>Feature sequence001 <1 1221 gene locus_tag LOCUS_00010 <1 1221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762144.1:nicotinate phosphoribosyltransferase 1899 1108 gene locus_tag LOCUS_00020 1899 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2842 2766 gene locus_tag LOCUS_t00010 2842 2766 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3329 3057 gene locus_tag LOCUS_00030 3329 3057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 3528 4682 gene locus_tag LOCUS_00040 gene twy1 3528 4682 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979301.1 protein_id gnl|my_center|LOCUS_00040 5466 4684 gene locus_tag LOCUS_00050 5466 4684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 6408 7802 gene locus_tag LOCUS_00060 gene gcvPA 6408 7802 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979226.1 protein_id gnl|my_center|LOCUS_00060 7806 9344 gene locus_tag LOCUS_00070 gene gcvPB 7806 9344 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868896.1 protein_id gnl|my_center|LOCUS_00070 9818 9333 gene locus_tag LOCUS_00080 9818 9333 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148208718.1 protein_id gnl|my_center|LOCUS_00080 10659 9742 gene locus_tag LOCUS_00090 10659 9742 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978553.1 protein_id gnl|my_center|LOCUS_00090 10769 12490 gene locus_tag LOCUS_00100 gene metG 10769 12490 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762101.1 protein_id gnl|my_center|LOCUS_00100 12574 12999 gene locus_tag LOCUS_00110 12574 12999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 13223 14131 gene locus_tag LOCUS_00120 13223 14131 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250632.1 protein_id gnl|my_center|LOCUS_00120 14106 14780 gene locus_tag LOCUS_00130 14106 14780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867709.1 protein_id gnl|my_center|LOCUS_00130 15062 14736 gene locus_tag LOCUS_00140 15062 14736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 16995 14995 gene locus_tag LOCUS_00150 gene rqcH 16995 14995 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061171.1 protein_id gnl|my_center|LOCUS_00150 17119 17361 gene locus_tag LOCUS_00160 17119 17361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 17684 17448 gene locus_tag LOCUS_00170 17684 17448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 18975 17791 gene locus_tag LOCUS_00180 18975 17791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 19155 19961 gene locus_tag LOCUS_00190 gene nucS 19155 19961 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 protein_id gnl|my_center|LOCUS_00190 21860 20034 gene locus_tag LOCUS_00200 21860 20034 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846358.1 protein_id gnl|my_center|LOCUS_00200 23587 21866 gene locus_tag LOCUS_00210 23587 21866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23753 27088 gene locus_tag LOCUS_00220 23753 27088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 27169 27603 gene locus_tag LOCUS_00230 27169 27603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 >Feature sequence002 34 573 gene locus_tag LOCUS_00240 34 573 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_00240 1073 831 gene locus_tag LOCUS_00250 1073 831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 1172 1384 gene locus_tag LOCUS_00260 1172 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 1637 1398 gene locus_tag LOCUS_00270 1637 1398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846524.1 protein_id gnl|my_center|LOCUS_00270 1795 4662 gene locus_tag LOCUS_00280 1795 4662 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979313.1 protein_id gnl|my_center|LOCUS_00280 5001 5525 gene locus_tag LOCUS_00290 5001 5525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 5663 5932 gene locus_tag LOCUS_00300 gene albA 5663 5932 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979310.1 protein_id gnl|my_center|LOCUS_00300 9639 5929 gene locus_tag LOCUS_00310 gene rgy 9639 5929 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979311.1 protein_id gnl|my_center|LOCUS_00310 9828 10133 gene locus_tag LOCUS_00320 gene albA 9828 10133 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979310.1 protein_id gnl|my_center|LOCUS_00320 10159 10398 gene locus_tag LOCUS_00330 10159 10398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 10992 10534 gene locus_tag LOCUS_00340 10992 10534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 10891 12423 gene locus_tag LOCUS_00350 gene glmS 10891 12423 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762183.1 protein_id gnl|my_center|LOCUS_00350 12455 13606 gene locus_tag LOCUS_00360 12455 13606 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762182.1 protein_id gnl|my_center|LOCUS_00360 13821 14444 gene locus_tag LOCUS_00370 13821 14444 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868704.1 protein_id gnl|my_center|LOCUS_00370 14431 14700 gene locus_tag LOCUS_00380 14431 14700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 15665 14922 gene locus_tag LOCUS_00390 gene deoC 15665 14922 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880038.1 protein_id gnl|my_center|LOCUS_00390 16862 15702 gene locus_tag LOCUS_00400 16862 15702 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979317.1 protein_id gnl|my_center|LOCUS_00400 18480 16882 gene locus_tag LOCUS_00410 18480 16882 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979316.1 protein_id gnl|my_center|LOCUS_00410 >Feature sequence003 4 435 gene locus_tag LOCUS_00420 4 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 763 1524 gene locus_tag LOCUS_00430 763 1524 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227942.1 protein_id gnl|my_center|LOCUS_00430 1527 3473 gene locus_tag LOCUS_00440 1527 3473 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256972.1 protein_id gnl|my_center|LOCUS_00440 3499 4407 gene locus_tag LOCUS_00450 3499 4407 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172673.1 protein_id gnl|my_center|LOCUS_00450 4427 5485 gene locus_tag LOCUS_00460 4427 5485 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812443.1 protein_id gnl|my_center|LOCUS_00460 5642 7012 gene locus_tag LOCUS_00470 5642 7012 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256969.1 protein_id gnl|my_center|LOCUS_00470 7134 7919 gene locus_tag LOCUS_00480 7134 7919 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227947.1 protein_id gnl|my_center|LOCUS_00480 8599 7916 gene locus_tag LOCUS_00490 8599 7916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 9463 8795 gene locus_tag LOCUS_00500 9463 8795 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 9584 10330 gene locus_tag LOCUS_00510 9584 10330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 10916 10434 gene locus_tag LOCUS_00520 10916 10434 CDS product DUF2795 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930622.1 protein_id gnl|my_center|LOCUS_00520 11369 11133 gene locus_tag LOCUS_00530 11369 11133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 11683 13044 gene locus_tag LOCUS_00540 11683 13044 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763417.1 protein_id gnl|my_center|LOCUS_00540 13063 13248 gene locus_tag LOCUS_00550 13063 13248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 13292 13870 gene locus_tag LOCUS_00560 13292 13870 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868483.1 protein_id gnl|my_center|LOCUS_00560 13867 14229 gene locus_tag LOCUS_00570 13867 14229 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762971.1 protein_id gnl|my_center|LOCUS_00570 14237 15499 gene locus_tag LOCUS_00580 14237 15499 CDS product ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240382.1 protein_id gnl|my_center|LOCUS_00580 15583 16539 gene locus_tag LOCUS_00590 gene porB 15583 16539 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496444.1 protein_id gnl|my_center|LOCUS_00590 >Feature sequence004 1281 373 gene locus_tag LOCUS_00600 gene rnz 1281 373 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_00600 1770 1372 gene locus_tag LOCUS_00610 1770 1372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 1880 2446 gene locus_tag LOCUS_00620 1880 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 2605 2943 gene locus_tag LOCUS_00630 2605 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 3005 4102 gene locus_tag LOCUS_00640 3005 4102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 4267 5196 gene locus_tag LOCUS_00650 gene sdhB 4267 5196 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_00650 5501 5193 gene locus_tag LOCUS_00660 5501 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 5913 5506 gene locus_tag LOCUS_00670 5913 5506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 6434 6000 gene locus_tag LOCUS_00680 6434 6000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 6679 6431 gene locus_tag LOCUS_00690 6679 6431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 8557 6749 gene locus_tag LOCUS_00700 8557 6749 CDS product succinate dehydrogenase/fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878184.1 protein_id gnl|my_center|LOCUS_00700 8604 9014 gene locus_tag LOCUS_00710 8604 9014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 9020 10270 gene locus_tag LOCUS_00720 9020 10270 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762391.1 protein_id gnl|my_center|LOCUS_00720 11313 10267 gene locus_tag LOCUS_00730 11313 10267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 <15107 11503 gene locus_tag LOCUS_00740 <15107 11503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251058.1:efflux RND transporter permease subunit >Feature sequence005 700 59 gene locus_tag LOCUS_00750 gene cas4 700 59 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847033.1 protein_id gnl|my_center|LOCUS_00750 1038 748 gene locus_tag LOCUS_00760 1038 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00760 1037 1231 gene locus_tag LOCUS_00770 1037 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 1448 4147 gene locus_tag LOCUS_00780 1448 4147 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429806.1 protein_id gnl|my_center|LOCUS_00780 4434 5744 gene locus_tag LOCUS_00790 4434 5744 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979397.1 protein_id gnl|my_center|LOCUS_00790 5741 6781 gene locus_tag LOCUS_00800 5741 6781 CDS product phosphorylating glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979396.1 protein_id gnl|my_center|LOCUS_00800 6896 7327 gene locus_tag LOCUS_00810 6896 7327 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979395.1 protein_id gnl|my_center|LOCUS_00810 7346 7969 gene locus_tag LOCUS_00820 7346 7969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 8080 8685 gene locus_tag LOCUS_00830 8080 8685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 8663 8905 gene locus_tag LOCUS_00840 8663 8905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 9541 8936 gene locus_tag LOCUS_00850 9541 8936 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742650.1 protein_id gnl|my_center|LOCUS_00850 11465 9882 gene locus_tag LOCUS_00860 11465 9882 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980182.1 protein_id gnl|my_center|LOCUS_00860 11592 12431 gene locus_tag LOCUS_00870 11592 12431 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240426.1 protein_id gnl|my_center|LOCUS_00870 12487 13800 gene locus_tag LOCUS_00880 12487 13800 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_136361690.1 protein_id gnl|my_center|LOCUS_00880 14211 13765 gene locus_tag LOCUS_00890 14211 13765 CDS product AIR carboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021394.1 protein_id gnl|my_center|LOCUS_00890 >Feature sequence006 932 1201 gene locus_tag LOCUS_00900 932 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 1325 2134 gene locus_tag LOCUS_00910 1325 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 3345 2131 gene locus_tag LOCUS_00920 3345 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 4086 3355 gene locus_tag LOCUS_00930 4086 3355 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763060.1 protein_id gnl|my_center|LOCUS_00930 4776 4099 gene locus_tag LOCUS_00940 4776 4099 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082876.1 protein_id gnl|my_center|LOCUS_00940 5536 4955 gene locus_tag LOCUS_00950 5536 4955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 5629 7569 gene locus_tag LOCUS_00960 5629 7569 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_00960 7771 8595 gene locus_tag LOCUS_00970 7771 8595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 8802 9575 gene locus_tag LOCUS_00980 gene rnhB 8802 9575 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_00980 9778 11085 gene locus_tag LOCUS_00990 9778 11085 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762514.1 protein_id gnl|my_center|LOCUS_00990 11923 12441 gene locus_tag LOCUS_01000 11923 12441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978183.1 protein_id gnl|my_center|LOCUS_01000 >Feature sequence007 969 514 gene locus_tag LOCUS_01010 969 514 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761914.1 protein_id gnl|my_center|LOCUS_01010 1507 1184 gene locus_tag LOCUS_01020 1507 1184 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763032.1 protein_id gnl|my_center|LOCUS_01020 2044 1532 gene locus_tag LOCUS_01030 2044 1532 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978373.1 protein_id gnl|my_center|LOCUS_01030 2262 5180 gene locus_tag LOCUS_01040 gene ileS 2262 5180 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763377.1 protein_id gnl|my_center|LOCUS_01040 5623 5201 gene locus_tag LOCUS_01050 5623 5201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 5829 5620 gene locus_tag LOCUS_01060 5829 5620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 6292 7746 gene locus_tag LOCUS_01070 6292 7746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 7813 10116 gene locus_tag LOCUS_01080 7813 10116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 10113 10589 gene locus_tag LOCUS_01090 10113 10589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 11007 10621 gene locus_tag LOCUS_01100 11007 10621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 12034 11183 gene locus_tag LOCUS_01110 12034 11183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763462.1 protein_id gnl|my_center|LOCUS_01110 12701 12273 gene locus_tag LOCUS_01120 12701 12273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 >Feature sequence008 63 656 gene locus_tag LOCUS_01130 63 656 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_01130 659 1195 gene locus_tag LOCUS_01140 659 1195 CDS product transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978294.1 protein_id gnl|my_center|LOCUS_01140 1167 2132 gene locus_tag LOCUS_01150 1167 2132 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978295.1 protein_id gnl|my_center|LOCUS_01150 2641 2129 gene locus_tag LOCUS_01160 2641 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 2783 3613 gene locus_tag LOCUS_01170 2783 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846227.1 protein_id gnl|my_center|LOCUS_01170 5145 3889 gene locus_tag LOCUS_01180 gene ahcY 5145 3889 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_01180 6159 5560 gene locus_tag LOCUS_01190 6159 5560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 6349 6274 gene locus_tag LOCUS_t00020 6349 6274 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 6672 6596 gene locus_tag LOCUS_t00030 6672 6596 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 7892 6867 gene locus_tag LOCUS_01200 7892 6867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 8167 9174 gene locus_tag LOCUS_01210 8167 9174 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978164.1 protein_id gnl|my_center|LOCUS_01210 9178 9468 gene locus_tag LOCUS_01220 9178 9468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 10190 9465 gene locus_tag LOCUS_01230 10190 9465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 11065 10226 gene locus_tag LOCUS_01240 11065 10226 CDS product BtpA/SgcQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868180.1 protein_id gnl|my_center|LOCUS_01240 11717 11289 gene locus_tag LOCUS_01250 gene trxA 11717 11289 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846557.1 protein_id gnl|my_center|LOCUS_01250 11849 12259 gene locus_tag LOCUS_01260 11849 12259 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762946.1 protein_id gnl|my_center|LOCUS_01260 12550 12879 gene locus_tag LOCUS_01270 12550 12879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 >Feature sequence009 342 812 gene locus_tag LOCUS_01280 gene cdd 342 812 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240361.1 protein_id gnl|my_center|LOCUS_01280 1045 809 gene locus_tag LOCUS_01290 1045 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 1017 1454 gene locus_tag LOCUS_01300 1017 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 1503 2021 gene locus_tag LOCUS_01310 1503 2021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01310 2109 2762 gene locus_tag LOCUS_01320 2109 2762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 2935 6144 gene locus_tag LOCUS_01330 2935 6144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 6333 7445 gene locus_tag LOCUS_01340 6333 7445 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762663.1 protein_id gnl|my_center|LOCUS_01340 7529 9076 gene locus_tag LOCUS_01350 7529 9076 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240320.1 protein_id gnl|my_center|LOCUS_01350 9081 10205 gene locus_tag LOCUS_01360 9081 10205 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250751.1 protein_id gnl|my_center|LOCUS_01360 10385 10975 gene locus_tag LOCUS_01370 10385 10975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 11374 11018 gene locus_tag LOCUS_01380 11374 11018 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249470.1 protein_id gnl|my_center|LOCUS_01380 11858 11460 gene locus_tag LOCUS_01390 gene crcB 11858 11460 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031399.1 protein_id gnl|my_center|LOCUS_01390 >Feature sequence010 324 1019 gene locus_tag LOCUS_01400 324 1019 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979463.1 protein_id gnl|my_center|LOCUS_01400 1096 2592 gene locus_tag LOCUS_01410 1096 2592 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879447.1 protein_id gnl|my_center|LOCUS_01410 2573 4234 gene locus_tag LOCUS_01420 gene pheT 2573 4234 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979460.1 protein_id gnl|my_center|LOCUS_01420 4452 5549 gene locus_tag LOCUS_01430 4452 5549 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846716.1 protein_id gnl|my_center|LOCUS_01430 5772 7085 gene locus_tag LOCUS_01440 gene dnaG 5772 7085 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980150.1 protein_id gnl|my_center|LOCUS_01440 8337 7183 gene locus_tag LOCUS_01450 8337 7183 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650980.1 protein_id gnl|my_center|LOCUS_01450 8490 9221 gene locus_tag LOCUS_01460 8490 9221 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980156.1 protein_id gnl|my_center|LOCUS_01460 9214 10275 gene locus_tag LOCUS_01470 9214 10275 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846717.1 protein_id gnl|my_center|LOCUS_01470 11298 10210 gene locus_tag LOCUS_01480 11298 10210 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867805.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence011 <1 1167 gene locus_tag LOCUS_01490 <1 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846316.1:elongation factor EF-2 2799 1381 gene locus_tag LOCUS_01500 2799 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 3017 3466 gene locus_tag LOCUS_01510 3017 3466 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_01510 4520 3456 gene locus_tag LOCUS_01520 4520 3456 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868269.1 protein_id gnl|my_center|LOCUS_01520 4772 6118 gene locus_tag LOCUS_01530 4772 6118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 6189 6350 gene locus_tag LOCUS_01540 6189 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 6552 7835 gene locus_tag LOCUS_01550 gene hemL 6552 7835 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846220.1 protein_id gnl|my_center|LOCUS_01550 7843 8754 gene locus_tag LOCUS_01560 gene hemC 7843 8754 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761811.1 protein_id gnl|my_center|LOCUS_01560 9615 8785 gene locus_tag LOCUS_01570 9615 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 9715 10491 gene locus_tag LOCUS_01580 gene cobA 9715 10491 CDS product uroporphyrinogen-III C-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496681.1 protein_id gnl|my_center|LOCUS_01580 <11182 10488 gene locus_tag LOCUS_01590 <11182 10488 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979225.1:glycine cleavage system aminomethyltransferase GcvT >Feature sequence012 1594 1217 gene locus_tag LOCUS_01600 1594 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 2258 1584 gene locus_tag LOCUS_01610 2258 1584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 3030 2704 gene locus_tag LOCUS_01620 3030 2704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 3388 4125 gene locus_tag LOCUS_01630 3388 4125 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978977.1 protein_id gnl|my_center|LOCUS_01630 4240 4602 gene locus_tag LOCUS_01640 4240 4602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01640 4599 5582 gene locus_tag LOCUS_01650 4599 5582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 5998 5579 gene locus_tag LOCUS_01660 5998 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 6243 6974 gene locus_tag LOCUS_01670 6243 6974 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978168.1 protein_id gnl|my_center|LOCUS_01670 9020 7068 gene locus_tag LOCUS_01680 gene gatE 9020 7068 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979281.1 protein_id gnl|my_center|LOCUS_01680 10390 9017 gene locus_tag LOCUS_01690 gene gatD 10390 9017 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_01690 10483 10650 gene locus_tag LOCUS_01700 10483 10650 CDS product 30S ribosomal protein S30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763628.1 protein_id gnl|my_center|LOCUS_01700 >Feature sequence013 141 638 gene locus_tag LOCUS_01710 141 638 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147325.1 protein_id gnl|my_center|LOCUS_01710 754 2940 gene locus_tag LOCUS_01720 754 2940 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978339.1 protein_id gnl|my_center|LOCUS_01720 3105 3377 gene locus_tag LOCUS_01730 3105 3377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 4630 3374 gene locus_tag LOCUS_01740 4630 3374 CDS product fucose isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762299.1 protein_id gnl|my_center|LOCUS_01740 4761 6098 gene locus_tag LOCUS_01750 4761 6098 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762275.1 protein_id gnl|my_center|LOCUS_01750 6336 6587 gene locus_tag LOCUS_01760 6336 6587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6635 7960 gene locus_tag LOCUS_01770 6635 7960 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870113.1 protein_id gnl|my_center|LOCUS_01770 8672 8061 gene locus_tag LOCUS_01780 8672 8061 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867717.1 protein_id gnl|my_center|LOCUS_01780 9397 8612 gene locus_tag LOCUS_01790 9397 8612 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846354.1 protein_id gnl|my_center|LOCUS_01790 10998 9601 gene locus_tag LOCUS_01800 10998 9601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence014 2055 499 gene locus_tag LOCUS_01810 2055 499 CDS product complex I subunit 5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763356.1 protein_id gnl|my_center|LOCUS_01810 2378 2064 gene locus_tag LOCUS_01820 2378 2064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 3076 2564 gene locus_tag LOCUS_01830 3076 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 3628 3083 gene locus_tag LOCUS_01840 gene nuoI 3628 3083 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847026.1 protein_id gnl|my_center|LOCUS_01840 4687 3653 gene locus_tag LOCUS_01850 gene nuoH 4687 3653 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015591312.1 protein_id gnl|my_center|LOCUS_01850 5920 4712 gene locus_tag LOCUS_01860 5920 4712 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980299.1 protein_id gnl|my_center|LOCUS_01860 6146 6688 gene locus_tag LOCUS_01870 6146 6688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 8396 6768 gene locus_tag LOCUS_01880 8396 6768 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005575582.1 protein_id gnl|my_center|LOCUS_01880 7594 7603 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9968 8475 gene locus_tag LOCUS_01890 9968 8475 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 protein_id gnl|my_center|LOCUS_01890 10090 10731 gene locus_tag LOCUS_01900 gene nuoB 10090 10731 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979576.1 protein_id gnl|my_center|LOCUS_01900 >Feature sequence015 1026 28 gene locus_tag LOCUS_01910 gene mvk 1026 28 CDS product mevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256769.1 protein_id gnl|my_center|LOCUS_01910 1366 1178 gene locus_tag LOCUS_01920 1366 1178 CDS product chromatin protein Cren7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846948.1 protein_id gnl|my_center|LOCUS_01920 1934 4216 gene locus_tag LOCUS_01930 1934 4216 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762768.1 protein_id gnl|my_center|LOCUS_01930 4564 5145 gene locus_tag LOCUS_01940 4564 5145 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909135.1 protein_id gnl|my_center|LOCUS_01940 6612 5980 gene locus_tag LOCUS_01950 6612 5980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 6554 6760 gene locus_tag LOCUS_01960 6554 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 6977 7717 gene locus_tag LOCUS_01970 6977 7717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 7780 8229 gene locus_tag LOCUS_01980 7780 8229 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000366244.1 protein_id gnl|my_center|LOCUS_01980 8546 8226 gene locus_tag LOCUS_01990 8546 8226 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867507.1 protein_id gnl|my_center|LOCUS_01990 8656 10020 gene locus_tag LOCUS_02000 8656 10020 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763469.