|LOCUS_08620 10499 12451 gene locus_tag LOCUS_08630 10499 12451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 12992 12492 gene locus_tag LOCUS_08640 12992 12492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 <13721 13011 gene locus_tag LOCUS_08650 <13721 13011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240510.1:ATP-binding protein >Feature sequence040 <1 524 gene locus_tag LOCUS_08660 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978287.1:tRNA guanosine(15) transglycosylase TgtA 1295 528 gene locus_tag LOCUS_08670 1295 528 CDS product PAC2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978288.1 protein_id gnl|my_center|LOCUS_08670 1770 1288 gene locus_tag LOCUS_08680 1770 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 2980 1787 gene locus_tag LOCUS_08690 2980 1787 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846270.1 protein_id gnl|my_center|LOCUS_08690 3077 3607 gene locus_tag LOCUS_08700 3077 3607 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978291.1 protein_id gnl|my_center|LOCUS_08700 3629 4738 gene locus_tag LOCUS_08710 gene hflX 3629 4738 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978292.1 protein_id gnl|my_center|LOCUS_08710 4781 5353 gene locus_tag LOCUS_08720 4781 5353 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_08720 5394 5891 gene locus_tag LOCUS_08730 5394 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 5888 6865 gene locus_tag LOCUS_08740 5888 6865 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763402.1 protein_id gnl|my_center|LOCUS_08740 6880 7314 gene locus_tag LOCUS_08750 6880 7314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 8254 7292 gene locus_tag LOCUS_08760 gene akrN 8254 7292 CDS product aldo/keto reductase AkrN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245422.1 protein_id gnl|my_center|LOCUS_08760 8381 9382 gene locus_tag LOCUS_08770 gene trxB 8381 9382 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846363.1 protein_id gnl|my_center|LOCUS_08770 10792 9398 gene locus_tag LOCUS_08780 10792 9398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 11084 11010 gene locus_tag LOCUS_t00080 11084 11010 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 12419 11160 gene locus_tag LOCUS_08790 gene ahcY 12419 11160 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978302.1 protein_id gnl|my_center|LOCUS_08790 12528 13040 gene locus_tag LOCUS_08800 12528 13040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 <13684 13185 gene locus_tag LOCUS_08810 <13684 13185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763240.1:adenylyl-sulfate kinase >Feature sequence041 690 325 gene locus_tag LOCUS_08820 690 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 885 697 gene locus_tag LOCUS_08830 885 697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 1712 900 gene locus_tag LOCUS_08840 1712 900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979269.1 protein_id gnl|my_center|LOCUS_08840 2105 1782 gene locus_tag LOCUS_08850 2105 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2284 2580 gene locus_tag LOCUS_08860 2284 2580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 3505 2582 gene locus_tag LOCUS_08870 3505 2582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 4467 3547 gene locus_tag LOCUS_08880 4467 3547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 4832 4470 gene locus_tag LOCUS_08890 4832 4470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08890 6953 5037 gene locus_tag LOCUS_08900 gene gatE 6953 5037 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869511.1 protein_id gnl|my_center|LOCUS_08900 8293 6950 gene locus_tag LOCUS_08910 gene gatD 8293 6950 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_08910 8545 10309 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtagaaaacaaataaaactgaaag 10730 11035 gene locus_tag LOCUS_08920 10730 11035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 13128 11050 gene locus_tag LOCUS_08930 13128 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 >Feature sequence042 552 388 gene locus_tag LOCUS_08940 552 388 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978389.1 protein_id gnl|my_center|LOCUS_08940 1133 570 gene locus_tag LOCUS_08950 1133 570 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_08950 1893 1135 gene locus_tag LOCUS_08960 1893 1135 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869968.1 protein_id gnl|my_center|LOCUS_08960 2345 1893 gene locus_tag LOCUS_08970 gene rplX 2345 1893 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867452.1 protein_id gnl|my_center|LOCUS_08970 2778 2365 gene locus_tag LOCUS_08980 2778 2365 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846308.1 protein_id gnl|my_center|LOCUS_08980 3125 2778 gene locus_tag LOCUS_08990 3125 2778 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867454.1 protein_id gnl|my_center|LOCUS_08990 3413 3132 gene locus_tag LOCUS_09000 3413 3132 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875653.1 protein_id gnl|my_center|LOCUS_09000 3646 3443 gene locus_tag LOCUS_09010 gene rpmC 3646 3443 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258239.1 protein_id gnl|my_center|LOCUS_09010 4344 3664 gene locus_tag LOCUS_09020 4344 3664 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978396.1 protein_id gnl|my_center|LOCUS_09020 4820 4341 gene locus_tag LOCUS_09030 4820 4341 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978397.1 protein_id gnl|my_center|LOCUS_09030 5257 4835 gene locus_tag LOCUS_09040 5257 4835 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978398.1 protein_id gnl|my_center|LOCUS_09040 7277 5409 gene locus_tag LOCUS_09050 7277 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 8190 7243 gene locus_tag LOCUS_09060 8190 7243 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 protein_id gnl|my_center|LOCUS_09060 8261 8611 gene locus_tag LOCUS_09070 8261 8611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 9327 8608 gene locus_tag LOCUS_09080 9327 8608 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978399.1 protein_id gnl|my_center|LOCUS_09080 9623 9348 gene locus_tag LOCUS_09090 9623 9348 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_09090 10437 9616 gene locus_tag LOCUS_09100 gene rpl4p 10437 9616 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846313.1 protein_id gnl|my_center|LOCUS_09100 11640 10453 gene locus_tag LOCUS_09110 11640 10453 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978402.1 protein_id gnl|my_center|LOCUS_09110 12525 11695 gene locus_tag LOCUS_09120 12525 11695 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250494.1 protein_id gnl|my_center|LOCUS_09120 12666 12538 gene locus_tag LOCUS_09130 12666 12538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 <13507 12792 gene locus_tag LOCUS_09140 <13507 12792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978136.1:DNA import protein CedB >Feature sequence043 66 704 gene locus_tag LOCUS_09150 66 704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1059 643 gene locus_tag LOCUS_09160 1059 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 2193 1201 gene locus_tag LOCUS_09170 2193 1201 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867665.1 protein_id gnl|my_center|LOCUS_09170 2324 3406 gene locus_tag LOCUS_09180 2324 3406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 3476 4327 gene locus_tag LOCUS_09190 3476 4327 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846190.1 protein_id gnl|my_center|LOCUS_09190 4506 5180 gene locus_tag LOCUS_09200 4506 5180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 5770 5195 gene locus_tag LOCUS_09210 5770 5195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 8220 5815 gene locus_tag LOCUS_09220 8220 5815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 9261 8317 gene locus_tag LOCUS_09230 gene argF 9261 8317 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_09230 10427 9264 gene locus_tag LOCUS_09240 10427 9264 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868444.1 protein_id gnl|my_center|LOCUS_09240 11926 10424 gene locus_tag LOCUS_09250 11926 10424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 12073 13149 gene locus_tag LOCUS_09260 gene argF 12073 13149 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393492.1 protein_id gnl|my_center|LOCUS_09260 >Feature sequence044 353 703 gene locus_tag LOCUS_09270 353 703 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 711 1247 gene locus_tag LOCUS_09280 711 1247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2612 1545 gene locus_tag LOCUS_09290 2612 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 4179 2626 gene locus_tag LOCUS_09300 4179 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 4800 5435 gene locus_tag LOCUS_09310 4800 5435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 6980 6753 gene locus_tag LOCUS_09320 6980 6753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 7224 7048 gene locus_tag LOCUS_09330 7224 7048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7871 7635 gene locus_tag LOCUS_09340 7871 7635 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048105191.1 protein_id gnl|my_center|LOCUS_09340 8100 7864 gene locus_tag LOCUS_09350 8100 7864 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024015.1 protein_id gnl|my_center|LOCUS_09350 8919 8737 gene locus_tag LOCUS_09360 8919 8737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 9126 9049 gene locus_tag LOCUS_t00090 9126 9049 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9881 9291 gene locus_tag LOCUS_09370 9881 9291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 9972 11090 gene locus_tag LOCUS_09380 9972 11090 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249922.1 protein_id gnl|my_center|LOCUS_09380 11416 11108 gene locus_tag LOCUS_09390 11416 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 <12699 11496 gene locus_tag LOCUS_09400 <12699 11496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146581.1:TrpB-like pyridoxal phosphate-dependent enzyme >Feature sequence045 3072 2857 gene locus_tag LOCUS_09410 3072 2857 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_09410 4498 3158 gene locus_tag LOCUS_09420 4498 3158 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 protein_id gnl|my_center|LOCUS_09420 5934 4495 gene locus_tag LOCUS_09430 5934 4495 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249650.1 protein_id gnl|my_center|LOCUS_09430 7172 6024 gene locus_tag LOCUS_09440 gene sat 7172 6024 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_09440 7438 7208 gene locus_tag LOCUS_09450 7438 7208 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_09450 7582 8130 gene locus_tag LOCUS_09460 gene cysC 7582 8130 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763240.1 protein_id gnl|my_center|LOCUS_09460 8159 9502 gene locus_tag LOCUS_09470 8159 9502 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_09470 9953 9528 gene locus_tag LOCUS_09480 9953 9528 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140723.1 protein_id gnl|my_center|LOCUS_09480 10231 9950 gene locus_tag LOCUS_09490 10231 9950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 10721 10266 gene locus_tag LOCUS_09500 10721 10266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09500 10968 10723 gene locus_tag LOCUS_09510 10968 10723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 12165 11035 gene locus_tag LOCUS_09520 12165 11035 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763625.1 protein_id gnl|my_center|LOCUS_09520 >Feature sequence046 137 1501 gene locus_tag LOCUS_09530 137 1501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 2386 1508 gene locus_tag LOCUS_09540 2386 1508 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878600.1 protein_id gnl|my_center|LOCUS_09540 2576 3346 gene locus_tag LOCUS_09550 2576 3346 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024087.1 protein_id gnl|my_center|LOCUS_09550 3484 3891 gene locus_tag LOCUS_09560 3484 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3899 4297 gene locus_tag LOCUS_09570 3899 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 4347 4559 gene locus_tag LOCUS_09580 4347 4559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 5804 7024 gene locus_tag LOCUS_09590 5804 7024 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868011.1 protein_id gnl|my_center|LOCUS_09590 8124 7129 gene locus_tag LOCUS_09600 8124 7129 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867610.1 protein_id gnl|my_center|LOCUS_09600 8707 8228 gene locus_tag LOCUS_09610 8707 8228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 9509 8901 gene locus_tag LOCUS_09620 9509 8901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 9784 10719 gene locus_tag LOCUS_09630 9784 10719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence047 <1 835 gene locus_tag LOCUS_09640 <1 835 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867862.1:flap endonuclease-1 1504 836 gene locus_tag LOCUS_09650 1504 836 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869667.1 protein_id gnl|my_center|LOCUS_09650 1605 2075 gene locus_tag LOCUS_09660 1605 2075 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251243.1 protein_id gnl|my_center|LOCUS_09660 3032 2022 gene locus_tag LOCUS_09670 gene trm5b 3032 2022 CDS product tRNA (guanine(37)-N1)-methyltransferase Trm5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867861.1 protein_id gnl|my_center|LOCUS_09670 3120 3935 gene locus_tag LOCUS_09680 3120 3935 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868033.1 protein_id gnl|my_center|LOCUS_09680 3946 4449 gene locus_tag LOCUS_09690 3946 4449 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249292.1 protein_id gnl|my_center|LOCUS_09690 5569 4427 gene locus_tag LOCUS_09700 5569 4427 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762419.1 protein_id gnl|my_center|LOCUS_09700 6210 5566 gene locus_tag LOCUS_09710 6210 5566 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025306754.1 protein_id gnl|my_center|LOCUS_09710 6329 6649 gene locus_tag LOCUS_09720 6329 6649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846516.1 protein_id gnl|my_center|LOCUS_09720 6694 7566 gene locus_tag LOCUS_09730 6694 7566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 7668 8609 gene locus_tag LOCUS_09740 7668 8609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 9280 8615 gene locus_tag LOCUS_09750 9280 8615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 10508 9273 gene locus_tag LOCUS_09760 gene coaBC 10508 9273 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978206.1 protein_id gnl|my_center|LOCUS_09760 10638 11213 gene locus_tag LOCUS_09770 gene rimI 10638 11213 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978207.