>Feature sequence001 1205 537 gene locus_tag LOCUS_0010 gene phoU 1205 537 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545517.1 protein_id gnl|my_center|LOCUS_0010 1361 2056 gene locus_tag LOCUS_0020 1361 2056 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_0020 2272 3891 gene locus_tag LOCUS_0030 2272 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0030 4744 3872 gene locus_tag LOCUS_0040 gene pstB 4744 3872 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_033448479.1 protein_id gnl|my_center|LOCUS_0040 5618 4761 gene locus_tag LOCUS_0050 gene pstA 5618 4761 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809638.1 protein_id gnl|my_center|LOCUS_0050 6562 5615 gene locus_tag LOCUS_0060 gene pstC 6562 5615 CDS product phosphate ABC transporter permease PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193912.1 protein_id gnl|my_center|LOCUS_0060 7802 6744 gene locus_tag LOCUS_0070 gene pstS 7802 6744 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809635.1 protein_id gnl|my_center|LOCUS_0070 8250 9416 gene locus_tag LOCUS_0080 8250 9416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0080 10009 9578 gene locus_tag LOCUS_0090 10009 9578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0090 11252 10071 gene locus_tag LOCUS_0100 gene hmeB 11252 10071 CDS product Hdr-like menaquinol oxidoreductase integral membrane subunit HmeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878007.1 protein_id gnl|my_center|LOCUS_0100 >Feature sequence002 511 3633 gene locus_tag LOCUS_0110 511 3633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0110 3764 4900 gene locus_tag LOCUS_0120 3764 4900 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929473.1 protein_id gnl|my_center|LOCUS_0120 5129 4923 gene locus_tag LOCUS_0130 gene secE2 5129 4923 CDS product calcium dodecin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003401885.1 protein_id gnl|my_center|LOCUS_0130 5480 6547 gene locus_tag LOCUS_0140 5480 6547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0140 7216 7443 gene locus_tag LOCUS_0150 7216 7443 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143545.1 protein_id gnl|my_center|LOCUS_0150 7443 7829 gene locus_tag LOCUS_0160 7443 7829 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142022.1 protein_id gnl|my_center|LOCUS_0160 8385 9479 gene locus_tag LOCUS_0170 8385 9479 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024118841.1 protein_id gnl|my_center|LOCUS_0170 10335 9799 gene locus_tag LOCUS_0180 10335 9799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0180 10475 11071 gene locus_tag LOCUS_0190 gene yedF 10475 11071 CDS product sulfurtransferase-like selenium metabolism protein YedF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938959.1 protein_id gnl|my_center|LOCUS_0190 11248 12177 gene locus_tag LOCUS_0200 11248 12177 CDS product diguanylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943987.1 protein_id gnl|my_center|LOCUS_0200 >Feature sequence003 433 442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2898 2281 gene locus_tag LOCUS_0210 gene cobC 2898 2281 CDS product alpha-ribazole phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914029.1 protein_id gnl|my_center|LOCUS_0210 3572 2886 gene locus_tag LOCUS_0220 gene cobS 3572 2886 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257084.1 protein_id gnl|my_center|LOCUS_0220 4298 3654 gene locus_tag LOCUS_0230 4298 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939499.1 protein_id gnl|my_center|LOCUS_0230 6576 4306 gene locus_tag LOCUS_0240 6576 4306 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha/beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939500.1 protein_id gnl|my_center|LOCUS_0240 8099 6609 gene locus_tag LOCUS_0250 8099 6609 CDS product biotin carboxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939501.1 protein_id gnl|my_center|LOCUS_0250 8249 8686 gene locus_tag LOCUS_0260 gene speD 8249 8686 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014510642.1 protein_id gnl|my_center|LOCUS_0260 8692 9567 gene locus_tag LOCUS_0270 gene speB 8692 9567 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583766.1 protein_id gnl|my_center|LOCUS_0270 9740 9952 gene locus_tag LOCUS_0280 9740 9952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0280 9984 10991 gene locus_tag LOCUS_0290 gene dusB 9984 10991 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015942604.1 protein_id gnl|my_center|LOCUS_0290 11695 10988 gene locus_tag LOCUS_0300 11695 10988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0300 12010 11711 gene locus_tag LOCUS_0310 12010 11711 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_0310 >Feature sequence004 1339 47 gene locus_tag LOCUS_0320 1339 47 CDS product phosphoribosylaminoimidazolecarboxamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791443.1 protein_id gnl|my_center|LOCUS_0320 2112 1351 gene locus_tag LOCUS_0330 2112 1351 CDS product DsbC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881368.1 protein_id gnl|my_center|LOCUS_0330 3886 2162 gene locus_tag LOCUS_0340 3886 2162 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940470.1 protein_id gnl|my_center|LOCUS_0340 4016 4543 gene locus_tag LOCUS_0350 gene yfcD 4016 4543 CDS product NUDIX hydrolase YfcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365574.1 protein_id gnl|my_center|LOCUS_0350 5951 4518 gene locus_tag LOCUS_0360 5951 4518 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938245.1 protein_id gnl|my_center|LOCUS_0360 7432 5966 gene locus_tag LOCUS_0370 gene guaB 7432 5966 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546759.1 protein_id gnl|my_center|LOCUS_0370 8375 7395 gene locus_tag LOCUS_0380 8375 7395 CDS product exopolyphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942386.1 protein_id gnl|my_center|LOCUS_0380 8546 8731 gene locus_tag LOCUS_0390 8546 8731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0390 >Feature sequence005 1444 905 gene locus_tag LOCUS_0400 1444 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0400 2805 1363 gene locus_tag LOCUS_0410 2805 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0410 2930 4378 gene locus_tag LOCUS_0420 gene glrR 2930 4378 CDS product two-component system response regulator GlrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000625590.1 protein_id gnl|my_center|LOCUS_0420 4703 7138 gene locus_tag LOCUS_0430 gene ppsA 4703 7138 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_0430 8438 7215 gene locus_tag LOCUS_0440 8438 7215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939755.1 protein_id gnl|my_center|LOCUS_0440 9113 8442 gene locus_tag LOCUS_0450 9113 8442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0450 >Feature sequence006 276 575 gene locus_tag LOCUS_0460 276 575 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868881.1 protein_id gnl|my_center|LOCUS_0460 578 1210 gene locus_tag LOCUS_0470 578 1210 CDS product V-type proton ATPase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496425.1 protein_id gnl|my_center|LOCUS_0470 1267 1276 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1302 3020 gene locus_tag LOCUS_0480 1302 3020 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_0480 3004 4446 gene locus_tag LOCUS_0490 3004 4446 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_0490 4409 5029 gene locus_tag LOCUS_0500 4409 5029 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_183773554.1 protein_id gnl|my_center|LOCUS_0500 5054 5515 gene locus_tag LOCUS_0510 5054 5515 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496534.1 protein_id gnl|my_center|LOCUS_0510 6049 5600 gene locus_tag LOCUS_0520 6049 5600 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228706.1 protein_id gnl|my_center|LOCUS_0520 6303 7475 gene locus_tag LOCUS_0530 6303 7475 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080839.1 protein_id gnl|my_center|LOCUS_0530 <7996 7447 gene locus_tag LOCUS_0540 <7996 7447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294586.1:twin-arginine translocase subunit TatC >Feature sequence007 164 1348 gene locus_tag LOCUS_0550 164 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0550 2172 3401 gene locus_tag LOCUS_0560 2172 3401 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_211292884.1 protein_id gnl|my_center|LOCUS_0560 3445 4662 gene locus_tag LOCUS_0570 3445 4662 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938527.1 protein_id gnl|my_center|LOCUS_0570 4678 5016 gene locus_tag LOCUS_0580 4678 5016 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942480.1 protein_id gnl|my_center|LOCUS_0580 >Feature sequence008 <1 761 gene locus_tag LOCUS_0590 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940787.1:F0F1 ATP synthase subunit alpha 775 1662 gene locus_tag LOCUS_0600 775 1662 CDS product F0F1 ATP synthase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938077.1 protein_id gnl|my_center|LOCUS_0600 1713 3116 gene locus_tag LOCUS_0610 gene atpD 1713 3116 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938076.1 protein_id gnl|my_center|LOCUS_0610 3133 3549 gene locus_tag LOCUS_0620 3133 3549 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938075.1 protein_id gnl|my_center|LOCUS_0620 3629 4597 gene locus_tag LOCUS_0630 3629 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0630 4638 4937 gene locus_tag LOCUS_0640 4638 4937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0640 4956 5249 gene locus_tag LOCUS_0650 4956 5249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0650 >Feature sequence009 <1 965 gene locus_tag LOCUS_0660 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545225.1:elongation factor G 1079 1642 gene locus_tag LOCUS_0670 gene efp 1079 1642 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942396.1 protein_id gnl|my_center|LOCUS_0670 1899 1702 gene locus_tag LOCUS_0680 1899 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0680 1852 2574 gene locus_tag LOCUS_0690 gene epmA 1852 2574 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942397.1 protein_id gnl|my_center|LOCUS_0690 2805 4055 gene locus_tag LOCUS_0700 2805 4055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0700 4077 6206 gene locus_tag LOCUS_0710 4077 6206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0710 6655 6272 gene locus_tag LOCUS_0720 6655 6272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0720 >Feature sequence010 1649 495 gene locus_tag LOCUS_0730 1649 495 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546260.1 protein_id gnl|my_center|LOCUS_0730 2114 1830 gene locus_tag LOCUS_0740 2114 1830 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0740 3073 2219 gene locus_tag LOCUS_0750 3073 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0750 3576 3070 gene locus_tag LOCUS_0760 gene bcp 3576 3070 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_0760 3943 3569 gene locus_tag LOCUS_0770 3943 3569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0770 4958 3957 gene locus_tag LOCUS_0780 4958 3957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0780 5024 5587 gene locus_tag LOCUS_0790 5024 5587 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937640.1 protein_id gnl|my_center|LOCUS_0790 5577 6290 gene locus_tag LOCUS_0800 5577 6290 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021328.1 protein_id gnl|my_center|LOCUS_0800 >Feature sequence011 344 1924 gene locus_tag LOCUS_0810 344 1924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0810 2446 3603 gene locus_tag LOCUS_0820 2446 3603 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583297.1 protein_id gnl|my_center|LOCUS_0820 4106 4480 gene locus_tag LOCUS_0830 4106 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_0830 4483 5364 gene locus_tag LOCUS_0840 4483 5364 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002674209.1 protein_id gnl|my_center|LOCUS_0840 5988 5827 gene locus_tag LOCUS_0850 5988 5827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0850 >Feature sequence012 517 167 gene locus_tag LOCUS_0860 517 167 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937898.1 protein_id gnl|my_center|LOCUS_0860 2255 597 gene locus_tag LOCUS_0870 gene ilvD 2255 597 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393742.1 protein_id gnl|my_center|LOCUS_0870 2896 2294 gene locus_tag LOCUS_0880 2896 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0880 4486 2966 gene locus_tag LOCUS_0890 4486 2966 CDS product TIGR03663 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023977.1 protein_id gnl|my_center|LOCUS_0890 <6219 4483 gene locus_tag LOCUS_0900 <6219 4483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065896.1:DUF2298 domain-containing protein >Feature sequence013 393 1037 gene locus_tag LOCUS_0910 393 1037 CDS product CBS and ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228227.1 protein_id gnl|my_center|LOCUS_0910 1046 1756 gene locus_tag LOCUS_0920 gene bioD 1046 1756 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002225454.1 protein_id gnl|my_center|LOCUS_0920 1753 2547 gene locus_tag LOCUS_0930 gene cobJ 1753 2547 CDS product precorrin-3B C(17)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392608.1 protein_id gnl|my_center|LOCUS_0930 2627 3442 gene locus_tag LOCUS_0940 2627 3442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0940 >Feature sequence014 2344 605 gene locus_tag LOCUS_0950 2344 605 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266274.1 protein_id gnl|my_center|LOCUS_0950 2445 3362 gene locus_tag LOCUS_0960 gene prmA 2445 3362 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941115.1 protein_id gnl|my_center|LOCUS_0960 3329 4117 gene locus_tag LOCUS_0970 3329 4117 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257708.1 protein_id gnl|my_center|LOCUS_0970 4114 5232 gene locus_tag LOCUS_0980 4114 5232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0980 5282 5839 gene locus_tag LOCUS_0990 5282 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_0990 >Feature sequence015 681 1865 gene locus_tag LOCUS_1000 681 1865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1000 2686 1862 gene locus_tag LOCUS_1010 2686 1862 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707235.1 protein_id gnl|my_center|LOCUS_1010 3386 2718 gene locus_tag LOCUS_1020 gene phoU 3386 2718 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007326666.1 protein_id gnl|my_center|LOCUS_1020 3542 4237 gene locus_tag LOCUS_1030 3542 4237 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272485.1 protein_id gnl|my_center|LOCUS_1030 >Feature sequence016 461 2227 gene locus_tag LOCUS_1040 461 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1040 2727 2224 gene locus_tag LOCUS_1050 2727 2224 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943377.1 protein_id gnl|my_center|LOCUS_1050 3023 3223 gene locus_tag LOCUS_1060 gene cspB 3023 3223 CDS product cold shock-like protein CspB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003224086.1 protein_id gnl|my_center|LOCUS_1060 4626 3316 gene locus_tag LOCUS_1070 4626 3316 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545534.1 protein_id gnl|my_center|LOCUS_1070 5368 4634 gene locus_tag LOCUS_1080 5368 4634 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942375.1 protein_id gnl|my_center|LOCUS_1080 >Feature sequence017 373 1386 gene locus_tag LOCUS_1090 gene aroF 373 1386 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943946.1 protein_id gnl|my_center|LOCUS_1090 1441 1516 gene locus_tag LOCUS_t0010 1441 1516 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1642 1938 gene locus_tag LOCUS_1100 1642 1938 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927166.1 protein_id gnl|my_center|LOCUS_1100 2070 2978 gene locus_tag LOCUS_1110 2070 2978 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002667700.1 protein_id gnl|my_center|LOCUS_1110 2944 3537 gene locus_tag LOCUS_1120 2944 3537 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545768.1 protein_id gnl|my_center|LOCUS_1120 3561 3728 gene locus_tag LOCUS_1130 3561 3728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1130 3767 4327 gene locus_tag LOCUS_1140 3767 4327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791841.1 protein_id gnl|my_center|LOCUS_1140 4331 5416 gene locus_tag LOCUS_1150 4331 5416 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545158.1 protein_id gnl|my_center|LOCUS_1150 >Feature sequence018 934 1692 gene locus_tag LOCUS_1160 934 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1160 2214 1708 gene locus_tag LOCUS_1170 2214 1708 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583213.1 protein_id gnl|my_center|LOCUS_1170 3585 2230 gene locus_tag LOCUS_1180 gene miaB 3585 2230 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545886.1 protein_id gnl|my_center|LOCUS_1180 5181 3598 gene locus_tag LOCUS_1190 5181 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1190 >Feature sequence019 72 1529 gene locus_tag LOCUS_1200 72 1529 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877731.1 protein_id gnl|my_center|LOCUS_1200 1531 3567 gene locus_tag LOCUS_1210 1531 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1210 3560 4348 gene locus_tag LOCUS_1220 3560 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1220 4430 4945 gene locus_tag LOCUS_1230 4430 4945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1230 4961 5248 gene locus_tag LOCUS_1240 4961 5248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1240 >Feature sequence020 1738 593 gene locus_tag LOCUS_1250 1738 593 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943707.1 protein_id gnl|my_center|LOCUS_1250 3392 1767 gene locus_tag LOCUS_1260 3392 1767 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_1260 4472 3609 gene locus_tag LOCUS_1270 4472 3609 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545968.1 protein_id gnl|my_center|LOCUS_1270 <5449 4469 gene locus_tag LOCUS_1280 <5449 4469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938860.