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence016 1288 911 gene locus_tag LOCUS_02010 gene pth2 1288 911 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146590.1 protein_id gnl|my_center|LOCUS_02010 1390 1605 gene locus_tag LOCUS_02020 1390 1605 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088862262.1 protein_id gnl|my_center|LOCUS_02020 1642 1920 gene locus_tag LOCUS_02030 1642 1920 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877307.1 protein_id gnl|my_center|LOCUS_02030 2133 4343 gene locus_tag LOCUS_02040 2133 4343 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429724.1 protein_id gnl|my_center|LOCUS_02040 4546 4782 gene locus_tag LOCUS_02050 4546 4782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02050 4875 5936 gene locus_tag LOCUS_02060 gene fen 4875 5936 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_02060 6787 5933 gene locus_tag LOCUS_02070 6787 5933 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869667.1 protein_id gnl|my_center|LOCUS_02070 7098 6931 gene locus_tag LOCUS_02080 7098 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02080 8116 7082 gene locus_tag LOCUS_02090 8116 7082 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020662.1 protein_id gnl|my_center|LOCUS_02090 8148 8984 gene locus_tag LOCUS_02100 8148 8984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 8963 9484 gene locus_tag LOCUS_02110 gene nob1 8963 9484 CDS product type II toxin-antitoxin system toxin endoribonuclease Nob1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877892.1 protein_id gnl|my_center|LOCUS_02110 <10295 9468 gene locus_tag LOCUS_02120 <10295 9468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868893.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase >Feature sequence017 739 1314 gene locus_tag LOCUS_02130 739 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02130 1322 2533 gene locus_tag LOCUS_02140 1322 2533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 2512 4185 gene locus_tag LOCUS_02150 2512 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 4201 5403 gene locus_tag LOCUS_02160 4201 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 6295 5297 gene locus_tag LOCUS_02170 6295 5297 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_02170 6216 6407 gene locus_tag LOCUS_02180 6216 6407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6509 7165 gene locus_tag LOCUS_02190 6509 7165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 7295 9304 gene locus_tag LOCUS_02200 gene acs 7295 9304 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762026.1 protein_id gnl|my_center|LOCUS_02200 9782 9351 gene locus_tag LOCUS_02210 9782 9351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence018 625 212 gene locus_tag LOCUS_02220 625 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 771 2495 gene locus_tag LOCUS_02230 771 2495 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_02230 2404 2883 gene locus_tag LOCUS_02240 2404 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3335 2880 gene locus_tag LOCUS_02250 3335 2880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 4557 3388 gene locus_tag LOCUS_02260 4557 3388 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978596.1 protein_id gnl|my_center|LOCUS_02260 5280 4690 gene locus_tag LOCUS_02270 5280 4690 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496737.1 protein_id gnl|my_center|LOCUS_02270 5980 5288 gene locus_tag LOCUS_02280 5980 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 6319 7191 gene locus_tag LOCUS_02290 6319 7191 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763579.1 protein_id gnl|my_center|LOCUS_02290 7914 7171 gene locus_tag LOCUS_02300 7914 7171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 8786 7908 gene locus_tag LOCUS_02310 8786 7908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence019 414 1763 gene locus_tag LOCUS_02320 414 1763 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870779.1 protein_id gnl|my_center|LOCUS_02320 2023 2799 gene locus_tag LOCUS_02330 2023 2799 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496773.1 protein_id gnl|my_center|LOCUS_02330 2820 3542 gene locus_tag LOCUS_02340 2820 3542 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384137.1 protein_id gnl|my_center|LOCUS_02340 3535 4518 gene locus_tag LOCUS_02350 3535 4518 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057431.1 protein_id gnl|my_center|LOCUS_02350 4525 5655 gene locus_tag LOCUS_02360 4525 5655 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762344.1 protein_id gnl|my_center|LOCUS_02360 5909 6205 gene locus_tag LOCUS_02370 5909 6205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 7761 6202 gene locus_tag LOCUS_02380 7761 6202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 7880 8170 gene locus_tag LOCUS_02390 7880 8170 CDS product 30S ribosomal protein S26e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979487.1 protein_id gnl|my_center|LOCUS_02390 8388 8999 gene locus_tag LOCUS_02400 8388 8999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 9199 9405 gene locus_tag LOCUS_02410 9199 9405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 <10077 9335 gene locus_tag LOCUS_02420 <10077 9335 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868093.1:proline--tRNA ligase >Feature sequence020 277 603 gene locus_tag LOCUS_02430 277 603 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147313.1 protein_id gnl|my_center|LOCUS_02430 1331 600 gene locus_tag LOCUS_02440 1331 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 2119 1328 gene locus_tag LOCUS_02450 gene wtpB 2119 1328 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248973.1 protein_id gnl|my_center|LOCUS_02450 3041 2097 gene locus_tag LOCUS_02460 gene wtpA 3041 2097 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870699.1 protein_id gnl|my_center|LOCUS_02460 3344 4831 gene locus_tag LOCUS_02470 3344 4831 CDS product class I adenylate-forming enzyme family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979433.1 protein_id gnl|my_center|LOCUS_02470 4908 5318 gene locus_tag LOCUS_02480 4908 5318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5330 6244 gene locus_tag LOCUS_02490 5330 6244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053679.1 protein_id gnl|my_center|LOCUS_02490 6247 7260 gene locus_tag LOCUS_02500 6247 7260 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249652.1 protein_id gnl|my_center|LOCUS_02500 7274 7645 gene locus_tag LOCUS_02510 7274 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 7887 10028 gene locus_tag LOCUS_02520 7887 10028 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240260.1 protein_id gnl|my_center|LOCUS_02520 >Feature sequence021 4141 3263 gene locus_tag LOCUS_02530 4141 3263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 5830 4325 gene locus_tag LOCUS_02540 5830 4325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 8584 5981 gene locus_tag LOCUS_02550 8584 5981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 8826 9245 gene locus_tag LOCUS_02560 gene trxA 8826 9245 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846557.1 protein_id gnl|my_center|LOCUS_02560 9904 9242 gene locus_tag LOCUS_02570 9904 9242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence022 1085 228 gene locus_tag LOCUS_02580 1085 228 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146582.1 protein_id gnl|my_center|LOCUS_02580 1177 1530 gene locus_tag LOCUS_02590 1177 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 1527 1952 gene locus_tag LOCUS_02600 1527 1952 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 1937 2398 gene locus_tag LOCUS_02610 1937 2398 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867943.1 protein_id gnl|my_center|LOCUS_02610 2568 2915 gene locus_tag LOCUS_02620 2568 2915 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156014597.1 protein_id gnl|my_center|LOCUS_02620 2955 3110 gene locus_tag LOCUS_02630 2955 3110 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868637.1 protein_id gnl|my_center|LOCUS_02630 3156 3473 gene locus_tag LOCUS_02640 3156 3473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 3671 4348 gene locus_tag LOCUS_02650 3671 4348 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979414.1 protein_id gnl|my_center|LOCUS_02650 4470 4733 gene locus_tag LOCUS_02660 4470 4733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 4730 5200 gene locus_tag LOCUS_02670 4730 5200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 5430 6359 gene locus_tag LOCUS_02680 gene ftsY 5430 6359 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010922948.1 protein_id gnl|my_center|LOCUS_02680 6452 6661 gene locus_tag LOCUS_02690 6452 6661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 6825 7334 gene locus_tag LOCUS_02700 6825 7334 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979409.1 protein_id gnl|my_center|LOCUS_02700 7337 7846 gene locus_tag LOCUS_02710 7337 7846 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979408.1 protein_id gnl|my_center|LOCUS_02710 7942 8592 gene locus_tag LOCUS_02720 7942 8592 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061119.1 protein_id gnl|my_center|LOCUS_02720 8677 9741 gene locus_tag LOCUS_02730 8677 9741 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742658.1 protein_id gnl|my_center|LOCUS_02730 >Feature sequence023 <1 792 gene locus_tag LOCUS_02740 <1 792 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846522.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA 820 1254 gene locus_tag LOCUS_02750 820 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02750 1208 1582 gene locus_tag LOCUS_02760 1208 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 1635 2183 gene locus_tag LOCUS_02770 1635 2183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 2275 2475 gene locus_tag LOCUS_02780 2275 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 2460 2741 gene locus_tag LOCUS_02790 2460 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 2866 3666 gene locus_tag LOCUS_02800 2866 3666 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762508.1 protein_id gnl|my_center|LOCUS_02800 3702 4643 gene locus_tag LOCUS_02810 3702 4643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 5188 4706 gene locus_tag LOCUS_02820 5188 4706 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978732.1 protein_id gnl|my_center|LOCUS_02820 5361 5705 gene locus_tag LOCUS_02830 5361 5705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 5749 6114 gene locus_tag LOCUS_02840 5749 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 6199 6621 gene locus_tag LOCUS_02850 gene gcvH 6199 6621 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846941.1 protein_id gnl|my_center|LOCUS_02850 7712 6639 gene locus_tag LOCUS_02860 7712 6639 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978410.1 protein_id gnl|my_center|LOCUS_02860 7805 9793 gene locus_tag LOCUS_02870 7805 9793 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249703.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence024 81 554 gene locus_tag LOCUS_02880 81 554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 1720 551 gene locus_tag LOCUS_02890 1720 551 CDS product cystathionine gamma-synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068577384.1 protein_id gnl|my_center|LOCUS_02890 2671 1727 gene locus_tag LOCUS_02900 2671 1727 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761815.1 protein_id gnl|my_center|LOCUS_02900 2855 4306 gene locus_tag LOCUS_02910 gene ppcA 2855 4306 CDS product phosphoenolpyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022649.1 protein_id gnl|my_center|LOCUS_02910 4510 4725 gene locus_tag LOCUS_02920 4510 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 4969 4882 gene locus_tag LOCUS_t00040 4969 4882 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 6455 5013 gene locus_tag LOCUS_02930 6455 5013 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978827.1 protein_id gnl|my_center|LOCUS_02930 7107 6529 gene locus_tag LOCUS_02940 7107 6529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 7993 7199 gene locus_tag LOCUS_02950 7993 7199 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867386.1 protein_id gnl|my_center|LOCUS_02950 9097 8036 gene locus_tag LOCUS_02960 9097 8036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 >Feature sequence025 351 428 gene locus_tag LOCUS_t00050 351 428 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 2051 561 gene locus_tag LOCUS_02970 2051 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 2170 2700 gene locus_tag LOCUS_02980 2170 2700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 2757 3251 gene locus_tag LOCUS_02990 2757 3251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 3631 3350 gene locus_tag LOCUS_03000 3631 3350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 3830 3636 gene locus_tag LOCUS_03010 3830 3636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3928 4614 gene locus_tag LOCUS_03020 3928 4614 CDS product ribosome biogenesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763527.1 protein_id gnl|my_center|LOCUS_03020 4968 5387 gene locus_tag LOCUS_03030 4968 5387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 5459 6196 gene locus_tag LOCUS_03040 5459 6196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 6344 7210 gene locus_tag LOCUS_03050 6344 7210 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250671.1 protein_id gnl|my_center|LOCUS_03050 7245 8393 gene locus_tag LOCUS_03060 7245 8393 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250672.1 protein_id gnl|my_center|LOCUS_03060 8448 9356 gene locus_tag LOCUS_03070 8448 9356 CDS product glycosyltransferase family A protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250673.1 protein_id gnl|my_center|LOCUS_03070 >Feature sequence026 76 2961 gene locus_tag LOCUS_03080 76 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 4935 3028 gene locus_tag LOCUS_03090 4935 3028 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762290.1 protein_id gnl|my_center|LOCUS_03090 6206 5025 gene locus_tag LOCUS_03100 6206 5025 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064399.1 protein_id gnl|my_center|LOCUS_03100 6342 7571 gene locus_tag LOCUS_03110 6342 7571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 8317 7670 gene locus_tag LOCUS_03120 8317 7670 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978426.1 protein_id gnl|my_center|LOCUS_03120 8651 8322 gene locus_tag LOCUS_03130 8651 8322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 9480 8623 gene locus_tag LOCUS_03140 9480 8623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 >Feature sequence027 1156 17 gene locus_tag LOCUS_03150 gene hflX 1156 17 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762823.1 protein_id gnl|my_center|LOCUS_03150 1399 1983 gene locus_tag LOCUS_03160 1399 1983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 2645 2049 gene locus_tag LOCUS_03170 2645 2049 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978291.1 protein_id gnl|my_center|LOCUS_03170 2833 4038 gene locus_tag LOCUS_03180 2833 4038 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846270.1 protein_id gnl|my_center|LOCUS_03180 4757 4035 gene locus_tag LOCUS_03190 4757 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 5226 4801 gene locus_tag LOCUS_03200 5226 4801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 6458 5295 gene locus_tag LOCUS_03210 6458 5295 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763494.1 protein_id gnl|my_center|LOCUS_03210 6651 7283 gene locus_tag LOCUS_03220 6651 7283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979538.1 protein_id gnl|my_center|LOCUS_03220 7374 7814 gene locus_tag LOCUS_03230 7374 7814 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762119.1 protein_id gnl|my_center|LOCUS_03230 7880 8680 gene locus_tag LOCUS_03240 7880 8680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence028 1187 411 gene locus_tag LOCUS_03250 1187 411 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980352.1 protein_id gnl|my_center|LOCUS_03250 1434 2255 gene locus_tag LOCUS_03260 gene aroF 1434 2255 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867571.1 protein_id gnl|my_center|LOCUS_03260 2298 3410 gene locus_tag LOCUS_03270 gene aroB 2298 3410 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337780.1 protein_id gnl|my_center|LOCUS_03270 3376 4071 gene locus_tag LOCUS_03280 3376 4071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 5284 4037 gene locus_tag LOCUS_03290 5284 4037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 5999 5865 gene locus_tag LOCUS_03300 5999 5865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 6394 5996 gene locus_tag LOCUS_03310 6394 5996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 7138 6551 gene locus_tag LOCUS_03320 7138 6551 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878192.1 protein_id gnl|my_center|LOCUS_03320 8420 7308 gene locus_tag LOCUS_03330 gene cdvC 8420 7308 CDS product cell division protein CdvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979234.1 protein_id gnl|my_center|LOCUS_03330 8867 8676 gene locus_tag LOCUS_03340 8867 8676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 >Feature sequence029 1120 218 gene locus_tag LOCUS_03350 1120 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 2681 1107 gene locus_tag LOCUS_03360 gene guaA 2681 1107 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762354.1 protein_id gnl|my_center|LOCUS_03360 2841 4220 gene locus_tag LOCUS_03370 gene guaB 2841 4220 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249149.1 protein_id gnl|my_center|LOCUS_03370 4334 5155 gene locus_tag LOCUS_03380 4334 5155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 5980 5141 gene locus_tag LOCUS_03390 gene proC 5980 5141 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978628.1 protein_id gnl|my_center|LOCUS_03390 7443 6112 gene locus_tag LOCUS_03400 7443 6112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 7716 9089 gene locus_tag LOCUS_03410 7716 9089 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249457.