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence048 937 2172 gene locus_tag LOCUS_09780 937 2172 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979245.1 protein_id gnl|my_center|LOCUS_09780 3662 2262 gene locus_tag LOCUS_09790 3662 2262 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004455014.1 protein_id gnl|my_center|LOCUS_09790 3810 5627 gene locus_tag LOCUS_09800 gene ade 3810 5627 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877751.1 protein_id gnl|my_center|LOCUS_09800 6169 5624 gene locus_tag LOCUS_09810 6169 5624 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978535.1 protein_id gnl|my_center|LOCUS_09810 6830 6177 gene locus_tag LOCUS_09820 6830 6177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 8119 6845 gene locus_tag LOCUS_09830 8119 6845 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986138.1 protein_id gnl|my_center|LOCUS_09830 9259 8366 gene locus_tag LOCUS_09840 9259 8366 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963688.1 protein_id gnl|my_center|LOCUS_09840 9408 10487 gene locus_tag LOCUS_09850 9408 10487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09850 11216 10434 gene locus_tag LOCUS_09860 11216 10434 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762992.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence049 <1 1631 gene locus_tag LOCUS_09870 <1 1631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259005.1:transcriptional regulator 1747 1652 gene locus_tag LOCUS_t00100 1747 1652 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2004 2960 gene locus_tag LOCUS_09880 2004 2960 CDS product pyridoxal-phosphate dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250429.1 protein_id gnl|my_center|LOCUS_09880 4049 2982 gene locus_tag LOCUS_09890 4049 2982 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867359.1 protein_id gnl|my_center|LOCUS_09890 4162 4887 gene locus_tag LOCUS_09900 4162 4887 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249896.1 protein_id gnl|my_center|LOCUS_09900 5944 4880 gene locus_tag LOCUS_09910 5944 4880 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980153.1 protein_id gnl|my_center|LOCUS_09910 6018 8420 gene locus_tag LOCUS_09920 6018 8420 CDS product DNA polymerase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980151.1 protein_id gnl|my_center|LOCUS_09920 9682 8429 gene locus_tag LOCUS_09930 gene dnaG 9682 8429 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980150.1 protein_id gnl|my_center|LOCUS_09930 10712 10026 gene locus_tag LOCUS_09940 10712 10026 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240313.1 protein_id gnl|my_center|LOCUS_09940 >Feature sequence050 123 935 gene locus_tag LOCUS_09950 123 935 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868180.1 protein_id gnl|my_center|LOCUS_09950 1555 929 gene locus_tag LOCUS_09960 1555 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249088.1 protein_id gnl|my_center|LOCUS_09960 1704 3023 gene locus_tag LOCUS_09970 1704 3023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 3571 3029 gene locus_tag LOCUS_09980 3571 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 3743 3594 gene locus_tag LOCUS_09990 3743 3594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 5309 3783 gene locus_tag LOCUS_10000 5309 3783 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980182.1 protein_id gnl|my_center|LOCUS_10000 5976 5359 gene locus_tag LOCUS_10010 5976 5359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 6123 7385 gene locus_tag LOCUS_10020 6123 7385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 7473 8267 gene locus_tag LOCUS_10030 7473 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 8371 9375 gene locus_tag LOCUS_10040 8371 9375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 9372 9899 gene locus_tag LOCUS_10050 9372 9899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763023.1 protein_id gnl|my_center|LOCUS_10050 >Feature sequence051 16 486 gene locus_tag LOCUS_10060 16 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1523 534 gene locus_tag LOCUS_10070 1523 534 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879267.1 protein_id gnl|my_center|LOCUS_10070 2486 1527 gene locus_tag LOCUS_10080 2486 1527 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879266.1 protein_id gnl|my_center|LOCUS_10080 3369 2494 gene locus_tag LOCUS_10090 3369 2494 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879265.1 protein_id gnl|my_center|LOCUS_10090 4406 3387 gene locus_tag LOCUS_10100 4406 3387 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_10100 6078 4492 gene locus_tag LOCUS_10110 6078 4492 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_10110 9461 6300 gene locus_tag LOCUS_10120 9461 6300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 9788 9588 gene locus_tag LOCUS_10130 9788 9588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence052 1204 2610 gene locus_tag LOCUS_10140 gene gcvPA 1204 2610 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868897.1 protein_id gnl|my_center|LOCUS_10140 2607 4178 gene locus_tag LOCUS_10150 gene gcvPB 2607 4178 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_10150 4248 5621 gene locus_tag LOCUS_10160 gene lpdA 4248 5621 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230317.1 protein_id gnl|my_center|LOCUS_10160 5648 6346 gene locus_tag LOCUS_10170 5648 6346 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763582.1 protein_id gnl|my_center|LOCUS_10170 6788 6348 gene locus_tag LOCUS_10180 gene moaC 6788 6348 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867492.1 protein_id gnl|my_center|LOCUS_10180 7602 6763 gene locus_tag LOCUS_10190 gene moaA 7602 6763 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762847.1 protein_id gnl|my_center|LOCUS_10190 7916 8968 gene locus_tag LOCUS_10200 7916 8968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10200 9032 9496 gene locus_tag LOCUS_10210 9032 9496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10210 10550 9570 gene locus_tag LOCUS_10220 10550 9570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 >Feature sequence053 1687 338 gene locus_tag LOCUS_10230 1687 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 1806 3149 gene locus_tag LOCUS_10240 1806 3149 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250885.1 protein_id gnl|my_center|LOCUS_10240 3201 4142 gene locus_tag LOCUS_10250 3201 4142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 4293 5135 gene locus_tag LOCUS_10260 4293 5135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 5662 5132 gene locus_tag LOCUS_10270 5662 5132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 6468 5758 gene locus_tag LOCUS_10280 6468 5758 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846889.1 protein_id gnl|my_center|LOCUS_10280 8070 6481 gene locus_tag LOCUS_10290 8070 6481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 8867 8076 gene locus_tag LOCUS_10300 8867 8076 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251231.1 protein_id gnl|my_center|LOCUS_10300 9018 9500 gene locus_tag LOCUS_10310 9018 9500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 10048 9896 gene locus_tag LOCUS_10320 10048 9896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence054 <1 1279 gene locus_tag LOCUS_10330 <1 1279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979307.1:DEAD/DEAH box helicase 1969 1286 gene locus_tag LOCUS_10340 1969 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2087 2386 gene locus_tag LOCUS_10350 2087 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2744 2448 gene locus_tag LOCUS_10360 gene albA 2744 2448 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979310.1 protein_id gnl|my_center|LOCUS_10360 2897 6589 gene locus_tag LOCUS_10370 gene rgy 2897 6589 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868381.1 protein_id gnl|my_center|LOCUS_10370 6888 6619 gene locus_tag LOCUS_10380 6888 6619 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979312.1 protein_id gnl|my_center|LOCUS_10380 8329 6977 gene locus_tag LOCUS_10390 8329 6977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 8964 8329 gene locus_tag LOCUS_10400 8964 8329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 9137 9886 gene locus_tag LOCUS_10410 9137 9886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 9870 10109 gene locus_tag LOCUS_10420 9870 10109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 10395 10183 gene locus_tag LOCUS_10430 10395 10183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 >Feature sequence055 545 1774 gene locus_tag LOCUS_10440 545 1774 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_10440 2163 1795 gene locus_tag LOCUS_10450 2163 1795 CDS product DUF2095 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867688.1 protein_id gnl|my_center|LOCUS_10450 3470 2205 gene locus_tag LOCUS_10460 gene spn 3470 2205 CDS product bifunctional sugar-1-phosphate nucleotidylyltransferase/acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978425.1 protein_id gnl|my_center|LOCUS_10460 4543 3467 gene locus_tag LOCUS_10470 4543 3467 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250208.1 protein_id gnl|my_center|LOCUS_10470 5269 4631 gene locus_tag LOCUS_10480 5269 4631 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_10480 5597 5340 gene locus_tag LOCUS_10490 5597 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 6700 5597 gene locus_tag LOCUS_10500 6700 5597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 7279 6815 gene locus_tag LOCUS_10510 7279 6815 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978348.1 protein_id gnl|my_center|LOCUS_10510 7949 7359 gene locus_tag LOCUS_10520 7949 7359 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978328.1 protein_id gnl|my_center|LOCUS_10520 8622 7939 gene locus_tag LOCUS_10530 8622 7939 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978327.1 protein_id gnl|my_center|LOCUS_10530 9632 8607 gene locus_tag LOCUS_10540 gene kae1 9632 8607 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978326.1 protein_id gnl|my_center|LOCUS_10540 9841 9677 gene locus_tag LOCUS_10550 9841 9677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 10215 9859 gene locus_tag LOCUS_10560 10215 9859 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763617.1 protein_id gnl|my_center|LOCUS_10560 >Feature sequence056 707 1879 gene locus_tag LOCUS_10570 707 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3450 2035 gene locus_tag LOCUS_10580 3450 2035 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_10580 3532 3948 gene locus_tag LOCUS_10590 3532 3948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 3995 5329 gene locus_tag LOCUS_10600 3995 5329 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867854.1 protein_id gnl|my_center|LOCUS_10600 5694 5338 gene locus_tag LOCUS_10610 5694 5338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 6001 5759 gene locus_tag LOCUS_10620 6001 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 7175 6018 gene locus_tag LOCUS_10630 7175 6018 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869913.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence057 449 2179 gene locus_tag LOCUS_10640 449 2179 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 protein_id gnl|my_center|LOCUS_10640 2276 4543 gene locus_tag LOCUS_10650 2276 4543 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249526.1 protein_id gnl|my_center|LOCUS_10650 4574 5671 gene locus_tag LOCUS_10660 4574 5671 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_10660 5717 6319 gene locus_tag LOCUS_10670 5717 6319 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_10670 6425 7261 gene locus_tag LOCUS_10680 6425 7261 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020954.1 protein_id gnl|my_center|LOCUS_10680 7242 8597 gene locus_tag LOCUS_10690 7242 8597 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020953.