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence021 <1 2295 gene locus_tag LOCUS_1290 <1 2295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943492.1:DNA-directed RNA polymerase subunit beta' 2361 3041 gene locus_tag LOCUS_1300 2361 3041 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933301.1 protein_id gnl|my_center|LOCUS_1300 3329 3057 gene locus_tag LOCUS_1310 3329 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1310 5363 3345 gene locus_tag LOCUS_1320 gene ligA 5363 3345 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545963.1 protein_id gnl|my_center|LOCUS_1320 >Feature sequence022 277 107 gene locus_tag LOCUS_1330 277 107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1330 1329 298 gene locus_tag LOCUS_1340 gene cas1c 1329 298 CDS product type I-C CRISPR-associated endonuclease Cas1c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011176711.1 protein_id gnl|my_center|LOCUS_1340 1775 1326 gene locus_tag LOCUS_1350 1775 1326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1350 2425 2204 gene locus_tag LOCUS_1360 2425 2204 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022341.1 protein_id gnl|my_center|LOCUS_1360 3176 2697 gene locus_tag LOCUS_1370 3176 2697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1370 5236 4904 gene locus_tag LOCUS_1380 5236 4904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1380 >Feature sequence023 80 349 gene locus_tag LOCUS_1390 80 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1390 356 1204 gene locus_tag LOCUS_1400 gene speE 356 1204 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424691.1 protein_id gnl|my_center|LOCUS_1400 1201 2385 gene locus_tag LOCUS_1410 1201 2385 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037378411.1 protein_id gnl|my_center|LOCUS_1410 2426 3535 gene locus_tag LOCUS_1420 2426 3535 CDS product glutamate--cysteine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142291.1 protein_id gnl|my_center|LOCUS_1420 4451 3582 gene locus_tag LOCUS_1430 4451 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1430 <5372 4453 gene locus_tag LOCUS_1440 <5372 4453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056556.1:pentapeptide repeat-containing protein >Feature sequence024 2076 4178 gene locus_tag LOCUS_1450 2076 4178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1450 >Feature sequence025 791 534 gene locus_tag LOCUS_1460 791 534 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393102.1 protein_id gnl|my_center|LOCUS_1460 2558 891 gene locus_tag LOCUS_1470 2558 891 CDS product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 protein_id gnl|my_center|LOCUS_1470 2665 3249 gene locus_tag LOCUS_1480 2665 3249 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948893.1 protein_id gnl|my_center|LOCUS_1480 4131 3250 gene locus_tag LOCUS_1490 4131 3250 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963616.1 protein_id gnl|my_center|LOCUS_1490 4254 5228 gene locus_tag LOCUS_1500 4254 5228 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940692.1 protein_id gnl|my_center|LOCUS_1500 >Feature sequence026 673 20 gene locus_tag LOCUS_1510 673 20 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940238.1 protein_id gnl|my_center|LOCUS_1510 1674 685 gene locus_tag LOCUS_1520 gene ilvC 1674 685 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938673.1 protein_id gnl|my_center|LOCUS_1520 2180 1695 gene locus_tag LOCUS_1530 gene ilvN 2180 1695 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_1530 3948 2248 gene locus_tag LOCUS_1540 gene ilvB 3948 2248 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545836.1 protein_id gnl|my_center|LOCUS_1540 >Feature sequence027 <1 1670 gene locus_tag LOCUS_1550 <1 1670 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081461260.1:PAS domain S-box protein 4920 1726 gene locus_tag LOCUS_1560 4920 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1560 >Feature sequence028 45 1388 gene locus_tag LOCUS_1570 45 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1570 1388 1960 gene locus_tag LOCUS_1580 1388 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1580 1957 4002 gene locus_tag LOCUS_1590 gene exeD 1957 4002 CDS product GspD family T2SS secretin variant ExeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704540.1 protein_id gnl|my_center|LOCUS_1590 4002 4667 gene locus_tag LOCUS_1600 4002 4667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1600 >Feature sequence029 1 210 gene locus_tag LOCUS_1610 1 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1610 252 1148 gene locus_tag LOCUS_1620 gene flgL 252 1148 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392268.1 protein_id gnl|my_center|LOCUS_1620 1199 1459 gene locus_tag LOCUS_1630 1199 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1630 1471 1902 gene locus_tag LOCUS_1640 gene fliW 1471 1902 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156273801.1 protein_id gnl|my_center|LOCUS_1640 1967 2434 gene locus_tag LOCUS_1650 gene nrdR 1967 2434 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942330.1 protein_id gnl|my_center|LOCUS_1650 >Feature sequence030 18 94 gene locus_tag LOCUS_t0020 18 94 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 488 288 gene locus_tag LOCUS_1660 488 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1660 1329 571 gene locus_tag LOCUS_1670 1329 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1670 2888 2643 gene locus_tag LOCUS_1680 2888 2643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1680 4401 3208 gene locus_tag LOCUS_1690 4401 3208 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937546.1 protein_id gnl|my_center|LOCUS_1690 >Feature sequence031 <1 625 gene locus_tag LOCUS_1700 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053104374.1:bifunctional oligoribonuclease/PAP phosphatase NrnA 622 1569 gene locus_tag LOCUS_1710 gene truB 622 1569 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958222.1 protein_id gnl|my_center|LOCUS_1710 1614 1883 gene locus_tag LOCUS_1720 gene rpsO 1614 1883 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942237.1 protein_id gnl|my_center|LOCUS_1720 1913 3997 gene locus_tag LOCUS_1730 gene pnp 1913 3997 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_1730 >Feature sequence032 436 1281 gene locus_tag LOCUS_1740 gene ccsB 436 1281 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941276.1 protein_id gnl|my_center|LOCUS_1740 1303 1524 gene locus_tag LOCUS_1750 1303 1524 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938662.1 protein_id gnl|my_center|LOCUS_1750 1549 2457 gene locus_tag LOCUS_1760 1549 2457 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933711.1 protein_id gnl|my_center|LOCUS_1760 2467 3129 gene locus_tag LOCUS_1770 2467 3129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1770 3239 3427 gene locus_tag LOCUS_1780 3239 3427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1780 3441 4013 gene locus_tag LOCUS_1790 3441 4013 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104251.1 protein_id gnl|my_center|LOCUS_1790 >Feature sequence033 89 1171 gene locus_tag LOCUS_1800 gene flhB 89 1171 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392310.1 protein_id gnl|my_center|LOCUS_1800 1183 3285 gene locus_tag LOCUS_1810 gene flhA 1183 3285 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940490.1 protein_id gnl|my_center|LOCUS_1810 3300 4520 gene locus_tag LOCUS_1820 gene flhF 3300 4520 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_1820 >Feature sequence034 <1 1960 gene locus_tag LOCUS_1830 <1 1960 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546193.1:isoleucine--tRNA ligase 1988 2596 gene locus_tag LOCUS_1840 1988 2596 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064451.1 protein_id gnl|my_center|LOCUS_1840 2583 3497 gene locus_tag LOCUS_1850 gene rsmI 2583 3497 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_1850 3494 4252 gene locus_tag LOCUS_1860 gene kdsB 3494 4252 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422541.1 protein_id gnl|my_center|LOCUS_1860 >Feature sequence035 13 1056 gene locus_tag LOCUS_1870 gene hrcA 13 1056 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_1870 1061 1672 gene locus_tag LOCUS_1880 gene grpE 1061 1672 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000064038.1 protein_id gnl|my_center|LOCUS_1880 1742 3673 gene locus_tag LOCUS_1890 gene dnaK 1742 3673 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940711.1 protein_id gnl|my_center|LOCUS_1890 >Feature sequence036 183 410 gene locus_tag LOCUS_1900 183 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1900 420 695 gene locus_tag LOCUS_1910 420 695 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011171672.1 protein_id gnl|my_center|LOCUS_1910 2339 2461 gene locus_tag LOCUS_1920 2339 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1920 2504 2635 gene locus_tag LOCUS_1930 2504 2635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1930 2979 4181 gene locus_tag LOCUS_1940 2979 4181 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939045.1 protein_id gnl|my_center|LOCUS_1940 >Feature sequence037 239 865 gene locus_tag LOCUS_1950 239 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1950 852 2084 gene locus_tag LOCUS_1960 852 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1960 2098 3915 gene locus_tag LOCUS_1970 gene mshL 2098 3915 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545709.1 protein_id gnl|my_center|LOCUS_1970 >Feature sequence038 1722 334 gene locus_tag LOCUS_1980 1722 334 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941139.1 protein_id gnl|my_center|LOCUS_1980 1808 3586 gene locus_tag LOCUS_1990 1808 3586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_1990 3607 4215 gene locus_tag LOCUS_2000 3607 4215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2000 >Feature sequence039 1 645 gene locus_tag LOCUS_2010 1 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2010 740 1009 gene locus_tag LOCUS_2020 740 1009 CDS product type II toxin-antitoxin system Phd/YefM family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957712.1 protein_id gnl|my_center|LOCUS_2020 2607 2242 gene locus_tag LOCUS_2030 2607 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2030 <4210 2634 gene locus_tag LOCUS_2040 <4210 2634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940804.1:primosomal protein N' >Feature sequence040 1948 869 gene locus_tag LOCUS_2050 gene mraY 1948 869 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943697.1 protein_id gnl|my_center|LOCUS_2050 <4191 1948 gene locus_tag LOCUS_2060 <4191 1948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943698.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence041 1736 138 gene locus_tag LOCUS_2070 gene fliF 1736 138 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546552.1 protein_id gnl|my_center|LOCUS_2070 2093 1770 gene locus_tag LOCUS_2080 2093 1770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2080 2563 2108 gene locus_tag LOCUS_2090 gene flgC 2563 2108 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941076.1 protein_id gnl|my_center|LOCUS_2090 2985 2560 gene locus_tag LOCUS_2100 gene flgB 2985 2560 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035214564.1 protein_id gnl|my_center|LOCUS_2100 <4186 2993 gene locus_tag LOCUS_2110 <4186 2993 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011792552.1:sigma-54 dependent transcriptional regulator >Feature sequence042 626 1216 gene locus_tag LOCUS_2120 gene coaE 626 1216 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546225.1 protein_id gnl|my_center|LOCUS_2120 1812 1387 gene locus_tag LOCUS_2130 1812 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2130 2772 1882 gene locus_tag LOCUS_2140 2772 1882 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809481.1 protein_id gnl|my_center|LOCUS_2140 <4129 2769 gene locus_tag LOCUS_2150 <4129 2769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000937921.1:exodeoxyribonuclease VII large subunit >Feature sequence043 <1 1274 gene locus_tag LOCUS_2160 <1 1274 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943502.1:YgiQ family radical SAM protein 1261 2262 gene locus_tag LOCUS_2170 gene dusB 1261 2262 CDS product tRNA dihydrouridine synthase DusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256119.1 protein_id gnl|my_center|LOCUS_2170 2406 2861 gene locus_tag LOCUS_2180 2406 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001007332.1 protein_id gnl|my_center|LOCUS_2180 3728 2889 gene locus_tag LOCUS_2190 3728 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2190 >Feature sequence044 <1 708 gene locus_tag LOCUS_2200 <1 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880784.1:bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase 684 1502 gene locus_tag LOCUS_2210 gene ccsB 684 1502 CDS product c-type cytochrome biogenesis protein CcsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943894.1 protein_id gnl|my_center|LOCUS_2210 1492 2862 gene locus_tag LOCUS_2220 gene hemA 1492 2862 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938754.1 protein_id gnl|my_center|LOCUS_2220 3966 2878 gene locus_tag LOCUS_2230 3966 2878 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_2230 >Feature sequence045 <1 1122 gene locus_tag LOCUS_2240 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583238.1:type II secretion system ATPase GspE 1123 2328 gene locus_tag LOCUS_2250 1123 2328 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_2250 2315 2779 gene locus_tag LOCUS_2260 2315 2779 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246056.1 protein_id gnl|my_center|LOCUS_2260 2760 3203 gene locus_tag LOCUS_2270 2760 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2270 3200 3859 gene locus_tag LOCUS_2280 3200 3859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2280 >Feature sequence046 262 1860 gene locus_tag LOCUS_2290 262 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2290 1988 2914 gene locus_tag LOCUS_2300 1988 2914 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938638.1 protein_id gnl|my_center|LOCUS_2300 2925 3746 gene locus_tag LOCUS_2310 2925 3746 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876244.1 protein_id gnl|my_center|LOCUS_2310 >Feature sequence047 2124 1369 gene locus_tag LOCUS_2320 gene istB 2124 1369 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064816995.1 protein_id gnl|my_center|LOCUS_2320 3386 2121 gene locus_tag LOCUS_2330 3386 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_2330 3494 3503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence048 1050 310 gene locus_tag LOCUS_2340 gene trmD 1050 310 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941307.1 protein_id gnl|my_center|LOCUS_2340 1589 1047 gene locus_tag LOCUS_2350 gene rimM 1589 1047 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036397.1 protein_id gnl|my_center|LOCUS_2350 1921 1691 gene locus_tag LOCUS_2360 1921 1691 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938139.1 protein_id gnl|my_center|LOCUS_2360 2230 1985 gene locus_tag LOCUS_2370 gene rpsP 2230 1985 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357434.1 protein_id gnl|my_center|LOCUS_2370 3648 2317 gene locus_tag LOCUS_2380 gene ffh 3648 2317 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392481.1 protein_id gnl|my_center|LOCUS_2380 >Feature sequence049 <1 542 gene locus_tag LOCUS_2390 <1 542 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942106.1:proline--tRNA ligase 539 2689 gene locus_tag LOCUS_2400 539 2689 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942876.1 protein_id gnl|my_center|LOCUS_2400 2935 2726 gene locus_tag LOCUS_2410 gene rpmB 2935 2726 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547624.1 protein_id gnl|my_center|LOCUS_2410 3071 3412 gene locus_tag LOCUS_2420 3071 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2420 >Feature sequence050 3382 380 gene locus_tag LOCUS_2430 3382 380 CDS product type I restriction endonuclease subunit R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114402.1 protein_id gnl|my_center|LOCUS_2430 >Feature sequence051 <1 775 gene locus_tag LOCUS_2440 <1 775 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943636.1:cobyrinate a,c-diamide synthase 759 3437 gene locus_tag LOCUS_2450 759 3437 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085792.1 protein_id gnl|my_center|LOCUS_2450 >Feature sequence052 2216 651 gene locus_tag LOCUS_2460 2216 651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2460 3410 2295 gene locus_tag