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence030 <1 747 gene locus_tag LOCUS_03420 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080614.1:radical SAM protein 763 1155 gene locus_tag LOCUS_03430 763 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 1475 2611 gene locus_tag LOCUS_03440 1475 2611 CDS product tRNA-ribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763725.1 protein_id gnl|my_center|LOCUS_03440 2698 4809 gene locus_tag LOCUS_03450 gene feoB 2698 4809 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044821.1 protein_id gnl|my_center|LOCUS_03450 5294 4806 gene locus_tag LOCUS_03460 5294 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5347 6624 gene locus_tag LOCUS_03470 5347 6624 CDS product Glu/Leu/Phe/Val dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980326.1 protein_id gnl|my_center|LOCUS_03470 7701 6673 gene locus_tag LOCUS_03480 gene gyaR 7701 6673 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868561.1 protein_id gnl|my_center|LOCUS_03480 8638 7757 gene locus_tag LOCUS_03490 8638 7757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 >Feature sequence031 471 316 gene locus_tag LOCUS_03500 471 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 976 557 gene locus_tag LOCUS_03510 976 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 1823 1038 gene locus_tag LOCUS_03520 1823 1038 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979223.1 protein_id gnl|my_center|LOCUS_03520 2515 1904 gene locus_tag LOCUS_03530 2515 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 2668 3018 gene locus_tag LOCUS_03540 2668 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 3332 3015 gene locus_tag LOCUS_03550 3332 3015 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250247.1 protein_id gnl|my_center|LOCUS_03550 3433 3876 gene locus_tag LOCUS_03560 3433 3876 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013749.1 protein_id gnl|my_center|LOCUS_03560 3939 4826 gene locus_tag LOCUS_03570 3939 4826 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846421.1 protein_id gnl|my_center|LOCUS_03570 4891 8046 gene locus_tag LOCUS_03580 4891 8046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence032 222 2279 gene locus_tag LOCUS_03590 222 2279 CDS product PGF-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878208.1 protein_id gnl|my_center|LOCUS_03590 3094 2276 gene locus_tag LOCUS_03600 3094 2276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 3581 3192 gene locus_tag LOCUS_03610 3581 3192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4482 3604 gene locus_tag LOCUS_03620 4482 3604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 5409 4486 gene locus_tag LOCUS_03630 5409 4486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 5510 6310 gene locus_tag LOCUS_03640 5510 6310 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240392.1 protein_id gnl|my_center|LOCUS_03640 6353 7192 gene locus_tag LOCUS_03650 6353 7192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 7189 7548 gene locus_tag LOCUS_03660 7189 7548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 8810 7734 gene locus_tag LOCUS_03670 8810 7734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 >Feature sequence033 917 1435 gene locus_tag LOCUS_03680 917 1435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2154 1432 gene locus_tag LOCUS_03690 2154 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3549 2386 gene locus_tag LOCUS_03700 3549 2386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 4217 3546 gene locus_tag LOCUS_03710 4217 3546 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879872.1 protein_id gnl|my_center|LOCUS_03710 6769 4238 gene locus_tag LOCUS_03720 6769 4238 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879871.1 protein_id gnl|my_center|LOCUS_03720 8165 6960 gene locus_tag LOCUS_03730 8165 6960 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250736.1 protein_id gnl|my_center|LOCUS_03730 >Feature sequence034 166 1395 gene locus_tag LOCUS_03740 166 1395 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978176.1 protein_id gnl|my_center|LOCUS_03740 3440 1392 gene locus_tag LOCUS_03750 3440 1392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 3930 4355 gene locus_tag LOCUS_03760 3930 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 4395 5081 gene locus_tag LOCUS_03770 4395 5081 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240534.1 protein_id gnl|my_center|LOCUS_03770 5901 5680 gene locus_tag LOCUS_03780 5901 5680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7031 5937 gene locus_tag LOCUS_03790 7031 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 7649 7275 gene locus_tag LOCUS_03800 7649 7275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03800 7784 8542 gene locus_tag LOCUS_03810 7784 8542 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761798.1 protein_id gnl|my_center|LOCUS_03810 >Feature sequence035 766 167 gene locus_tag LOCUS_03820 766 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03820 2211 763 gene locus_tag LOCUS_03830 2211 763 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868821.1 protein_id gnl|my_center|LOCUS_03830 3856 2462 gene locus_tag LOCUS_03840 3856 2462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 8576 4068 gene locus_tag LOCUS_03850 8576 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence036 <1 817 gene locus_tag LOCUS_03860 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867345.1:amidophosphoribosyltransferase 824 2029 gene locus_tag LOCUS_03870 824 2029 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979547.1 protein_id gnl|my_center|LOCUS_03870 2036 3517 gene locus_tag LOCUS_03880 gene purD 2036 3517 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761866.1 protein_id gnl|my_center|LOCUS_03880 3578 4813 gene locus_tag LOCUS_03890 gene purT 3578 4813 CDS product formate-dependent phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846770.1 protein_id gnl|my_center|LOCUS_03890 5114 4821 gene locus_tag LOCUS_03900 5114 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 6260 5121 gene locus_tag LOCUS_03910 6260 5121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 7669 6257 gene locus_tag LOCUS_03920 7669 6257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 >Feature sequence037 103 387 gene locus_tag LOCUS_03930 103 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 1313 384 gene locus_tag LOCUS_03940 gene ubiA 1313 384 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762363.1 protein_id gnl|my_center|LOCUS_03940 2784 1327 gene locus_tag LOCUS_03950 2784 1327 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763483.1 protein_id gnl|my_center|LOCUS_03950 3905 2868 gene locus_tag LOCUS_03960 3905 2868 CDS product ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053875.1 protein_id gnl|my_center|LOCUS_03960 4531 4169 gene locus_tag LOCUS_03970 4531 4169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 5460 4618 gene locus_tag LOCUS_03980 5460 4618 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249303.1 protein_id gnl|my_center|LOCUS_03980 5654 6601 gene locus_tag LOCUS_03990 5654 6601 CDS product ARMT1-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762322.1 protein_id gnl|my_center|LOCUS_03990 7633 6551 gene locus_tag LOCUS_04000 gene hisC 7633 6551 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_152940674.1 protein_id gnl|my_center|LOCUS_04000 >Feature sequence038 802 2388 gene locus_tag LOCUS_04010 802 2388 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877491.1 protein_id gnl|my_center|LOCUS_04010 2681 2385 gene locus_tag LOCUS_04020 2681 2385 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978366.1 protein_id gnl|my_center|LOCUS_04020 3399 2785 gene locus_tag LOCUS_04030 3399 2785 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762154.1 protein_id gnl|my_center|LOCUS_04030 3566 4138 gene locus_tag LOCUS_04040 3566 4138 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003978343.1 protein_id gnl|my_center|LOCUS_04040 4418 4128 gene locus_tag LOCUS_04050 4418 4128 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146877.1 protein_id gnl|my_center|LOCUS_04050 4997 4515 gene locus_tag LOCUS_04060 4997 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 5614 4994 gene locus_tag LOCUS_04070 5614 4994 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846302.1 protein_id gnl|my_center|LOCUS_04070 6984 5689 gene locus_tag LOCUS_04080 gene secY 6984 5689 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978380.1 protein_id gnl|my_center|LOCUS_04080 7451 7308 gene locus_tag LOCUS_04090 7451 7308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence039 1215 391 gene locus_tag LOCUS_04100 1215 391 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978563.1 protein_id gnl|my_center|LOCUS_04100 1531 2052 gene locus_tag LOCUS_04110 1531 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 5044 2069 gene locus_tag LOCUS_04120 gene leuS 5044 2069 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846570.1 protein_id gnl|my_center|LOCUS_04120 5205 5807 gene locus_tag LOCUS_04130 gene hxlB 5205 5807 CDS product 6-phospho-3-hexuloisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978137.1 protein_id gnl|my_center|LOCUS_04130 5963 6853 gene locus_tag LOCUS_04140 5963 6853 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762992.1 protein_id gnl|my_center|LOCUS_04140 7162 6821 gene locus_tag LOCUS_04150 7162 6821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 7608 7159 gene locus_tag LOCUS_04160 7608 7159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 >Feature sequence040 111 263 gene locus_tag LOCUS_04170 111 263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 357 698 gene locus_tag LOCUS_04180 357 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04180 949 695 gene locus_tag LOCUS_04190 949 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 2407 956 gene locus_tag LOCUS_04200 2407 956 CDS product Ni/Fe hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582502.1 protein_id gnl|my_center|LOCUS_04200 3494 2484 gene locus_tag LOCUS_04210 3494 2484 CDS product methyl viologen-reducing hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943055.1 protein_id gnl|my_center|LOCUS_04210 4452 3487 gene locus_tag LOCUS_04220 4452 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 4698 5780 gene locus_tag LOCUS_04230 4698 5780 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867675.1 protein_id gnl|my_center|LOCUS_04230 7240 5777 gene locus_tag LOCUS_04240 7240 5777 CDS product DUF2139 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251098.1 protein_id gnl|my_center|LOCUS_04240 7758 7360 gene locus_tag LOCUS_04250 7758 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence041 2228 783 gene locus_tag LOCUS_04260 2228 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 2362 3930 gene locus_tag LOCUS_04270 2362 3930 CDS product carboxypeptidase M32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762889.1 protein_id gnl|my_center|LOCUS_04270 5065 3914 gene locus_tag LOCUS_04280 5065 3914 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867725.1 protein_id gnl|my_center|LOCUS_04280 6148 5303 gene locus_tag LOCUS_04290 6148 5303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 6518 7054 gene locus_tag LOCUS_04300 6518 7054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence042 1908 808 gene locus_tag LOCUS_04310 1908 808 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877833.1 protein_id gnl|my_center|LOCUS_04310 2752 1997 gene locus_tag LOCUS_04320 2752 1997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 3944 2733 gene locus_tag LOCUS_04330 3944 2733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 5026 3941 gene locus_tag LOCUS_04340 5026 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 >Feature sequence043 <1 774 gene locus_tag LOCUS_04350 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979488.1:pyridoxal 5'-phosphate synthase lyase subunit PdxS 801 1430 gene locus_tag LOCUS_04360 gene pdxT 801 1430 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763074.1 protein_id gnl|my_center|LOCUS_04360 1791 1411 gene locus_tag LOCUS_04370 1791 1411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 2575 3456 gene locus_tag LOCUS_04380 2575 3456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 4271 3480 gene locus_tag LOCUS_04390 4271 3480 CDS product aspartate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060936.1 protein_id gnl|my_center|LOCUS_04390 5119 4262 gene locus_tag LOCUS_04400 gene nadC 5119 4262 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867134.1 protein_id gnl|my_center|LOCUS_04400 6131 5160 gene locus_tag LOCUS_04410 gene nadA 6131 5160 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146454.1 protein_id gnl|my_center|LOCUS_04410 6048 6353 gene locus_tag LOCUS_04420 6048 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 6898 6350 gene locus_tag LOCUS_04430 6898 6350 CDS product HyaD/HybD family hydrogenase maturation endopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221953.1 protein_id gnl|my_center|LOCUS_04430 7359 6922 gene locus_tag LOCUS_04440 7359 6922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence044 382 1314 gene locus_tag LOCUS_04450 382 1314 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846193.1 protein_id gnl|my_center|LOCUS_04450 2105 1311 gene locus_tag LOCUS_04460 2105 1311 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978941.1 protein_id gnl|my_center|LOCUS_04460 2213 2593 gene locus_tag LOCUS_04470 2213 2593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 2735 2938 gene locus_tag LOCUS_04480 2735 2938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 3023 4366 gene locus_tag LOCUS_04490 3023 4366 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762804.1 protein_id gnl|my_center|LOCUS_04490 4434 5318 gene locus_tag LOCUS_04500 4434 5318 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979450.1 protein_id gnl|my_center|LOCUS_04500 5547 5999 gene locus_tag LOCUS_04510 5547 5999 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240343.1 protein_id gnl|my_center|LOCUS_04510 6436 6113 gene locus_tag LOCUS_04520 6436 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 6994 6560 gene locus_tag LOCUS_04530 gene lysM 6994 6560 CDS product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 protein_id gnl|my_center|LOCUS_04530 >Feature sequence045 160 393 gene locus_tag LOCUS_04540 160 393 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_04540 415 1581 gene locus_tag LOCUS_04550 gene sat 415 1581 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_04550 1578 2624 gene locus_tag LOCUS_04560 1578 2624 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868286.1 protein_id gnl|my_center|LOCUS_04560 2688 4046 gene locus_tag LOCUS_04570 2688 4046 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_04570 4082 4294 gene locus_tag LOCUS_04580 4082 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4753 5382 gene locus_tag LOCUS_04590 4753 5382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5696 6469 gene locus_tag LOCUS_04600 5696 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 >Feature sequence046 54 818 gene locus_tag LOCUS_04610 54 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 2089 815 gene locus_tag LOCUS_04620 2089 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 2709 2110 gene locus_tag LOCUS_04630 2709 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 3524 2715 gene locus_tag LOCUS_04640 3524 2715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 4746 3676 gene locus_tag LOCUS_04650 4746 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 6034 4886 gene locus_tag LOCUS_04660 6034 4886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 >Feature sequence047 614 24 gene locus_tag LOCUS_04670 614 24 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978019.1 protein_id gnl|my_center|LOCUS_04670 1835 651 gene locus_tag LOCUS_04680 1835 651 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763169.1 protein_id gnl|my_center|LOCUS_04680 1942 2352 gene locus_tag LOCUS_04690 1942 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 2425 2766 gene locus_tag LOCUS_04700 2425 2766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 2945 4729 gene locus_tag LOCUS_04710 2945 4729 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763167.1 protein_id gnl|my_center|LOCUS_04710 5372 4794 gene locus_tag LOCUS_04720 5372 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 6024 5476 gene locus_tag LOCUS_04730 6024 5476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence048 626 2023 gene locus_tag LOCUS_04740 gene serS 626 2023 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979517.1 protein_id gnl|my_center|LOCUS_04740 2023 2310 gene locus_tag LOCUS_04750 2023 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04750 2432 3592 gene locus_tag LOCUS_04760 2432 3592 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762578.1 protein_id gnl|my_center|LOCUS_04760 3624 5348 gene locus_tag LOCUS_04770 3624 5348 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762431.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence049 1645 854 gene locus_tag LOCUS_04780 1645 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2423 1653 gene locus_tag LOCUS_04790 2423 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 2560 3402 gene locus_tag LOCUS_04800 2560 3402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 4046 3399 gene locus_tag LOCUS_04810 4046 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 5525 4074 gene locus_tag LOCUS_04820 5525 4074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 5698 6270 gene locus_tag LOCUS_04830 5698 6270 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846214.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence050 1443 709 gene locus_tag LOCUS_04840 1443 709 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762886.1 protein_id gnl|my_center|LOCUS_04840 2467 1511 gene locus_tag LOCUS_04850 2467 1511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 2986 2603 gene locus_tag LOCUS_04860 2986 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 3978 3037 gene locus_tag LOCUS_04870 3978 3037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 4522 5583 gene locus_tag LOCUS_04880 4522 5583 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979390.1 protein_id gnl|my_center|LOCUS_04880 5590 6750 gene locus_tag LOCUS_04890 5590 6750 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868485.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence051 1212 25 gene locus_tag LOCUS_04900 1212 25 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048095662.1 protein_id gnl|my_center|LOCUS_04900 2263 1238 gene locus_tag LOCUS_04910 2263 1238 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496774.1 protein_id gnl|my_center|LOCUS_04910 3058 2324 gene locus_tag LOCUS_04920 3058 2324 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180546217.1 protein_id gnl|my_center|LOCUS_04920 3841 3065 gene locus_tag LOCUS_04930 3841 3065 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762347.1 protein_id gnl|my_center|LOCUS_04930 4468 4265 gene locus_tag LOCUS_04940 4468 4265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 4428 5606 gene locus_tag LOCUS_04950 4428 5606 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240264.1 protein_id gnl|my_center|LOCUS_04950 6654 5677 gene locus_tag LOCUS_04960 6654 5677 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876019.1 protein_id gnl|my_center|LOCUS_04960 >Feature sequence052 638 1042 gene locus_tag LOCUS_04970 638 1042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 1039 1926 gene locus_tag LOCUS_04980 1039 1926 CDS product transcription initiation factor IIB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846945.1 protein_id gnl|my_center|LOCUS_04980 2252 2686 gene locus_tag LOCUS_04990 2252 2686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979290.1 protein_id gnl|my_center|LOCUS_04990 3891 2683 gene locus_tag LOCUS_05000 3891 2683 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_05000 5013 4009 gene locus_tag LOCUS_05010 5013 4009 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978349.1 protein_id gnl|my_center|LOCUS_05010 5755 5510 gene locus_tag LOCUS_05020 5755 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 >Feature sequence053 363 1904 gene locus_tag LOCUS_05030 363 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1937 2509 gene locus_tag LOCUS_05040 1937 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 2624 3370 gene locus_tag LOCUS_05050 2624 3370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3398 4465 gene locus_tag LOCUS_05060 3398 4465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4498 5772 gene locus_tag LOCUS_05070 gene nrfD 4498 5772 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272193.1 protein_id gnl|my_center|LOCUS_05070 5879 6499 gene locus_tag LOCUS_05080 5879 6499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence054 1010 1183 gene locus_tag LOCUS_05090 1010 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 1988 1134 gene locus_tag LOCUS_05100 1988 1134 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761885.1 protein_id gnl|my_center|LOCUS_05100 3828 2167 gene locus_tag LOCUS_05110 3828 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 4012 4260 gene locus_tag LOCUS_05120 4012 4260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 4341 4817 gene locus_tag LOCUS_05130 4341 4817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4909 5130 gene locus_tag LOCUS_05140 4909 5130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 5627 5998 gene locus_tag LOCUS_05150 5627 5998 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146460.1 protein_id gnl|my_center|LOCUS_05150 5979 6278 gene locus_tag LOCUS_05160 5979 6278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 >Feature sequence055 1565 1077 gene locus_tag LOCUS_05170 1565 1077 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875797.1 protein_id gnl|my_center|LOCUS_05170 2468 1614 gene locus_tag LOCUS_05180 2468 1614 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978637.1 protein_id gnl|my_center|LOCUS_05180 2696 4120 gene locus_tag LOCUS_05190 2696 4120 CDS product AMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015590753.1 protein_id gnl|my_center|LOCUS_05190 4380 4117 gene locus_tag LOCUS_05200 4380 4117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5402 4377 gene locus_tag LOCUS_05210 gene gyaR 5402 4377 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_05210 5473 6324 gene locus_tag LOCUS_05220 5473 6324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 >Feature sequence056 106 1182 gene locus_tag LOCUS_05230 106 1182 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240228.1 protein_id gnl|my_center|LOCUS_05230 2065 1520 gene locus_tag LOCUS_05240 2065 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 2360 2926 gene locus_tag LOCUS_05250 2360 2926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 2982 4250 gene locus_tag LOCUS_05260 gene coaBC 2982 4250 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978206.1 protein_id gnl|my_center|LOCUS_05260 4412 5326 gene locus_tag LOCUS_05270 4412 5326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763101.1 protein_id gnl|my_center|LOCUS_05270 >Feature sequence057 75 1559 gene locus_tag LOCUS_05280 75 1559 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004068250.1 protein_id gnl|my_center|LOCUS_05280 1613 1933 gene locus_tag LOCUS_05290 1613 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 2767 1976 gene locus_tag LOCUS_05300 2767 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3193 4551 gene locus_tag LOCUS_05310 gene hemA 3193 4551 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879467.1 protein_id gnl|my_center|LOCUS_05310 5885 4725 gene locus_tag LOCUS_05320 gene tdt 5885 4725 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870080.