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence058 3414 1408 gene locus_tag LOCUS_10700 3414 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 4738 3419 gene locus_tag LOCUS_10710 4738 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 5990 4722 gene locus_tag LOCUS_10720 5990 4722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6165 7778 gene locus_tag LOCUS_10730 gene fdrA 6165 7778 CDS product acyl-CoA synthetase FdrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393612.1 protein_id gnl|my_center|LOCUS_10730 7775 7948 gene locus_tag LOCUS_10740 7775 7948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 7960 9192 gene locus_tag LOCUS_10750 7960 9192 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090011.1 protein_id gnl|my_center|LOCUS_10750 9693 9196 gene locus_tag LOCUS_10760 9693 9196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence059 71 1141 gene locus_tag LOCUS_10770 71 1141 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048096393.1 protein_id gnl|my_center|LOCUS_10770 2208 1138 gene locus_tag LOCUS_10780 2208 1138 CDS product DUF711 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762695.1 protein_id gnl|my_center|LOCUS_10780 2308 3660 gene locus_tag LOCUS_10790 gene allB 2308 3660 CDS product allantoinase AllB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461638.1 protein_id gnl|my_center|LOCUS_10790 4503 3676 gene locus_tag LOCUS_10800 4503 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4753 6147 gene locus_tag LOCUS_10810 4753 6147 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228579.1 protein_id gnl|my_center|LOCUS_10810 6301 7773 gene locus_tag LOCUS_10820 6301 7773 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583514.1 protein_id gnl|my_center|LOCUS_10820 7775 8884 gene locus_tag LOCUS_10830 7775 8884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence060 515 171 gene locus_tag LOCUS_10840 515 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1520 522 gene locus_tag LOCUS_10850 1520 522 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249140.1 protein_id gnl|my_center|LOCUS_10850 2469 1525 gene locus_tag LOCUS_10860 2469 1525 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020436.1 protein_id gnl|my_center|LOCUS_10860 3426 2527 gene locus_tag LOCUS_10870 3426 2527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 3539 5239 gene locus_tag LOCUS_10880 3539 5239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4853 4862 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5717 5220 gene locus_tag LOCUS_10890 5717 5220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 7168 5804 gene locus_tag LOCUS_10900 7168 5804 CDS product tRNA(Ile)(2)-agmatinylcytidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876597.1 protein_id gnl|my_center|LOCUS_10900 8154 7165 gene locus_tag LOCUS_10910 8154 7165 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_10910 8260 8916 gene locus_tag LOCUS_10920 8260 8916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence061 86 835 gene locus_tag LOCUS_10930 86 835 CDS product DUF2192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846962.1 protein_id gnl|my_center|LOCUS_10930 3875 795 gene locus_tag LOCUS_10940 3875 795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4012 5121 gene locus_tag LOCUS_10950 4012 5121 CDS product thiamine ABC transporter substrate binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146675.1 protein_id gnl|my_center|LOCUS_10950 5192 6745 gene locus_tag LOCUS_10960 5192 6745 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010889113.1 protein_id gnl|my_center|LOCUS_10960 6742 7743 gene locus_tag LOCUS_10970 6742 7743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 9124 7718 gene locus_tag LOCUS_10980 9124 7718 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979448.1 protein_id gnl|my_center|LOCUS_10980 >Feature sequence062 1043 1537 gene locus_tag LOCUS_10990 1043 1537 CDS product QueT transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002297147.1 protein_id gnl|my_center|LOCUS_10990 1530 2249 gene locus_tag LOCUS_11000 1530 2249 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 protein_id gnl|my_center|LOCUS_11000 2233 2808 gene locus_tag LOCUS_11010 2233 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 2864 3265 gene locus_tag LOCUS_11020 2864 3265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 3794 3943 gene locus_tag LOCUS_11030 3794 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 4285 4130 gene locus_tag LOCUS_11040 4285 4130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 4878 4282 gene locus_tag LOCUS_11050 4878 4282 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868704.1 protein_id gnl|my_center|LOCUS_11050 6632 4896 gene locus_tag LOCUS_11060 6632 4896 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763439.1 protein_id gnl|my_center|LOCUS_11060 7072 6653 gene locus_tag LOCUS_11070 7072 6653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence063 5580 3262 gene locus_tag LOCUS_11080 5580 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 4273 4282 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6270 5605 gene locus_tag LOCUS_11090 6270 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 7212 6280 gene locus_tag LOCUS_11100 gene cmr4 7212 6280 CDS product type III-B CRISPR module RAMP protein Cmr4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980046.1 protein_id gnl|my_center|LOCUS_11100 8027 7215 gene locus_tag LOCUS_11110 8027 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 8941 8162 gene locus_tag LOCUS_11120 8941 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 >Feature sequence064 1373 999 gene locus_tag LOCUS_11130 1373 999 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868416.1 protein_id gnl|my_center|LOCUS_11130 1528 1382 gene locus_tag LOCUS_11140 1528 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 1663 2259 gene locus_tag LOCUS_11150 1663 2259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 2420 2941 gene locus_tag LOCUS_11160 2420 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 3030 4454 gene locus_tag LOCUS_11170 3030 4454 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_11170 4461 5975 gene locus_tag LOCUS_11180 4461 5975 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_11180 6635 5979 gene locus_tag LOCUS_11190 6635 5979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 7531 7355 gene locus_tag LOCUS_11200 7531 7355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 7862 7536 gene locus_tag LOCUS_11210 7862 7536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 8965 7865 gene locus_tag LOCUS_11220 8965 7865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence065 80 325 gene locus_tag LOCUS_11230 80 325 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422320.1 protein_id gnl|my_center|LOCUS_11230 424 1032 gene locus_tag LOCUS_11240 gene hxlB 424 1032 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978137.1 protein_id gnl|my_center|LOCUS_11240 1204 2862 gene locus_tag LOCUS_11250 1204 2862 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867315.1 protein_id gnl|my_center|LOCUS_11250 2881 3873 gene locus_tag LOCUS_11260 2881 3873 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867314.1 protein_id gnl|my_center|LOCUS_11260 3873 4748 gene locus_tag LOCUS_11270 3873 4748 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867313.1 protein_id gnl|my_center|LOCUS_11270 4755 5882 gene locus_tag LOCUS_11280 4755 5882 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_11280 6996 5896 gene locus_tag LOCUS_11290 6996 5896 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017871885.1 protein_id gnl|my_center|LOCUS_11290 8971 7058 gene locus_tag LOCUS_11300 8971 7058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence066 2442 487 gene locus_tag LOCUS_11310 2442 487 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978304.1 protein_id gnl|my_center|LOCUS_11310 3215 2592 gene locus_tag LOCUS_11320 gene psmB 3215 2592 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978453.1 protein_id gnl|my_center|LOCUS_11320 3343 4410 gene locus_tag LOCUS_11330 3343 4410 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978305.1 protein_id gnl|my_center|LOCUS_11330 5176 4412 gene locus_tag LOCUS_11340 5176 4412 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978306.1 protein_id gnl|my_center|LOCUS_11340 5291 5587 gene locus_tag LOCUS_11350 5291 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 6072 5584 gene locus_tag LOCUS_11360 6072 5584 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868433.1 protein_id gnl|my_center|LOCUS_11360 6196 6426 gene locus_tag LOCUS_11370 6196 6426 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846912.1 protein_id gnl|my_center|LOCUS_11370 6448 6636 gene locus_tag LOCUS_11380 6448 6636 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978307.1 protein_id gnl|my_center|LOCUS_11380 6647 7753 gene locus_tag LOCUS_11390 6647 7753 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868279.1 protein_id gnl|my_center|LOCUS_11390 >Feature sequence067 344 493 gene locus_tag LOCUS_11400 344 493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1036 830 gene locus_tag LOCUS_11410 1036 830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1358 1059 gene locus_tag LOCUS_11420 1358 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 1437 2681 gene locus_tag LOCUS_11430 1437 2681 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762718.1 protein_id gnl|my_center|LOCUS_11430 4103 2688 gene locus_tag LOCUS_11440 4103 2688 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475414.1 protein_id gnl|my_center|LOCUS_11440 4297 5433 gene locus_tag LOCUS_11450 4297 5433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 5470 5554 gene locus_tag LOCUS_t00110 5470 5554 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 5830 5994 gene locus_tag LOCUS_11460 5830 5994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 5981 6886 gene locus_tag LOCUS_11470 5981 6886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 7765 7040 gene locus_tag LOCUS_11480 7765 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 8581 7907 gene locus_tag LOCUS_11490 8581 7907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence068 124 4065 gene locus_tag LOCUS_11500 124 4065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 3959 4174 gene locus_tag LOCUS_11510 3959 4174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 4206 5399 gene locus_tag LOCUS_11520 4206 5399 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763058.1 protein_id gnl|my_center|LOCUS_11520 5422 6435 gene locus_tag LOCUS_11530 5422 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6471 7616 gene locus_tag LOCUS_11540 6471 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 >Feature sequence069 65 310 gene locus_tag LOCUS_11550 65 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 1660 344 gene locus_tag LOCUS_11560 gene eno 1660 344 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251056.1 protein_id gnl|my_center|LOCUS_11560 1699 2019 gene locus_tag LOCUS_11570 1699 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 2024 2338 gene locus_tag LOCUS_11580 2024 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979229.1 protein_id gnl|my_center|LOCUS_11580 2346 2837 gene locus_tag LOCUS_11590 2346 2837 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877058.1 protein_id gnl|my_center|LOCUS_11590 5003 2841 gene locus_tag LOCUS_11600 5003 2841 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979235.1 protein_id gnl|my_center|LOCUS_11600 6109 5033 gene locus_tag LOCUS_11610 6109 5033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 6401 6099 gene locus_tag LOCUS_11620 6401 6099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 8151 6496 gene locus_tag LOCUS_11630 gene thsA 8151 6496 CDS product thermosome subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846517.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence070 88 411 gene locus_tag LOCUS_11640 88 411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 508 1041 gene locus_tag LOCUS_11650 508 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 1317 1045 gene locus_tag LOCUS_11660 1317 1045 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868081.1 protein_id gnl|my_center|LOCUS_11660 2447 1338 gene locus_tag LOCUS_11670 2447 1338 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_11670 2557 4434 gene locus_tag LOCUS_11680 gene aor 2557 4434 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_11680 5223 4420 gene locus_tag LOCUS_11690 gene mpgP 5223 4420 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_11690 5352 6548 gene locus_tag LOCUS_11700 gene mpgS 5352 6548 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228323.1 protein_id gnl|my_center|LOCUS_11700 7209 6538 gene locus_tag LOCUS_11710 7209 6538 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761779.1 protein_id gnl|my_center|LOCUS_11710 7873 7193 gene locus_tag LOCUS_11720 7873 7193 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence071 429 848 gene locus_tag LOCUS_11730 429 848 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868586.1 protein_id gnl|my_center|LOCUS_11730 845 1348 gene locus_tag LOCUS_11740 845 1348 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868585.1 protein_id gnl|my_center|LOCUS_11740 1370 1726 gene locus_tag LOCUS_11750 1370 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11750 1730 2716 gene locus_tag LOCUS_11760 gene nuoH 1730 2716 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545198.1 protein_id gnl|my_center|LOCUS_11760 4000 2711 gene locus_tag LOCUS_11770 4000 2711 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430161.1 protein_id gnl|my_center|LOCUS_11770 5233 4022 gene locus_tag LOCUS_11780 5233 4022 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393897.1 protein_id gnl|my_center|LOCUS_11780 5353 5427 gene locus_tag LOCUS_t00120 5353 5427 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 5517 6083 gene locus_tag LOCUS_11790 5517 6083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11790 6174 6428 gene locus_tag LOCUS_11800 6174 6428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 6505 6879 gene locus_tag LOCUS_11810 gene speD 6505 6879 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979389.1 protein_id gnl|my_center|LOCUS_11810 6996 7889 gene locus_tag LOCUS_11820 6996 7889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 >Feature sequence072 1193 1885 gene locus_tag LOCUS_11830 1193 1885 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978356.1 protein_id gnl|my_center|LOCUS_11830 1878 2345 gene locus_tag LOCUS_11840 gene ribC 1878 2345 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978357.1 protein_id gnl|my_center|LOCUS_11840 2363 2812 gene locus_tag LOCUS_11850 gene ribH 2363 2812 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846879.1 protein_id gnl|my_center|LOCUS_11850 2825 3532 gene locus_tag LOCUS_11860 2825 3532 CDS product GTP cyclohydrolase IIa inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978359.1 protein_id gnl|my_center|LOCUS_11860 4712 3468 gene locus_tag LOCUS_11870 4712 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence073 271 1170 gene locus_tag LOCUS_11880 271 1170 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869167.1 protein_id gnl|my_center|LOCUS_11880 1750 1118 gene locus_tag LOCUS_11890 1750 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 3297 2029 gene locus_tag LOCUS_11900 3297 2029 CDS product DUF1116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869166.1 protein_id gnl|my_center|LOCUS_11900 3543 4430 gene locus_tag LOCUS_11910 3543 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4792 5319 gene locus_tag LOCUS_11920 4792 5319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 5700 5371 gene locus_tag LOCUS_11930 5700 5371 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846412.1 protein_id gnl|my_center|LOCUS_11930 6116 5697 gene locus_tag LOCUS_11940 6116 5697 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878097.1 protein_id gnl|my_center|LOCUS_11940 6373 6780 gene locus_tag LOCUS_11950 6373 6780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 6855 7097 gene locus_tag LOCUS_11960 6855 7097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence074 357 632 gene locus_tag LOCUS_11970 357 632 CDS product U6 snRNA-associated Sm-like protein LSm6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846864.1 protein_id gnl|my_center|LOCUS_11970 