LOCUS_2470 3410 2295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2470 >Feature sequence053 <1 1652 gene locus_tag LOCUS_2480 <1 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001123098.1:DUF11 domain-containing protein >Feature sequence054 >Feature sequence055 780 1679 gene locus_tag LOCUS_2490 780 1679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2490 1831 2196 gene locus_tag LOCUS_2500 1831 2196 CDS product class III cytochrome C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546815.1 protein_id gnl|my_center|LOCUS_2500 2260 3000 gene locus_tag LOCUS_2510 2260 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2510 >Feature sequence056 1960 1001 gene locus_tag LOCUS_2520 1960 1001 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942903.1 protein_id gnl|my_center|LOCUS_2520 2787 1966 gene locus_tag LOCUS_2530 gene lpxI 2787 1966 CDS product UDP-2,3-diacylglucosamine diphosphatase LpxI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791912.1 protein_id gnl|my_center|LOCUS_2530 3581 2778 gene locus_tag LOCUS_2540 gene lpxA 3581 2778 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_2540 >Feature sequence057 416 1372 gene locus_tag LOCUS_2550 416 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2550 2096 1323 gene locus_tag LOCUS_2560 2096 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2560 3590 2238 gene locus_tag LOCUS_2570 3590 2238 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_2570 >Feature sequence058 836 2827 gene locus_tag LOCUS_2580 gene acs 836 2827 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940228.1 protein_id gnl|my_center|LOCUS_2580 >Feature sequence059 <1 936 gene locus_tag LOCUS_2590 <1 936 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942449.1:pyridoxine 5'-phosphate synthase 948 1325 gene locus_tag LOCUS_2600 948 1325 CDS product holo-[acyl-carrier-protein] synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939195.1 protein_id gnl|my_center|LOCUS_2600 2940 1423 gene locus_tag LOCUS_2610 2940 1423 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938736.1 protein_id gnl|my_center|LOCUS_2610 <3597 2974 gene locus_tag LOCUS_2620 <3597 2974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938737.1:flagellar hook assembly protein FlgD >Feature sequence060 <1 2645 gene locus_tag LOCUS_2630 <1 2645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546498.1:excinuclease ABC subunit UvrA 2726 3220 gene locus_tag LOCUS_2640 2726 3220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2640 >Feature sequence061 3051 1045 gene locus_tag LOCUS_2650 3051 1045 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_2650 >Feature sequence062 1595 624 gene locus_tag LOCUS_2660 gene arnC 1595 624 CDS product undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816394.1 protein_id gnl|my_center|LOCUS_2660 2602 1598 gene locus_tag LOCUS_2670 2602 1598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2670 2775 3353 gene locus_tag LOCUS_2680 2775 3353 CDS product flavodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020385.1 protein_id gnl|my_center|LOCUS_2680 >Feature sequence063 998 18 gene locus_tag LOCUS_2690 998 18 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041271909.1 protein_id gnl|my_center|LOCUS_2690 1933 1274 gene locus_tag LOCUS_2700 1933 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2700 3112 1943 gene locus_tag LOCUS_2710 3112 1943 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545245.1 protein_id gnl|my_center|LOCUS_2710 >Feature sequence064 170 1153 gene locus_tag LOCUS_2720 170 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2720 1077 2231 gene locus_tag LOCUS_2730 1077 2231 CDS product dipeptide epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029490874.1 protein_id gnl|my_center|LOCUS_2730 <3508 2279 gene locus_tag LOCUS_2740 <3508 2279 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880656.1:nicotinate phosphoribosyltransferase >Feature sequence065 1450 3447 gene locus_tag LOCUS_2750 1450 3447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2750 >Feature sequence066 705 1253 gene locus_tag LOCUS_2760 gene hslV 705 1253 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392543.1 protein_id gnl|my_center|LOCUS_2760 1250 2602 gene locus_tag LOCUS_2770 gene hslU 1250 2602 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880072.1 protein_id gnl|my_center|LOCUS_2770 >Feature sequence067 2690 1452 gene locus_tag LOCUS_2780 2690 1452 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939741.1 transl_except (pos:complement(1974..1976),aa:Sec) note codon on position 239 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_2780 >Feature sequence068 1958 267 gene locus_tag LOCUS_2790 gene iorA 1958 267 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877454.1 protein_id gnl|my_center|LOCUS_2790 2963 1980 gene locus_tag LOCUS_2800 2963 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2800 >Feature sequence069 1380 748 gene locus_tag LOCUS_2810 1380 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2810 1621 1364 gene locus_tag LOCUS_2820 1621 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2820 2295 1633 gene locus_tag LOCUS_2830 2295 1633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2830 3335 2364 gene locus_tag LOCUS_2840 3335 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2840 >Feature sequence070 307 393 gene locus_tag LOCUS_t0030 307 393 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 602 1867 gene locus_tag LOCUS_2850 gene sat 602 1867 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_2850 1941 2390 gene locus_tag LOCUS_2860 gene aprB 1941 2390 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938146.1 protein_id gnl|my_center|LOCUS_2860 >Feature sequence071 80 391 gene locus_tag LOCUS_2870 80 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2870 372 381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 453 1025 gene locus_tag LOCUS_2880 453 1025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2880 1068 1835 gene locus_tag LOCUS_2890 gene wtpB 1068 1835 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877607.1 protein_id gnl|my_center|LOCUS_2890 1836 2900 gene locus_tag LOCUS_2900 1836 2900 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099211502.1 protein_id gnl|my_center|LOCUS_2900 >Feature sequence072 1883 348 gene locus_tag LOCUS_2910 1883 348 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_2910 2022 2714 gene locus_tag LOCUS_2920 2022 2714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2920 3310 2741 gene locus_tag LOCUS_2930 3310 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2930 >Feature sequence073 294 2300 gene locus_tag LOCUS_2940 294 2300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2940 310 319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence074 752 761 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1454 2419 gene locus_tag LOCUS_2950 1454 2419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_2950 2359 2368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2376 3185 gene locus_tag LOCUS_2960 2376 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2960 >Feature sequence075 1551 697 gene locus_tag LOCUS_2970 1551 697 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_2970 2201 1548 gene locus_tag LOCUS_2980 gene mqnB 2201 1548 CDS product futalosine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228023.1 protein_id gnl|my_center|LOCUS_2980 2758 2198 gene locus_tag LOCUS_2990 2758 2198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_2990 >Feature sequence076 352 65 gene locus_tag LOCUS_3000 gene gatC 352 65 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_3000 2168 432 gene locus_tag LOCUS_3010 2168 432 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546358.1 protein_id gnl|my_center|LOCUS_3010 <3253 2183 gene locus_tag LOCUS_3020 <3253 2183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002682243.1:AMP-binding protein >Feature sequence077 671 21 gene locus_tag LOCUS_3030 671 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3030 2730 1651 gene locus_tag LOCUS_3040 2730 1651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3040 3047 2939 gene locus_tag LOCUS_r0010 3047 2939 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence078 312 626 gene locus_tag LOCUS_3050 312 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3050 3122 723 gene locus_tag LOCUS_3060 3122 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3060 >Feature sequence079 <1 1130 gene locus_tag LOCUS_3070 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482725.1:formate dehydrogenase subunit alpha note possible pseudo, internal stop codon 1272 2786 gene locus_tag LOCUS_3080 1272 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3080 >Feature sequence080 1327 581 gene locus_tag LOCUS_3090 1327 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3090 2658 1324 gene locus_tag LOCUS_3100 2658 1324 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942159.1 protein_id gnl|my_center|LOCUS_3100 3007 2681 gene locus_tag LOCUS_3110 3007 2681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3110 >Feature sequence081 1460 543 gene locus_tag LOCUS_3120 gene nadA 1460 543 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940699.1 protein_id gnl|my_center|LOCUS_3120 2160 1471 gene locus_tag LOCUS_3130 2160 1471 CDS product outer membrane lipoprotein carrier protein LolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943821.1 protein_id gnl|my_center|LOCUS_3130 2583 2164 gene locus_tag LOCUS_3140 2583 2164 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932389.1 protein_id gnl|my_center|LOCUS_3140 <3222 2591 gene locus_tag LOCUS_3150 <3222 2591 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939585.1:N-acyl homoserine lactonase family protein >Feature sequence082 6 608 gene locus_tag LOCUS_3160 gene lepB 6 608 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545806.1 protein_id gnl|my_center|LOCUS_3160 1363 626 gene locus_tag LOCUS_3170 1363 626 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256332.1 protein_id gnl|my_center|LOCUS_3170 2100 1360 gene locus_tag LOCUS_3180 2100 1360 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001256811.1 protein_id gnl|my_center|LOCUS_3180 3033 2125 gene locus_tag LOCUS_3190 3033 2125 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_3190 >Feature sequence083 <1 1838 gene locus_tag LOCUS_3200 <1 1838 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941478.1:ATP-binding protein >Feature sequence084 1450 1064 gene locus_tag LOCUS_3210 gene rplL 1450 1064 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_3210 2011 1490 gene locus_tag LOCUS_3220 gene rplJ 2011 1490 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_3220 2891 2187 gene locus_tag LOCUS_3230 gene rplA 2891 2187 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_3230 >Feature sequence085 <1 713 gene locus_tag LOCUS_3240 <1 713 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544939.1:PAS domain S-box protein 739 1824 gene locus_tag LOCUS_3250 739 1824 CDS product cobalt-precorrin-5B (C(1))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943627.1 protein_id gnl|my_center|LOCUS_3250 <3182 2005 gene locus_tag LOCUS_3260 <3182 2005 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119127.1:chloride channel protein >Feature sequence086 <1 683 gene locus_tag LOCUS_3270 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545375.1:type I methionyl aminopeptidase 705 923 gene locus_tag LOCUS_3280 gene infA 705 923 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003854422.1 protein_id gnl|my_center|LOCUS_3280 1069 1440 gene locus_tag LOCUS_3290 gene rpsM 1069 1440 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938621.1 protein_id gnl|my_center|LOCUS_3290 1460 1846 gene locus_tag LOCUS_3300 gene rpsK 1460 1846 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009966385.1 protein_id gnl|my_center|LOCUS_3300 1904 2530 gene locus_tag LOCUS_3310 gene rpsD 1904 2530 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943460.1 protein_id gnl|my_center|LOCUS_3310 >Feature sequence087 388 1221 gene locus_tag LOCUS_3320 388 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3320 1223 1732 gene locus_tag LOCUS_3330 1223 1732 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459677.1 protein_id gnl|my_center|LOCUS_3330 1876 2337 gene locus_tag LOCUS_3340 1876 2337 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005381269.1 protein_id gnl|my_center|LOCUS_3340 3062 2334 gene locus_tag LOCUS_3350 gene pyrF 3062 2334 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083509.1 protein_id gnl|my_center|LOCUS_3350 >Feature sequence088 1289 546 gene locus_tag LOCUS_3360 1289 546 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082798.1 protein_id gnl|my_center|LOCUS_3360 2221 1655 gene locus_tag LOCUS_3370 2221 1655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3370 >Feature sequence089 2816 2265 gene locus_tag LOCUS_3380 2816 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3380 >Feature sequence090 307 474 gene locus_tag LOCUS_3390 307 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3390 900 487 gene locus_tag LOCUS_3400 900 487 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_3400 1911 913 gene locus_tag LOCUS_3410 1911 913 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937471.1 protein_id gnl|my_center|LOCUS_3410 <3129 1904 gene locus_tag LOCUS_3420 <3129 1904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937472.1:amidophosphoribosyltransferase >Feature sequence091 2220 685 gene locus_tag LOCUS_3430 2220 685 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_3430 3019 2243 gene locus_tag LOCUS_3440 gene pssA 3019 2243 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_3440 >Feature sequence092 316 1272 gene locus_tag LOCUS_3450 gene bioB 316 1272 CDS product biotin synthase BioB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546730.1 protein_id gnl|my_center|LOCUS_3450 1326 2423 gene locus_tag LOCUS_3460 1326 2423 CDS product chromate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870223.1 protein_id gnl|my_center|LOCUS_3460 2523 2608 gene locus_tag LOCUS_t0040 2523 2608 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence093 3 152 gene locus_tag LOCUS_3470 3 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3470 183 743 gene locus_tag LOCUS_3480 gene amrA 183 743 CDS product AmmeMemoRadiSam system protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941768.1 protein_id gnl|my_center|LOCUS_3480 1264 755 gene locus_tag LOCUS_3490 gene coaD 1264 755 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938824.1 protein_id gnl|my_center|LOCUS_3490 1845 1264 gene locus_tag LOCUS_3500 gene rsmD 1845 1264 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941900.1 protein_id gnl|my_center|LOCUS_3500 <3113 1848 gene locus_tag LOCUS_3510 <3113 1848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941850.1:class II fructose-bisphosphate aldolase >Feature sequence094 1721 501 gene locus_tag LOCUS_3520 1721 501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3520 2656 1718 gene locus_tag LOCUS_3530 gene mdh 2656 1718 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007325654.1 protein_id gnl|my_center|LOCUS_3530 >Feature sequence095 576 1085 gene locus_tag LOCUS_3540 gene rfaH 576 1085 CDS product transcription/translation regulatory transformer protein RfaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005760598.1 protein_id gnl|my_center|LOCUS_3540 1790 1110 gene locus_tag LOCUS_3550 1790 1110 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_3550 1957 2667 gene locus_tag LOCUS_3560 1957 2667 CDS product lipid-binding SYLF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099798508.1 protein_id gnl|my_center|LOCUS_3560 3007 2705 gene locus_tag LOCUS_3570 3007 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939234.1 protein_id gnl|my_center|LOCUS_3570 >Feature sequence096 1292 252 gene locus_tag LOCUS_3580 gene trpD 1292 252 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880074.1 protein_id gnl|my_center|LOCUS_3580 1865 1299 gene locus_tag LOCUS_3590 1865 1299 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943018.1 protein_id gnl|my_center|LOCUS_3590 <3064 1915 gene locus_tag LOCUS_3600 <3064 1915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943019.1:anthranilate synthase component I >Feature sequence097 2726 1545 gene locus_tag LOCUS_3610 2726 1545 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919046.1 protein_id gnl|my_center|LOCUS_3610 2979 2728 gene locus_tag LOCUS_3620 2979 2728 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000248104.1 protein_id gnl|my_center|LOCUS_3620 >Feature sequence098 545 751 gene locus_tag LOCUS_3630 545 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3630 748 1119 gene locus_tag LOCUS_3640 748 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3640 >Feature sequence099 2124 1543 gene locus_tag LOCUS_3650 2124 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459317.1 protein_id gnl|my_center|LOCUS_3650 2184 2612 gene locus_tag LOCUS_3660 2184 2612 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583101.1 protein_id gnl|my_center|LOCUS_3660 >Feature sequence100 <1 1648 gene locus_tag LOCUS_3670 <1 1648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942590.1:Ig-like domain-containing protein >Feature sequence101 1221 238 gene locus_tag LOCUS_3680 1221 238 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_3680 2238 1231 gene locus_tag LOCUS_3690 gene plsX 2238 1231 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942245.1 protein_id gnl|my_center|LOCUS_3690 2427 2245 gene locus_tag LOCUS_3700 gene rpmF 2427 2245 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942244.1 protein_id gnl|my_center|LOCUS_3700 <2983 2461 gene locus_tag LOCUS_3710 <2983 2461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545391.1:DUF177 domain-containing protein >Feature sequence102 178 336 gene locus_tag LOCUS_3720 178 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3720 493 1476 gene locus_tag LOCUS_3730 493 1476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3730 2666 1467 gene locus_tag LOCUS_3740 2666 1467 CDS product cyclopropane-fatty-acyl-phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000229037.1 protein_id gnl|my_center|LOCUS_3740 >Feature sequence103 1483 380 gene locus_tag LOCUS_3750 1483 380 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060968.1 protein_id gnl|my_center|LOCUS_3750 1740 1531 gene locus_tag LOCUS_3760 1740 1531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3760 2923 1997 gene locus_tag LOCUS_3770 2923 1997 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940694.1 protein_id gnl|my_center|LOCUS_3770 >Feature sequence104 1267 254 gene locus_tag LOCUS_3780 gene amrS 1267 254 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546747.1 protein_id gnl|my_center|LOCUS_3780 1447 1914 gene locus_tag LOCUS_3790 1447 1914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3790 1911 2783 gene locus_tag LOCUS_3800 1911 2783 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869527.1 protein_id gnl|my_center|LOCUS_3800 >Feature sequence105 886 635 gene locus_tag LOCUS_3810 gene rpmA 886 635 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938227.1 protein_id gnl|my_center|LOCUS_3810 1210 899 gene locus_tag LOCUS_3820 gene rplU 1210 899 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005896540.1 protein_id gnl|my_center|LOCUS_3820 >Feature sequence106 <1 930 gene locus_tag LOCUS_3830 <1 930 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393617.1:dihydroorotate dehydrogenase >Feature sequence107 <1 865 gene locus_tag LOCUS_3840 <1 865 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005647785.1:transglutaminase family protein 865 1764 gene locus_tag LOCUS_3850 865 1764 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813638.1 protein_id gnl|my_center|LOCUS_3850 >Feature sequence108 1555 611 gene locus_tag LOCUS_3860 gene mvhG 1555 611 CDS product F420-non-reducing hydrogenase subunit MvhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876759.1 protein_id gnl|my_center|LOCUS_3860 2352 1813 gene locus_tag LOCUS_3870 gene frhD 2352 1813 CDS product coenzyme F420-reducing hydrogenase, FrhD protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869751.1 protein_id gnl|my_center|LOCUS_3870 >Feature sequence109 173 1363 gene locus_tag LOCUS_3880 173 1363 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919043.1 protein_id gnl|my_center|LOCUS_3880 1366 2337 gene locus_tag LOCUS_3890 1366 2337 CDS product diacylglycerol kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919044.1 protein_id gnl|my_center|LOCUS_3890 >Feature sequence110 125 625 gene locus_tag LOCUS_3900 125 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3900 628 1443 gene locus_tag LOCUS_3910 628 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3910 2143 1739 gene locus_tag LOCUS_3920 2143 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_3920 <2883 2164 gene locus_tag LOCUS_3930 <2883 2164 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070833.1:4Fe-4S dicluster domain-containing protein >Feature sequence111 <1 701 gene locus_tag LOCUS_3940 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942694.1:phenylacetate--CoA ligase 716 1756 gene locus_tag LOCUS_3950 716 1756 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942697.1 protein_id gnl|my_center|LOCUS_3950 1820 2293 gene locus_tag LOCUS_3960 1820 2293 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942698.1 protein_id gnl|my_center|LOCUS_3960 >Feature sequence112 1817 174 gene locus_tag LOCUS_3970 1817 174 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938914.1 protein_id gnl|my_center|LOCUS_3970 2355 1912 gene locus_tag LOCUS_3980 2355 1912 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938903.1 protein_id gnl|my_center|LOCUS_3980 <2866 2352 gene locus_tag LOCUS_3990 <2866 2352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942382.1:phenylacetate--CoA ligase >Feature sequence113 <1 1142 gene locus_tag LOCUS_4000 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939383.1:sigma 54-interacting transcriptional regulator OrpR 1571 1164 gene locus_tag LOCUS_4010 1571 1164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4010 2859 1666 gene locus_tag LOCUS_4020 gene nrfD 2859 1666 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817192.1 protein_id gnl|my_center|LOCUS_4020 >Feature sequence114 <2849 825 gene locus_tag LOCUS_4030 <2849 825 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011791698.1:PEP/pyruvate-binding domain-containing protein >Feature sequence115 184 1281 gene locus_tag LOCUS_4040 184 1281 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093087.1 protein_id gnl|my_center|LOCUS_4040 1310 2566 gene locus_tag LOCUS_4050 1310 2566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4050 >Feature sequence116 153 623 gene locus_tag LOCUS_4060 153 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4060 620 1192 gene locus_tag LOCUS_4070 620 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4070 1318 1393 gene locus_tag LOCUS_t0050 1318 1393 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1544 2017 gene locus_tag LOCUS_4080 gene rimP 1544 2017 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460396.1 protein_id gnl|my_center|LOCUS_4080 >Feature sequence117 470 946 gene locus_tag LOCUS_4090 gene nusB 470 946 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_4090 >Feature sequence118 211 666 gene locus_tag LOCUS_4100 211 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4100 2756 705 gene locus_tag LOCUS_4110 2756 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4110 >Feature sequence119 1161 2087 gene locus_tag LOCUS_4120 1161 2087 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792785.1 protein_id gnl|my_center|LOCUS_4120 >Feature sequence120 2151 22 gene locus_tag LOCUS_4130 2151 22 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392959.1 protein_id gnl|my_center|LOCUS_4130 >Feature sequence121 427 1605 gene locus_tag LOCUS_4140 gene yghO 427 1605 CDS product protein YghO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001305975.1 protein_id gnl|my_center|LOCUS_4140 1602 2423 gene locus_tag LOCUS_4150 1602 2423 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640161.1 protein_id gnl|my_center|LOCUS_4150 >Feature sequence122 481 1395 gene locus_tag LOCUS_4160 481 1395 CDS product 4-deoxy-4-formamido-L-arabinose-phosphoundecaprenol deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943193.1 protein_id gnl|my_center|LOCUS_4160 1399 2511 gene locus_tag LOCUS_4170 1399 2511 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_4170 >Feature sequence123 <1 1173 gene locus_tag LOCUS_4180 <1 1173 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965929.1:trigger factor 1186 1788 gene locus_tag LOCUS_4190 gene clpP 1186 1788 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036184.1 protein_id gnl|my_center|LOCUS_4190 >Feature sequence124 254 2371 gene locus_tag LOCUS_4200 254 2371 CDS product DNA translocase FtsK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943733.1 protein_id gnl|my_center|LOCUS_4200 >Feature sequence125 1619 1059 gene locus_tag LOCUS_4210 1619 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4210 <2745 1658 gene locus_tag LOCUS_4220 <2745 1658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393352.1:glycosyltransferase family 1 protein >Feature sequence126 <1 1688 gene locus_tag LOCUS_4230 <1 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268103.1:CHASE domain-containing protein >Feature sequence127 400 92 gene locus_tag LOCUS_4240 400 92 CDS product ATP-dependent Clp protease adaptor ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938892.1 protein_id gnl|my_center|LOCUS_4240 1158 403 gene locus_tag LOCUS_4250 1158 403 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942068.1 protein_id gnl|my_center|LOCUS_4250 1217 2284 gene locus_tag LOCUS_4260 1217 2284 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164928792.1 protein_id gnl|my_center|LOCUS_4260 >Feature sequence128 <1 1988 gene locus_tag LOCUS_4270 <1 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940695.1:transcription-repair coupling factor >Feature sequence129 <1 1115 gene locus_tag LOCUS_4280 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000451037.1:sodium:alanine symporter family protein <2727 1178 gene locus_tag LOCUS_4290 <2727 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545464.1:hydroxylamine reductase >Feature sequence130 1517 942 gene locus_tag LOCUS_4300 1517 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4300 >Feature sequence131 <1 852 gene locus_tag LOCUS_4310 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545977.1:menaquinone biosynthesis decarboxylase 864 1433 gene locus_tag LOCUS_4320 864 1433 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_4320 1839 2057 gene locus_tag LOCUS_4330 1839 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4330 2579 2503 gene locus_tag LOCUS_t0060 2579 2503 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence132 447 1010 gene locus_tag LOCUS_4340 447 1010 CDS product pyruvate kinase alpha/beta domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870005.1 protein_id gnl|my_center|LOCUS_4340 1040 1501 gene locus_tag LOCUS_4350 gene smpB 1040 1501 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002356550.1 protein_id gnl|my_center|LOCUS_4350 >Feature sequence133 <1 1077 gene locus_tag LOCUS_4360 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250045.1:pyridoxal phosphate-dependent aminotransferase 1693 2442 gene locus_tag LOCUS_4370 1693 2442 CDS product redox-sensing transcriptional repressor Rex inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938215.1 protein_id gnl|my_center|LOCUS_4370 >Feature sequence134 448 798 gene locus_tag LOCUS_4380 448 798 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546341.1 protein_id gnl|my_center|LOCUS_4380 1968 799 gene locus_tag LOCUS_4390 1968 799 CDS product DUF1343 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545899.1 protein_id gnl|my_center|LOCUS_4390 <2693 2002 gene locus_tag LOCUS_4400 <2693 2002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851174.1:formate dehydrogenase subunit gamma >Feature sequence135 <1 884 gene locus_tag LOCUS_4410 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012868777.1:isocitrate dehydrogenase (NADP(+)) 1366 1656 gene locus_tag LOCUS_4420 1366 1656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4420 2372 2381 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence136 1122 271 gene locus_tag LOCUS_4430 1122 271 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937958.1 protein_id gnl|my_center|LOCUS_4430 <2666 1130 gene locus_tag LOCUS_4440 <2666 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938364.1:peptidylprolyl isomerase >Feature sequence137 <1 1294 gene locus_tag LOCUS_4450 <1 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942532.1:RNA polymerase factor sigma-54 1331 1852 gene locus_tag LOCUS_4460 gene raiA 1331 1852 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942531.1 protein_id gnl|my_center|LOCUS_4460 1857 2333 gene locus_tag LOCUS_4470 1857 2333 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_4470 >Feature sequence138 1636 785 gene locus_tag LOCUS_4480 1636 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4480 2567 1605 gene locus_tag LOCUS_4490 gene murB 2567 1605 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000437020.1 protein_id gnl|my_center|LOCUS_4490 >Feature sequence139 590 1120 gene locus_tag LOCUS_4500 590 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4500 1212 2528 gene locus_tag LOCUS_4510 gene nhaA 1212 2528 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107366.1 protein_id gnl|my_center|LOCUS_4510 >Feature sequence140 <1 752 gene locus_tag LOCUS_4520 <1 752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927125.1:SLC13 family permease 1450 758 gene locus_tag LOCUS_4530 1450 758 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023187.1 protein_id gnl|my_center|LOCUS_4530 <2639 1451 gene locus_tag LOCUS_4540 <2639 1451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010930094.1:OmpA family protein >Feature sequence141 <1 1032 gene locus_tag LOCUS_4550 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545243.1:threonine--tRNA ligase 1062 1532 gene locus_tag LOCUS_4560 1062 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4560 1679 1876 gene locus_tag LOCUS_4570 gene rpmI 1679 1876 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005893833.1 protein_id gnl|my_center|LOCUS_4570 1962 2315 gene locus_tag LOCUS_4580 gene rplT 1962 2315 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004727974.1 protein_id gnl|my_center|LOCUS_4580 2423 2432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence142 46 606 gene locus_tag LOCUS_4590 46 606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4590 1735 665 gene locus_tag LOCUS_4600 gene cobT 1735 665 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943639.1 protein_id gnl|my_center|LOCUS_4600 2339 1773 gene locus_tag LOCUS_4610 gene cobU 2339 1773 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932625.1 protein_id gnl|my_center|LOCUS_4610 2467 2339 gene locus_tag LOCUS_4620 2467 2339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4620 >Feature sequence143 <1 972 gene locus_tag LOCUS_4630 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393107.1:dissimilatory-type sulfite reductase subunit alpha 1002 2258 gene locus_tag LOCUS_4640 gene dsrB 1002 2258 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393106.1 protein_id gnl|my_center|LOCUS_4640 2273 2530 gene locus_tag LOCUS_4650 2273 2530 CDS product dissimilatory sulfite reductase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393105.1 protein_id gnl|my_center|LOCUS_4650 >Feature sequence144 1800 487 gene locus_tag LOCUS_4660 1800 487 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545699.1 protein_id gnl|my_center|LOCUS_4660 <2605 1827 gene locus_tag LOCUS_4670 <2605 1827 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943097.1:penicillin-binding transpeptidase domain-containing protein >Feature sequence145 <1 1155 gene locus_tag LOCUS_4680 <1 1155 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943854.1:TIGR03960 family B12-binding radical SAM protein 2465 1152 gene locus_tag LOCUS_4690 2465 1152 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931016.1 protein_id gnl|my_center|LOCUS_4690 >Feature sequence146 <2597 541 gene locus_tag LOCUS_4700 <2597 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257457.1:GAF domain-containing protein >Feature sequence147 324 1820 gene locus_tag LOCUS_4710 gene lysS 324 1820 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791906.1 protein_id gnl|my_center|LOCUS_4710 >Feature sequence148 1706 27 gene locus_tag LOCUS_4720 1706 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4720 2405 1734 gene locus_tag LOCUS_4730 2405 1734 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546348.1 protein_id gnl|my_center|LOCUS_4730 >Feature sequence149 1558 50 gene locus_tag LOCUS_4740 1558 50 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358530.1 protein_id gnl|my_center|LOCUS_4740 >Feature sequence150 787 2199 gene locus_tag LOCUS_4750 gene glnA 787 2199 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_4750 >Feature sequence151 144 1592 gene locus_tag LOCUS_4760 144 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4760 1606 1968 gene locus_tag LOCUS_4770 1606 1968 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245707.1 protein_id gnl|my_center|LOCUS_4770 >Feature sequence152 638 1702 gene locus_tag LOCUS_4780 gene purM 638 1702 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942402.1 protein_id gnl|my_center|LOCUS_4780 1699 2103 gene locus_tag LOCUS_4790 1699 2103 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965636.1 protein_id gnl|my_center|LOCUS_4790 2399 2100 gene locus_tag LOCUS_4800 2399 2100 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942391.1 protein_id gnl|my_center|LOCUS_4800 >Feature sequence153 2051 822 gene locus_tag LOCUS_4810 gene tolB 2051 822 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_4810 2393 2202 gene locus_tag LOCUS_4820 2393 2202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4820 >Feature sequence154 18 2186 gene locus_tag LOCUS_4830 18 2186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4830 >Feature sequence155 423 662 gene locus_tag LOCUS_4840 423 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4840 975 679 gene locus_tag LOCUS_4850 975 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4850 2381 1059 gene locus_tag LOCUS_4860 2381 1059 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_4860 >Feature sequence156 695 423 gene locus_tag LOCUS_4870 695 423 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939083.1 protein_id gnl|my_center|LOCUS_4870 1437 814 gene locus_tag LOCUS_4880 1437 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4880 2472 1447 gene locus_tag LOCUS_4890 2472 1447 CDS product homocysteine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940198.1 protein_id gnl|my_center|LOCUS_4890 >Feature sequence157 <2459 1494 gene locus_tag LOCUS_4900 <2459 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392712.1:CO dehydrogenase/acetyl-CoA synthase subunit delta >Feature sequence158 50 910 gene locus_tag LOCUS_4910 50 910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4910 921 1280 gene locus_tag LOCUS_4920 921 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_4920 >Feature sequence159 >Feature sequence160 <1 1242 gene locus_tag LOCUS_4930 <1 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001298766.1:fatty acyl-AMP ligase 1277 2206 gene locus_tag LOCUS_4940 1277 2206 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077137.1 protein_id gnl|my_center|LOCUS_4940 >Feature sequence161 <1 603 gene locus_tag LOCUS_4950 <1 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941262.1:ATP-binding protein 626 2014 gene locus_tag LOCUS_4960 626 2014 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_4960 >Feature sequence162 461 1729 gene locus_tag LOCUS_4970 461 1729 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545411.1 protein_id gnl|my_center|LOCUS_4970 <2442 1681 gene locus_tag LOCUS_4980 <2442 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942140.1:ATP-binding protein >Feature sequence163 >Feature sequence164 2263 386 gene locus_tag LOCUS_4990 gene cooS 2263 386 CDS product anaerobic carbon-monoxide dehydrogenase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939375.1 protein_id gnl|my_center|LOCUS_4990 >Feature sequence165 1673 813 gene locus_tag LOCUS_5000 1673 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5000 <2420 1683 gene locus_tag LOCUS_5010 <2420 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942184.1:AAA family ATPase >Feature sequence166 831 250 gene locus_tag LOCUS_5020 gene fdh3B 831 250 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812668.1 protein_id gnl|my_center|LOCUS_5020 <2416 854 gene locus_tag LOCUS_5030 <2416 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261956.1:formate dehydrogenase subunit alpha >Feature sequence167 614 1306 gene locus_tag LOCUS_5040 614 1306 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939647.1 protein_id gnl|my_center|LOCUS_5040 >Feature sequence168 389 141 gene locus_tag LOCUS_5050 389 141 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256580.1 protein_id gnl|my_center|LOCUS_5050 625 380 gene locus_tag LOCUS_5060 625 380 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5060 1163 546 gene locus_tag LOCUS_5070 1163 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_5070 1200 1209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2042 1365 gene locus_tag LOCUS_5080 2042 1365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5080 >Feature sequence169 556 272 gene locus_tag LOCUS_5090 gene rpsS 556 272 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938602.1 protein_id gnl|my_center|LOCUS_5090 1412 585 gene locus_tag LOCUS_5100 gene rplB 1412 585 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943483.1 protein_id gnl|my_center|LOCUS_5100 1702 1412 gene locus_tag LOCUS_5110 1702 1412 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943484.1 protein_id gnl|my_center|LOCUS_5110 2322 1702 gene locus_tag LOCUS_5120 gene rplD 2322 1702 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_5120 >Feature sequence170 >Feature sequence171 <1 543 gene locus_tag LOCUS_5130 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940512.1:ChaN family lipoprotein 567 1502 gene locus_tag LOCUS_5140 567 1502 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015775844.1 protein_id gnl|my_center|LOCUS_5140 1585 1944 gene locus_tag LOCUS_5150 1585 1944 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937557.1 protein_id gnl|my_center|LOCUS_5150 >Feature sequence172 <2383 1677 gene locus_tag LOCUS_5160 <2383 1677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206819368.1:bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase >Feature sequence173 2062 905 gene locus_tag LOCUS_5170 2062 905 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964319.1 protein_id gnl|my_center|LOCUS_5170 2381 2145 gene locus_tag LOCUS_5180 2381 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5180 >Feature sequence174 127 729 gene locus_tag LOCUS_5190 127 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5190 >Feature sequence175 <1 2183 gene locus_tag LOCUS_5200 <1 2183 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010875712.1:tetratricopeptide repeat protein >Feature sequence176 553 335 gene locus_tag LOCUS_5210 gene rpmE 553 335 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_5210 2040 649 gene locus_tag LOCUS_5220 gene rho 2040 649 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943729.1 protein_id gnl|my_center|LOCUS_5220 >Feature sequence177 204 1076 gene locus_tag LOCUS_5230 204 1076 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546572.1 protein_id gnl|my_center|LOCUS_5230 >Feature sequence178 362 1933 gene locus_tag LOCUS_5240 362 1933 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_5240 >Feature sequence179 <2328 1469 gene locus_tag LOCUS_5250 <2328 1469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337967.1:flagellin >Feature sequence180 641 168 gene locus_tag LOCUS_5260 gene tadA 641 168 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803986.1 protein_id gnl|my_center|LOCUS_5260 1337 645 gene locus_tag LOCUS_5270 gene radC 1337 645 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532006.1 protein_id gnl|my_center|LOCUS_5270 2085 1351 gene locus_tag LOCUS_5280 2085 1351 CDS product SagB/ThcOx family dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932495.1 protein_id gnl|my_center|LOCUS_5280 >Feature sequence181 875 240 gene locus_tag LOCUS_5290 875 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5290 <2323 1227 gene locus_tag LOCUS_5300 <2323 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272193.1:polysulfide reductase NrfD >Feature sequence182 1824 544 gene locus_tag LOCUS_5310 1824 544 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003128157.1 protein_id gnl|my_center|LOCUS_5310 >Feature sequence183 888 4 gene locus_tag LOCUS_5320 888 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5320 <2314 920 gene locus_tag LOCUS_5330 <2314 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010944075.1:membrane protein insertase YidC >Feature sequence184 373 382 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 551 1882 gene locus_tag LOCUS_5340 551 1882 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942336.1 protein_id gnl|my_center|LOCUS_5340 >Feature sequence185 479 1243 gene locus_tag LOCUS_5350 gene mreC 479 1243 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942723.1 protein_id gnl|my_center|LOCUS_5350 1410 1739 gene locus_tag LOCUS_5360 1410 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5360 >Feature sequence186 538 547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 577 1089 gene locus_tag LOCUS_5370 577 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5370 >Feature sequence187 523 900 gene locus_tag LOCUS_5380 gene atpE 523 900 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792634.1 protein_id gnl|my_center|LOCUS_5380 2311 962 gene locus_tag LOCUS_5390 2311 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5390 >Feature sequence188 1108 152 gene locus_tag LOCUS_5400 1108 152 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902504.1 protein_id gnl|my_center|LOCUS_5400 1294 1974 gene locus_tag LOCUS_5410 1294 1974 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_5410 2056 2065 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence189 1391 180 gene locus_tag LOCUS_5420 1391 180 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_5420 1840 1544 gene locus_tag LOCUS_5430 1840 1544 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041914001.1 protein_id gnl|my_center|LOCUS_5430 >Feature sequence190 >Feature sequence191 <1 747 gene locus_tag LOCUS_5440 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391669.1:3-methyl-2-oxobutanoate hydroxymethyltransferase 908 789 gene locus_tag LOCUS_5450 908 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5450 <2290 1239 gene locus_tag LOCUS_5460 <2290 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941346.1:1-deoxy-D-xylulose-5-phosphate synthase >Feature sequence192 2145 1411 gene locus_tag LOCUS_5470 2145 1411 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_5470 >Feature sequence193 725 810 gene locus_tag LOCUS_t0070 725 810 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence194 625 236 gene locus_tag LOCUS_5480 625 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5480 905 1378 gene locus_tag LOCUS_5490 905 1378 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932287.1 protein_id gnl|my_center|LOCUS_5490 1482 1970 gene locus_tag LOCUS_5500 1482 1970 CDS product BCAM0308 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193764.1 protein_id gnl|my_center|LOCUS_5500 >Feature sequence195 213 4 gene locus_tag LOCUS_5510 213 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5510 276 1316 gene locus_tag LOCUS_5520 gene waaF 276 1316 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942896.1 protein_id gnl|my_center|LOCUS_5520 1295 1918 gene locus_tag LOCUS_5530 gene gmhB 1295 1918 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942726.1 protein_id gnl|my_center|LOCUS_5530 >Feature sequence196 858 622 gene locus_tag LOCUS_5540 gene acpP 858 622 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_5540 1637 882 gene locus_tag LOCUS_5550 gene fabG 1637 882 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869844.1 protein_id gnl|my_center|LOCUS_5550 <2268 1630 gene locus_tag LOCUS_5560 <2268 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003437556.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence197 413 619 gene locus_tag LOCUS_5570 gene rpmC 413 619 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869921.1 protein_id gnl|my_center|LOCUS_5570 619 879 gene locus_tag LOCUS_5580 gene rpsQ 619 879 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555480.1 protein_id gnl|my_center|LOCUS_5580 904 1272 gene locus_tag LOCUS_5590 gene rplN 904 1272 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938608.1 protein_id gnl|my_center|LOCUS_5590 1293 1637 gene locus_tag LOCUS_5600 gene rplX 1293 1637 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546700.1 protein_id gnl|my_center|LOCUS_5600 1659 2198 gene locus_tag LOCUS_5610 gene rplE 1659 2198 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_5610 >Feature sequence198 941 642 gene locus_tag LOCUS_5620 941 642 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941530.1 protein_id gnl|my_center|LOCUS_5620 2028 961 gene locus_tag LOCUS_5630 2028 961 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392449.1 protein_id gnl|my_center|LOCUS_5630 >Feature sequence199 <1 842 gene locus_tag LOCUS_5640 <1 842 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941139.1:ATP-binding protein 842 2197 gene locus_tag LOCUS_5650 gene radA 842 2197 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545683.1 protein_id gnl|my_center|LOCUS_5650 >Feature sequence200 264 551 gene locus_tag LOCUS_5660 264 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5660 605 1909 gene locus_tag LOCUS_5670 gene secY 605 1909 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943466.1 protein_id gnl|my_center|LOCUS_5670 >Feature sequence201 1101 130 gene locus_tag LOCUS_5680 1101 130 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881241.1 protein_id gnl|my_center|LOCUS_5680 2144 1116 gene locus_tag LOCUS_5690 2144 1116 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000575569.1 protein_id gnl|my_center|LOCUS_5690 >Feature sequence202 <2245 924 gene locus_tag LOCUS_5700 <2245 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066467.1:anaerobic carbon-monoxide dehydrogenase catalytic subunit >Feature sequence203 925 230 gene locus_tag LOCUS_5710 925 230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5710 1934 930 gene locus_tag LOCUS_5720 1934 930 CDS product HpnL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004206084.1 protein_id gnl|my_center|LOCUS_5720 >Feature sequence204 631 1983 gene locus_tag LOCUS_5730 631 1983 CDS product ATP-dependent 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939339.1 protein_id gnl|my_center|LOCUS_5730 >Feature sequence205 868 1074 gene locus_tag LOCUS_5740 868 1074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5740 <2243 1357 gene locus_tag LOCUS_5750 <2243 1357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966838.1:ACP S-malonyltransferase >Feature sequence206 262 1641 gene locus_tag LOCUS_5760 gene dnaB 262 1641 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941663.1 protein_id gnl|my_center|LOCUS_5760 >Feature sequence207 138 581 gene locus_tag LOCUS_5770 138 581 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792757.1 protein_id gnl|my_center|LOCUS_5770 >Feature sequence208 <1 1058 gene locus_tag LOCUS_5780 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256516.1:redox-regulated ATPase YchF 1230 1670 gene locus_tag LOCUS_5790 gene nikR 1230 1670 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940151.1 protein_id gnl|my_center|LOCUS_5790 >Feature sequence209 265 1542 gene locus_tag LOCUS_5800 gene qmoC 265 1542 CDS product quinone-interacting membrane-bound oxidoreductase complex subunit QmoC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545389.1 protein_id gnl|my_center|LOCUS_5800 1648 1723 gene locus_tag LOCUS_t0080 1648 1723 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1735 1819 gene locus_tag LOCUS_t0090 1735 1819 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 1885 1961 gene locus_tag LOCUS_t0100 1885 1961 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1967 2042 gene locus_tag LOCUS_t0110 1967 2042 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence210 >Feature sequence211 1033 1167 gene locus_tag LOCUS_5810 1033 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5810 1184 1603 gene locus_tag LOCUS_5820 1184 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5820 >Feature sequence212 1554 1012 gene locus_tag LOCUS_5830 1554 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5830 2074 1547 gene locus_tag LOCUS_5840 2074 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5840 >Feature sequence213 565 368 gene locus_tag LOCUS_5850 565 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5850 >Feature sequence214 1171 773 gene locus_tag LOCUS_5860 1171 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5860 >Feature sequence215 1967 1002 gene locus_tag LOCUS_5870 1967 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5870 >Feature sequence216 305 1429 gene locus_tag LOCUS_5880 gene lpxK 305 1429 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942898.1 protein_id gnl|my_center|LOCUS_5880 >Feature sequence217 <2190 545 gene locus_tag LOCUS_5890 <2190 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000679508.1:collagenase ColA >Feature sequence218 1630 92 gene locus_tag LOCUS_5900 1630 92 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_5900 1919 1635 gene locus_tag LOCUS_5910 1919 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5910 >Feature sequence219 690 385 gene locus_tag LOCUS_5920 690 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5920 1267 770 gene locus_tag LOCUS_5930 1267 770 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941451.1 protein_id gnl|my_center|LOCUS_5930 <2175 1267 gene locus_tag LOCUS_5940 <2175 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940978.1:hydrogenase expression/formation protein HypE >Feature sequence220 529 1830 gene locus_tag LOCUS_5950 gene tolC 529 1830 CDS product outer membrane channel protein TolC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073650.1 protein_id gnl|my_center|LOCUS_5950 >Feature sequence221 <2169 589 gene locus_tag LOCUS_5960 <2169 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478902.1:efflux RND transporter permease subunit VmeI >Feature sequence222 1060 563 gene locus_tag LOCUS_5970 1060 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_5970 1395 1114 gene locus_tag LOCUS_5980 gene rpsT 1395 1114 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939182.1 protein_id gnl|my_center|LOCUS_5980 >Feature sequence223 510 1958 gene locus_tag LOCUS_5990 510 1958 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000189676.1 protein_id gnl|my_center|LOCUS_5990 >Feature sequence224 >Feature sequence225 114 761 gene locus_tag LOCUS_6000 114 761 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_6000 777 1967 gene locus_tag LOCUS_6010 777 1967 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256604.1 protein_id gnl|my_center|LOCUS_6010 >Feature sequence226 <2157 181 gene locus_tag LOCUS_6020 <2157 181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840058.1:TolC family protein 226 235 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence227 <1 723 gene locus_tag LOCUS_6030 <1 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011028181.1:endo alpha-1,4 polygalactosaminidase >Feature sequence228 2 124 gene locus_tag LOCUS_6040 2 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6040 239 1669 gene locus_tag LOCUS_6050 gene mnmE 239 1669 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003359423.1 protein_id gnl|my_center|LOCUS_6050 2003 1674 gene locus_tag LOCUS_6060 gene yajC 2003 1674 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943256.1 protein_id gnl|my_center|LOCUS_6060 >Feature sequence229 724 26 gene locus_tag LOCUS_6070 724 26 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545876.1 protein_id gnl|my_center|LOCUS_6070 1465 773 gene locus_tag LOCUS_6080 gene nadC 1465 773 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_067615902.