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence058 1221 1745 gene locus_tag LOCUS_05330 1221 1745 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878128.1 protein_id gnl|my_center|LOCUS_05330 1818 2261 gene locus_tag LOCUS_05340 gene lrs14 1818 2261 CDS product HTH-type transcriptional regulator Lrs14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979935.1 protein_id gnl|my_center|LOCUS_05340 2638 2288 gene locus_tag LOCUS_05350 2638 2288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 2888 3490 gene locus_tag LOCUS_05360 2888 3490 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978535.1 protein_id gnl|my_center|LOCUS_05360 4035 3496 gene locus_tag LOCUS_05370 4035 3496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4209 5570 gene locus_tag LOCUS_05380 4209 5570 CDS product digeranylgeranylglycerophospholipid reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846351.1 protein_id gnl|my_center|LOCUS_05380 5605 5847 gene locus_tag LOCUS_05390 5605 5847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 >Feature sequence059 251 919 gene locus_tag LOCUS_05400 251 919 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877484.1 protein_id gnl|my_center|LOCUS_05400 1166 1417 gene locus_tag LOCUS_05410 1166 1417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 1476 1973 gene locus_tag LOCUS_05420 1476 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 2034 3845 gene locus_tag LOCUS_05430 2034 3845 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978165.1 protein_id gnl|my_center|LOCUS_05430 5754 4189 gene locus_tag LOCUS_05440 5754 4189 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429818.1 protein_id gnl|my_center|LOCUS_05440 6332 5751 gene locus_tag LOCUS_05450 6332 5751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 5889 5898 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence060 2188 323 gene locus_tag LOCUS_05460 2188 323 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240328.1 protein_id gnl|my_center|LOCUS_05460 2295 2513 gene locus_tag LOCUS_05470 2295 2513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 2706 3782 gene locus_tag LOCUS_05480 2706 3782 CDS product alcohol dehydrogenase catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763671.1 protein_id gnl|my_center|LOCUS_05480 3925 3779 gene locus_tag LOCUS_05490 3925 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 4135 4836 gene locus_tag LOCUS_05500 4135 4836 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080855.1 protein_id gnl|my_center|LOCUS_05500 <6303 4929 gene locus_tag LOCUS_05510 <6303 4929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938066.1:glycerate kinase >Feature sequence061 449 177 gene locus_tag LOCUS_05520 449 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 666 1484 gene locus_tag LOCUS_05530 666 1484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 1147 1156 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3469 1772 gene locus_tag LOCUS_05540 3469 1772 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762356.1 protein_id gnl|my_center|LOCUS_05540 3630 4640 gene locus_tag LOCUS_05550 3630 4640 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064459.1 protein_id gnl|my_center|LOCUS_05550 4660 5538 gene locus_tag LOCUS_05560 4660 5538 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865273.1 protein_id gnl|my_center|LOCUS_05560 >Feature sequence062 <1 1097 gene locus_tag LOCUS_05570 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460435.1:NADH-quinone oxidoreductase subunit N 1187 1780 gene locus_tag LOCUS_05580 gene thpR 1187 1780 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762325.1 protein_id gnl|my_center|LOCUS_05580 3039 1777 gene locus_tag LOCUS_05590 3039 1777 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_05590 2992 3444 gene locus_tag LOCUS_05600 2992 3444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3492 3839 gene locus_tag LOCUS_05610 3492 3839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 4417 3836 gene locus_tag LOCUS_05620 4417 3836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4509 4889 gene locus_tag LOCUS_05630 4509 4889 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879692.1 protein_id gnl|my_center|LOCUS_05630 4880 5650 gene locus_tag LOCUS_05640 4880 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 6143 5610 gene locus_tag LOCUS_05650 6143 5610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05650 >Feature sequence063 664 200 gene locus_tag LOCUS_05660 664 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05660 1560 592 gene locus_tag LOCUS_05670 1560 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05670 2452 1595 gene locus_tag LOCUS_05680 2452 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 2549 2887 gene locus_tag LOCUS_05690 2549 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 3180 2884 gene locus_tag LOCUS_05700 gene moaD 3180 2884 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_05700 3258 3866 gene locus_tag LOCUS_05710 3258 3866 CDS product DUF2250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980177.1 protein_id gnl|my_center|LOCUS_05710 4401 3889 gene locus_tag LOCUS_05720 4401 3889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 5620 4451 gene locus_tag LOCUS_05730 5620 4451 CDS product DUF1464 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867332.1 protein_id gnl|my_center|LOCUS_05730 <6223 5659 gene locus_tag LOCUS_05740 <6223 5659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251192.1:GHMP kinase >Feature sequence064 990 91 gene locus_tag LOCUS_05750 990 91 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250867.1 protein_id gnl|my_center|LOCUS_05750 1213 1013 gene locus_tag LOCUS_05760 1213 1013 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870713.1 protein_id gnl|my_center|LOCUS_05760 1504 1259 gene locus_tag LOCUS_05770 1504 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 1637 2359 gene locus_tag LOCUS_05780 1637 2359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 2824 2444 gene locus_tag LOCUS_05790 gene rpl7ae 2824 2444 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240293.1 protein_id gnl|my_center|LOCUS_05790 4723 2915 gene locus_tag LOCUS_05800 4723 2915 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762126.1 protein_id gnl|my_center|LOCUS_05800 5219 4701 gene locus_tag LOCUS_05810 5219 4701 CDS product DUF2118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496642.1 protein_id gnl|my_center|LOCUS_05810 <6222 5291 gene locus_tag LOCUS_05820 <6222 5291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250419.1:polyprenyl synthetase family protein >Feature sequence065 733 1062 gene locus_tag LOCUS_05830 733 1062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 2361 1069 gene locus_tag LOCUS_05840 gene rsmB 2361 1069 CDS product 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943984.1 protein_id gnl|my_center|LOCUS_05840 2409 3326 gene locus_tag LOCUS_05850 2409 3326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 3413 4093 gene locus_tag LOCUS_05860 3413 4093 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249129.1 protein_id gnl|my_center|LOCUS_05860 4866 4090 gene locus_tag LOCUS_05870 4866 4090 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978306.1 protein_id gnl|my_center|LOCUS_05870 5416 4874 gene locus_tag LOCUS_05880 5416 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 <6182 5389 gene locus_tag LOCUS_05890 <6182 5389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048147263.1:RsmB/NOP family class I SAM-dependent RNA methyltransferase >Feature sequence066 2091 1648 gene locus_tag LOCUS_05900 2091 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 2977 2156 gene locus_tag LOCUS_05910 2977 2156 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013805.1 protein_id gnl|my_center|LOCUS_05910 3402 2974 gene locus_tag LOCUS_05920 3402 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 3630 3460 gene locus_tag LOCUS_05930 3630 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 3673 4014 gene locus_tag LOCUS_05940 3673 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 <6121 4011 gene locus_tag LOCUS_05950 <6121 4011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020139.1:endonuclease MutS2 >Feature sequence067 <1 721 gene locus_tag LOCUS_05960 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000238915.1:cellulase family glycosylhydrolase 829 1371 gene locus_tag LOCUS_05970 829 1371 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846759.1 protein_id gnl|my_center|LOCUS_05970 1491 2525 gene locus_tag LOCUS_05980 gene dph2 1491 2525 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876932.1 protein_id gnl|my_center|LOCUS_05980 2519 3172 gene locus_tag LOCUS_05990 2519 3172 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892753.1 protein_id gnl|my_center|LOCUS_05990 3166 3789 gene locus_tag LOCUS_06000 3166 3789 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867177.1 protein_id gnl|my_center|LOCUS_06000 3858 4550 gene locus_tag LOCUS_06010 3858 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4510 4821 gene locus_tag LOCUS_06020 4510 4821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 4811 5203 gene locus_tag LOCUS_06030 4811 5203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence068 <1 740 gene locus_tag LOCUS_06040 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011248977.1:SPFH domain-containing protein 759 1904 gene locus_tag LOCUS_06050 759 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 1926 2861 gene locus_tag LOCUS_06060 1926 2861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3271 2858 gene locus_tag LOCUS_06070 3271 2858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 3509 3276 gene locus_tag LOCUS_06080 3509 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 3622 3936 gene locus_tag LOCUS_06090 3622 3936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 4055 4435 gene locus_tag LOCUS_06100 4055 4435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 4703 4494 gene locus_tag LOCUS_06110 4703 4494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5253 5912 gene locus_tag LOCUS_06120 gene cdvB1/B2 5253 5912 CDS product cell division protein CdvB1/B2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979256.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence069 330 1541 gene locus_tag LOCUS_06130 330 1541 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705766.1 protein_id gnl|my_center|LOCUS_06130 1531 2166 gene locus_tag LOCUS_06140 1531 2166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 2209 3066 gene locus_tag LOCUS_06150 2209 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 3782 3063 gene locus_tag LOCUS_06160 gene alaXM 3782 3063 CDS product alanyl-tRNA editing protein AlaXM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762783.1 protein_id gnl|my_center|LOCUS_06160 3892 4647 gene locus_tag LOCUS_06170 3892 4647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846943.1 protein_id gnl|my_center|LOCUS_06170 <5995 5172 gene locus_tag LOCUS_06180 <5995 5172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249764.1:DUF2258 domain-containing protein >Feature sequence070 376 1698 gene locus_tag LOCUS_06190 376 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 2982 1663 gene locus_tag LOCUS_06200 2982 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3862 2954 gene locus_tag LOCUS_06210 3862 2954 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 protein_id gnl|my_center|LOCUS_06210 4595 3960 gene locus_tag LOCUS_06220 4595 3960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870566.1 protein_id gnl|my_center|LOCUS_06220 4795 5721 gene locus_tag LOCUS_06230 gene speE 4795 5721 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978308.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence071 367 1359 gene locus_tag LOCUS_06240 367 1359 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762696.1 protein_id gnl|my_center|LOCUS_06240 2468 1356 gene locus_tag LOCUS_06250 2468 1356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 2616 3623 gene locus_tag LOCUS_06260 2616 3623 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_06260 3632 4447 gene locus_tag LOCUS_06270 3632 4447 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250096.1 protein_id gnl|my_center|LOCUS_06270 5283 4444 gene locus_tag LOCUS_06280 5283 4444 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228840.1 protein_id gnl|my_center|LOCUS_06280 <5861 5276 gene locus_tag LOCUS_06290 <5861 5276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003977406.1:glycerophosphodiester phosphodiesterase >Feature sequence072 1042 581 gene locus_tag LOCUS_06300 1042 581 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762714.1 protein_id gnl|my_center|LOCUS_06300 1590 1069 gene locus_tag LOCUS_06310 1590 1069 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867442.1 protein_id gnl|my_center|LOCUS_06310 2390 1749 gene locus_tag LOCUS_06320 2390 1749 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978383.1 protein_id gnl|my_center|LOCUS_06320 3025 2387 gene locus_tag LOCUS_06330 3025 2387 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763591.1 protein_id gnl|my_center|LOCUS_06330 4253 3132 gene locus_tag LOCUS_06340 gene tdt 4253 3132 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870267.1 protein_id gnl|my_center|LOCUS_06340 4957 4496 gene locus_tag LOCUS_06350 4957 4496 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867445.1 protein_id gnl|my_center|LOCUS_06350 5392 5000 gene locus_tag LOCUS_06360 5392 5000 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867446.1 protein_id gnl|my_center|LOCUS_06360 >Feature sequence073 1287 7 gene locus_tag LOCUS_06370 1287 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 4175 1281 gene locus_tag LOCUS_06380 4175 1281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 4321 5094 gene locus_tag LOCUS_06390 4321 5094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 5444 5091 gene locus_tag LOCUS_06400 5444 5091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence074 599 1483 gene locus_tag LOCUS_06410 599 1483 CDS product ornithine cyclodeaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763622.1 protein_id gnl|my_center|LOCUS_06410 1937 1437 gene locus_tag LOCUS_06420 1937 1437 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980181.1 protein_id gnl|my_center|LOCUS_06420 2030 2815 gene locus_tag LOCUS_06430 2030 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 3909 2812 gene locus_tag LOCUS_06440 gene moaA 3909 2812 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 protein_id gnl|my_center|LOCUS_06440 4178 4420 gene locus_tag LOCUS_06450 4178 4420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 4523 5209 gene locus_tag LOCUS_06460 4523 5209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 >Feature sequence075 1832 951 gene locus_tag LOCUS_06470 1832 951 CDS product extragenic suppressor protein suhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978527.1 protein_id gnl|my_center|LOCUS_06470 2888 1929 gene locus_tag LOCUS_06480 2888 1929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 3073 3420 gene locus_tag LOCUS_06490 3073 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 3492 3902 gene locus_tag LOCUS_06500 3492 3902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06500 4657 3899 gene locus_tag LOCUS_06510 4657 3899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 5060 4725 gene locus_tag LOCUS_06520 5060 4725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 5465 5085 gene locus_tag LOCUS_06530 5465 5085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 >Feature sequence076 873 526 gene locus_tag LOCUS_06540 873 526 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867454.1 protein_id gnl|my_center|LOCUS_06540 1189 812 gene locus_tag LOCUS_06550 1189 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 1475 1245 gene locus_tag LOCUS_06560 1475 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 2247 1522 gene locus_tag LOCUS_06570 2247 1522 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978396.1 protein_id gnl|my_center|LOCUS_06570 2726 2250 gene locus_tag LOCUS_06580 2726 2250 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978397.1 protein_id gnl|my_center|LOCUS_06580 3402 3133 gene locus_tag LOCUS_06590 3402 3133 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867462.1 protein_id gnl|my_center|LOCUS_06590 4271 3441 gene locus_tag LOCUS_06600 gene rpl4p 4271 3441 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846313.1 protein_id gnl|my_center|LOCUS_06600 5278 4310 gene locus_tag LOCUS_06610 5278 4310 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978402.1 protein_id gnl|my_center|LOCUS_06610 >Feature sequence077 1573 737 gene locus_tag LOCUS_06620 1573 737 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978819.1 protein_id gnl|my_center|LOCUS_06620 3536 1584 gene locus_tag LOCUS_06630 3536 1584 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762007.1 protein_id gnl|my_center|LOCUS_06630 3758 4915 gene locus_tag LOCUS_06640 3758 4915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 5032 5265 gene locus_tag LOCUS_06650 5032 5265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249328.1 protein_id gnl|my_center|LOCUS_06650 5252 5665 gene locus_tag LOCUS_06660 5252 5665 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763266.1 protein_id gnl|my_center|LOCUS_06660 5772 5695 gene locus_tag LOCUS_t00060 5772 5695 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence078 662 156 gene locus_tag LOCUS_06670 662 156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 3073 767 gene locus_tag LOCUS_06680 3073 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 3383 3093 gene locus_tag LOCUS_06690 3383 3093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 3396 3824 gene locus_tag LOCUS_06700 3396 3824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 4774 3821 gene locus_tag LOCUS_06710 gene argF 4774 3821 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584136.1 protein_id gnl|my_center|LOCUS_06710 <5793 4931 gene locus_tag LOCUS_06720 <5793 4931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879528.1:heme o synthase >Feature sequence079 <1 517 gene locus_tag LOCUS_06730 <1 517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763580.1:carbon-nitrogen hydrolase family protein 823 434 gene locus_tag LOCUS_06740 823 434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 1014 2285 gene locus_tag LOCUS_06750 1014 2285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2393 2869 gene locus_tag LOCUS_06760 2393 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 4011 3424 gene locus_tag LOCUS_06770 4011 3424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 5269 4001 gene locus_tag LOCUS_06780 5269 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 5681 5352 gene locus_tag LOCUS_06790 5681 5352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 >Feature sequence080 722 33 gene locus_tag LOCUS_06800 722 33 CDS product cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762168.1 protein_id gnl|my_center|LOCUS_06800 840 1502 gene locus_tag LOCUS_06810 840 1502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 1574 1780 gene locus_tag LOCUS_06820 1574 1780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 1814 2851 gene locus_tag LOCUS_06830 1814 2851 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_06830 2955 3581 gene locus_tag LOCUS_06840 2955 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 3619 4248 gene locus_tag LOCUS_06850 3619 4248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 4331 5092 gene locus_tag LOCUS_06860 4331 5092 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979298.1 protein_id gnl|my_center|LOCUS_06860 5149 5224 gene locus_tag LOCUS_t00070 5149 5224 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 5243 5165 gene locus_tag LOCUS_t00080 5243 5165 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence081 2010 841 gene locus_tag LOCUS_06870 2010 841 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113342.1 protein_id gnl|my_center|LOCUS_06870 2126 2842 gene locus_tag LOCUS_06880 gene sfsA 2126 2842 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391969.1 protein_id gnl|my_center|LOCUS_06880 4113 2869 gene locus_tag LOCUS_06890 4113 2869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 4869 4120 gene locus_tag LOCUS_06900 4869 4120 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250288.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence082 603 875 gene locus_tag LOCUS_06910 603 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 1005 1472 gene locus_tag LOCUS_06920 1005 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06920 1849 3498 gene locus_tag LOCUS_06930 1849 3498 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763137.1 protein_id gnl|my_center|LOCUS_06930 3508 4458 gene locus_tag LOCUS_06940 3508 4458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06940 4491 5429 gene locus_tag LOCUS_06950 4491 5429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06950 >Feature sequence083 <1 581 gene locus_tag LOCUS_06960 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978815.1:sulfite oxidase-like oxidoreductase 664 1299 gene locus_tag LOCUS_06970 664 1299 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763582.1 protein_id gnl|my_center|LOCUS_06970 1995 1288 gene locus_tag LOCUS_06980 1995 1288 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972733.1 protein_id gnl|my_center|LOCUS_06980 2218 2574 gene locus_tag LOCUS_06990 2218 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 2784 4436 gene locus_tag LOCUS_07000 2784 4436 CDS product DUF4910 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146467.1 protein_id gnl|my_center|LOCUS_07000 4533 4928 gene locus_tag LOCUS_07010 4533 4928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 >Feature sequence084 1 804 gene locus_tag LOCUS_07020 1 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 788 1120 gene locus_tag LOCUS_07030 788 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 1130 2089 gene locus_tag LOCUS_07040 1130 2089 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763084.1 protein_id gnl|my_center|LOCUS_07040 2099 3313 gene locus_tag LOCUS_07050 2099 3313 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763086.1 protein_id gnl|my_center|LOCUS_07050 3439 3861 gene locus_tag LOCUS_07060 3439 3861 CDS product DUF2153 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846228.1 protein_id gnl|my_center|LOCUS_07060 5291 3858 gene locus_tag LOCUS_07070 gene lysS 5291 3858 CDS product homocitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979323.