>Feature sequence001 565 11 gene locus_tag LOCUS_00010 565 11 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000388051.1 protein_id gnl|my_center|LOCUS_00010 1405 575 gene locus_tag LOCUS_00020 1405 575 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_00020 2532 1405 gene locus_tag LOCUS_00030 2532 1405 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_00030 2859 2542 gene locus_tag LOCUS_00040 2859 2542 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851088.1 protein_id gnl|my_center|LOCUS_00040 3753 2881 gene locus_tag LOCUS_00050 gene sucD 3753 2881 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002872006.1 protein_id gnl|my_center|LOCUS_00050 4925 3750 gene locus_tag LOCUS_00060 gene sucC 4925 3750 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858590.1 protein_id gnl|my_center|LOCUS_00060 5496 4936 gene locus_tag LOCUS_00070 5496 4936 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158303423.1 protein_id gnl|my_center|LOCUS_00070 6357 5506 gene locus_tag LOCUS_00080 6357 5506 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940522.1 protein_id gnl|my_center|LOCUS_00080 7345 6395 gene locus_tag LOCUS_00090 gene mdh 7345 6395 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933173.1 protein_id gnl|my_center|LOCUS_00090 9625 7421 gene locus_tag LOCUS_00100 9625 7421 CDS product NADP-dependent isocitrate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942111.1 protein_id gnl|my_center|LOCUS_00100 10727 9786 gene locus_tag LOCUS_00110 gene mltG 10727 9786 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859067.1 protein_id gnl|my_center|LOCUS_00110 10672 13182 gene locus_tag LOCUS_00120 10672 13182 CDS product DUF3971 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858480.1 protein_id gnl|my_center|LOCUS_00120 14245 13166 gene locus_tag LOCUS_00130 14245 13166 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 protein_id gnl|my_center|LOCUS_00130 17008 14372 gene locus_tag LOCUS_00140 gene secA 17008 14372 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858134.1 protein_id gnl|my_center|LOCUS_00140 17563 17090 gene locus_tag LOCUS_00150 17563 17090 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257301.1 protein_id gnl|my_center|LOCUS_00150 17648 18157 gene locus_tag LOCUS_00160 gene lolA 17648 18157 CDS product LolA-like outer membrane lipoprotein chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853302.1 protein_id gnl|my_center|LOCUS_00160 18201 19436 gene locus_tag LOCUS_00170 18201 19436 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000712480.1 protein_id gnl|my_center|LOCUS_00170 19828 19424 gene locus_tag LOCUS_00180 19828 19424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00180 20844 19996 gene locus_tag LOCUS_00190 20844 19996 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_00190 21565 20876 gene locus_tag LOCUS_00200 gene modB 21565 20876 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_00200 21960 21565 gene locus_tag LOCUS_00210 21960 21565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 22694 21957 gene locus_tag LOCUS_00220 gene modA 22694 21957 CDS product molybdate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000798928.1 protein_id gnl|my_center|LOCUS_00220 23481 22726 gene locus_tag LOCUS_00230 23481 22726 CDS product TOBE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943595.1 protein_id gnl|my_center|LOCUS_00230 23677 24141 gene locus_tag LOCUS_00240 23677 24141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 25473 24193 gene locus_tag LOCUS_00250 gene pif1 25473 24193 CDS product ATP-dependent DNA helicase Pif1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853306.1 protein_id gnl|my_center|LOCUS_00250 28116 25540 gene locus_tag LOCUS_00260 gene acnB 28116 25540 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932230.1 protein_id gnl|my_center|LOCUS_00260 30038 28209 gene locus_tag LOCUS_00270 30038 28209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 32269 30335 gene locus_tag LOCUS_00280 gene flgL 32269 30335 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852538.1 protein_id gnl|my_center|LOCUS_00280 32475 32753 gene locus_tag LOCUS_00290 32475 32753 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859562.1 protein_id gnl|my_center|LOCUS_00290 32839 32925 gene locus_tag LOCUS_t00010 32839 32925 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 34070 32916 gene locus_tag LOCUS_00300 34070 32916 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545276.1 protein_id gnl|my_center|LOCUS_00300 35590 34067 gene locus_tag LOCUS_00310 gene emrB 35590 34067 CDS product multidrug efflux MFS transporter permease subunit EmrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816951.1 protein_id gnl|my_center|LOCUS_00310 36732 35587 gene locus_tag LOCUS_00320 36732 35587 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112616.1 protein_id gnl|my_center|LOCUS_00320 36851 37300 gene locus_tag LOCUS_00330 36851 37300 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011793158.1 protein_id gnl|my_center|LOCUS_00330 37285 37686 gene locus_tag LOCUS_00340 gene paaI 37285 37686 CDS product hydroxyphenylacetyl-CoA thioesterase PaaI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081423284.1 