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_6080 1542 1551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2149 1634 gene locus_tag LOCUS_6090 <2149 1634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880914.1:valine--tRNA ligase >Feature sequence230 339 1154 gene locus_tag LOCUS_6100 339 1154 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083222.1 protein_id gnl|my_center|LOCUS_6100 >Feature sequence231 1254 712 gene locus_tag LOCUS_6110 1254 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940532.1 protein_id gnl|my_center|LOCUS_6110 1475 1948 gene locus_tag LOCUS_6120 1475 1948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6120 >Feature sequence232 198 344 gene locus_tag LOCUS_6130 198 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6130 363 791 gene locus_tag LOCUS_6140 363 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_6140 >Feature sequence233 <1 983 gene locus_tag LOCUS_6150 <1 983 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015942559.1:methylenetetrahydrofolate reductase C-terminal domain-containing protein 901 1743 gene locus_tag LOCUS_6160 901 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6160 >Feature sequence234 1107 427 gene locus_tag LOCUS_6170 1107 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6170 1733 1149 gene locus_tag LOCUS_6180 gene hisB 1733 1149 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243389.1 protein_id gnl|my_center|LOCUS_6180 >Feature sequence235 <1 1688 gene locus_tag LOCUS_6190 <1 1688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081555.1:sensor histidine kinase >Feature sequence236 134 1222 gene locus_tag LOCUS_6200 134 1222 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_6200 <2124 1238 gene locus_tag LOCUS_6210 <2124 1238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938754.1:glutamyl-tRNA reductase >Feature sequence237 1682 1131 gene locus_tag LOCUS_6220 1682 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6220 >Feature sequence238 1481 984 gene locus_tag LOCUS_6230 1481 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6230 >Feature sequence239 43 771 gene locus_tag LOCUS_6240 43 771 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546323.1 protein_id gnl|my_center|LOCUS_6240 >Feature sequence240 <1 543 gene locus_tag LOCUS_6250 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546634.1:formate--tetrahydrofolate ligase 822 1709 gene locus_tag LOCUS_6260 gene folD 822 1709 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230259.1 protein_id gnl|my_center|LOCUS_6260 >Feature sequence241 976 2019 gene locus_tag LOCUS_6270 gene hrcA 976 2019 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_6270 >Feature sequence242 <1 1067 gene locus_tag LOCUS_6280 <1 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938320.1:SufD family Fe-S cluster assembly protein >Feature sequence243 1896 961 gene locus_tag LOCUS_6290 1896 961 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188687.1 protein_id gnl|my_center|LOCUS_6290 >Feature sequence244 1579 689 gene locus_tag LOCUS_6300 1579 689 CDS product methyltetrahydrofolate cobalamin methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392711.1 protein_id gnl|my_center|LOCUS_6300 >Feature sequence245 <1 1014 gene locus_tag LOCUS_6310 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545006.1:endolytic transglycosylase MltG 1169 1684 gene locus_tag LOCUS_6320 1169 1684 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036503.1 protein_id gnl|my_center|LOCUS_6320 >Feature sequence246 1942 494 gene locus_tag LOCUS_6330 1942 494 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940649.1 protein_id gnl|my_center|LOCUS_6330 >Feature sequence247 30 572 gene locus_tag LOCUS_6340 30 572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6340 655 1149 gene locus_tag LOCUS_6350 655 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6350 1429 1244 gene locus_tag LOCUS_6360 1429 1244 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940534.1 protein_id gnl|my_center|LOCUS_6360 <2094 1577 gene locus_tag LOCUS_6370 <2094 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272194.1:hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) >Feature sequence248 >Feature sequence249 502 131 gene locus_tag LOCUS_6380 gene rpsL 502 131 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943491.1 protein_id gnl|my_center|LOCUS_6380 721 1503 gene locus_tag LOCUS_6390 721 1503 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942579.1 protein_id gnl|my_center|LOCUS_6390 >Feature sequence250 1576 266 gene locus_tag LOCUS_6400 gene hflX 1576 266 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941674.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_6400 >Feature sequence251 170 1123 gene locus_tag LOCUS_6410 gene hemH 170 1123 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943924.1 protein_id gnl|my_center|LOCUS_6410 >Feature sequence252 933 616 gene locus_tag LOCUS_6420 933 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6420 1823 936 gene locus_tag LOCUS_6430 1823 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6430 990 999 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence253 542 985 gene locus_tag LOCUS_6440 542 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6440 982 1806 gene locus_tag LOCUS_6450 gene lgt 982 1806 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_6450 >Feature sequence254 618 391 gene locus_tag LOCUS_6460 618 391 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545791.1 protein_id gnl|my_center|LOCUS_6460 1586 645 gene locus_tag LOCUS_6470 1586 645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942728.1 protein_id gnl|my_center|LOCUS_6470 2077 1583 gene locus_tag LOCUS_6480 2077 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6480 >Feature sequence255 112 2067 gene locus_tag LOCUS_6490 112 2067 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582597.1 protein_id gnl|my_center|LOCUS_6490 >Feature sequence256 666 508 gene locus_tag LOCUS_6500 666 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6500 527 536 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1607 729 gene locus_tag LOCUS_6510 1607 729 CDS product peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545595.1 protein_id gnl|my_center|LOCUS_6510 >Feature sequence257 >Feature sequence258 931 857 gene locus_tag LOCUS_t0120 931 857 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1782 943 gene locus_tag LOCUS_6520 gene ispE 1782 943 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545467.1 protein_id gnl|my_center|LOCUS_6520 >Feature sequence259 1513 1602 gene locus_tag LOCUS_t0130 1513 1602 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1611 1702 gene locus_tag LOCUS_t0140 1611 1702 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence260 <2067 113 gene locus_tag LOCUS_6530 <2067 113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937814.1:translation initiation factor IF-2 >Feature sequence261 >Feature sequence262 944 321 gene locus_tag LOCUS_6540 944 321 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250527.1 protein_id gnl|my_center|LOCUS_6540 1219 1905 gene locus_tag LOCUS_6550 1219 1905 CDS product TIGR00703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870983.1 protein_id gnl|my_center|LOCUS_6550 >Feature sequence263 811 215 gene locus_tag LOCUS_6560 811 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6560 1573 815 gene locus_tag LOCUS_6570 1573 815 CDS product flagellar motor protein MotB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870067.1 protein_id gnl|my_center|LOCUS_6570 >Feature sequence264 123 1109 gene locus_tag LOCUS_6580 gene hemB 123 1109 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546067.1 protein_id gnl|my_center|LOCUS_6580 >Feature sequence265 <1 935 gene locus_tag LOCUS_6590 <1 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205537.1:Hsp70 family protein 932 1396 gene locus_tag LOCUS_6600 932 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6600 >Feature sequence266 686 198 gene locus_tag LOCUS_6610 686 198 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937470.1 protein_id gnl|my_center|LOCUS_6610 1586 696 gene locus_tag LOCUS_6620 1586 696 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015868484.1 protein_id gnl|my_center|LOCUS_6620 >Feature sequence267 1003 569 gene locus_tag LOCUS_6630 1003 569 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546682.1 protein_id gnl|my_center|LOCUS_6630 1270 1674 gene locus_tag LOCUS_6640 1270 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6640 1675 1938 gene locus_tag LOCUS_6650 gene rpsR 1675 1938 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941327.1 protein_id gnl|my_center|LOCUS_6650 >Feature sequence268 76 2 gene locus_tag LOCUS_t0150 76 2 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 231 1406 gene locus_tag LOCUS_6660 231 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_6660 >Feature sequence269 1428 595 gene locus_tag LOCUS_6670 1428 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6670 >Feature sequence270 <1 1007 gene locus_tag LOCUS_6680 <1 1007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942477.1:tryptophan--tRNA ligase 980 1735 gene locus_tag LOCUS_6690 980 1735 CDS product segregation/condensation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942476.1 protein_id gnl|my_center|LOCUS_6690 >Feature sequence271 >Feature sequence272 482 491 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 595 1062 gene locus_tag LOCUS_6700 595 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_6700 >Feature sequence273 <1 1080 gene locus_tag LOCUS_6710 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939146.1:apolipoprotein N-acyltransferase >Feature sequence274 <1 706 gene locus_tag LOCUS_6720 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942140.1:ATP-binding protein >Feature sequence275 >Feature sequence276 1493 561 gene locus_tag LOCUS_6730 gene argF 1493 561 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940828.1 protein_id gnl|my_center|LOCUS_6730 >Feature sequence277 <1 656 gene locus_tag LOCUS_6740 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071579.1:LPS export ABC transporter permease LptG 1312 1500 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttccaaacctagacctgatgaagaagggattgag >Feature sequence278 1954 368 gene locus_tag LOCUS_6750 gene rng 1954 368 CDS product ribonuclease G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943853.1 protein_id gnl|my_center|LOCUS_6750 >Feature sequence279 433 1344 gene locus_tag LOCUS_6760 433 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6760 1348 1800 gene locus_tag LOCUS_6770 1348 1800 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546571.1 protein_id gnl|my_center|LOCUS_6770 1679 1688 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence280 <1 1233 gene locus_tag LOCUS_6780 <1 1233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257457.1:GAF domain-containing protein 1598 1221 gene locus_tag LOCUS_6790 1598 1221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6790 >Feature sequence281 1489 50 gene locus_tag LOCUS_6800 1489 50 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6800 >Feature sequence282 <1 764 gene locus_tag LOCUS_6810 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226986802.1:L,D-transpeptidase family protein 1474 761 gene locus_tag LOCUS_6820 1474 761 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546015.1 protein_id gnl|my_center|LOCUS_6820 >Feature sequence283 435 1178 gene locus_tag LOCUS_6830 gene thiD 435 1178 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202801.1 protein_id gnl|my_center|LOCUS_6830 >Feature sequence284 <1 524 gene locus_tag LOCUS_6840 <1 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003814978.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB 529 1887 gene locus_tag LOCUS_6850 529 1887 CDS product 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942899.1 protein_id gnl|my_center|LOCUS_6850 >Feature sequence285 <1 541 gene locus_tag LOCUS_6860 <1 541 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011727508.1:ABC transporter ATP-binding protein <1983 1037 gene locus_tag LOCUS_6870 <1983 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477390.1:sodium/proline symporter PutP >Feature sequence286 >Feature sequence287 672 1820 gene locus_tag LOCUS_6880 672 1820 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943025.1 protein_id gnl|my_center|LOCUS_6880 >Feature sequence288 270 1547 gene locus_tag LOCUS_6890 270 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6890 >Feature sequence289 227 1450 gene locus_tag LOCUS_6900 gene nuoD 227 1450 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545955.1 protein_id gnl|my_center|LOCUS_6900 >Feature sequence290 1848 271 gene locus_tag LOCUS_6910 1848 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6910 >Feature sequence291 497 1039 gene locus_tag LOCUS_6920 497 1039 CDS product PilN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942674.1 protein_id gnl|my_center|LOCUS_6920 1067 1825 gene locus_tag LOCUS_6930 1067 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6930 >Feature sequence292 865 470 gene locus_tag LOCUS_6940 865 470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6940 1887 952 gene locus_tag LOCUS_6950 1887 952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6950 >Feature sequence293 <1955 564 gene locus_tag LOCUS_6960 <1955 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939262.1:chaperonin GroEL >Feature sequence294 3 617 gene locus_tag LOCUS_6970 3 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6970 >Feature sequence295 1190 390 gene locus_tag LOCUS_6980 1190 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6980 1328 1792 gene locus_tag LOCUS_6990 1328 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_6990 >Feature sequence296 <1 1873 gene locus_tag LOCUS_7000 <1 1873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003733096.1:Stk1 family PASTA domain-containing Ser/Thr kinase >Feature sequence297 1150 797 gene locus_tag LOCUS_7010 1150 797 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546371.1 protein_id gnl|my_center|LOCUS_7010 1560 1279 gene locus_tag LOCUS_7020 1560 1279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7020 >Feature sequence298 <1 1123 gene locus_tag LOCUS_7030 <1 1123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941159.1:DEAD/DEAH box helicase 1392 1129 gene locus_tag LOCUS_7040 1392 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7040 1926 1708 gene locus_tag LOCUS_7050 1926 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7050 >Feature sequence299 <1 747 gene locus_tag LOCUS_7060 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940832.1:argininosuccinate lyase 825 1793 gene locus_tag LOCUS_7070 825 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7070 >Feature sequence300 528 962 gene locus_tag LOCUS_7080 528 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7080 >Feature sequence301 >Feature sequence302 1518 598 gene locus_tag LOCUS_7090 1518 598 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938750.1 protein_id gnl|my_center|LOCUS_7090 1731 1522 gene locus_tag LOCUS_7100 1731 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7100 >Feature sequence303 <1 522 gene locus_tag LOCUS_7110 <1 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943984.