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence085 154 438 gene locus_tag LOCUS_07080 154 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 499 729 gene locus_tag LOCUS_07090 499 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 1379 726 gene locus_tag LOCUS_07100 1379 726 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248985.1 protein_id gnl|my_center|LOCUS_07100 3083 1452 gene locus_tag LOCUS_07110 3083 1452 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979518.1 protein_id gnl|my_center|LOCUS_07110 3226 4128 gene locus_tag LOCUS_07120 3226 4128 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763692.1 protein_id gnl|my_center|LOCUS_07120 4125 4856 gene locus_tag LOCUS_07130 4125 4856 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249186.1 protein_id gnl|my_center|LOCUS_07130 5082 4834 gene locus_tag LOCUS_07140 5082 4834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 >Feature sequence086 402 851 gene locus_tag LOCUS_07150 gene pfdA 402 851 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870153.1 protein_id gnl|my_center|LOCUS_07150 988 1302 gene locus_tag LOCUS_07160 988 1302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 3462 1294 gene locus_tag LOCUS_07170 3462 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 3569 4156 gene locus_tag LOCUS_07180 3569 4156 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146540.1 protein_id gnl|my_center|LOCUS_07180 5004 4153 gene locus_tag LOCUS_07190 5004 4153 CDS product [LysW]-aminoadipate/[LysW]-glutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978133.1 protein_id gnl|my_center|LOCUS_07190 >Feature sequence087 84 734 gene locus_tag LOCUS_07200 84 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 1619 1407 gene locus_tag LOCUS_07210 1619 1407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 1749 1961 gene locus_tag LOCUS_07220 1749 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 1958 2416 gene locus_tag LOCUS_07230 1958 2416 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877824.1 protein_id gnl|my_center|LOCUS_07230 2622 2545 gene locus_tag LOCUS_t00090 2622 2545 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3315 2608 gene locus_tag LOCUS_07240 3315 2608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07240 <5417 3350 gene locus_tag LOCUS_07250 <5417 3350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979404.1:alanine--tRNA ligase >Feature sequence088 2339 939 gene locus_tag LOCUS_07260 gene argH 2339 939 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762037.1 protein_id gnl|my_center|LOCUS_07260 3636 2425 gene locus_tag LOCUS_07270 3636 2425 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827706.1 protein_id gnl|my_center|LOCUS_07270 3778 4053 gene locus_tag LOCUS_07280 3778 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 4140 4880 gene locus_tag LOCUS_07290 4140 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence089 <1 1204 gene locus_tag LOCUS_07300 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257773.1:MATE family efflux transporter 2151 1201 gene locus_tag LOCUS_07310 2151 1201 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053788.1 protein_id gnl|my_center|LOCUS_07310 2287 2628 gene locus_tag LOCUS_07320 2287 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 2606 3337 gene locus_tag LOCUS_07330 2606 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 3416 4366 gene locus_tag LOCUS_07340 3416 4366 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978942.1 protein_id gnl|my_center|LOCUS_07340 4636 5235 gene locus_tag LOCUS_07350 4636 5235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 >Feature sequence090 1634 162 gene locus_tag LOCUS_07360 gene accC 1634 162 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944627.1 protein_id gnl|my_center|LOCUS_07360 1777 2475 gene locus_tag LOCUS_07370 1777 2475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 3995 2472 gene locus_tag LOCUS_07380 3995 2472 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_07380 5176 4064 gene locus_tag LOCUS_07390 5176 4064 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064463.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence091 1960 599 gene locus_tag LOCUS_07400 1960 599 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978554.1 protein_id gnl|my_center|LOCUS_07400 4065 2074 gene locus_tag LOCUS_07410 4065 2074 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023138.1 protein_id gnl|my_center|LOCUS_07410 3949 4257 gene locus_tag LOCUS_07420 3949 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 <5253 4433 gene locus_tag LOCUS_07430 <5253 4433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251117.1:phosphoadenosine phosphosulfate reductase family protein >Feature sequence092 307 1143 gene locus_tag LOCUS_07440 307 1143 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763176.1 protein_id gnl|my_center|LOCUS_07440 1120 1129 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1201 1677 gene locus_tag LOCUS_07450 1201 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 1609 1618 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3969 1630 gene locus_tag LOCUS_07460 gene hypF 3969 1630 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761966.1 protein_id gnl|my_center|LOCUS_07460 5151 4090 gene locus_tag LOCUS_07470 gene hypE 5151 4090 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761962.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence093 423 602 gene locus_tag LOCUS_07480 423 602 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 644 1078 gene locus_tag LOCUS_07490 644 1078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07490 1015 1962 gene locus_tag LOCUS_07500 1015 1962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07500 2020 2388 gene locus_tag LOCUS_07510 2020 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2410 2419 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4434 3466 gene locus_tag LOCUS_07520 4434 3466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 <5196 4638 gene locus_tag LOCUS_07530 <5196 4638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852404.1:periplasmic nitrate reductase subunit alpha >Feature sequence094 1139 120 gene locus_tag LOCUS_07540 1139 120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 1338 2051 gene locus_tag LOCUS_07550 1338 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 2156 3283 gene locus_tag LOCUS_07560 2156 3283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3753 3301 gene locus_tag LOCUS_07570 3753 3301 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064971.1 protein_id gnl|my_center|LOCUS_07570 3872 4276 gene locus_tag LOCUS_07580 3872 4276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 <5136 4273 gene locus_tag LOCUS_07590 <5136 4273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879134.1:type III ribulose-bisphosphate carboxylase >Feature sequence095 1 612 gene locus_tag LOCUS_07600 1 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 1742 633 gene locus_tag LOCUS_07610 1742 633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2004 3461 gene locus_tag LOCUS_07620 2004 3461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 3488 4165 gene locus_tag LOCUS_07630 3488 4165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4282 4656 gene locus_tag LOCUS_07640 4282 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence096 2214 172 gene locus_tag LOCUS_07650 2214 172 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979478.1 protein_id gnl|my_center|LOCUS_07650 2318 2653 gene locus_tag LOCUS_07660 2318 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 2701 3294 gene locus_tag LOCUS_07670 2701 3294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence097 <1 1504 gene locus_tag LOCUS_07680 <1 1504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980442.1:GNAT family N-acetyltransferase 1560 2219 gene locus_tag LOCUS_07690 1560 2219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 2919 2122 gene locus_tag LOCUS_07700 2919 2122 CDS product VTT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762102.1 protein_id gnl|my_center|LOCUS_07700 3709 3155 gene locus_tag LOCUS_07710 3709 3155 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868429.1 protein_id gnl|my_center|LOCUS_07710 4612 3803 gene locus_tag LOCUS_07720 4612 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 5084 4749 gene locus_tag LOCUS_07730 5084 4749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07730 >Feature sequence098 1018 1644 gene locus_tag LOCUS_07740 1018 1644 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879050.1 protein_id gnl|my_center|LOCUS_07740 1675 2475 gene locus_tag LOCUS_07750 1675 2475 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249624.1 protein_id gnl|my_center|LOCUS_07750 3302 2505 gene locus_tag LOCUS_07760 3302 2505 CDS product TIGR01457 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276467.1 protein_id gnl|my_center|LOCUS_07760 4075 3335 gene locus_tag LOCUS_07770 gene sfsA 4075 3335 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence099 796 638 gene locus_tag LOCUS_07780 796 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 1094 1471 gene locus_tag LOCUS_07790 1094 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 1572 3977 gene locus_tag LOCUS_07800 gene ppsA 1572 3977 CDS product pyruvate, water dikinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846514.1 protein_id gnl|my_center|LOCUS_07800 4645 4022 gene locus_tag LOCUS_07810 4645 4022 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545352.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence100 <1 1018 gene locus_tag LOCUS_07820 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978258.1:ORC1-type DNA replication protein 1197 2840 gene locus_tag LOCUS_07830 1197 2840 CDS product long-chain-fatty-acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762392.1 protein_id gnl|my_center|LOCUS_07830 4105 2837 gene locus_tag LOCUS_07840 4105 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence101 206 757 gene locus_tag LOCUS_07850 206 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 767 1309 gene locus_tag LOCUS_07860 767 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 2655 1306 gene locus_tag LOCUS_07870 gene thiC 2655 1306 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763181.1 protein_id gnl|my_center|LOCUS_07870 3456 2662 gene locus_tag LOCUS_07880 3456 2662 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240513.1 protein_id gnl|my_center|LOCUS_07880 <4903 3522 gene locus_tag LOCUS_07890 <4903 3522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903947.1:bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase >Feature sequence102 553 948 gene locus_tag LOCUS_07900 553 948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1050 1475 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcatttcttctctggttgcttc 2526 1897 gene locus_tag LOCUS_07910 2526 1897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 2803 2513 gene locus_tag LOCUS_07920 gene cas2 2803 2513 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846845.1 protein_id gnl|my_center|LOCUS_07920 3101 3459 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaagcaaccagaaacgaaatacaac 4555 3581 gene locus_tag LOCUS_07930 4555 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 >Feature sequence103 148 756 gene locus_tag LOCUS_07940 148 756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2625 721 gene locus_tag LOCUS_07950 2625 721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 3538 2612 gene locus_tag LOCUS_07960 3538 2612 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877416.1 protein_id gnl|my_center|LOCUS_07960 3743 4225 gene locus_tag LOCUS_07970 3743 4225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 4562 4269 gene locus_tag LOCUS_07980 4562 4269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence104 <1 720 gene locus_tag LOCUS_07990 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979554.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit 725 1570 gene locus_tag LOCUS_08000 gene lysX 725 1570 CDS product lysine biosynthesis protein LysX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979555.1 protein_id gnl|my_center|LOCUS_08000 2661 1567 gene locus_tag LOCUS_08010 2661 1567 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867617.1 protein_id gnl|my_center|LOCUS_08010 2872 2669 gene locus_tag LOCUS_08020 2872 2669 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146862.1 protein_id gnl|my_center|LOCUS_08020 3004 4161 gene locus_tag LOCUS_08030 3004 4161 CDS product DUF1646 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878290.1 protein_id gnl|my_center|LOCUS_08030 4481 4158 gene locus_tag LOCUS_08040 4481 4158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence105 1078 4278 gene locus_tag LOCUS_08050 1078 4278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence106 993 529 gene locus_tag LOCUS_08060 993 529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 2060 1146 gene locus_tag LOCUS_08070 2060 1146 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762132.1 protein_id gnl|my_center|LOCUS_08070 2274 2552 gene locus_tag LOCUS_08080 2274 2552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 3390 2497 gene locus_tag LOCUS_08090 gene panB 3390 2497 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763099.1 protein_id gnl|my_center|LOCUS_08090 4292 3345 gene locus_tag LOCUS_08100 4292 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence107 <1 965 gene locus_tag LOCUS_08110 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867634.1:ABC transporter substrate-binding protein 990 1973 gene locus_tag LOCUS_08120 990 1973 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388249.1 protein_id gnl|my_center|LOCUS_08120 2002 2799 gene locus_tag LOCUS_08130 2002 2799 CDS product heme ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028243.1 protein_id gnl|my_center|LOCUS_08130 3617 2796 gene locus_tag LOCUS_08140 3617 2796 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157868130.1 protein_id gnl|my_center|LOCUS_08140 <4708 3665 gene locus_tag LOCUS_08150 <4708 3665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978425.1:bifunctional sugar-1-phosphate nucleotidylyltransferase/acetyltransferase >Feature sequence108 1270 2298 gene locus_tag LOCUS_08160 1270 2298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 3779 2295 gene locus_tag LOCUS_08170 3779 2295 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932852.1 protein_id gnl|my_center|LOCUS_08170 3891 4175 gene locus_tag LOCUS_08180 3891 4175 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240306.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence109 336 692 gene locus_tag LOCUS_08190 336 692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1061 816 gene locus_tag LOCUS_08200 1061 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 1362 1195 gene locus_tag LOCUS_08210 1362 1195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 2836 3489 gene locus_tag LOCUS_08220 2836 3489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 4677 3616 gene locus_tag LOCUS_08230 4677 3616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 >Feature sequence110 <1 588 gene locus_tag LOCUS_08240 <1 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762959.1:imidazoleglycerol-phosphate dehydratase 633 1409 gene locus_tag LOCUS_08250 gene hisF 633 1409 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_08250 1412 2680 gene locus_tag LOCUS_08260 gene hisD 1412 2680 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014877610.1 protein_id gnl|my_center|LOCUS_08260 2677 2991 gene locus_tag LOCUS_08270 2677 2991 CDS product phosphoribosyl-ATP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528343.1 protein_id gnl|my_center|LOCUS_08270 2976 3599 gene locus_tag LOCUS_08280 gene hisH 2976 3599 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393529.1 protein_id gnl|my_center|LOCUS_08280 3609 4406 gene locus_tag LOCUS_08290 3609 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 >Feature sequence111 262 996 gene locus_tag LOCUS_08300 262 996 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846261.1 protein_id gnl|my_center|LOCUS_08300 1247 993 gene locus_tag LOCUS_08310 1247 993 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249651.1 protein_id gnl|my_center|LOCUS_08310 1513 1319 gene locus_tag LOCUS_08320 1513 1319 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 2796 2038 gene locus_tag LOCUS_08330 2796 2038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 2912 2921 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3224 2976 gene locus_tag LOCUS_08340 3224 2976 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978266.1 protein_id gnl|my_center|LOCUS_08340 3367 3966 gene locus_tag LOCUS_08350 3367 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence112 1567 815 gene locus_tag LOCUS_08360 1567 815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 1512 2249 gene locus_tag LOCUS_08370 1512 2249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 3269 2322 gene locus_tag LOCUS_08380 3269 2322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 3375 4505 gene locus_tag LOCUS_08390 3375 4505 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence113 105 1646 gene locus_tag LOCUS_08400 105 1646 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_08400 1671 2720 gene locus_tag LOCUS_08410 1671 2720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 2731 3600 gene locus_tag LOCUS_08420 2731 3600 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975572.1 protein_id gnl|my_center|LOCUS_08420 >Feature sequence114 1403 627 gene locus_tag LOCUS_08430 1403 627 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980120.1 protein_id gnl|my_center|LOCUS_08430 1587 2342 gene locus_tag LOCUS_08440 gene uppS 1587 2342 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867696.1 protein_id gnl|my_center|LOCUS_08440 3477 2275 gene locus_tag LOCUS_08450 3477 2275 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846947.1 protein_id gnl|my_center|LOCUS_08450 4390 3440 gene locus_tag LOCUS_08460 4390 3440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979293.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence115 3 437 gene locus_tag LOCUS_08470 3 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 434 1747 gene locus_tag LOCUS_08480 434 1747 CDS product chorismate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763636.1 protein_id gnl|my_center|LOCUS_08480 1757 2347 gene locus_tag LOCUS_08490 1757 2347 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763635.1 protein_id gnl|my_center|LOCUS_08490 2378 3157 gene locus_tag LOCUS_08500 2378 3157 CDS product indole-3-glycerol-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761884.1 protein_id gnl|my_center|LOCUS_08500 3269 3997 gene locus_tag LOCUS_08510 3269 3997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 >Feature sequence116 1532 318 gene locus_tag LOCUS_08520 1532 318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3150 1696 gene locus_tag LOCUS_08530 3150 1696 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979314.1 protein_id gnl|my_center|LOCUS_08530 4098 3211 gene locus_tag LOCUS_08540 4098 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence117 148 846 gene locus_tag LOCUS_08550 148 846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 884 1456 gene locus_tag LOCUS_08560 gene endA 884 1456 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978320.1 protein_id gnl|my_center|LOCUS_08560 1806 2051 gene locus_tag LOCUS_08570 1806 2051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08570 2596 2048 gene locus_tag LOCUS_08580 2596 2048 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_08580 3356 2481 gene locus_tag LOCUS_08590 3356 2481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 >Feature sequence118 165 980 gene locus_tag LOCUS_08600 165 980 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_08600 >Feature sequence119 2608 1721 gene locus_tag LOCUS_08610 2608 1721 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249220.1 protein_id gnl|my_center|LOCUS_08610 2738 3937 gene locus_tag LOCUS_08620 2738 3937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 >Feature sequence120 228 821 gene locus_tag LOCUS_08630 228 821 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763279.1 protein_id gnl|my_center|LOCUS_08630 920 2320 gene locus_tag LOCUS_08640 920 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 2407 2494 gene locus_tag LOCUS_t00100 2407 2494 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2588 3115 gene locus_tag LOCUS_08650 2588 3115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 4076 3525 gene locus_tag LOCUS_08660 4076 3525 CDS product DUF3782 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763642.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence121 578 1147 gene locus_tag LOCUS_08670 578 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1220 2347 gene locus_tag LOCUS_08680 1220 2347 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_08680 3413 2331 gene locus_tag LOCUS_08690 gene rtcA 3413 2331 CDS product RNA 3'-terminal phosphate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762505.1 protein_id gnl|my_center|LOCUS_08690 3941 3417 gene locus_tag LOCUS_08700 3941 3417 CDS product nicotinamide-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868691.1 protein_id gnl|my_center|LOCUS_08700 >Feature sequence122 1029 58 gene locus_tag LOCUS_08710 1029 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 1946 1026 gene locus_tag LOCUS_08720 1946 1026 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229683.