647 1081 gene locus_tag LOCUS_11980 647 1081 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870436.1 protein_id gnl|my_center|LOCUS_11980 1181 2140 gene locus_tag LOCUS_11990 1181 2140 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496957.1 protein_id gnl|my_center|LOCUS_11990 2167 3009 gene locus_tag LOCUS_12000 2167 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 3017 3559 gene locus_tag LOCUS_12010 3017 3559 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978170.1 protein_id gnl|my_center|LOCUS_12010 3556 4236 gene locus_tag LOCUS_12020 3556 4236 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867133.1 protein_id gnl|my_center|LOCUS_12020 4996 4238 gene locus_tag LOCUS_12030 4996 4238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 5108 5932 gene locus_tag LOCUS_12040 5108 5932 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240426.1 protein_id gnl|my_center|LOCUS_12040 6765 5929 gene locus_tag LOCUS_12050 6765 5929 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978473.1 protein_id gnl|my_center|LOCUS_12050 7064 6768 gene locus_tag LOCUS_12060 7064 6768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 7329 7090 gene locus_tag LOCUS_12070 7329 7090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence075 495 211 gene locus_tag LOCUS_12080 495 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249944.1 protein_id gnl|my_center|LOCUS_12080 2465 594 gene locus_tag LOCUS_12090 2465 594 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868362.1 protein_id gnl|my_center|LOCUS_12090 2992 2786 gene locus_tag LOCUS_12100 2992 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 3501 3049 gene locus_tag LOCUS_12110 3501 3049 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846576.1 protein_id gnl|my_center|LOCUS_12110 3648 4967 gene locus_tag LOCUS_12120 gene glnA 3648 4967 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_12120 5344 6174 gene locus_tag LOCUS_12130 5344 6174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12130 6611 6180 gene locus_tag LOCUS_12140 gene gcvH 6611 6180 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846941.1 protein_id gnl|my_center|LOCUS_12140 7610 6651 gene locus_tag LOCUS_12150 7610 6651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence076 442 131 gene locus_tag LOCUS_12160 442 131 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250777.1 protein_id gnl|my_center|LOCUS_12160 1116 469 gene locus_tag LOCUS_12170 1116 469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 1263 2189 gene locus_tag LOCUS_12180 1263 2189 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582519.1 protein_id gnl|my_center|LOCUS_12180 2192 3487 gene locus_tag LOCUS_12190 2192 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 4715 3558 gene locus_tag LOCUS_12200 4715 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 4860 5696 gene locus_tag LOCUS_12210 gene fba 4860 5696 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249940.1 protein_id gnl|my_center|LOCUS_12210 5912 5697 gene locus_tag LOCUS_12220 5912 5697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 6052 6324 gene locus_tag LOCUS_12230 6052 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 6355 6582 gene locus_tag LOCUS_12240 6355 6582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 >Feature sequence077 401 135 gene locus_tag LOCUS_12250 401 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 404 655 gene locus_tag LOCUS_12260 404 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1028 648 gene locus_tag LOCUS_12270 1028 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1362 1021 gene locus_tag LOCUS_12280 1362 1021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 1445 2335 gene locus_tag LOCUS_12290 1445 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 3549 2332 gene locus_tag LOCUS_12300 3549 2332 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762777.1 protein_id gnl|my_center|LOCUS_12300 3628 5208 gene locus_tag LOCUS_12310 3628 5208 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877491.1 protein_id gnl|my_center|LOCUS_12310 6270 5167 gene locus_tag LOCUS_12320 6270 5167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 6679 6260 gene locus_tag LOCUS_12330 6679 6260 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846952.1 protein_id gnl|my_center|LOCUS_12330 <7406 6688 gene locus_tag LOCUS_12340 <7406 6688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979390.1:hydroxymethylglutaryl-CoA synthase >Feature sequence078 52 855 gene locus_tag LOCUS_12350 52 855 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 1047 805 gene locus_tag LOCUS_12360 1047 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1668 2426 gene locus_tag LOCUS_12370 1668 2426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980258.1 protein_id gnl|my_center|LOCUS_12370 2450 3205 gene locus_tag LOCUS_12380 2450 3205 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980257.1 protein_id gnl|my_center|LOCUS_12380 3717 3460 gene locus_tag LOCUS_12390 3717 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 <7387 3933 gene locus_tag LOCUS_12400 <7387 3933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250571.1:MCM2/3/5 family DNA replication licensing factor >Feature sequence079 82 1413 gene locus_tag LOCUS_12410 82 1413 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475626.1 protein_id gnl|my_center|LOCUS_12410 1433 2812 gene locus_tag LOCUS_12420 1433 2812 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250996.1 protein_id gnl|my_center|LOCUS_12420 3537 2809 gene locus_tag LOCUS_12430 3537 2809 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763153.1 protein_id gnl|my_center|LOCUS_12430 3653 5362 gene locus_tag LOCUS_12440 3653 5362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 5365 6018 gene locus_tag LOCUS_12450 5365 6018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 7121 6015 gene locus_tag LOCUS_12460 7121 6015 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496822.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence080 1453 143 gene locus_tag LOCUS_12470 1453 143 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979317.1 protein_id gnl|my_center|LOCUS_12470 3051 1456 gene locus_tag LOCUS_12480 3051 1456 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 protein_id gnl|my_center|LOCUS_12480 3251 3646 gene locus_tag LOCUS_12490 3251 3646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 3735 5159 gene locus_tag LOCUS_12500 3735 5159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 5159 6478 gene locus_tag LOCUS_12510 5159 6478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 <7168 6475 gene locus_tag LOCUS_12520 <7168 6475 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979314.1:RtcB family protein >Feature sequence081 1743 1159 gene locus_tag LOCUS_12530 1743 1159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1828 4155 gene locus_tag LOCUS_12540 1828 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 4168 5472 gene locus_tag LOCUS_12550 4168 5472 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846342.1 protein_id gnl|my_center|LOCUS_12550 5682 5479 gene locus_tag LOCUS_12560 5682 5479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 6929 5679 gene locus_tag LOCUS_12570 6929 5679 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429732.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence082 81 2042 gene locus_tag LOCUS_12580 gene gor 81 2042 CDS product glyceraldehyde-3-phosphate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868698.1 protein_id gnl|my_center|LOCUS_12580 2110 2613 gene locus_tag LOCUS_12590 gene tsaA 2110 2613 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978062.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence083 174 1010 gene locus_tag LOCUS_12600 174 1010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1098 2399 gene locus_tag LOCUS_12610 gene asnS 1098 2399 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867347.1 protein_id gnl|my_center|LOCUS_12610 2691 4124 gene locus_tag LOCUS_12620 2691 4124 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867283.1 protein_id gnl|my_center|LOCUS_12620 4809 4108 gene locus_tag LOCUS_12630 4809 4108 CDS product R.Pab1 family restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146495.1 protein_id gnl|my_center|LOCUS_12630 4960 5045 gene locus_tag LOCUS_t00130 4960 5045 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 5207 6277 gene locus_tag LOCUS_12640 5207 6277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 6655 6278 gene locus_tag LOCUS_12650 6655 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 >Feature sequence084 108 707 gene locus_tag LOCUS_12660 108 707 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879522.1 protein_id gnl|my_center|LOCUS_12660 916 1836 gene locus_tag LOCUS_12670 916 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 2738 1830 gene locus_tag LOCUS_12680 2738 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2891 3598 gene locus_tag LOCUS_12690 2891 3598 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080855.1 protein_id gnl|my_center|LOCUS_12690 3673 3903 gene locus_tag LOCUS_12700 3673 3903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 4502 3900 gene locus_tag LOCUS_12710 4502 3900 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867364.1 protein_id gnl|my_center|LOCUS_12710 5029 4565 gene locus_tag LOCUS_12720 5029 4565 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980181.1 protein_id gnl|my_center|LOCUS_12720 5492 5040 gene locus_tag LOCUS_12730 gene lrpA 5492 5040 CDS product HTH-type transcriptional regulator LrpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251084.1 protein_id gnl|my_center|LOCUS_12730 5930 5553 gene locus_tag LOCUS_12740 5930 5553 CDS product class II SORL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081116.1 protein_id gnl|my_center|LOCUS_12740 6056 6775 gene locus_tag LOCUS_12750 gene sfsA 6056 6775 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence085 1953 859 gene locus_tag LOCUS_12760 1953 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 2468 2010 gene locus_tag LOCUS_12770 2468 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 3804 2530 gene locus_tag LOCUS_12780 gene hisS 3804 2530 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978283.1 protein_id gnl|my_center|LOCUS_12780 4324 3806 gene locus_tag LOCUS_12790 gene endA 4324 3806 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251165.1 protein_id gnl|my_center|LOCUS_12790 4451 5521 gene locus_tag LOCUS_12800 gene mtnA 4451 5521 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080652.1 protein_id gnl|my_center|LOCUS_12800 5844 6539 gene locus_tag LOCUS_12810 gene rpiA 5844 6539 CDS product ribose 5-phosphate isomerase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979326.1 protein_id gnl|my_center|LOCUS_12810 6543 6959 gene locus_tag LOCUS_12820 6543 6959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence086 2171 903 gene locus_tag LOCUS_12830 gene thrC 2171 903 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870985.1 protein_id gnl|my_center|LOCUS_12830 2359 3435 gene locus_tag LOCUS_12840 2359 3435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 3472 4422 gene locus_tag LOCUS_12850 3472 4422 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249658.1 protein_id gnl|my_center|LOCUS_12850 4410 5177 gene locus_tag LOCUS_12860 4410 5177 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546427.1 protein_id gnl|my_center|LOCUS_12860 5836 5213 gene locus_tag LOCUS_12870 5836 5213 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 6162 6962 gene locus_tag LOCUS_12880 6162 6962 CDS product SAM-dependent chlorinase/fluorinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842665.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence087 2771 2442 gene locus_tag LOCUS_12890 2771 2442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 3893 2877 gene locus_tag LOCUS_12900 3893 2877 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742658.1 protein_id gnl|my_center|LOCUS_12900 4547 3909 gene locus_tag LOCUS_12910 4547 3909 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_12910 5065 4547 gene locus_tag LOCUS_12920 5065 4547 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979408.1 protein_id gnl|my_center|LOCUS_12920 5598 5068 gene locus_tag LOCUS_12930 5598 5068 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979409.1 protein_id gnl|my_center|LOCUS_12930 5790 5605 gene locus_tag LOCUS_12940 5790 5605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 6690 5803 gene locus_tag LOCUS_12950 gene ftsY 6690 5803 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922948.1 protein_id gnl|my_center|LOCUS_12950 6947 6741 gene locus_tag LOCUS_12960 6947 6741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence088 547 158 gene locus_tag LOCUS_12970 547 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1081 683 gene locus_tag LOCUS_12980 1081 683 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196772272.1 protein_id gnl|my_center|LOCUS_12980 1167 4022 gene locus_tag LOCUS_12990 1167 4022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence089 1237 185 gene locus_tag LOCUS_13000 1237 185 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871038.1 protein_id gnl|my_center|LOCUS_13000 2535 1618 gene locus_tag LOCUS_13010 2535 1618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13010 3577 2597 gene locus_tag LOCUS_13020 3577 2597 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064299.1 protein_id gnl|my_center|LOCUS_13020 3747 3574 gene locus_tag LOCUS_13030 3747 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 4602 4820 gene locus_tag LOCUS_13040 4602 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 5073 4852 gene locus_tag LOCUS_13050 5073 4852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 5228 5440 gene locus_tag LOCUS_13060 5228 5440 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_13060 5418 5759 gene locus_tag LOCUS_13070 5418 5759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 6216 5953 gene locus_tag LOCUS_13080 6216 5953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 6424 6209 gene locus_tag LOCUS_13090 6424 6209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 6588 6513 gene locus_tag LOCUS_t00140 6588 6513 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence090 1575 784 gene locus_tag LOCUS_13100 1575 784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2474 1572 gene locus_tag LOCUS_13110 2474 1572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 4102 2471 gene locus_tag LOCUS_13120 4102 2471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 5312 4197 gene locus_tag LOCUS_13130 5312 4197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 6328 5324 gene locus_tag LOCUS_13140 6328 5324 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_13140 6521 6321 gene locus_tag LOCUS_13150 6521 6321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence091 784 1662 gene locus_tag LOCUS_13160 784 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1880 1671 gene locus_tag LOCUS_13170 1880 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2023 1880 gene locus_tag LOCUS_13180 2023 1880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2454 3047 gene locus_tag LOCUS_13190 2454 3047 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979589.1 protein_id gnl|my_center|LOCUS_13190 3268 5259 gene locus_tag LOCUS_13200 3268 5259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 5380 6312 gene locus_tag LOCUS_13210 5380 6312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence092 <1 583 gene locus_tag LOCUS_13220 <1 583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011277553.1:DUF87 domain-containing protein 2245 608 gene locus_tag LOCUS_13230 gene thsB 2245 608 CDS product thermosome subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846874.1 protein_id gnl|my_center|LOCUS_13230 2431 2634 gene locus_tag LOCUS_13240 2431 2634 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_13240 2672 3175 gene locus_tag LOCUS_13250 2672 3175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 3673 3419 gene locus_tag LOCUS_13260 3673 3419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 4045 5856 gene locus_tag LOCUS_13270 4045 5856 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978275.