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB >Feature sequence304 122 625 gene locus_tag LOCUS_7120 122 625 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003700597.1 protein_id gnl|my_center|LOCUS_7120 >Feature sequence305 <1 787 gene locus_tag LOCUS_7130 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546021.1:lipopolysaccharide heptosyltransferase I 856 1056 gene locus_tag LOCUS_7140 856 1056 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_7140 >Feature sequence306 <1 512 gene locus_tag LOCUS_7150 <1 512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393112.1:(Fe-S)-binding protein 505 903 gene locus_tag LOCUS_7160 gene dsrJ 505 903 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393111.1 protein_id gnl|my_center|LOCUS_7160 900 1718 gene locus_tag LOCUS_7170 900 1718 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459005.1 protein_id gnl|my_center|LOCUS_7170 >Feature sequence307 75 731 gene locus_tag LOCUS_7180 gene adk 75 731 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185840.1 protein_id gnl|my_center|LOCUS_7180 <1914 799 gene locus_tag LOCUS_7190 <1914 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941039.1:glycosyltransferase family 1 protein >Feature sequence308 1304 300 gene locus_tag LOCUS_7200 gene thiL 1304 300 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943812.1 protein_id gnl|my_center|LOCUS_7200 1727 1311 gene locus_tag LOCUS_7210 gene ndk 1727 1311 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939606.1 protein_id gnl|my_center|LOCUS_7210 >Feature sequence309 482 108 gene locus_tag LOCUS_7220 gene crcB 482 108 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_7220 <1903 517 gene locus_tag LOCUS_7230 <1903 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005811724.1:ASKHA domain-containing protein >Feature sequence310 1061 555 gene locus_tag LOCUS_7240 1061 555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7240 >Feature sequence311 209 664 gene locus_tag LOCUS_7250 209 664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7250 >Feature sequence312 397 1059 gene locus_tag LOCUS_7260 397 1059 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942052.1 protein_id gnl|my_center|LOCUS_7260 >Feature sequence313 402 827 gene locus_tag LOCUS_7270 gene rlmH 402 827 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435703.1 protein_id gnl|my_center|LOCUS_7270 1085 858 gene locus_tag LOCUS_7280 1085 858 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011791779.1 protein_id gnl|my_center|LOCUS_7280 1791 1156 gene locus_tag LOCUS_7290 gene thiE 1791 1156 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093148.1 protein_id gnl|my_center|LOCUS_7290 >Feature sequence314 1 525 gene locus_tag LOCUS_7300 1 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7300 584 1387 gene locus_tag LOCUS_7310 gene dapB 584 1387 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_7310 >Feature sequence315 180 253 gene locus_tag LOCUS_t0160 180 253 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 396 1211 gene locus_tag LOCUS_7320 396 1211 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_7320 >Feature sequence316 >Feature sequence317 >Feature sequence318 >Feature sequence319 346 1131 gene locus_tag LOCUS_7330 346 1131 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393473.1 protein_id gnl|my_center|LOCUS_7330 1605 1132 gene locus_tag LOCUS_7340 1605 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7340 >Feature sequence320 1182 1063 gene locus_tag LOCUS_7350 1182 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7350 <1881 1335 gene locus_tag LOCUS_7360 <1881 1335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003102894.1:metallophosphoesterase family protein >Feature sequence321 102 1247 gene locus_tag LOCUS_7370 gene murG 102 1247 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943694.1 protein_id gnl|my_center|LOCUS_7370 >Feature sequence322 <1 840 gene locus_tag LOCUS_7380 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943679.1:MinD/ParA family protein 843 1661 gene locus_tag LOCUS_7390 gene whiG 843 1661 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_7390 >Feature sequence323 388 397 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence324 <1 598 gene locus_tag LOCUS_7400 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937471.1:KpsF/GutQ family sugar-phosphate isomerase 611 1024 gene locus_tag LOCUS_7410 611 1024 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943738.1 protein_id gnl|my_center|LOCUS_7410 1204 1037 gene locus_tag LOCUS_7420 1204 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7420 >Feature sequence325 1156 140 gene locus_tag LOCUS_7430 1156 140 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_7430 <1869 1153 gene locus_tag LOCUS_7440 <1869 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011970478.1:LssY C-terminal domain-containing protein >Feature sequence326 >Feature sequence327 1239 580 gene locus_tag LOCUS_7450 1239 580 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942332.1 protein_id gnl|my_center|LOCUS_7450 <1865 1242 gene locus_tag LOCUS_7460 <1865 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392432.1:bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD >Feature sequence328 <1 577 gene locus_tag LOCUS_7470 <1 577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010929958.1:peptide chain release factor N(5)-glutamine methyltransferase 796 1605 gene locus_tag LOCUS_7480 796 1605 CDS product flagellar motor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460801.1 protein_id gnl|my_center|LOCUS_7480 >Feature sequence329 31 906 gene locus_tag LOCUS_7490 31 906 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965618.1 protein_id gnl|my_center|LOCUS_7490 261 270 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1035 1805 gene locus_tag LOCUS_7500 1035 1805 CDS product DUF4198 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546093.1 protein_id gnl|my_center|LOCUS_7500 >Feature sequence330 187 798 gene locus_tag LOCUS_7510 gene yihA 187 798 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385283.1 protein_id gnl|my_center|LOCUS_7510 >Feature sequence331 <1 844 gene locus_tag LOCUS_7520 <1 844 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546519.1:radical SAM protein >Feature sequence332 1508 282 gene locus_tag LOCUS_7530 1508 282 CDS product muropeptide transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815250.1 protein_id gnl|my_center|LOCUS_7530 >Feature sequence333 >Feature sequence334 1635 541 gene locus_tag LOCUS_7540 1635 541 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957791.1 protein_id gnl|my_center|LOCUS_7540 >Feature sequence335 <1840 707 gene locus_tag LOCUS_7550 <1840 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546336.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence336 236 245 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 480 1163 gene locus_tag LOCUS_7560 480 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7560 >Feature sequence337 3 134 gene locus_tag LOCUS_7570 3 134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7570 164 478 gene locus_tag LOCUS_7580 gene rpsJ 164 478 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943487.1 protein_id gnl|my_center|LOCUS_7580 494 1123 gene locus_tag LOCUS_7590 gene rplC 494 1123 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081835.1 protein_id gnl|my_center|LOCUS_7590 1146 1766 gene locus_tag LOCUS_7600 gene rplD 1146 1766 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393936.1 protein_id gnl|my_center|LOCUS_7600 >Feature sequence338 499 257 gene locus_tag LOCUS_7610 499 257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7610 1425 880 gene locus_tag LOCUS_7620 1425 880 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_7620 >Feature sequence339 <1829 562 gene locus_tag LOCUS_7630 <1829 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546491.1:bifunctional aminoglycoside phosphotransferase/ATP-binding protein >Feature sequence340 >Feature sequence341 4 1668 gene locus_tag LOCUS_7640 4 1668 CDS product cation:dicarboxylase symporter family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020540.1 protein_id gnl|my_center|LOCUS_7640 >Feature sequence342 1341 793 gene locus_tag LOCUS_7650 gene pyrR 1341 793 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546581.1 protein_id gnl|my_center|LOCUS_7650 >Feature sequence343 198 455 gene locus_tag LOCUS_7660 198 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7660 443 871 gene locus_tag LOCUS_7670 443 871 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_7670 >Feature sequence344 1475 357 gene locus_tag LOCUS_7680 gene dnaJ 1475 357 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000004170.1 protein_id gnl|my_center|LOCUS_7680 1735 1472 gene locus_tag LOCUS_7690 1735 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7690 >Feature sequence345 479 925 gene locus_tag LOCUS_7700 gene rpiB 479 925 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880713.1 protein_id gnl|my_center|LOCUS_7700 >Feature sequence346 3 755 gene locus_tag LOCUS_7710 3 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7710 752 1429 gene locus_tag LOCUS_7720 752 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7720 >Feature sequence347 849 1463 gene locus_tag LOCUS_7730 849 1463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7730 1367 1376 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence348 <1 809 gene locus_tag LOCUS_7740 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943120.1:sensor histidine kinase KdpD >Feature sequence349 231 1163 gene locus_tag LOCUS_7750 231 1163 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941926.1 protein_id gnl|my_center|LOCUS_7750 >Feature sequence350 3 500 gene locus_tag LOCUS_7760 3 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7760 551 1690 gene locus_tag LOCUS_7770 551 1690 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_7770 >Feature sequence351 973 1767 gene locus_tag LOCUS_7780 gene mazG 973 1767 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941834.1 protein_id gnl|my_center|LOCUS_7780 >Feature sequence352 959 87 gene locus_tag LOCUS_7790 gene galU 959 87 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583975.1 protein_id gnl|my_center|LOCUS_7790 <1798 975 gene locus_tag LOCUS_7800 <1798 975 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228547.1:acetate--CoA ligase >Feature sequence353 <1794 296 gene locus_tag LOCUS_7810 <1794 296 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084982.1:hybrid sensor histidine kinase/response regulator >Feature sequence354 >Feature sequence355 <1792 708 gene locus_tag LOCUS_7820 <1792 708 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000834715.1:ABC transporter ATP-binding protein >Feature sequence356 1090 905 gene locus_tag LOCUS_7830 1090 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7830 941 950 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence357 <1 1484 gene locus_tag LOCUS_7840 <1 1484 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940249.1:molybdopterin biosynthesis protein >Feature sequence358 408 139 gene locus_tag LOCUS_7850 408 139 CDS product YHS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943607.1 protein_id gnl|my_center|LOCUS_7850 927 409 gene locus_tag LOCUS_7860 gene folK 927 409 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391686.1 protein_id gnl|my_center|LOCUS_7860 <1785 928 gene locus_tag LOCUS_7870 <1785 928 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392408.1:LL-diaminopimelate aminotransferase >Feature sequence359 <1 1086 gene locus_tag LOCUS_7880 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545339.1:ATP-binding protein <1784 1083 gene locus_tag LOCUS_7890 <1784 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011342568.1:DUF4139 domain-containing protein >Feature sequence360 694 1344 gene locus_tag LOCUS_7900 694 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7900 >Feature sequence361 <1 633 gene locus_tag LOCUS_7910 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973800.1:MoxR family ATPase >Feature sequence362 285 294 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 709 1101 gene locus_tag LOCUS_7920 709 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7920 1164 1261 gene locus_tag LOCUS_t0170 1164 1261 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 <1777 1269 gene locus_tag LOCUS_7930 <1777 1269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021995.1:glycogen debranching protein GlgX >Feature sequence363 913 461 gene locus_tag LOCUS_7940 913 461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7940 1668 1273 gene locus_tag LOCUS_7950 1668 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7950 >Feature sequence364 <1 681 gene locus_tag LOCUS_7960 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940799.1:hydrogenase small subunit >Feature sequence365 312 1244 gene locus_tag LOCUS_7970 312 1244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7970 >Feature sequence366 1770 454 gene locus_tag LOCUS_7980 1770 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_7980 >Feature sequence367 <1768 905 gene locus_tag LOCUS_7990 <1768 905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941793.1:signal recognition particle-docking protein FtsY >Feature sequence368 52 933 gene locus_tag LOCUS_8000 52 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8000 <1767 948 gene locus_tag LOCUS_8010 <1767 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877833.1:glucose-1-phosphate thymidylyltransferase >Feature sequence369 >Feature sequence370 201 1358 gene locus_tag LOCUS_8020 201 1358 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403123.1 protein_id gnl|my_center|LOCUS_8020 >Feature sequence371 <1 753 gene locus_tag LOCUS_8030 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942643.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA 750 1283 gene locus_tag LOCUS_8040 750 1283 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532444.1 protein_id gnl|my_center|LOCUS_8040 1337 1413 gene locus_tag LOCUS_t0180 1337 1413 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence372 <1 1372 gene locus_tag LOCUS_8050 <1 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250553.1:ATP synthase subunit A >Feature sequence373 1053 373 gene locus_tag LOCUS_8060 1053 373 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940040.1 protein_id gnl|my_center|LOCUS_8060 >Feature sequence374 565 1581 gene locus_tag LOCUS_8070 565 1581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8070 >Feature sequence375 138 446 gene locus_tag LOCUS_8080 138 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938093.1 protein_id gnl|my_center|LOCUS_8080 655 1203 gene locus_tag LOCUS_8090 655 1203 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_8090 1234 1527 gene locus_tag LOCUS_8100 gene porD 1234 1527 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_8100 >Feature sequence376 881 306 gene locus_tag LOCUS_8110 881 306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8110 <1746 977 gene locus_tag LOCUS_8120 <1746 977 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048066546.1:pyruvate kinase >Feature sequence377 >Feature sequence378 <1 628 gene locus_tag LOCUS_8130 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011117960.1:extracellular solute-binding protein >Feature sequence379 1730 1269 gene locus_tag LOCUS_8140 1730 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8140 >Feature sequence380 <1730 30 gene locus_tag LOCUS_8150 <1730 30 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938942.1:CBS domain-containing protein >Feature sequence381 <1727 804 gene locus_tag LOCUS_8160 <1727 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403684.1:Mur ligase family protein >Feature sequence382 912 553 gene locus_tag LOCUS_8170 912 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_8170 1074 925 gene locus_tag LOCUS_8180 1074 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_8180 1439 1062 gene locus_tag LOCUS_8190 1439 1062 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545140.1 protein_id gnl|my_center|LOCUS_8190 >Feature sequence383 <1 897 gene locus_tag LOCUS_8200 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071344.1:TRAP transporter substrate-binding protein DctP <1723 972 gene locus_tag LOCUS_8210 <1723 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258192.1:TRAP transporter large permease subunit >Feature sequence384 <1721 841 gene locus_tag LOCUS_8220 <1721 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545526.1:adenosylhomocysteinase >Feature sequence385 3 662 gene locus_tag LOCUS_8230 3 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8230 >Feature sequence386 63 956 gene locus_tag LOCUS_8240 63 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8240 >Feature sequence387 <1 756 gene locus_tag LOCUS_8250 <1 756 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942733.