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08720 2126 2051 gene locus_tag LOCUS_t00110 2126 2051 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2478 2554 gene locus_tag LOCUS_t00120 2478 2554 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 2692 3498 gene locus_tag LOCUS_08730 2692 3498 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228146.1 protein_id gnl|my_center|LOCUS_08730 >Feature sequence123 286 1194 gene locus_tag LOCUS_08740 286 1194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 1403 1957 gene locus_tag LOCUS_08750 1403 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 2055 2225 gene locus_tag LOCUS_08760 2055 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08760 2358 2687 gene locus_tag LOCUS_08770 2358 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 4065 2650 gene locus_tag LOCUS_08780 4065 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence124 764 1075 gene locus_tag LOCUS_08790 764 1075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1054 1488 gene locus_tag LOCUS_08800 1054 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1530 2294 gene locus_tag LOCUS_08810 1530 2294 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980413.1 protein_id gnl|my_center|LOCUS_08810 3676 2291 gene locus_tag LOCUS_08820 gene cdr 3676 2291 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068576671.1 protein_id gnl|my_center|LOCUS_08820 3850 3859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence125 <1 760 gene locus_tag LOCUS_08830 <1 760 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256829.1:cytochrome c biogenesis protein CcsA 791 1381 gene locus_tag LOCUS_08840 791 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 1629 1877 gene locus_tag LOCUS_08850 1629 1877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 2661 1861 gene locus_tag LOCUS_08860 2661 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 2708 3409 gene locus_tag LOCUS_08870 2708 3409 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761969.1 protein_id gnl|my_center|LOCUS_08870 3918 3460 gene locus_tag LOCUS_08880 3918 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 >Feature sequence126 970 1380 gene locus_tag LOCUS_08890 970 1380 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172718.1 protein_id gnl|my_center|LOCUS_08890 1322 1726 gene locus_tag LOCUS_08900 1322 1726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 2412 1723 gene locus_tag LOCUS_08910 2412 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 3372 2599 gene locus_tag LOCUS_08920 3372 2599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 <4079 3448 gene locus_tag LOCUS_08930 <4079 3448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763581.1:LysE family translocator >Feature sequence127 2244 880 gene locus_tag LOCUS_08940 2244 880 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980121.1 protein_id gnl|my_center|LOCUS_08940 2422 3147 gene locus_tag LOCUS_08950 2422 3147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence128 2160 1045 gene locus_tag LOCUS_08960 gene prf1 2160 1045 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084742617.1 protein_id gnl|my_center|LOCUS_08960 2317 2619 gene locus_tag LOCUS_08970 2317 2619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 3041 2616 gene locus_tag LOCUS_08980 3041 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978740.1 protein_id gnl|my_center|LOCUS_08980 3650 3090 gene locus_tag LOCUS_08990 3650 3090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08990 4010 3651 gene locus_tag LOCUS_09000 4010 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence129 1039 2034 gene locus_tag LOCUS_09010 1039 2034 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727498.1 protein_id gnl|my_center|LOCUS_09010 2201 3328 gene locus_tag LOCUS_09020 2201 3328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 <4021 3314 gene locus_tag LOCUS_09030 <4021 3314 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763197.1:glycosyltransferase >Feature sequence130 311 670 gene locus_tag LOCUS_09040 311 670 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867741.1 protein_id gnl|my_center|LOCUS_09040 700 1131 gene locus_tag LOCUS_09050 700 1131 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978223.1 protein_id gnl|my_center|LOCUS_09050 1198 1641 gene locus_tag LOCUS_09060 1198 1641 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978222.1 protein_id gnl|my_center|LOCUS_09060 1765 2298 gene locus_tag LOCUS_09070 1765 2298 CDS product DUF151 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978221.1 protein_id gnl|my_center|LOCUS_09070 2404 3012 gene locus_tag LOCUS_09080 2404 3012 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978220.1 protein_id gnl|my_center|LOCUS_09080 >Feature sequence131 633 2405 gene locus_tag LOCUS_09090 gene ilvB 633 2405 CDS product biosynthetic-type acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827711.1 protein_id gnl|my_center|LOCUS_09090 2412 2717 gene locus_tag LOCUS_09100 2412 2717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 2799 3818 gene locus_tag LOCUS_09110 gene ilvC 2799 3818 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762306.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence132 234 1178 gene locus_tag LOCUS_09120 234 1178 CDS product sugar ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867314.1 protein_id gnl|my_center|LOCUS_09120 1175 2128 gene locus_tag LOCUS_09130 1175 2128 CDS product carbohydrate ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867313.1 protein_id gnl|my_center|LOCUS_09130 2129 3271 gene locus_tag LOCUS_09140 2129 3271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867312.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence133 227 1672 gene locus_tag LOCUS_09150 227 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 2209 1580 gene locus_tag LOCUS_09160 2209 1580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 3317 2211 gene locus_tag LOCUS_09170 3317 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3789 3379 gene locus_tag LOCUS_09180 3789 3379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 >Feature sequence134 940 5 gene locus_tag LOCUS_09190 gene pstC 940 5 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868164.1 protein_id gnl|my_center|LOCUS_09190 2245 1064 gene locus_tag LOCUS_09200 gene pstS 2245 1064 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496700.1 protein_id gnl|my_center|LOCUS_09200 2660 3709 gene locus_tag LOCUS_09210 2660 3709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence135 610 179 gene locus_tag LOCUS_09220 610 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 2650 908 gene locus_tag LOCUS_09230 2650 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 3729 2848 gene locus_tag LOCUS_09240 3729 2848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870975.1 protein_id gnl|my_center|LOCUS_09240 >Feature sequence136 <1 636 gene locus_tag LOCUS_09250 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583777.1:phosphoribosyltransferase 557 1150 gene locus_tag LOCUS_09260 557 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1753 3594 gene locus_tag LOCUS_09270 1753 3594 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146933.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence137 <1 810 gene locus_tag LOCUS_09280 <1 810 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_029490874.1:dipeptide epimerase 1041 954 gene locus_tag LOCUS_t00130 1041 954 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1488 1183 gene locus_tag LOCUS_09290 1488 1183 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 3184 1661 gene locus_tag LOCUS_09300 3184 1661 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146577.1 protein_id gnl|my_center|LOCUS_09300 3283 3645 gene locus_tag LOCUS_09310 3283 3645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 3797 3874 gene locus_tag LOCUS_t00140 3797 3874 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence138 <1 966 gene locus_tag LOCUS_09320 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053820.1:thiamine ABC transporter substrate-binding protein 1001 1837 gene locus_tag LOCUS_09330 1001 1837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 1850 1859 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1875 2606 gene locus_tag LOCUS_09340 1875 2606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09340 2644 3528 gene locus_tag LOCUS_09350 2644 3528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 >Feature sequence139 269 676 gene locus_tag LOCUS_09360 269 676 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902004.1 protein_id gnl|my_center|LOCUS_09360 2638 746 gene locus_tag LOCUS_09370 gene aor 2638 746 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250017.1 protein_id gnl|my_center|LOCUS_09370 3460 2708 gene locus_tag LOCUS_09380 3460 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 >Feature sequence140 3083 438 gene locus_tag LOCUS_09390 gene rpoA1 3083 438 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846236.1 protein_id gnl|my_center|LOCUS_09390 <3823 3172 gene locus_tag LOCUS_09400 <3823 3172 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978227.1:DNA-directed RNA polymerase subunit B >Feature sequence141 377 1906 gene locus_tag LOCUS_09410 377 1906 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867577.1 protein_id gnl|my_center|LOCUS_09410 1899 2939 gene locus_tag LOCUS_09420 1899 2939 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249610.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence142 964 383 gene locus_tag LOCUS_09430 964 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1204 2553 gene locus_tag LOCUS_09440 1204 2553 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240499.1 protein_id gnl|my_center|LOCUS_09440 3226 2528 gene locus_tag LOCUS_09450 3226 2528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence143 475 1497 gene locus_tag LOCUS_09460 475 1497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250752.1 protein_id gnl|my_center|LOCUS_09460 1591 2859 gene locus_tag LOCUS_09470 gene hmgA 1591 2859 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762566.1 protein_id gnl|my_center|LOCUS_09470 3809 2856 gene locus_tag LOCUS_09480 3809 2856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 >Feature sequence144 879 628 gene locus_tag LOCUS_09490 879 628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1888 1049 gene locus_tag LOCUS_09500 gene surE 1888 1049 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762060.1 protein_id gnl|my_center|LOCUS_09500 2973 1915 gene locus_tag LOCUS_09510 2973 1915 CDS product DUF1152 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761773.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence145 <1 1168 gene locus_tag LOCUS_09520 <1 1168 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762695.1:DUF711 family protein 2146 1220 gene locus_tag LOCUS_09530 2146 1220 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496405.1 protein_id gnl|my_center|LOCUS_09530 3665 2217 gene locus_tag LOCUS_09540 3665 2217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 >Feature sequence146 161 1846 gene locus_tag LOCUS_09550 161 1846 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871145.1 protein_id gnl|my_center|LOCUS_09550 2316 1867 gene locus_tag LOCUS_09560 2316 1867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 2909 2502 gene locus_tag LOCUS_09570 2909 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 <3806 3003 gene locus_tag LOCUS_09580 <3806 3003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978316.1:glycine--tRNA ligase >Feature sequence147 1050 1295 gene locus_tag LOCUS_09590 1050 1295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 1276 1632 gene locus_tag LOCUS_09600 1276 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2747 1629 gene locus_tag LOCUS_09610 2747 1629 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080873.1 protein_id gnl|my_center|LOCUS_09610 1788 1797 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2846 3262 gene locus_tag LOCUS_09620 2846 3262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 >Feature sequence148 854 1660 gene locus_tag LOCUS_09630 854 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 2155 1637 gene locus_tag LOCUS_09640 2155 1637 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880795.1 protein_id gnl|my_center|LOCUS_09640 <3772 2240 gene locus_tag LOCUS_09650 <3772 2240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053756.1:ATP-binding protein >Feature sequence149 1030 251 gene locus_tag LOCUS_09660 1030 251 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763153.1 protein_id gnl|my_center|LOCUS_09660 1727 996 gene locus_tag LOCUS_09670 1727 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1853 2818 gene locus_tag LOCUS_09680 1853 2818 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979315.1 protein_id gnl|my_center|LOCUS_09680 3320 2802 gene locus_tag LOCUS_09690 3320 2802 CDS product protein-lysine N-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846965.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence150 1614 1240 gene locus_tag LOCUS_09700 1614 1240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 2275 1607 gene locus_tag LOCUS_09710 2275 1607 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846654.1 protein_id gnl|my_center|LOCUS_09710 2441 3337 gene locus_tag LOCUS_09720 2441 3337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence151 3413 1500 gene locus_tag LOCUS_09730 3413 1500 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870139.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence152 221 1144 gene locus_tag LOCUS_09740 221 1144 CDS product UbiA family prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979498.1 protein_id gnl|my_center|LOCUS_09740 1898 1245 gene locus_tag LOCUS_09750 1898 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683780.1 protein_id gnl|my_center|LOCUS_09750 2601 1858 gene locus_tag LOCUS_09760 2601 1858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2790 3203 gene locus_tag LOCUS_09770 2790 3203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 3526 3185 gene locus_tag LOCUS_09780 3526 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979309.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence153 351 1337 gene locus_tag LOCUS_09790 351 1337 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240278.1 protein_id gnl|my_center|LOCUS_09790 1351 2130 gene locus_tag LOCUS_09800 1351 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 2486 2127 gene locus_tag LOCUS_09810 2486 2127 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064662.1 protein_id gnl|my_center|LOCUS_09810 3705 2509 gene locus_tag LOCUS_09820 3705 2509 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879245.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence154 3411 2353 gene locus_tag LOCUS_09830 3411 2353 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761913.1 protein_id gnl|my_center|LOCUS_09830 >Feature sequence155 128 829 gene locus_tag LOCUS_09840 128 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 1620 826 gene locus_tag LOCUS_09850 1620 826 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024265536.1 protein_id gnl|my_center|LOCUS_09850 >Feature sequence156 2101 989 gene locus_tag LOCUS_09860 2101 989 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240229.1 protein_id gnl|my_center|LOCUS_09860 2298 3044 gene locus_tag LOCUS_09870 2298 3044 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868524.1 protein_id gnl|my_center|LOCUS_09870 >Feature sequence157 1404 658 gene locus_tag LOCUS_09880 1404 658 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867666.1 protein_id gnl|my_center|LOCUS_09880 2258 1401 gene locus_tag LOCUS_09890 2258 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 3168 2242 gene locus_tag LOCUS_09900 gene amrB 3168 2242 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980136.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence158 153 656 gene locus_tag LOCUS_09910 153 656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 973 653 gene locus_tag LOCUS_09920 973 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3120 1123 gene locus_tag LOCUS_09930 3120 1123 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249391.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence159 84 659 gene locus_tag LOCUS_09940 84 659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 1054 746 gene locus_tag LOCUS_09950 gene yciH 1054 746 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978313.1 protein_id gnl|my_center|LOCUS_09950 1205 1408 gene locus_tag LOCUS_09960 1205 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 2375 1416 gene locus_tag LOCUS_09970 gene speB 2375 1416 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978315.1 protein_id gnl|my_center|LOCUS_09970 >Feature sequence160 172 735 gene locus_tag LOCUS_09980 172 735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1828 701 gene locus_tag LOCUS_09990 1828 701 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250208.1 protein_id gnl|my_center|LOCUS_09990 3247 1877 gene locus_tag LOCUS_10000 gene mdtG 3247 1877 CDS product multidrug efflux MFS transporter MdtG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816067.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence161 482 715 gene locus_tag LOCUS_10010 482 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 804 2114 gene locus_tag LOCUS_10020 804 2114 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979394.1 protein_id gnl|my_center|LOCUS_10020 2424 2951 gene locus_tag LOCUS_10030 2424 2951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10030 2852 2861 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2932 3231 gene locus_tag LOCUS_10040 2932 3231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10040 3231 3458 gene locus_tag LOCUS_10050 3231 3458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence162 1351 1073 gene locus_tag LOCUS_10060 1351 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1561 1836 gene locus_tag LOCUS_10070 1561 1836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 1886 2275 gene locus_tag LOCUS_10080 1886 2275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 3438 2272 gene locus_tag LOCUS_10090 3438 2272 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392962.1 protein_id gnl|my_center|LOCUS_10090 >Feature sequence163 1706 450 gene locus_tag LOCUS_10100 1706 450 CDS product TIGR04053 family radical SAM/SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761873.1 protein_id gnl|my_center|LOCUS_10100 3255 1918 gene locus_tag LOCUS_10110 gene aspS 3255 1918 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence164 1514 252 gene locus_tag LOCUS_10120 1514 252 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_10120 2542 1508 gene locus_tag LOCUS_10130 2542 1508 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763539.1 protein_id gnl|my_center|LOCUS_10130 <3449 2517 gene locus_tag LOCUS_10140 <3449 2517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240575.1:homocitrate synthase family protein >Feature sequence165 1333 587 gene locus_tag LOCUS_10150 1333 587 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_10150 2601 1288 gene locus_tag LOCUS_10160 2601 1288 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249842.1 protein_id gnl|my_center|LOCUS_10160 <3417 2550 gene locus_tag LOCUS_10170 <3417 2550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496874.1:UPF0104 family protein >Feature sequence166 301 2193 gene locus_tag LOCUS_10180 301 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10180 2350 2808 gene locus_tag LOCUS_10190 2350 2808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2774 3193 gene locus_tag LOCUS_10200 2774 3193 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978781.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence167 801 70 gene locus_tag LOCUS_10210 801 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 1750 1058 gene locus_tag LOCUS_10220 gene thiF 1750 1058 CDS product thiazole biosynthesis adenylyltransferase ThiF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007056327.1 protein_id gnl|my_center|LOCUS_10220 1964 3136 gene locus_tag LOCUS_10230 gene thiI 1964 3136 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762723.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence168 378 866 gene locus_tag LOCUS_10240 378 866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 832 2172 gene locus_tag LOCUS_10250 832 2172 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_10250 2217 2567 gene locus_tag LOCUS_10260 2217 2567 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978432.1 protein_id gnl|my_center|LOCUS_10260 2638 2991 gene locus_tag LOCUS_10270 2638 2991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 >Feature sequence169 571 1290 gene locus_tag LOCUS_10280 571 1290 CDS product 3,4-dihydroxy-2-butanone-4-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978356.1 protein_id gnl|my_center|LOCUS_10280 1247 1714 gene locus_tag LOCUS_10290 gene ribC 1247 1714 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870697.1 protein_id gnl|my_center|LOCUS_10290 2475 1711 gene locus_tag LOCUS_10300 2475 1711 CDS product 2,5-diamino-6-(ribosylamino)-4(3H)-pyrimidinone 5'-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762140.1 protein_id gnl|my_center|LOCUS_10300 3120 2518 gene locus_tag LOCUS_10310 3120 2518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence170 714 1052 gene locus_tag LOCUS_10320 714 1052 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240464.1 protein_id gnl|my_center|LOCUS_10320 1198 2094 gene locus_tag LOCUS_10330 gene tatC 1198 2094 CDS product Sec-independent protein translocase TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763345.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence171 1742 867 gene locus_tag LOCUS_10340 1742 867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2467 1931 gene locus_tag LOCUS_10350 gene ppa 2467 1931 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846890.1 protein_id gnl|my_center|LOCUS_10350 2626 3204 gene locus_tag LOCUS_10360 gene folE 2626 3204 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_10360 >Feature sequence172 <3231 1526 gene locus_tag LOCUS_10370 <3231 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868469.1:dihydroxy-acid dehydratase >Feature sequence173 2399 516 gene locus_tag LOCUS_10380 2399 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 2805 2677 gene locus_tag LOCUS_10390 2805 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence174 1 558 gene locus_tag LOCUS_10400 1 558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 701 1237 gene locus_tag LOCUS_10410 701 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 1956 1234 gene locus_tag LOCUS_10420 1956 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence175 217 1443 gene locus_tag LOCUS_10430 217 1443 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978424.1 protein_id gnl|my_center|LOCUS_10430 1660 2340 gene locus_tag LOCUS_10440 1660 2340 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978423.1 protein_id gnl|my_center|LOCUS_10440 2515 2982 gene locus_tag LOCUS_10450 2515 2982 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868849.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence176 249 437 gene locus_tag LOCUS_10460 249 437 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763616.1 protein_id gnl|my_center|LOCUS_10460 400 1497 gene locus_tag LOCUS_10470 gene kae1 400 1497 CDS product KEOPS complex N(6)-L-threonylcarbamoyladenine synthase Kae1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978326.1 protein_id gnl|my_center|LOCUS_10470 1461 2171 gene locus_tag LOCUS_10480 1461 2171 CDS product Kae1-associated kinase Bud32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249630.1 protein_id gnl|my_center|LOCUS_10480 2168 2737 gene locus_tag LOCUS_10490 2168 2737 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence177 1322 1537 gene locus_tag LOCUS_10500 1322 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 2701 1691 gene locus_tag LOCUS_10510 2701 1691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence178 1715 570 gene locus_tag LOCUS_10520 gene pepQ 1715 570 CDS product Xaa-Pro dipeptidase PepQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146836.1 protein_id gnl|my_center|LOCUS_10520 2257 1721 gene locus_tag LOCUS_10530 2257 1721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762933.1 protein_id gnl|my_center|LOCUS_10530 2355 3086 gene locus_tag LOCUS_10540 2355 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 >Feature sequence179 903 175 gene locus_tag LOCUS_10550 903 175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1391 1804 gene locus_tag LOCUS_10560 1391 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1801 2142 gene locus_tag LOCUS_10570 1801 2142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009071466.1 protein_id gnl|my_center|LOCUS_10570 2674 2171 gene locus_tag LOCUS_10580 2674 2171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence180 572 351 gene locus_tag LOCUS_10590 572 351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 758 976 gene locus_tag LOCUS_10600 758 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 1797 973 gene locus_tag LOCUS_10610 1797 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 <3128 1883 gene locus_tag LOCUS_10620 <3128 1883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583735.