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence093 <1 608 gene locus_tag LOCUS_13280 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584039.1:D-2-hydroxyacid dehydrogenase 817 2655 gene locus_tag LOCUS_13290 817 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 3269 2583 gene locus_tag LOCUS_13300 3269 2583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3444 3911 gene locus_tag LOCUS_13310 3444 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 4881 3916 gene locus_tag LOCUS_13320 4881 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13320 5197 4973 gene locus_tag LOCUS_13330 5197 4973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 5661 5206 gene locus_tag LOCUS_13340 5661 5206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 5857 5648 gene locus_tag LOCUS_13350 5857 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 >Feature sequence094 360 1538 gene locus_tag LOCUS_13360 360 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1545 2237 gene locus_tag LOCUS_13370 1545 2237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 2451 3989 gene locus_tag LOCUS_13380 2451 3989 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877731.1 protein_id gnl|my_center|LOCUS_13380 >Feature sequence095 1397 57 gene locus_tag LOCUS_13390 1397 57 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584153.1 protein_id gnl|my_center|LOCUS_13390 1668 2372 gene locus_tag LOCUS_13400 1668 2372 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250639.1 protein_id gnl|my_center|LOCUS_13400 2596 2399 gene locus_tag LOCUS_13410 2596 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 2695 2618 gene locus_tag LOCUS_t00150 2695 2618 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3827 2772 gene locus_tag LOCUS_13420 gene amrS 3827 2772 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879767.1 protein_id gnl|my_center|LOCUS_13420 4384 3821 gene locus_tag LOCUS_13430 4384 3821 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948277.1 protein_id gnl|my_center|LOCUS_13430 4836 4405 gene locus_tag LOCUS_13440 4836 4405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 4930 5481 gene locus_tag LOCUS_13450 4930 5481 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846214.1 protein_id gnl|my_center|LOCUS_13450 5656 5814 gene locus_tag LOCUS_13460 5656 5814 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978144.1 protein_id gnl|my_center|LOCUS_13460 <6393 5830 gene locus_tag LOCUS_13470 <6393 5830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979404.1:alanine--tRNA ligase >Feature sequence096 <1 585 gene locus_tag LOCUS_13480 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979464.1:type II methionyl aminopeptidase 626 1720 gene locus_tag LOCUS_13490 626 1720 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_13490 1717 2022 gene locus_tag LOCUS_13500 1717 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2321 4741 gene locus_tag LOCUS_13510 2321 4741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 4848 5483 gene locus_tag LOCUS_13520 4848 5483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 <6110 5504 gene locus_tag LOCUS_13530 <6110 5504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846505.1:Fe-S cluster assembly ATPase SufC >Feature sequence097 2672 1344 gene locus_tag LOCUS_13540 2672 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 3633 2740 gene locus_tag LOCUS_13550 3633 2740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 4444 3656 gene locus_tag LOCUS_13560 4444 3656 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762787.1 protein_id gnl|my_center|LOCUS_13560 4578 5312 gene locus_tag LOCUS_13570 4578 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 >Feature sequence098 1402 818 gene locus_tag LOCUS_13580 1402 818 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_13580 1503 1871 gene locus_tag LOCUS_13590 1503 1871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 1968 3074 gene locus_tag LOCUS_13600 1968 3074 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880717.1 protein_id gnl|my_center|LOCUS_13600 3248 3087 gene locus_tag LOCUS_13610 3248 3087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 4631 3339 gene locus_tag LOCUS_13620 gene thrC 4631 3339 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867870.1 protein_id gnl|my_center|LOCUS_13620 4699 5412 gene locus_tag LOCUS_13630 4699 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence099 651 388 gene locus_tag LOCUS_13640 651 388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13640 1336 659 gene locus_tag LOCUS_13650 1336 659 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979414.1 protein_id gnl|my_center|LOCUS_13650 1733 1410 gene locus_tag LOCUS_13660 1733 1410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1914 1759 gene locus_tag LOCUS_13670 1914 1759 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762197.1 protein_id gnl|my_center|LOCUS_13670 2259 1927 gene locus_tag LOCUS_13680 2259 1927 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014597.1 protein_id gnl|my_center|LOCUS_13680 2809 2312 gene locus_tag LOCUS_13690 2809 2312 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_13690 3168 2821 gene locus_tag LOCUS_13700 3168 2821 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980210.1 protein_id gnl|my_center|LOCUS_13700 3440 3075 gene locus_tag LOCUS_13710 3440 3075 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867686.1 protein_id gnl|my_center|LOCUS_13710 3568 4242 gene locus_tag LOCUS_13720 3568 4242 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249827.1 protein_id gnl|my_center|LOCUS_13720 4437 5924 gene locus_tag LOCUS_13730 4437 5924 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545515.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence100 145 624 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtaacaactataatagaattgaaag 693 1007 gene locus_tag LOCUS_13740 693 1007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1501 1277 gene locus_tag LOCUS_13750 1501 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 2592 1507 gene locus_tag LOCUS_13760 2592 1507 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001158098.1 protein_id gnl|my_center|LOCUS_13760 2739 3302 gene locus_tag LOCUS_13770 2739 3302 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021181.1 protein_id gnl|my_center|LOCUS_13770 3876 3319 gene locus_tag LOCUS_13780 3876 3319 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978531.1 protein_id gnl|my_center|LOCUS_13780 3974 5566 gene locus_tag LOCUS_13790 3974 5566 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978180.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence101 251 2857 gene locus_tag LOCUS_13800 251 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13800 3103 5013 gene locus_tag LOCUS_13810 3103 5013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 5051 5861 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaattctattattgttgttac >Feature sequence102 605 766 gene locus_tag LOCUS_13820 605 766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 2383 1112 gene locus_tag LOCUS_13830 2383 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 3898 2390 gene locus_tag LOCUS_13840 3898 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13840 4054 5241 gene locus_tag LOCUS_13850 4054 5241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence103 456 2480 gene locus_tag LOCUS_13860 456 2480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 2918 5551 gene locus_tag LOCUS_13870 2918 5551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence104 95 757 gene locus_tag LOCUS_13880 95 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249947.1 protein_id gnl|my_center|LOCUS_13880 833 906 gene locus_tag LOCUS_t00160 833 906 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1162 947 gene locus_tag LOCUS_13890 1162 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 1373 3265 gene locus_tag LOCUS_13900 1373 3265 CDS product anaerobic ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146456.1 protein_id gnl|my_center|LOCUS_13900 3322 4122 gene locus_tag LOCUS_13910 3322 4122 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867145.1 protein_id gnl|my_center|LOCUS_13910 4133 5101 gene locus_tag LOCUS_13920 gene thyX 4133 5101 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980296.1 protein_id gnl|my_center|LOCUS_13920 5094 5624 gene locus_tag LOCUS_13930 gene dcd 5094 5624 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846226.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence105 1171 1974 gene locus_tag LOCUS_13940 1171 1974 CDS product translation initiation factor IF-2 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978935.1 protein_id gnl|my_center|LOCUS_13940 1971 2171 gene locus_tag LOCUS_13950 1971 2171 CDS product RNA-protein complex protein Nop10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762187.1 protein_id gnl|my_center|LOCUS_13950 2293 3159 gene locus_tag LOCUS_13960 2293 3159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 3243 3572 gene locus_tag LOCUS_13970 3243 3572 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061051.1 protein_id gnl|my_center|LOCUS_13970 3548 3826 gene locus_tag LOCUS_13980 3548 3826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 4371 3823 gene locus_tag LOCUS_13990 4371 3823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 >Feature sequence106 1411 182 gene locus_tag LOCUS_14000 1411 182 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250139.1 protein_id gnl|my_center|LOCUS_14000 3268 1430 gene locus_tag LOCUS_14010 gene glmS 3268 1430 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762183.1 protein_id gnl|my_center|LOCUS_14010 3371 4057 gene locus_tag LOCUS_14020 gene pyrH 3371 4057 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979322.1 protein_id gnl|my_center|LOCUS_14020 4745 4044 gene locus_tag LOCUS_14030 4745 4044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 <5258 4742 gene locus_tag LOCUS_14040 <5258 4742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250624.1:class I SAM-dependent methyltransferase >Feature sequence107 1538 534 gene locus_tag LOCUS_14050 1538 534 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_14050 1869 2102 gene locus_tag LOCUS_14060 1869 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 2913 2056 gene locus_tag LOCUS_14070 2913 2056 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763567.1 protein_id gnl|my_center|LOCUS_14070 3013 3693 gene locus_tag LOCUS_14080 3013 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 3717 4766 gene locus_tag LOCUS_14090 3717 4766 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978164.1 protein_id gnl|my_center|LOCUS_14090 >Feature sequence108 215 481 gene locus_tag LOCUS_14100 215 481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 656 940 gene locus_tag LOCUS_14110 656 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 1013 1174 gene locus_tag LOCUS_14120 1013 1174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1519 1307 gene locus_tag LOCUS_14130 1519 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1616 2578 gene locus_tag LOCUS_14140 1616 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2587 2901 gene locus_tag LOCUS_14150 2587 2901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2894 3442 gene locus_tag LOCUS_14160 2894 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence109 195 1277 gene locus_tag LOCUS_14170 gene rtcA 195 1277 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_14170 2286 1234 gene locus_tag LOCUS_14180 2286 1234 CDS product 50S ribosome-binding GTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979540.1 protein_id gnl|my_center|LOCUS_14180 2964 2353 gene locus_tag LOCUS_14190 2964 2353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 3195 3797 gene locus_tag LOCUS_14200 gene psmB 3195 3797 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978284.1 protein_id gnl|my_center|LOCUS_14200 3803 4468 gene locus_tag LOCUS_14210 gene nfi 3803 4468 CDS product deoxyribonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583138.1 protein_id gnl|my_center|LOCUS_14210 4509 4584 gene locus_tag LOCUS_t00170 4509 4584 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5137 4637 gene locus_tag LOCUS_14220 5137 4637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence110 1508 1047 gene locus_tag LOCUS_14230 1508 1047 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869978.1 protein_id gnl|my_center|LOCUS_14230 2017 1529 gene locus_tag LOCUS_14240 2017 1529 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_14240 2683 2039 gene locus_tag LOCUS_14250 2683 2039 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978383.1 protein_id gnl|my_center|LOCUS_14250 3315 2686 gene locus_tag LOCUS_14260 3315 2686 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978384.1 protein_id gnl|my_center|LOCUS_14260 3770 3312 gene locus_tag LOCUS_14270 3770 3312 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867445.1 protein_id gnl|my_center|LOCUS_14270 4186 3773 gene locus_tag LOCUS_14280 4186 3773 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_14280 4740 4183 gene locus_tag LOCUS_14290 4740 4183 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978387.