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase 761 1429 gene locus_tag LOCUS_8260 761 1429 CDS product thermonuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011792219.1 protein_id gnl|my_center|LOCUS_8260 >Feature sequence388 1399 59 gene locus_tag LOCUS_8270 1399 59 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_8270 >Feature sequence389 849 298 gene locus_tag LOCUS_8280 849 298 CDS product arylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939211.1 protein_id gnl|my_center|LOCUS_8280 1628 852 gene locus_tag LOCUS_8290 1628 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8290 >Feature sequence390 1006 1188 gene locus_tag LOCUS_8300 1006 1188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8300 1171 1180 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence391 956 87 gene locus_tag LOCUS_8310 956 87 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940783.1 protein_id gnl|my_center|LOCUS_8310 <1716 953 gene locus_tag LOCUS_8320 <1716 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003219244.1:sporulation initiation inhibitor protein Soj >Feature sequence392 901 254 gene locus_tag LOCUS_8330 901 254 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932570.1 protein_id gnl|my_center|LOCUS_8330 >Feature sequence393 766 86 gene locus_tag LOCUS_8340 766 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8340 <1715 804 gene locus_tag LOCUS_8350 <1715 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941157.1:YifB family Mg chelatase-like AAA ATPase >Feature sequence394 <1713 442 gene locus_tag LOCUS_8360 <1713 442 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869048.1:trehalose-6-phosphate synthase >Feature sequence395 <1 1370 gene locus_tag LOCUS_8370 <1 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583633.1:glutamate--tRNA ligase >Feature sequence396 382 1128 gene locus_tag LOCUS_8380 382 1128 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_8380 >Feature sequence397 967 1644 gene locus_tag LOCUS_8390 gene ftsE 967 1644 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942419.1 protein_id gnl|my_center|LOCUS_8390 >Feature sequence398 1375 137 gene locus_tag LOCUS_8400 1375 137 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938250.1 protein_id gnl|my_center|LOCUS_8400 >Feature sequence399 <1 623 gene locus_tag LOCUS_8410 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940307.1:aspartate-semialdehyde dehydrogenase 697 1368 gene locus_tag LOCUS_8420 697 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8420 >Feature sequence400 1318 59 gene locus_tag LOCUS_8430 1318 59 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943829.1 protein_id gnl|my_center|LOCUS_8430 1701 1417 gene locus_tag LOCUS_8440 1701 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8440 >Feature sequence401 1348 494 gene locus_tag LOCUS_8450 1348 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8450 >Feature sequence402 >Feature sequence403 559 44 gene locus_tag LOCUS_8460 559 44 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_8460 941 579 gene locus_tag LOCUS_8470 941 579 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010910112.1 protein_id gnl|my_center|LOCUS_8470 1593 1518 gene locus_tag LOCUS_t0190 1593 1518 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence404 880 440 gene locus_tag LOCUS_8480 880 440 CDS product gamma-glutamylcyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871037.1 protein_id gnl|my_center|LOCUS_8480 987 1259 gene locus_tag LOCUS_8490 987 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8490 >Feature sequence405 >Feature sequence406 >Feature sequence407 3 308 gene locus_tag LOCUS_8500 3 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8500 780 526 gene locus_tag LOCUS_8510 780 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8510 >Feature sequence408 >Feature sequence409 664 1410 gene locus_tag LOCUS_8520 664 1410 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946141.1 protein_id gnl|my_center|LOCUS_8520 >Feature sequence410 <1 1659 gene locus_tag LOCUS_8530 <1 1659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707657.1:exodeoxyribonuclease V subunit beta >Feature sequence411 655 777 gene locus_tag LOCUS_8540 655 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8540 >Feature sequence412 <1656 113 gene locus_tag LOCUS_8550 <1656 113 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942131.1:ribonuclease R >Feature sequence413 <1 1519 gene locus_tag LOCUS_8560 <1 1519 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942050.1:DNA polymerase III subunit alpha >Feature sequence414 >Feature sequence415 >Feature sequence416 844 419 gene locus_tag LOCUS_8570 gene arfB 844 419 CDS product alternative ribosome rescue aminoacyl-tRNA hydrolase ArfB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933639.1 protein_id gnl|my_center|LOCUS_8570 >Feature sequence417 >Feature sequence418 950 129 gene locus_tag LOCUS_8580 950 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8580 >Feature sequence419 <1 516 gene locus_tag LOCUS_8590 <1 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942721.1:penicillin-binding protein 2 523 1614 gene locus_tag LOCUS_8600 gene rodA 523 1614 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942720.1 protein_id gnl|my_center|LOCUS_8600 >Feature sequence420 >Feature sequence421 <1 624 gene locus_tag LOCUS_8610 <1 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941152.1:GTP cyclohydrolase FolE2 1479 640 gene locus_tag LOCUS_8620 1479 640 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258850.1 protein_id gnl|my_center|LOCUS_8620 >Feature sequence422 <1639 265 gene locus_tag LOCUS_8630 <1639 265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940695.1:transcription-repair coupling factor note possible pseudo, frameshifted 328 337 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence423 864 388 gene locus_tag LOCUS_8640 864 388 CDS product PTS sugar transporter subunit IIA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938921.1 protein_id gnl|my_center|LOCUS_8640 1237 869 gene locus_tag LOCUS_8650 1237 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_8650 1249 1258 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence424 <1 1624 gene locus_tag LOCUS_8660 <1 1624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000494544.1:multidrug efflux RND transporter permease subunit VexF >Feature sequence425 1178 159 gene locus_tag LOCUS_8670 1178 159 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392334.1 protein_id gnl|my_center|LOCUS_8670 >Feature sequence426 1562 300 gene locus_tag LOCUS_8680 gene murA 1562 300 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546097.1 protein_id gnl|my_center|LOCUS_8680 >Feature sequence427 <1 675 gene locus_tag LOCUS_8690 <1 675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004524145.1:DUF2760 domain-containing protein >Feature sequence428 792 274 gene locus_tag LOCUS_8700 792 274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8700 <1624 797 gene locus_tag LOCUS_8710 <1624 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942849.1:leucine--tRNA ligase >Feature sequence429 685 1245 gene locus_tag LOCUS_8720 685 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8720 >Feature sequence430 640 146 gene locus_tag LOCUS_8730 gene mog 640 146 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943343.1 protein_id gnl|my_center|LOCUS_8730 <1620 641 gene locus_tag LOCUS_8740 <1620 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942578.1:elongation factor G >Feature sequence431 >Feature sequence432 3 518 gene locus_tag LOCUS_8750 3 518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8750 627 1160 gene locus_tag LOCUS_8760 gene lptA 627 1160 CDS product lipopolysaccharide transport periplasmic protein LptA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942534.1 protein_id gnl|my_center|LOCUS_8760 >Feature sequence433 46 438 gene locus_tag LOCUS_8770 46 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8770 622 446 gene locus_tag LOCUS_8780 622 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8780 991 626 gene locus_tag LOCUS_8790 991 626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8790 >Feature sequence434 29 1285 gene locus_tag LOCUS_8800 29 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8800 >Feature sequence435 15 341 gene locus_tag LOCUS_8810 15 341 CDS product YegP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207563.1 protein_id gnl|my_center|LOCUS_8810 1283 405 gene locus_tag LOCUS_8820 1283 405 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048393.1 protein_id gnl|my_center|LOCUS_8820 >Feature sequence436 <1605 982 gene locus_tag LOCUS_8830 <1605 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938228.1:GTPase ObgE >Feature sequence437 596 988 gene locus_tag LOCUS_8840 596 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8840 >Feature sequence438 <1 1161 gene locus_tag LOCUS_8850 <1 1161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931750.1:ferrous iron transport protein B >Feature sequence439 388 897 gene locus_tag LOCUS_8860 388 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8860 411 420 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 894 1238 gene locus_tag LOCUS_8870 894 1238 CDS product YtxH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545864.1 protein_id gnl|my_center|LOCUS_8870 >Feature sequence440 <1 1083 gene locus_tag LOCUS_8880 <1 1083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143571.1:glycosyltransferase family 39 protein >Feature sequence441 <1 633 gene locus_tag LOCUS_8890 <1 633 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000544275.1:excinuclease ABC subunit C >Feature sequence442 544 203 gene locus_tag LOCUS_8900 544 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8900 895 563 gene locus_tag LOCUS_8910 895 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8910 1205 948 gene locus_tag LOCUS_8920 1205 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8920 >Feature sequence443 379 1566 gene locus_tag LOCUS_8930 379 1566 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938142.1 protein_id gnl|my_center|LOCUS_8930 >Feature sequence444 225 149 gene locus_tag LOCUS_t0200 225 149 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence445 <1 602 gene locus_tag LOCUS_8940 <1 602 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889526.1:FmdE family protein >Feature sequence446 >Feature sequence447 605 231 gene locus_tag LOCUS_8950 gene divK 605 231 CDS product cell-cycle response regulator DivK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012640499.1 protein_id gnl|my_center|LOCUS_8950 <1586 607 gene locus_tag LOCUS_8960 <1586 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008763530.1:hybrid sensor histidine kinase/response regulator >Feature sequence448 434 1441 gene locus_tag LOCUS_8970 434 1441 CDS product J domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881126.1 protein_id gnl|my_center|LOCUS_8970 >Feature sequence449 326 1039 gene locus_tag LOCUS_8980 326 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_8980 >Feature sequence450 76 591 gene locus_tag LOCUS_8990 gene rplF 76 591 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055950.1 protein_id gnl|my_center|LOCUS_8990 626 997 gene locus_tag LOCUS_9000 gene rplR 626 997 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055951.1 protein_id gnl|my_center|LOCUS_9000 1019 1531 gene locus_tag LOCUS_9010 gene rpsE 1019 1531 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938615.1 protein_id gnl|my_center|LOCUS_9010 >Feature sequence451 >Feature sequence452 63 578 gene locus_tag LOCUS_9020 63 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9020 >Feature sequence453 >Feature sequence454 1468 761 gene locus_tag LOCUS_9030 1468 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_9030 >Feature sequence455 <1 1559 gene locus_tag LOCUS_9040 <1 1559 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080521.1:DUF505 domain-containing protein >Feature sequence456 >Feature sequence457 <1571 946 gene locus_tag LOCUS_9050 <1571 946 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257223.1:DUF2298 domain-containing protein >Feature sequence458 410 781 gene locus_tag LOCUS_9060 410 781 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941311.1 protein_id gnl|my_center|LOCUS_9060 >Feature sequence459 1519 488 gene locus_tag LOCUS_9070 1519 488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9070 >Feature sequence460 962 246 gene locus_tag LOCUS_9080 962 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9080 >Feature sequence461 <1 780 gene locus_tag LOCUS_9090 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_140017877.1:histone deacetylase 800 1093 gene locus_tag LOCUS_9100 800 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_9100 1033 1042 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1050 1448 gene locus_tag LOCUS_9110 1050 1448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9110 >Feature sequence462 >Feature sequence463 >Feature sequence464 <1 1403 gene locus_tag LOCUS_9120 <1 1403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937565.1:DEAD/DEAH box helicase >Feature sequence465 163 1494 gene locus_tag LOCUS_9130 163 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9130 >Feature sequence466 <1 1077 gene locus_tag LOCUS_9140 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_047863328.1:glycogen synthase GlgA >Feature sequence467 1208 504 gene locus_tag LOCUS_9150 1208 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9150 >Feature sequence468 <1551 568 gene locus_tag LOCUS_9160 <1551 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943129.1:PAS domain-containing sensor histidine kinase >Feature sequence469 >Feature sequence470 1366 494 gene locus_tag LOCUS_9170 gene hisG 1366 494 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937425.1 protein_id gnl|my_center|LOCUS_9170 1542 1363 gene locus_tag LOCUS_9180 1542 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9180 >Feature sequence471 406 1041 gene locus_tag LOCUS_9190 406 1041 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942470.1 protein_id gnl|my_center|LOCUS_9190 >Feature sequence472 <1 556 gene locus_tag LOCUS_9200 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044997.1:ATP-binding protein >Feature sequence473 >Feature sequence474 270 1031 gene locus_tag LOCUS_9210 270 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9210 <1537 997 gene locus_tag LOCUS_9220 <1537 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256624.1:L,D-transpeptidase >Feature sequence475 >Feature sequence476 808 455 gene locus_tag LOCUS_9230 808 455 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958148.1 protein_id gnl|my_center|LOCUS_9230 >Feature sequence477 148 1443 gene locus_tag LOCUS_9240 gene arnB 148 1443 CDS product UDP-4-amino-4-deoxy-L-arabinose aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704927.1 protein_id gnl|my_center|LOCUS_9240 1269 1278 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence478 853 263 gene locus_tag LOCUS_9250 853 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9250 1304 915 gene locus_tag LOCUS_9260 1304 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9260 >Feature sequence479 986 1234 gene locus_tag LOCUS_9270 986 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9270 >Feature sequence480 317 1099 gene locus_tag LOCUS_9280 gene fetB 317 1099 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004191253.1 protein_id gnl|my_center|LOCUS_9280 >Feature sequence481 >Feature sequence482 1448 972 gene locus_tag LOCUS_9290 gene nusB 1448 972 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942335.1 protein_id gnl|my_center|LOCUS_9290 >Feature sequence483 <1 1130 gene locus_tag LOCUS_9300 <1 1130 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895558.1:type II secretion system protein GspD >Feature sequence484 785 138 gene locus_tag LOCUS_9310 785 138 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880134.1 protein_id gnl|my_center|LOCUS_9310 <1522 790 gene locus_tag LOCUS_9320 <1522 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162890715.1:PAS domain-containing sensor histidine kinase >Feature sequence485 <1 552 gene locus_tag LOCUS_9330 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941192.1:TIGR02757 family protein 633 833 gene locus_tag LOCUS_9340 633 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9340 >Feature sequence486 >Feature sequence487 <1 1413 gene locus_tag LOCUS_9350 <1 1413 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869266.1:DUF2207 domain-containing protein >Feature sequence488 >Feature sequence489 1375 707 gene locus_tag LOCUS_9360 gene nth 1375 707 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583053.1 protein_id gnl|my_center|LOCUS_9360 >Feature sequence490 1337 288 gene locus_tag LOCUS_9370 1337 288 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072825.1 protein_id gnl|my_center|LOCUS_9370 >Feature sequence491 <1 1119 gene locus_tag LOCUS_9380 <1 1119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010895558.1:type II secretion system protein GspD >Feature sequence492 >Feature sequence493 <1 1368 gene locus_tag LOCUS_9390 <1 1368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933195.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence494 31 1143 gene locus_tag LOCUS_9400 31 1143 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_9400 >Feature sequence495 <1 611 gene locus_tag LOCUS_9410 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064402.1:FprA family A-type flavoprotein 644 973 gene locus_tag LOCUS_9420 644 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9420 >Feature sequence496 190 1128 gene locus_tag LOCUS_9430 190 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9430 >Feature sequence497 <1 712 gene locus_tag LOCUS_9440 <1 712 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010919046.1:pyridoxal phosphate-dependent aminotransferase family protein >Feature sequence498 1485 61 gene locus_tag LOCUS_9450 1485 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_9450