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence181 <1 817 gene locus_tag LOCUS_10630 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010903488.1:aldo/keto reductase 1624 722 gene locus_tag LOCUS_10640 1624 722 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148692627.1 protein_id gnl|my_center|LOCUS_10640 2599 1643 gene locus_tag LOCUS_10650 2599 1643 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867338.1 protein_id gnl|my_center|LOCUS_10650 2904 2596 gene locus_tag LOCUS_10660 2904 2596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10660 >Feature sequence182 210 1451 gene locus_tag LOCUS_10670 210 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 1616 2305 gene locus_tag LOCUS_10680 1616 2305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 <3109 2302 gene locus_tag LOCUS_10690 <3109 2302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881223.1:metallopeptidase TldD-related protein >Feature sequence183 1094 693 gene locus_tag LOCUS_10700 1094 693 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978388.1 protein_id gnl|my_center|LOCUS_10700 1288 1124 gene locus_tag LOCUS_10710 1288 1124 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978389.1 protein_id gnl|my_center|LOCUS_10710 1909 1322 gene locus_tag LOCUS_10720 1909 1322 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250479.1 protein_id gnl|my_center|LOCUS_10720 2679 1906 gene locus_tag LOCUS_10730 2679 1906 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250480.1 protein_id gnl|my_center|LOCUS_10730 >Feature sequence184 734 2242 gene locus_tag LOCUS_10740 734 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 2338 2412 gene locus_tag LOCUS_t00150 2338 2412 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 2846 2472 gene locus_tag LOCUS_10750 2846 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 >Feature sequence185 128 658 gene locus_tag LOCUS_10760 128 658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 931 668 gene locus_tag LOCUS_10770 931 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1045 2721 gene locus_tag LOCUS_10780 1045 2721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence186 328 810 gene locus_tag LOCUS_10790 328 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1044 1226 gene locus_tag LOCUS_10800 1044 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 <3046 1223 gene locus_tag LOCUS_10810 <3046 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762145.1:ATP-dependent DNA helicase >Feature sequence187 1945 233 gene locus_tag LOCUS_10820 1945 233 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860413.1 protein_id gnl|my_center|LOCUS_10820 2731 2087 gene locus_tag LOCUS_10830 2731 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence188 381 390 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 421 1314 gene locus_tag LOCUS_10840 421 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 1568 2431 gene locus_tag LOCUS_10850 1568 2431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 >Feature sequence189 763 557 gene locus_tag LOCUS_10860 763 557 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 1235 858 gene locus_tag LOCUS_10870 1235 858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 1902 1354 gene locus_tag LOCUS_10880 1902 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2240 1932 gene locus_tag LOCUS_10890 2240 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 >Feature sequence190 398 934 gene locus_tag LOCUS_10900 398 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1613 924 gene locus_tag LOCUS_10910 1613 924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2968 1628 gene locus_tag LOCUS_10920 2968 1628 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868369.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence191 1165 1677 gene locus_tag LOCUS_10930 1165 1677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10930 2537 1674 gene locus_tag LOCUS_10940 2537 1674 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060947.1 protein_id gnl|my_center|LOCUS_10940 >Feature sequence192 1138 101 gene locus_tag LOCUS_10950 1138 101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 872 881 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1233 2114 gene locus_tag LOCUS_10960 1233 2114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 2293 2111 gene locus_tag LOCUS_10970 2293 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 2601 2362 gene locus_tag LOCUS_10980 2601 2362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 >Feature sequence193 1269 2243 gene locus_tag LOCUS_10990 1269 2243 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146505.1 protein_id gnl|my_center|LOCUS_10990 <2970 2240 gene locus_tag LOCUS_11000 <2970 2240 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762701.1:fumarate hydratase >Feature sequence194 416 2410 gene locus_tag LOCUS_11010 416 2410 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979277.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence195 850 305 gene locus_tag LOCUS_11020 850 305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1500 895 gene locus_tag LOCUS_11030 1500 895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1943 1497 gene locus_tag LOCUS_11040 gene hypA 1943 1497 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250958.1 protein_id gnl|my_center|LOCUS_11040 2687 1971 gene locus_tag LOCUS_11050 gene hypB 2687 1971 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869941.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence196 68 144 gene locus_tag LOCUS_t00160 68 144 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 216 1787 gene locus_tag LOCUS_11060 216 1787 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240545.1 protein_id gnl|my_center|LOCUS_11060 2797 1784 gene locus_tag LOCUS_11070 2797 1784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence197 990 106 gene locus_tag LOCUS_11080 990 106 CDS product RimK family alpha-L-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198429779.1 protein_id gnl|my_center|LOCUS_11080 1951 998 gene locus_tag LOCUS_11090 1951 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2751 1918 gene locus_tag LOCUS_11100 2751 1918 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846346.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence198 213 2387 gene locus_tag LOCUS_11110 gene purL 213 2387 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173566.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence199 373 29 gene locus_tag LOCUS_11120 373 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11120 1710 523 gene locus_tag LOCUS_11130 1710 523 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978973.1 protein_id gnl|my_center|LOCUS_11130 2350 2087 gene locus_tag LOCUS_11140 2350 2087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence200 <1 870 gene locus_tag LOCUS_11150 <1 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763351.1:glycosyltransferase 1006 920 gene locus_tag LOCUS_t00170 1006 920 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1295 1882 gene locus_tag LOCUS_11160 1295 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869810.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence201 <1 533 gene locus_tag LOCUS_11170 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053091.1:mechanosensitive ion channel family protein 442 1314 gene locus_tag LOCUS_11180 442 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 2222 1311 gene locus_tag LOCUS_11190 2222 1311 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978336.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence202 1028 1270 gene locus_tag LOCUS_11200 1028 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 1287 1790 gene locus_tag LOCUS_11210 1287 1790 CDS product DUF3368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249167.1 protein_id gnl|my_center|LOCUS_11210 1886 1809 gene locus_tag LOCUS_t00180 1886 1809 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 2137 2655 gene locus_tag LOCUS_11220 2137 2655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763023.1 protein_id gnl|my_center|LOCUS_11220 >Feature sequence203 8 83 gene locus_tag LOCUS_t00190 8 83 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 300 2057 gene locus_tag LOCUS_11230 300 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 <2834 2054 gene locus_tag LOCUS_11240 <2834 2054 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250859.1:biotin/lipoate A/B protein ligase family protein >Feature sequence204 1284 565 gene locus_tag LOCUS_11250 gene rrp4 1284 565 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978417.1 protein_id gnl|my_center|LOCUS_11250 2008 1292 gene locus_tag LOCUS_11260 2008 1292 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978418.1 protein_id gnl|my_center|LOCUS_11260 2652 2011 gene locus_tag LOCUS_11270 gene psmA 2652 2011 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846326.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence205 849 301 gene locus_tag LOCUS_11280 849 301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 953 1204 gene locus_tag LOCUS_11290 953 1204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1179 1658 gene locus_tag LOCUS_11300 1179 1658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1994 1635 gene locus_tag LOCUS_11310 1994 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 2453 2070 gene locus_tag LOCUS_11320 2453 2070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 >Feature sequence206 1575 2342 gene locus_tag LOCUS_11330 1575 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence207 765 2180 gene locus_tag LOCUS_11340 765 2180 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761957.1 protein_id gnl|my_center|LOCUS_11340 2554 2270 gene locus_tag LOCUS_11350 2554 2270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence208 210 458 gene locus_tag LOCUS_11360 210 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 699 1397 gene locus_tag LOCUS_11370 699 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762167.1 protein_id gnl|my_center|LOCUS_11370 1481 2131 gene locus_tag LOCUS_11380 1481 2131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 2203 2514 gene locus_tag LOCUS_11390 2203 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence209 936 226 gene locus_tag LOCUS_11400 936 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1034 1432 gene locus_tag LOCUS_11410 1034 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1517 2230 gene locus_tag LOCUS_11420 1517 2230 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249007.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence210 74 988 gene locus_tag LOCUS_11430 74 988 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249219.1 protein_id gnl|my_center|LOCUS_11430 1041 1472 gene locus_tag LOCUS_11440 1041 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1469 1915 gene locus_tag LOCUS_11450 1469 1915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 2688 1912 gene locus_tag LOCUS_11460 2688 1912 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846565.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence211 456 1322 gene locus_tag LOCUS_11470 456 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11470 2363 1299 gene locus_tag LOCUS_11480 2363 1299 CDS product chorismate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980354.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence212 390 1235 gene locus_tag LOCUS_11490 390 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 2281 1331 gene locus_tag LOCUS_11500 2281 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2589 2514 gene locus_tag LOCUS_t00200 2589 2514 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence213 878 153 gene locus_tag LOCUS_11510 878 153 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762240.1 protein_id gnl|my_center|LOCUS_11510 977 1735 gene locus_tag LOCUS_11520 977 1735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11520 1710 2375 gene locus_tag LOCUS_11530 1710 2375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11530 >Feature sequence214 1415 384 gene locus_tag LOCUS_11540 1415 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1868 2434 gene locus_tag LOCUS_11550 1868 2434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 >Feature sequence215 1150 560 gene locus_tag LOCUS_11560 1150 560 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763573.1 protein_id gnl|my_center|LOCUS_11560 1292 2401 gene locus_tag LOCUS_11570 1292 2401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence216 >Feature sequence217 >Feature sequence218 390 881 gene locus_tag LOCUS_11580 390 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 933 2093 gene locus_tag LOCUS_11590 933 2093 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080040.1 protein_id gnl|my_center|LOCUS_11590 2192 2680 gene locus_tag LOCUS_11600 2192 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence219 1209 1931 gene locus_tag LOCUS_11610 1209 1931 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880535.1 protein_id gnl|my_center|LOCUS_11610 2007 2201 gene locus_tag LOCUS_11620 2007 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence220 939 1625 gene locus_tag LOCUS_11630 939 1625 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761972.1 protein_id gnl|my_center|LOCUS_11630 1704 2018 gene locus_tag LOCUS_11640 1704 2018 CDS product PDGLE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761971.1 protein_id gnl|my_center|LOCUS_11640 2125 2134 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence221 11 241 gene locus_tag LOCUS_11650 11 241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 2163 238 gene locus_tag LOCUS_11660 2163 238 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763533.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence222 208 1185 gene locus_tag LOCUS_11670 208 1185 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250507.1 protein_id gnl|my_center|LOCUS_11670 1182 1757 gene locus_tag LOCUS_11680 1182 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 >Feature sequence223 119 1951 gene locus_tag LOCUS_11690 119 1951 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868362.1 protein_id gnl|my_center|LOCUS_11690 2063 2365 gene locus_tag LOCUS_11700 2063 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence224 48 515 gene locus_tag LOCUS_11710 48 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 984 532 gene locus_tag LOCUS_11720 984 532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827657.1 protein_id gnl|my_center|LOCUS_11720 1129 2100 gene locus_tag LOCUS_11730 1129 2100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11730 2138 2491 gene locus_tag LOCUS_11740 2138 2491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence225 1194 97 gene locus_tag LOCUS_11750 1194 97 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979237.1 protein_id gnl|my_center|LOCUS_11750 2308 1229 gene locus_tag LOCUS_11760 2308 1229 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979238.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence226 1503 1180 gene locus_tag LOCUS_11770 1503 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846516.1 protein_id gnl|my_center|LOCUS_11770 2094 1720 gene locus_tag LOCUS_11780 2094 1720 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence227 2434 1427 gene locus_tag LOCUS_11790 2434 1427 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978312.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence228 876 7 gene locus_tag LOCUS_11800 876 7 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 847 1317 gene locus_tag LOCUS_11810 847 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1858 1280 gene locus_tag LOCUS_11820 gene folE 1858 1280 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391949.1 protein_id gnl|my_center|LOCUS_11820 2018 2554 gene locus_tag LOCUS_11830 gene ppa 2018 2554 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846890.1 protein_id gnl|my_center|LOCUS_11830 >Feature sequence229 569 36 gene locus_tag LOCUS_11840 569 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11840 1472 711 gene locus_tag LOCUS_11850 1472 711 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763646.1 protein_id gnl|my_center|LOCUS_11850 1753 2502 gene locus_tag LOCUS_11860 1753 2502 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978969.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence230 32 1048 gene locus_tag LOCUS_11870 32 1048 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762938.1 protein_id gnl|my_center|LOCUS_11870 1081 2535 gene locus_tag LOCUS_11880 1081 2535 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762937.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence231 929 678 gene locus_tag LOCUS_11890 929 678 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978514.1 protein_id gnl|my_center|LOCUS_11890 1372 1683 gene locus_tag LOCUS_11900 1372 1683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 <2559 1676 gene locus_tag LOCUS_11910 <2559 1676 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762852.1:pyruvate kinase >Feature sequence232 1958 558 gene locus_tag LOCUS_11920 gene glnA 1958 558 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979431.1 protein_id gnl|my_center|LOCUS_11920 >Feature sequence233 148 1005 gene locus_tag LOCUS_11930 148 1005 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762605.1 protein_id gnl|my_center|LOCUS_11930 2366 987 gene locus_tag LOCUS_11940 2366 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence234 1 195 gene locus_tag LOCUS_11950 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 397 714 gene locus_tag LOCUS_11960 397 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1055 711 gene locus_tag LOCUS_11970 1055 711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 1171 2022 gene locus_tag LOCUS_11980 1171 2022 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249125.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence235 1677 475 gene locus_tag LOCUS_11990 1677 475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 <2503 1674 gene locus_tag LOCUS_12000 <2503 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868584.1:proton-conducting transporter membrane subunit >Feature sequence236 >Feature sequence237 2007 880 gene locus_tag LOCUS_12010 2007 880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 >Feature sequence238 137 1015 gene locus_tag LOCUS_12020 137 1015 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980142.1 protein_id gnl|my_center|LOCUS_12020 1088 1465 gene locus_tag LOCUS_12030 1088 1465 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250453.1 protein_id gnl|my_center|LOCUS_12030 1515 2000 gene locus_tag LOCUS_12040 1515 2000 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980140.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence239 <1 628 gene locus_tag LOCUS_12050 <1 628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249940.1:class I fructose-bisphosphate aldolase 613 1572 gene locus_tag LOCUS_12060 613 1572 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762863.1 protein_id gnl|my_center|LOCUS_12060 2249 1542 gene locus_tag LOCUS_12070 2249 1542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence240 479 36 gene locus_tag LOCUS_12080 479 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 1168 422 gene locus_tag LOCUS_12090 gene rpiA 1168 422 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871128.1 protein_id gnl|my_center|LOCUS_12090 <2448 1150 gene locus_tag LOCUS_12100 <2448 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011277826.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase >Feature sequence241 810 217 gene locus_tag LOCUS_12110 810 217 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978343.1 protein_id gnl|my_center|LOCUS_12110 1451 981 gene locus_tag LOCUS_12120 1451 981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 <2442 1370 gene locus_tag LOCUS_12130 <2442 1370 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867591.1:translation initiation factor IF-2 subunit gamma >Feature sequence242 356 643 gene locus_tag LOCUS_12140 356 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 1468 884 gene locus_tag LOCUS_12150 1468 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 >Feature sequence243 15 520 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttctattcccttttgggtgtttg 855 1625 gene locus_tag LOCUS_12160 gene cas4a 855 1625 CDS product type I-A CRISPR-associated protein Cas4/Csa1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010977960.1 protein_id gnl|my_center|LOCUS_12160 1603 2136 gene locus_tag LOCUS_12170 1603 2136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2025 2034 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence244 <1 1082 gene locus_tag LOCUS_12180 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763151.1:family 1 encapsulin nanocompartment shell protein 1192 1809 gene locus_tag LOCUS_12190 1192 1809 CDS product FumA C-terminus/TtdB family hydratase beta subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240327.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence245 84 686 gene locus_tag LOCUS_12200 84 686 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250877.1 protein_id gnl|my_center|LOCUS_12200 781 1209 gene locus_tag LOCUS_12210 781 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 1814 1206 gene locus_tag LOCUS_12220 1814 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 >Feature sequence246 696 2063 gene locus_tag LOCUS_12230 696 2063 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867262.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence247 991 746 gene locus_tag LOCUS_12240 991 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1151 1924 gene locus_tag LOCUS_12250 1151 1924 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979296.1 protein_id gnl|my_center|LOCUS_12250 <2370 1840 gene locus_tag LOCUS_12260 <2370 1840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011029619.1:acyl-CoA dehydrogenase family protein >Feature sequence248 >Feature sequence249 707 1444 gene locus_tag LOCUS_12270 gene fabG 707 1444 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057342.