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence111 1577 963 gene locus_tag LOCUS_14300 1577 963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1684 2712 gene locus_tag LOCUS_14310 1684 2712 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868636.1 protein_id gnl|my_center|LOCUS_14310 2752 3531 gene locus_tag LOCUS_14320 2752 3531 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240277.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence112 <1 1747 gene locus_tag LOCUS_14330 <1 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240545.1:ATP-binding protein 2142 1756 gene locus_tag LOCUS_14340 2142 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 2251 3009 gene locus_tag LOCUS_14350 gene pcn3 2251 3009 CDS product DNA polymerase sliding clamp Pcn3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978940.1 protein_id gnl|my_center|LOCUS_14350 3265 3011 gene locus_tag LOCUS_14360 3265 3011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011839290.1 protein_id gnl|my_center|LOCUS_14360 4178 3411 gene locus_tag LOCUS_14370 4178 3411 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_14370 4606 4196 gene locus_tag LOCUS_14380 4606 4196 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249577.1 protein_id gnl|my_center|LOCUS_14380 >Feature sequence113 183 329 gene locus_tag LOCUS_14390 183 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14390 1355 510 gene locus_tag LOCUS_14400 gene frhB 1355 510 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496371.1 protein_id gnl|my_center|LOCUS_14400 2080 1361 gene locus_tag LOCUS_14410 gene frhG 2080 1361 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496370.1 protein_id gnl|my_center|LOCUS_14410 3283 2081 gene locus_tag LOCUS_14420 gene frhA 3283 2081 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774535.1 protein_id gnl|my_center|LOCUS_14420 4411 4064 gene locus_tag LOCUS_14430 4411 4064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence114 140 2110 gene locus_tag LOCUS_14440 140 2110 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867369.1 protein_id gnl|my_center|LOCUS_14440 <4817 2120 gene locus_tag LOCUS_14450 <4817 2120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978365.1:DEAD/DEAH box helicase >Feature sequence115 2299 119 gene locus_tag LOCUS_14460 2299 119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 2792 2445 gene locus_tag LOCUS_14470 2792 2445 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_14470 3141 2860 gene locus_tag LOCUS_14480 3141 2860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 3312 3148 gene locus_tag LOCUS_14490 3312 3148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 3406 3281 gene locus_tag LOCUS_14500 3406 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 3531 3403 gene locus_tag LOCUS_14510 3531 3403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 3847 4797 gene locus_tag LOCUS_14520 3847 4797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 >Feature sequence116 <1 569 gene locus_tag LOCUS_14530 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978516.1:MBL fold metallo-hydrolase 1358 573 gene locus_tag LOCUS_14540 1358 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 1805 1365 gene locus_tag LOCUS_14550 1805 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2006 4498 gene locus_tag LOCUS_14560 2006 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 4488 4721 gene locus_tag LOCUS_14570 4488 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence117 56 262 gene locus_tag LOCUS_14580 56 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 1542 259 gene locus_tag LOCUS_14590 1542 259 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980269.1 protein_id gnl|my_center|LOCUS_14590 1683 2036 gene locus_tag LOCUS_14600 1683 2036 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_14600 2039 4603 gene locus_tag LOCUS_14610 2039 4603 CDS product DNA-directed DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979471.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence118 1422 217 gene locus_tag LOCUS_14620 1422 217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14620 3221 2496 gene locus_tag LOCUS_14630 3221 2496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14630 3704 3832 gene locus_tag LOCUS_14640 3704 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 4132 3992 gene locus_tag LOCUS_14650 4132 3992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 4615 4421 gene locus_tag LOCUS_14660 4615 4421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 >Feature sequence119 <1 763 gene locus_tag LOCUS_14670 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_083500625.1:restriction endonuclease subunit S 770 3805 gene locus_tag LOCUS_14680 770 3805 CDS product HsdR family type I site-specific deoxyribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876573.1 protein_id gnl|my_center|LOCUS_14680 3789 4364 gene locus_tag LOCUS_14690 3789 4364 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879203.1 protein_id gnl|my_center|LOCUS_14690 4372 4680 gene locus_tag LOCUS_14700 4372 4680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 >Feature sequence120 <1 553 gene locus_tag LOCUS_14710 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978404.1:isoleucine--tRNA ligase 947 1117 gene locus_tag LOCUS_14720 947 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14720 1117 1533 gene locus_tag LOCUS_14730 1117 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 1636 2022 gene locus_tag LOCUS_14740 1636 2022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14740 2082 2522 gene locus_tag LOCUS_14750 2082 2522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 2529 2819 gene locus_tag LOCUS_14760 2529 2819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 2862 4538 gene locus_tag LOCUS_14770 2862 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 >Feature sequence121 388 2 gene locus_tag LOCUS_14780 388 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 2280 454 gene locus_tag LOCUS_14790 2280 454 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240328.1 protein_id gnl|my_center|LOCUS_14790 2460 2981 gene locus_tag LOCUS_14800 2460 2981 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267101.1 protein_id gnl|my_center|LOCUS_14800 2978 3850 gene locus_tag LOCUS_14810 2978 3850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence122 1664 423 gene locus_tag LOCUS_14820 1664 423 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979050.1 protein_id gnl|my_center|LOCUS_14820 1757 2503 gene locus_tag LOCUS_14830 1757 2503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2506 2976 gene locus_tag LOCUS_14840 2506 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3016 4029 gene locus_tag LOCUS_14850 3016 4029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 >Feature sequence123 751 3300 gene locus_tag LOCUS_14860 751 3300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 3303 3854 gene locus_tag LOCUS_14870 3303 3854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 <4532 3823 gene locus_tag LOCUS_14880 <4532 3823 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004083143.1:ABC transporter ATP-binding protein >Feature sequence124 1173 790 gene locus_tag LOCUS_14890 1173 790 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146785.1 protein_id gnl|my_center|LOCUS_14890 2474 1170 gene locus_tag LOCUS_14900 2474 1170 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042680609.1 protein_id gnl|my_center|LOCUS_14900 2566 3099 gene locus_tag LOCUS_14910 2566 3099 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978503.1 protein_id gnl|my_center|LOCUS_14910 3593 3105 gene locus_tag LOCUS_14920 3593 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 4197 3793 gene locus_tag LOCUS_14930 4197 3793 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879721.1 protein_id gnl|my_center|LOCUS_14930 >Feature sequence125 >Feature sequence126 573 815 gene locus_tag LOCUS_14940 573 815 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868845.1 protein_id gnl|my_center|LOCUS_14940 982 1731 gene locus_tag LOCUS_14950 gene fabG 982 1731 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_14950 3053 1800 gene locus_tag LOCUS_14960 3053 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978805.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence127 7 678 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcagttcttattgttttctac 890 1072 gene locus_tag LOCUS_14970 890 1072 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846285.1 protein_id gnl|my_center|LOCUS_14970 1528 1097 gene locus_tag LOCUS_14980 1528 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 1710 2501 gene locus_tag LOCUS_14990 1710 2501 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978333.1 protein_id gnl|my_center|LOCUS_14990 2964 2476 gene locus_tag LOCUS_15000 2964 2476 CDS product protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846965.1 protein_id gnl|my_center|LOCUS_15000 3309 2986 gene locus_tag LOCUS_15010 3309 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 3831 3340 gene locus_tag LOCUS_15020 3831 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15020 4087 3800 gene locus_tag LOCUS_15030 4087 3800 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979487.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence128 2010 1519 gene locus_tag LOCUS_15040 2010 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 3287 2007 gene locus_tag LOCUS_15050 3287 2007 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980121.1 protein_id gnl|my_center|LOCUS_15050 3408 4040 gene locus_tag LOCUS_15060 3408 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence129 1596 922 gene locus_tag LOCUS_15070 gene lolD 1596 922 CDS product lipoprotein-releasing ABC transporter ATP-binding protein LolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003017997.1 protein_id gnl|my_center|LOCUS_15070 2095 1583 gene locus_tag LOCUS_15080 2095 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 2571 2756 gene locus_tag LOCUS_15090 2571 2756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15090 >Feature sequence130 468 1691 gene locus_tag LOCUS_15100 468 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1776 2723 gene locus_tag LOCUS_15110 1776 2723 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868400.1 protein_id gnl|my_center|LOCUS_15110 2733 3392 gene locus_tag LOCUS_15120 2733 3392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 3376 3627 gene locus_tag LOCUS_15130 3376 3627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 >Feature sequence131 161 77 gene locus_tag LOCUS_t00180 161 77 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 756 172 gene locus_tag LOCUS_15140 756 172 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867650.1 protein_id gnl|my_center|LOCUS_15140 1793 753 gene locus_tag LOCUS_15150 1793 753 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867646.1 protein_id gnl|my_center|LOCUS_15150 2186 1896 gene locus_tag LOCUS_15160 2186 1896 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978366.1 protein_id gnl|my_center|LOCUS_15160 2774 2226 gene locus_tag LOCUS_15170 2774 2226 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978376.1 protein_id gnl|my_center|LOCUS_15170 3086 2805 gene locus_tag LOCUS_15180 3086 2805 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870160.1 protein_id gnl|my_center|LOCUS_15180 3626 3186 gene locus_tag LOCUS_15190 3626 3186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 3974 3630 gene locus_tag LOCUS_15200 3974 3630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 >Feature sequence132 433 1458 gene locus_tag LOCUS_15210 433 1458 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846871.1 protein_id gnl|my_center|LOCUS_15210 1461 1964 gene locus_tag LOCUS_15220 1461 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 3141 1972 gene locus_tag LOCUS_15230 3141 1972 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868783.1 protein_id gnl|my_center|LOCUS_15230 3310 3645 gene locus_tag LOCUS_15240 3310 3645 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762233.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence133 244 1389 gene locus_tag LOCUS_15250 244 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009990130.1 protein_id gnl|my_center|LOCUS_15250 1678 1394 gene locus_tag LOCUS_15260 1678 1394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 1808 2161 gene locus_tag LOCUS_15270 1808 2161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2158 2418 gene locus_tag LOCUS_15280 2158 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 2460 3062 gene locus_tag LOCUS_15290 2460 3062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15290 3596 3066 gene locus_tag LOCUS_15300 3596 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence134 551 2554 gene locus_tag LOCUS_15310 551 2554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 3793 2558 gene locus_tag LOCUS_15320 3793 2558 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083215.1 protein_id gnl|my_center|LOCUS_15320 >Feature sequence135 887 201 gene locus_tag LOCUS_15330 887 201 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762886.1 protein_id gnl|my_center|LOCUS_15330 983 1759 gene locus_tag LOCUS_15340 983 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 1828 3258 gene locus_tag LOCUS_15350 1828 3258 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978681.1 protein_id gnl|my_center|LOCUS_15350 3266 3661 gene locus_tag LOCUS_15360 gene hypA 3266 3661 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250958.1 protein_id gnl|my_center|LOCUS_15360 >Feature sequence136 2438 222 gene locus_tag LOCUS_15370 2438 222 CDS product beta-propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871078.1 protein_id gnl|my_center|LOCUS_15370 2580 2984 gene locus_tag LOCUS_15380 2580 2984 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980316.1 protein_id gnl|my_center|LOCUS_15380 3048 3530 gene locus_tag LOCUS_15390 3048 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence137 1315 989 gene locus_tag LOCUS_15400 1315 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 2772 1390 gene locus_tag LOCUS_15410 gene serS 2772 1390 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979517.1 protein_id gnl|my_center|LOCUS_15410 3234 2869 gene locus_tag LOCUS_15420 3234 2869 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979516.1 protein_id gnl|my_center|LOCUS_15420 3776 3417 gene locus_tag LOCUS_15430 3776 3417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 >Feature sequence138 <1 653 gene locus_tag LOCUS_15440 <1 653 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978497.1:ribonuclease HII 750 1919 gene locus_tag LOCUS_15450 750 1919 CDS product TGS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978498.1 protein_id gnl|my_center|LOCUS_15450 2331 1930 gene locus_tag LOCUS_15460 2331 1930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168191.1 protein_id gnl|my_center|LOCUS_15460 3144 2350 gene locus_tag LOCUS_15470 3144 2350 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979223.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence139 2867 2559 gene locus_tag LOCUS_15480 2867 2559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 3221 2877 gene locus_tag LOCUS_15490 3221 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence140 1325 522 gene locus_tag LOCUS_15500 1325 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 1548 1348 gene locus_tag LOCUS_15510 1548 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 1460 2836 gene locus_tag LOCUS_15520 1460 2836 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_15520 2830 3375 gene locus_tag LOCUS_15530 2830 3375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429693.1 protein_id gnl|my_center|LOCUS_15530 >Feature sequence141 241 900 gene locus_tag LOCUS_15540 241 900 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074453.1 protein_id gnl|my_center|LOCUS_15540 945 1817 gene locus_tag LOCUS_15550 945 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 2877 1867 gene locus_tag LOCUS_15560 2877 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence142 3 2189 gene locus_tag LOCUS_15570 3 2189 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429806.1 protein_id gnl|my_center|LOCUS_15570 2435 2172 gene locus_tag LOCUS_15580 2435 2172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 3539 2715 gene locus_tag LOCUS_15590 3539 2715 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979450.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence143 201 1106 gene locus_tag LOCUS_15600 201 1106 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979801.1 protein_id gnl|my_center|LOCUS_15600 1103 2686 gene locus_tag LOCUS_15610 1103 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 2828 3049 gene locus_tag LOCUS_15620 2828 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 3221 3340 gene locus_tag LOCUS_15630 3221 3340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence144 1828 365 gene locus_tag LOCUS_15640 1828 365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 3216 1861 gene locus_tag LOCUS_15650 3216 1861 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence145 1516 842 gene locus_tag LOCUS_15660 1516 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 1553 3076 gene locus_tag LOCUS_15670 1553 3076 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868605.1 protein_id gnl|my_center|LOCUS_15670 3261 3100 gene locus_tag LOCUS_15680 3261 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence146 178 891 gene locus_tag LOCUS_15690 178 891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 1147 1308 gene locus_tag LOCUS_15700 1147 1308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1283 2419 gene locus_tag LOCUS_15710 1283 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009990130.1 protein_id gnl|my_center|LOCUS_15710 2416 2754 gene locus_tag LOCUS_15720 2416 2754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence147 2843 1590 gene locus_tag LOCUS_15730 2843 1590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence148 299 1177 gene locus_tag LOCUS_15740 299 1177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1698 1195 gene locus_tag LOCUS_15750 1698 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248978.1 protein_id gnl|my_center|LOCUS_15750 2762 1755 gene locus_tag LOCUS_15760 2762 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 3126 2782 gene locus_tag LOCUS_15770 3126 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15770 >Feature sequence149 1166 918 gene locus_tag LOCUS_15780 1166 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 1248 2792 gene locus_tag LOCUS_15790 1248 2792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 <3509 2799 gene locus_tag LOCUS_15800 <3509 2799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978586.1:DUF1614 domain-containing protein >Feature sequence150 128 1300 gene locus_tag LOCUS_15810 128 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1454 2911 gene locus_tag LOCUS_15820 1454 2911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 <3492 2912 gene locus_tag LOCUS_15830 <3492 2912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868855.1:triose-phosphate isomerase >Feature sequence151 249 479 gene locus_tag LOCUS_15840 249 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15840 1363 482 gene locus_tag LOCUS_15850 1363 482 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023142.1 protein_id gnl|my_center|LOCUS_15850 1937 1449 gene locus_tag LOCUS_15860 1937 1449 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080283.1 protein_id gnl|my_center|LOCUS_15860 2042 2716 gene locus_tag LOCUS_15870 2042 2716 CDS product DUF1122 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881283.1 protein_id gnl|my_center|LOCUS_15870 3078 2734 gene locus_tag LOCUS_15880 3078 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15880 3098 3107 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence152 <1 651 gene locus_tag LOCUS_15890 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867706.1:Mrp/NBP35 family ATP-binding protein 774 1712 gene locus_tag LOCUS_15900 774 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 2353 1709 gene locus_tag LOCUS_15910 gene upp 2353 1709 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763370.1 protein_id gnl|my_center|LOCUS_15910 3262 2393 gene locus_tag LOCUS_15920 3262 2393 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846193.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence153 172 1080 gene locus_tag LOCUS_15930 172 1080 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_127580519.1 protein_id gnl|my_center|LOCUS_15930 1064 1924 gene locus_tag LOCUS_15940 1064 1924 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258586.1 protein_id gnl|my_center|LOCUS_15940 1931 3037 gene locus_tag LOCUS_15950 1931 3037 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence154 1813 662 gene locus_tag LOCUS_15960 gene cdvC 1813 662 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_15960 2664 1870 gene locus_tag LOCUS_15970 2664 1870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence155 611 1357 gene locus_tag LOCUS_15980 611 1357 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_15980 2606 1338 gene locus_tag LOCUS_15990 2606 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 3351 2593 gene locus_tag LOCUS_16000 3351 2593 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846775.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence156 227 1258 gene locus_tag LOCUS_16010 227 1258 CDS product UDP-N-acetylglucosamine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868280.1 protein_id gnl|my_center|LOCUS_16010 1279 1995 gene locus_tag LOCUS_16020 1279 1995 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763299.1 protein_id gnl|my_center|LOCUS_16020 1992 3341 gene locus_tag LOCUS_16030 1992 3341 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762251.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence157 1210 359 gene locus_tag LOCUS_16040 1210 359 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867384.1 protein_id gnl|my_center|LOCUS_16040 2694 1297 gene locus_tag LOCUS_16050 2694 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence158 1373 417 gene locus_tag LOCUS_16060 1373 417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1514 1523 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2424 1978 gene locus_tag LOCUS_16070 2424 1978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence159 1476 532 gene locus_tag LOCUS_16080 1476 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 2344 1469 gene locus_tag LOCUS_16090 2344 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 <3250 2429 gene locus_tag LOCUS_16100 <3250 2429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005418795.1:SLC13 family permease >Feature sequence160 530 258 gene locus_tag LOCUS_16110 530 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 700 2940 gene locus_tag LOCUS_16120 700 2940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence161 728 438 gene locus_tag LOCUS_16130 728 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1718 732 gene locus_tag LOCUS_16140 gene cas1 1718 732 CDS product CRISPR-associated endonuclease Cas1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_069168166.1 protein_id gnl|my_center|LOCUS_16140 2551 1715 gene locus_tag LOCUS_16150 gene cas4a 2551 1715 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980726.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence162 1677 1228 gene locus_tag LOCUS_16160 1677 1228 CDS product Lsm family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846267.1 protein_id gnl|my_center|LOCUS_16160 1775 2128 gene locus_tag LOCUS_16170 1775 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 2211 2555 gene locus_tag LOCUS_16180 2211 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence163 772 128 gene locus_tag LOCUS_16190 gene cas4 772 128 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847033.1 protein_id gnl|my_center|LOCUS_16190 1220 765 gene locus_tag LOCUS_16200 1220 765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 1765 1217 gene locus_tag LOCUS_16210 gene cyaB 1765 1217 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762860.1 protein_id gnl|my_center|LOCUS_16210 2790 1750 gene locus_tag LOCUS_16220 2790 1750 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868269.1 protein_id gnl|my_center|LOCUS_16220 >Feature sequence164 2518 884 gene locus_tag LOCUS_16230 2518 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 2999 2541 gene locus_tag LOCUS_16240 2999 2541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence165 >Feature sequence166 190 843 gene locus_tag LOCUS_16250 190 843 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020150.1 protein_id gnl|my_center|LOCUS_16250 2756 840 gene locus_tag LOCUS_16260 2756 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence167 426 1175 gene locus_tag LOCUS_16270 426 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 2270 1344 gene locus_tag LOCUS_16280 2270 1344 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876013.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence168 2060 2578 gene locus_tag LOCUS_16290 2060 2578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence169 <1 731 gene locus_tag LOCUS_16300 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980334.1:ATP-binding protein 2193 733 gene locus_tag LOCUS_16310 2193 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 2865 2284 gene locus_tag LOCUS_16320 gene pgsA 2865 2284 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979475.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence170 113 1117 gene locus_tag LOCUS_16330 113 1117 CDS product zinc-dependent alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941236.1 protein_id gnl|my_center|LOCUS_16330 1124 1597 gene locus_tag LOCUS_16340 1124 1597 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_16340 2146 1586 gene locus_tag LOCUS_16350 2146 1586 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146540.1 protein_id gnl|my_center|LOCUS_16350 2552 2848 gene locus_tag LOCUS_16360 2552 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 >Feature sequence171 >Feature sequence172 552 103 gene locus_tag LOCUS_16370 552 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 <3052 2548 gene locus_tag LOCUS_16380 <3052 2548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011013783.1:ABC transporter ATP-binding protein >Feature sequence173 983 1252 gene locus_tag LOCUS_16390 983 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 1221 1652 gene locus_tag LOCUS_16400 1221 1652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16400 2950 1649 gene locus_tag LOCUS_16410 2950 1649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence174 1681 551 gene locus_tag LOCUS_16420 1681 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16420 2996 1695 gene locus_tag LOCUS_16430 2996 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16430 >Feature sequence175 942 2372 gene locus_tag LOCUS_16440 942 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16440 <2988 2409 gene locus_tag LOCUS_16450 <2988 2409 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763642.1:DUF3782 domain-containing protein >Feature sequence176 12 1133 gene locus_tag LOCUS_16460 12 1133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16460 1137 2135 gene locus_tag LOCUS_16470 1137 2135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 2140 2877 gene locus_tag LOCUS_16480 2140 2877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence177 14 1144 gene locus_tag LOCUS_16490 14 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 1203 2075 gene locus_tag LOCUS_16500 1203 2075 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978336.1 protein_id gnl|my_center|LOCUS_16500 2044 2409 gene locus_tag LOCUS_16510 2044 2409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16510 2821 2426 gene locus_tag LOCUS_16520 2821 2426 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979318.1 protein_id gnl|my_center|LOCUS_16520 >Feature sequence178 787 428 gene locus_tag LOCUS_16530 787 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 1217 2881 gene locus_tag LOCUS_16540 gene iorA 1217 2881 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249091.1 protein_id gnl|my_center|LOCUS_16540 >Feature sequence179 >Feature sequence180 484 1599 gene locus_tag LOCUS_16550 484 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16550 1982 2704 gene locus_tag LOCUS_16560 1982 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence181 1552 1274 gene locus_tag LOCUS_16570 1552 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16570 2631 1663 gene locus_tag LOCUS_16580 2631 1663 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240546.