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence250 441 244 gene locus_tag LOCUS_12280 441 244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12280 711 454 gene locus_tag LOCUS_12290 711 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 1071 1480 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgtagttctttgtggttg >Feature sequence251 954 46 gene locus_tag LOCUS_12300 954 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 1884 1051 gene locus_tag LOCUS_12310 1884 1051 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence252 1024 1539 gene locus_tag LOCUS_12320 1024 1539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 <2347 1536 gene locus_tag LOCUS_12330 <2347 1536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846368.1:methyltransferase >Feature sequence253 237 1334 gene locus_tag LOCUS_12340 gene mfnA 237 1334 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902198.1 protein_id gnl|my_center|LOCUS_12340 1331 1825 gene locus_tag LOCUS_12350 1331 1825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence254 535 1554 gene locus_tag LOCUS_12360 gene rrp42 535 1554 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978415.1 protein_id gnl|my_center|LOCUS_12360 1628 1894 gene locus_tag LOCUS_12370 1628 1894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 >Feature sequence255 >Feature sequence256 990 595 gene locus_tag LOCUS_12380 gene speD 990 595 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184650921.1 protein_id gnl|my_center|LOCUS_12380 1211 1996 gene locus_tag LOCUS_12390 1211 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence257 759 1031 gene locus_tag LOCUS_12400 759 1031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1024 1458 gene locus_tag LOCUS_12410 1024 1458 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979870.1 protein_id gnl|my_center|LOCUS_12410 2233 1415 gene locus_tag LOCUS_12420 2233 1415 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761969.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence258 <1 599 gene locus_tag LOCUS_12430 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421608.1:hydantoinase/oxoprolinase family protein >Feature sequence259 508 41 gene locus_tag LOCUS_12440 508 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 890 516 gene locus_tag LOCUS_12450 890 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 1009 1084 gene locus_tag LOCUS_t00210 1009 1084 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1133 1582 gene locus_tag LOCUS_12460 1133 1582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 1638 1647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1683 2057 gene locus_tag LOCUS_12470 1683 2057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence260 <1 929 gene locus_tag LOCUS_12480 <1 929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763687.1:amidohydrolase family protein 1243 899 gene locus_tag LOCUS_12490 1243 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250284.1 protein_id gnl|my_center|LOCUS_12490 1617 1312 gene locus_tag LOCUS_12500 1617 1312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 <2274 1681 gene locus_tag LOCUS_12510 <2274 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876334.1:ABC transporter permease >Feature sequence261 257 1369 gene locus_tag LOCUS_12520 257 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 1380 1814 gene locus_tag LOCUS_12530 1380 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 1870 1946 gene locus_tag LOCUS_t00220 1870 1946 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence262 85 1302 gene locus_tag LOCUS_12540 85 1302 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763168.1 protein_id gnl|my_center|LOCUS_12540 1617 1626 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence263 1804 1178 gene locus_tag LOCUS_12550 1804 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12550 1867 1876 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence264 205 663 gene locus_tag LOCUS_12560 205 663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 1544 702 gene locus_tag LOCUS_12570 gene udp 1544 702 CDS product uridine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250430.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence265 93 16 gene locus_tag LOCUS_t00230 93 16 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 209 616 gene locus_tag LOCUS_12580 209 616 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979318.1 protein_id gnl|my_center|LOCUS_12580 956 1636 gene locus_tag LOCUS_12590 956 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence266 <1 743 gene locus_tag LOCUS_12600 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762156.1:fibrillarin-like rRNA/tRNA 2'-O-methyltransferase 916 1359 gene locus_tag LOCUS_12610 916 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 >Feature sequence267 <1 1686 gene locus_tag LOCUS_12620 <1 1686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763355.1:NADH-quinone oxidoreductase subunit L >Feature sequence268 <2159 1354 gene locus_tag LOCUS_12630 <2159 1354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869844.1:3-oxoacyl-[acyl-carrier-protein] reductase >Feature sequence269 318 70 gene locus_tag LOCUS_12640 318 70 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868845.1 protein_id gnl|my_center|LOCUS_12640 952 359 gene locus_tag LOCUS_12650 952 359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 1929 937 gene locus_tag LOCUS_12660 1929 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903882.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence270 489 1901 gene locus_tag LOCUS_12670 489 1901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12670 >Feature sequence271 144 1070 gene locus_tag LOCUS_12680 144 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2077 1067 gene locus_tag LOCUS_12690 2077 1067 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249140.1 protein_id gnl|my_center|LOCUS_12690 >Feature sequence272 244 1098 gene locus_tag LOCUS_12700 244 1098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 1781 1095 gene locus_tag LOCUS_12710 1781 1095 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761795.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence273 205 870 gene locus_tag LOCUS_12720 205 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 959 1207 gene locus_tag LOCUS_12730 959 1207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1217 1756 gene locus_tag LOCUS_12740 1217 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 >Feature sequence274 >Feature sequence275 240 31 gene locus_tag LOCUS_12750 240 31 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 1002 265 gene locus_tag LOCUS_12760 1002 265 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763000.1 protein_id gnl|my_center|LOCUS_12760 1141 1773 gene locus_tag LOCUS_12770 1141 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 >Feature sequence276 <1 755 gene locus_tag LOCUS_12780 <1 755 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979564.1:AmmeMemoRadiSam system radical SAM enzyme 1327 752 gene locus_tag LOCUS_12790 gene cysC 1327 752 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763240.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence277 1377 82 gene locus_tag LOCUS_12800 1377 82 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980086.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence278 621 397 gene locus_tag LOCUS_12810 621 397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1569 670 gene locus_tag LOCUS_12820 1569 670 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391813.1 protein_id gnl|my_center|LOCUS_12820 1998 1690 gene locus_tag LOCUS_12830 1998 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence279 1220 6 gene locus_tag LOCUS_12840 1220 6 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053786.1 protein_id gnl|my_center|LOCUS_12840 >Feature sequence280 <2056 1051 gene locus_tag LOCUS_12850 <2056 1051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846406.1:ATP-binding protein >Feature sequence281 209 484 gene locus_tag LOCUS_12860 209 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 >Feature sequence282 <1 531 gene locus_tag LOCUS_12870 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763638.1:TrpB-like pyridoxal phosphate-dependent enzyme 636 1688 gene locus_tag LOCUS_12880 gene trpD 636 1688 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880074.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence283 639 1 gene locus_tag LOCUS_12890 639 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 1096 611 gene locus_tag LOCUS_12900 gene pyrI 1096 611 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240282.1 protein_id gnl|my_center|LOCUS_12900 <2038 1093 gene locus_tag LOCUS_12910 <2038 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762814.1:aspartate carbamoyltransferase >Feature sequence284 1198 35 gene locus_tag LOCUS_12920 gene priS 1198 35 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762192.1 protein_id gnl|my_center|LOCUS_12920 1948 1202 gene locus_tag LOCUS_12930 1948 1202 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868494.1 protein_id gnl|my_center|LOCUS_12930 >Feature sequence285 1191 1766 gene locus_tag LOCUS_12940 1191 1766 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870916.1 protein_id gnl|my_center|LOCUS_12940 >Feature sequence286 >Feature sequence287 77 487 gene locus_tag LOCUS_12950 77 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979242.1 protein_id gnl|my_center|LOCUS_12950 613 984 gene locus_tag LOCUS_12960 613 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 959 1528 gene locus_tag LOCUS_12970 959 1528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 <2019 1462 gene locus_tag LOCUS_12980 <2019 1462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878985.1:nicotinamide-nucleotide adenylyltransferase >Feature sequence288 825 283 gene locus_tag LOCUS_12990 825 283 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918615.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence289 <1 510 gene locus_tag LOCUS_13000 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846422.1:FHA domain-containing protein 601 1779 gene locus_tag LOCUS_13010 601 1779 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846423.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence290 87 728 gene locus_tag LOCUS_13020 87 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 >Feature sequence291 1148 336 gene locus_tag LOCUS_13030 1148 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 1730 1464 gene locus_tag LOCUS_13040 1730 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13040 >Feature sequence292 <1 1397 gene locus_tag LOCUS_13050 <1 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005575582.1:alkaline phosphatase family protein >Feature sequence293 380 1210 gene locus_tag LOCUS_13060 gene modA 380 1210 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249668.1 protein_id gnl|my_center|LOCUS_13060 1216 1659 gene locus_tag LOCUS_13070 1216 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence294 232 1203 gene locus_tag LOCUS_13080 232 1203 CDS product isoaspartyl peptidase/L-asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762659.1 protein_id gnl|my_center|LOCUS_13080 1276 1605 gene locus_tag LOCUS_13090 gene rpl12p 1276 1605 CDS product 50S ribosomal protein P1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846954.1 protein_id gnl|my_center|LOCUS_13090 >Feature sequence295 491 1141 gene locus_tag LOCUS_13100 491 1141 CDS product cytochrome c biogenesis CcdA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868125.1 protein_id gnl|my_center|LOCUS_13100 1611 1138 gene locus_tag LOCUS_13110 1611 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence296 470 1027 gene locus_tag LOCUS_13120 470 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1034 1201 gene locus_tag LOCUS_13130 1034 1201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 1201 1371 gene locus_tag LOCUS_13140 1201 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence297 496 1164 gene locus_tag LOCUS_13150 496 1164 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979483.1 protein_id gnl|my_center|LOCUS_13150 1863 1210 gene locus_tag LOCUS_13160 1863 1210 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763128.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence298 10 798 gene locus_tag LOCUS_13170 gene speE 10 798 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763050.1 protein_id gnl|my_center|LOCUS_13170 1256 834 gene locus_tag LOCUS_13180 1256 834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 <1976 1371 gene locus_tag LOCUS_13190 <1976 1371 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061081.1:lysine--tRNA ligase >Feature sequence299 1041 1793 gene locus_tag LOCUS_13200 gene pcn 1041 1793 CDS product proliferating cell nuclear antigen (pcna) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762193.1 protein_id gnl|my_center|LOCUS_13200 >Feature sequence300 116 973 gene locus_tag LOCUS_13210 gene pstA 116 973 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250818.1 protein_id gnl|my_center|LOCUS_13210 973 1761 gene locus_tag LOCUS_13220 973 1761 CDS product phosphate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146811.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence301 1433 198 gene locus_tag LOCUS_13230 1433 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 >Feature sequence302 1108 77 gene locus_tag LOCUS_13240 1108 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1675 1292 gene locus_tag LOCUS_13250 1675 1292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167827657.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence303 1 468 gene locus_tag LOCUS_13260 1 468 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846952.1 protein_id gnl|my_center|LOCUS_13260 1277 465 gene locus_tag LOCUS_13270 1277 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 >Feature sequence304 683 117 gene locus_tag LOCUS_13280 683 117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 1134 961 gene locus_tag LOCUS_13290 1134 961 CDS product ribbon-helix-helix protein, CopG family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978515.1 protein_id gnl|my_center|LOCUS_13290 1327 1698 gene locus_tag LOCUS_13300 1327 1698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846359.1 protein_id gnl|my_center|LOCUS_13300 >Feature sequence305 714 445 gene locus_tag LOCUS_13310 714 445 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761867.1 protein_id gnl|my_center|LOCUS_13310 1471 707 gene locus_tag LOCUS_13320 1471 707 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761865.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence306 871 446 gene locus_tag LOCUS_13330 871 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence307 >Feature sequence308 22 1146 gene locus_tag LOCUS_13340 22 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 >Feature sequence309 <1 1747 gene locus_tag LOCUS_13350 <1 1747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846723.1:DNA double-strand break repair ATPase Rad50 >Feature sequence310 <1928 523 gene locus_tag LOCUS_13360 <1928 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761966.1:carbamoyltransferase HypF >Feature sequence311 1590 280 gene locus_tag LOCUS_13370 1590 280 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583978.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence312 <1 759 gene locus_tag LOCUS_13380 <1 759 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_156007467.1:metallophosphoesterase >Feature sequence313 715 296 gene locus_tag LOCUS_13390 715 296 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868416.1 protein_id gnl|my_center|LOCUS_13390 981 712 gene locus_tag LOCUS_13400 981 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 <1910 1058 gene locus_tag LOCUS_13410 <1910 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256051.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence314 528 58 gene locus_tag LOCUS_13420 528 58 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1087 680 gene locus_tag LOCUS_13430 1087 680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence315 317 670 gene locus_tag LOCUS_13440 317 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 <1905 953 gene locus_tag LOCUS_13450 <1905 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582434.1:alkaline phosphatase family protein >Feature sequence316 97 873 gene locus_tag LOCUS_13460 97 873 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240509.1 protein_id gnl|my_center|LOCUS_13460 <1893 870 gene locus_tag LOCUS_13470 <1893 870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762511.1:PFL family protein >Feature sequence317 1079 366 gene locus_tag LOCUS_13480 1079 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence318 <1 547 gene locus_tag LOCUS_13490 <1 547 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010979569.1:B3/4 domain-containing protein 551 1381 gene locus_tag LOCUS_13500 551 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 >Feature sequence319 254 33 gene locus_tag LOCUS_13510 254 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 933 292 gene locus_tag LOCUS_13520 933 292 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762690.1 protein_id gnl|my_center|LOCUS_13520 1202 1363 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaagcaaccagagaagacttgcaac >Feature sequence320 <1 1785 gene locus_tag LOCUS_13530 <1 1785 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978230.1:translation initiation factor IF-2 >Feature sequence321 >Feature sequence322 <1 691 gene locus_tag LOCUS_13540 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980386.1:2-oxoacid:ferredoxin oxidoreductase subunit alpha 681 1658 gene locus_tag LOCUS_13550 681 1658 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980384.1 protein_id gnl|my_center|LOCUS_13550 >Feature sequence323 698 87 gene locus_tag LOCUS_13560 698 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 >Feature sequence324 1047 151 gene locus_tag LOCUS_13570 gene cas6 1047 151 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980738.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence325 1187 573 gene locus_tag LOCUS_13580 1187 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 >Feature sequence326 <1 625 gene locus_tag LOCUS_13590 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198429777.1:Lrp/AsnC family transcriptional regulator >Feature sequence327 138 953 gene locus_tag LOCUS_13600 138 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 >Feature sequence328 762 166 gene locus_tag LOCUS_13610 762 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1124 813 gene locus_tag LOCUS_13620 1124 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 >Feature sequence329 893 375 gene locus_tag LOCUS_13630 893 375 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762515.1 protein_id gnl|my_center|LOCUS_13630 <1753 917 gene locus_tag LOCUS_13640 <1753 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011763536.1:glutamate synthase >Feature sequence330 183 953 gene locus_tag LOCUS_13650 gene trpA 183 953 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763634.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence331 523 1068 gene locus_tag LOCUS_13660 523 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence332 >Feature sequence333 1595 129 gene locus_tag LOCUS_13670 gene cysS 1595 129 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052847028.1 protein_id gnl|my_center|LOCUS_13670 >Feature sequence334 <1695 552 gene locus_tag LOCUS_13680 <1695 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249218.1:3-phosphoshikimate 1-carboxyvinyltransferase >Feature sequence335 <1 579 gene locus_tag LOCUS_13690 <1 579 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061290.1:methyltransferase 576 1292 gene locus_tag LOCUS_13700 gene trmJ 576 1292 CDS product tRNA (cytidine-2'-O-)-methyltransferase TrmJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978427.1 protein_id gnl|my_center|LOCUS_13700 >Feature sequence336 763 422 gene locus_tag LOCUS_13710 763 422 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 1520 744 gene locus_tag LOCUS_13720 1520 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13720 >Feature sequence337 1156 2 gene locus_tag LOCUS_13730 1156 2 CDS product aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012027527.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence338 >Feature sequence339 189 1256 gene locus_tag LOCUS_13740 189 1256 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023750.1 protein_id gnl|my_center|LOCUS_13740 1266 1275 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1321 1494 gene locus_tag LOCUS_13750 1321 1494 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978144.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence340 1241 48 gene locus_tag LOCUS_13760 1241 48 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846423.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence341 <1 533 gene locus_tag LOCUS_13770 <1 533 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_053240270.1:NAD-dependent protein deacetylase <1640 498 gene locus_tag LOCUS_13780 <1640 498 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074137.1:coproporphyrinogen III oxidase family protein >Feature sequence342 212 290 gene locus_tag LOCUS_t00240 212 290 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 455 1045 gene locus_tag LOCUS_13790 455 1045 CDS product PaREP1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763245.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence343 <1628 741 gene locus_tag LOCUS_13800 <1628 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980186.1:DNA double-strand break repair protein Mre11 >Feature sequence344 >Feature sequence345 618 448 gene locus_tag LOCUS_13810 618 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 1033 653 gene locus_tag LOCUS_13820 1033 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1301 1020 gene locus_tag LOCUS_13830 1301 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13830 >Feature sequence346 224 1279 gene locus_tag LOCUS_13840 224 1279 CDS product isocitrate/isopropylmalate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454234.1 protein_id gnl|my_center|LOCUS_13840 >Feature sequence347 271 822 gene locus_tag LOCUS_13850 271 822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 >Feature sequence348 <1 976 gene locus_tag LOCUS_13860 <1 976 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011761797.1:SufD family Fe-S cluster assembly protein 1108 1019 gene locus_tag LOCUS_t00250 1108 1019 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence349 >Feature sequence350 78 647 gene locus_tag LOCUS_13870 78 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 644 1150 gene locus_tag LOCUS_13880 644 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13880 >Feature sequence351 932 249 gene locus_tag LOCUS_13890 932 249 CDS product orotidine 5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979531.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence352 1315 236 gene locus_tag LOCUS_13900 1315 236 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978466.1 protein_id gnl|my_center|LOCUS_13900 >Feature sequence353 >Feature sequence354 >Feature sequence355 >Feature sequence356 198 1277 gene locus_tag LOCUS_13910 198 1277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 >Feature sequence357 <1 599 gene locus_tag LOCUS_13920 <1 599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978430.1:DUF655 domain-containing protein 559 1368 gene locus_tag LOCUS_13930 gene rsmA 559 1368 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870542.1 protein_id gnl|my_center|LOCUS_13930