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence182 1030 32 gene locus_tag LOCUS_16590 1030 32 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 1110 1253 gene locus_tag LOCUS_16600 1110 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 1601 1287 gene locus_tag LOCUS_16610 1601 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 1895 1650 gene locus_tag LOCUS_16620 1895 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16620 >Feature sequence183 1756 644 gene locus_tag LOCUS_16630 1756 644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 1897 2310 gene locus_tag LOCUS_16640 1897 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16640 >Feature sequence184 3 461 gene locus_tag LOCUS_16650 3 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16650 1333 458 gene locus_tag LOCUS_16660 1333 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16660 >Feature sequence185 52 1299 gene locus_tag LOCUS_16670 52 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763651.1 protein_id gnl|my_center|LOCUS_16670 >Feature sequence186 1 267 gene locus_tag LOCUS_16680 1 267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 908 264 gene locus_tag LOCUS_16690 908 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16690 993 1877 gene locus_tag LOCUS_16700 993 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763101.1 protein_id gnl|my_center|LOCUS_16700 1831 2610 gene locus_tag LOCUS_16710 1831 2610 CDS product 4-phosphopantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763098.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence187 1054 404 gene locus_tag LOCUS_16720 1054 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16720 2430 1051 gene locus_tag LOCUS_16730 2430 1051 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022191.1 protein_id gnl|my_center|LOCUS_16730 >Feature sequence188 <1 601 gene locus_tag LOCUS_16740 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005816806.1:DUF47 family protein 2104 608 gene locus_tag LOCUS_16750 gene pepA 2104 608 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707422.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence189 1598 1401 gene locus_tag LOCUS_16760 1598 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 1840 2280 gene locus_tag LOCUS_16770 1840 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16770 >Feature sequence190 39 2516 gene locus_tag LOCUS_16780 39 2516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16780 >Feature sequence191 <1 528 gene locus_tag LOCUS_16790 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582434.1:alkaline phosphatase family protein 482 491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1077 499 gene locus_tag LOCUS_16800 1077 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 1199 2170 gene locus_tag LOCUS_16810 1199 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 <2700 2179 gene locus_tag LOCUS_16820 <2700 2179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392739.1:molybdopterin-dependent oxidoreductase >Feature sequence192 1974 2279 gene locus_tag LOCUS_16830 1974 2279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 2306 2644 gene locus_tag LOCUS_16840 2306 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16840 >Feature sequence193 2425 338 gene locus_tag LOCUS_16850 gene feoB 2425 338 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249665.1 protein_id gnl|my_center|LOCUS_16850 >Feature sequence194 550 1545 gene locus_tag LOCUS_16860 550 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 2372 1608 gene locus_tag LOCUS_16870 2372 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence195 1322 105 gene locus_tag LOCUS_16880 1322 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16880 1909 1625 gene locus_tag LOCUS_16890 1909 1625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 <2612 1993 gene locus_tag LOCUS_16900 <2612 1993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869178.1:ornithine carbamoyltransferase >Feature sequence196 1722 1093 gene locus_tag LOCUS_16910 1722 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 1838 2302 gene locus_tag LOCUS_16920 1838 2302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16920 >Feature sequence197 1564 2283 gene locus_tag LOCUS_16930 1564 2283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16930 >Feature sequence198 1602 1477 gene locus_tag LOCUS_16940 1602 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16940 1884 1666 gene locus_tag LOCUS_16950 1884 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 1787 2035 gene locus_tag LOCUS_16960 1787 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 >Feature sequence199 1955 189 gene locus_tag LOCUS_16970 1955 189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16970 >Feature sequence200 1415 1068 gene locus_tag LOCUS_16980 1415 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16980 1692 1378 gene locus_tag LOCUS_16990 1692 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 2391 1837 gene locus_tag LOCUS_17000 gene dps 2391 1837 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250010.1 protein_id gnl|my_center|LOCUS_17000 >Feature sequence201 <1 1962 gene locus_tag LOCUS_17010 <1 1962 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198429806.1:ATP-dependent helicase 2208 1945 gene locus_tag LOCUS_17020 2208 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 >Feature sequence202 900 1352 gene locus_tag LOCUS_17030 gene rimI 900 1352 CDS product ribosomal protein S18-alanine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868792.1 protein_id gnl|my_center|LOCUS_17030 1669 1436 gene locus_tag LOCUS_17040 1669 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17040 1951 1715 gene locus_tag LOCUS_17050 1951 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17050 >Feature sequence203 2144 1974 gene locus_tag LOCUS_17060 2144 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 >Feature sequence204 742 2073 gene locus_tag LOCUS_17070 gene rbcL 742 2073 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879134.1 protein_id gnl|my_center|LOCUS_17070 2213 2076 gene locus_tag LOCUS_17080 2213 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17080 >Feature sequence205 >Feature sequence206 636 196 gene locus_tag LOCUS_17090 636 196 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095528.1 protein_id gnl|my_center|LOCUS_17090 810 646 gene locus_tag LOCUS_17100 810 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 1351 1275 gene locus_tag LOCUS_t00190 1351 1275 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2107 1403 gene locus_tag LOCUS_17110 2107 1403 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249663.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence207 1295 369 gene locus_tag LOCUS_17120 1295 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17120 <2284 1347 gene locus_tag LOCUS_17130 <2284 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250659.1:NAD-dependent epimerase/dehydratase family protein >Feature sequence208 218 1141 gene locus_tag LOCUS_17140 218 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17140 1138 1455 gene locus_tag LOCUS_17150 1138 1455 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868508.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence209 531 157 gene locus_tag LOCUS_17160 531 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 779 534 gene locus_tag LOCUS_17170 779 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17170 >Feature sequence210 1361 969 gene locus_tag LOCUS_17180 1361 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 <2205 1457 gene locus_tag LOCUS_17190 <2205 1457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001020381.1:selenium-dependent molybdenum cofactor biosynthesis protein YqeB >Feature sequence211 912 616 gene locus_tag LOCUS_17200 912 616 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147037.1 protein_id gnl|my_center|LOCUS_17200 1295 909 gene locus_tag LOCUS_17210 gene mnhG 1295 909 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868588.1 protein_id gnl|my_center|LOCUS_17210 1591 1298 gene locus_tag LOCUS_17220 1591 1298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17220 2071 1610 gene locus_tag LOCUS_17230 gene nuoI 2071 1610 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258756.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence212 >Feature sequence213 1380 1304 gene locus_tag LOCUS_t00200 1380 1304 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence214 1798 1529 gene locus_tag LOCUS_17240 1798 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17240 2036 1917 gene locus_tag LOCUS_17250 2036 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence215 1550 444 gene locus_tag LOCUS_17260 1550 444 CDS product family 1 encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763151.1 protein_id gnl|my_center|LOCUS_17260 1950 1573 gene locus_tag LOCUS_17270 1950 1573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence216 437 147 gene locus_tag LOCUS_17280 437 147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17280 1051 635 gene locus_tag LOCUS_17290 1051 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 1810 1262 gene locus_tag LOCUS_17300 1810 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence217 <1 1540 gene locus_tag LOCUS_17310 <1 1540 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868584.1:proton-conducting transporter membrane subunit 1547 1909 gene locus_tag LOCUS_17320 1547 1909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17320 >Feature sequence218 610 1749 gene locus_tag LOCUS_17330 610 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17330 >Feature sequence219 375 109 gene locus_tag LOCUS_17340 375 109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 914 480 gene locus_tag LOCUS_17350 914 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 <1907 1038 gene locus_tag LOCUS_17360 <1907 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876179.1:SMC family ATPase >Feature sequence220 95 1078 gene locus_tag LOCUS_17370 95 1078 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978561.1 protein_id gnl|my_center|LOCUS_17370 >Feature sequence221 662 1849 gene locus_tag LOCUS_17380 662 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence222 270 16 gene locus_tag LOCUS_17390 270 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 550 239 gene locus_tag LOCUS_17400 550 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 730 1800 gene locus_tag LOCUS_17410 730 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17410 >Feature sequence223 <1 598 gene locus_tag LOCUS_17420 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846870.1:DNA repair and recombination protein RadA 1423 611 gene locus_tag LOCUS_17430 1423 611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1435 1797 gene locus_tag LOCUS_17440 1435 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence224 1211 381 gene locus_tag LOCUS_17450 1211 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17450 1468 1214 gene locus_tag LOCUS_17460 1468 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17460 >Feature sequence225 74 907 gene locus_tag LOCUS_17470 74 907 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980630.1 protein_id gnl|my_center|LOCUS_17470 1109 957 gene locus_tag LOCUS_17480 1109 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 <1791 1102 gene locus_tag LOCUS_17490 <1791 1102 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064397.1:ABC transporter permease >Feature sequence226 899 1687 gene locus_tag LOCUS_17500 899 1687 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249603.1 protein_id gnl|my_center|LOCUS_17500 >Feature sequence227 >Feature sequence228 172 840 gene locus_tag LOCUS_17510 172 840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17510 >Feature sequence229 273 692 gene locus_tag LOCUS_17520 273 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17520 799 1653 gene locus_tag LOCUS_17530 gene speE 799 1653 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763050.1 protein_id gnl|my_center|LOCUS_17530 >Feature sequence230 >Feature sequence231 <1 1238 gene locus_tag LOCUS_17540 <1 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584105.1:glycoside hydrolase family 38 C-terminal domain-containing protein 1296 1445 gene locus_tag LOCUS_17550 1296 1445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 >Feature sequence232 360 542 gene locus_tag LOCUS_17560 gene cc1 360 542 CDS product DNA-binding protein CC1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240420.1 protein_id gnl|my_center|LOCUS_17560 1440 601 gene locus_tag LOCUS_17570 1440 601 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240504.1 protein_id gnl|my_center|LOCUS_17570 >Feature sequence233 277 1467 gene locus_tag LOCUS_17580 277 1467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17580 >Feature sequence234 304 1047 gene locus_tag LOCUS_17590 304 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17590 >Feature sequence235 149 448 gene locus_tag LOCUS_17600 149 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 >Feature sequence236 <1511 407 gene locus_tag LOCUS_17610 <1511 407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928857.1:glycosyltransferase family 4 protein >Feature sequence237 >Feature sequence238 325 179 gene locus_tag LOCUS_17620 325 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1082 609 gene locus_tag LOCUS_17630 1082 609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 1314 1075 gene locus_tag LOCUS_17640 1314 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640