protein_id gnl|my_center|LOCUS_00340 <39673 37788 gene locus_tag LOCUS_00350 <39673 37788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937372.1:efflux RND transporter permease subunit >Feature sequence002 <1 531 gene locus_tag LOCUS_00360 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858561.1:OmpA family protein 524 688 gene locus_tag LOCUS_00370 524 688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 1009 1374 gene locus_tag LOCUS_00380 gene panD 1009 1374 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142250.1 protein_id gnl|my_center|LOCUS_00380 1367 1678 gene locus_tag LOCUS_00390 1367 1678 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851172.1 protein_id gnl|my_center|LOCUS_00390 1668 2705 gene locus_tag LOCUS_00400 1668 2705 CDS product PDZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000468475.1 protein_id gnl|my_center|LOCUS_00400 2707 3567 gene locus_tag LOCUS_00410 2707 3567 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 protein_id gnl|my_center|LOCUS_00410 3569 5548 gene locus_tag LOCUS_00420 gene tkt 3569 5548 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_00420 5560 6672 gene locus_tag LOCUS_00430 5560 6672 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000924085.1 protein_id gnl|my_center|LOCUS_00430 6662 7516 gene locus_tag LOCUS_00440 6662 7516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 7509 8771 gene locus_tag LOCUS_00450 7509 8771 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 protein_id gnl|my_center|LOCUS_00450 8904 9323 gene locus_tag LOCUS_00460 8904 9323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 9833 9932 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10079 10354 gene locus_tag LOCUS_00470 10079 10354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 10464 11015 gene locus_tag LOCUS_00480 10464 11015 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851269.1 protein_id gnl|my_center|LOCUS_00480 11030 12163 gene locus_tag LOCUS_00490 gene carA 11030 12163 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851156.1 protein_id gnl|my_center|LOCUS_00490 12224 12943 gene locus_tag LOCUS_00500 12224 12943 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851528.1 protein_id gnl|my_center|LOCUS_00500 12946 14175 gene locus_tag LOCUS_00510 12946 14175 CDS product PAS domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851243.1 protein_id gnl|my_center|LOCUS_00510 14185 14889 gene locus_tag LOCUS_00520 14185 14889 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_00520 15005 16471 gene locus_tag LOCUS_00530 gene ccoN 15005 16471 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851405.1 protein_id gnl|my_center|LOCUS_00530 16484 17149 gene locus_tag LOCUS_00540 gene ccoO 16484 17149 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851187.1 protein_id gnl|my_center|LOCUS_00540 17162 17389 gene locus_tag LOCUS_00550 17162 17389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 17386 18240 gene locus_tag LOCUS_00560 17386 18240 CDS product cbb3-type cytochrome c oxidase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851306.1 protein_id gnl|my_center|LOCUS_00560 18250 18465 gene locus_tag LOCUS_00570 18250 18465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 18580 19191 gene locus_tag LOCUS_00580 18580 19191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851454.1 protein_id gnl|my_center|LOCUS_00580 19211 19711 gene locus_tag LOCUS_00590 19211 19711 CDS product FixH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851150.1 protein_id gnl|my_center|LOCUS_00590 20804 19731 gene locus_tag LOCUS_00600 20804 19731 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611585.1 protein_id gnl|my_center|LOCUS_00600 21730 21089 gene locus_tag LOCUS_00610 21730 21089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 22080 22397 gene locus_tag LOCUS_00620 gene rpsJ 22080 22397 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_00620 22402 22980 gene locus_tag LOCUS_00630 gene rplC 22402 22980 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_00630 22977 23591 gene locus_tag LOCUS_00640 gene rplD 22977 23591 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 protein_id gnl|my_center|LOCUS_00640 23591 23875 gene locus_tag LOCUS_00650 23591 23875 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851441.1 protein_id gnl|my_center|LOCUS_00650 23877 24707 gene locus_tag LOCUS_00660 gene rplB 23877 24707 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 protein_id gnl|my_center|LOCUS_00660 24708 24989 gene locus_tag LOCUS_00670 gene rpsS 24708 24989 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851509.1 protein_id gnl|my_center|LOCUS_00670 25000 25332 gene locus_tag LOCUS_00680 gene rplV 25000 25332 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851214.1 protein_id gnl|my_center|LOCUS_00680 25334 26029 gene locus_tag LOCUS_00690 gene rpsC 25334 26029 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851138.1 protein_id gnl|my_center|LOCUS_00690 26032 26457 gene locus_tag LOCUS_00700 gene rplP 26032 26457 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779441.1 protein_id gnl|my_center|LOCUS_00700 26444 26638 gene locus_tag LOCUS_00710 gene rpmC 26444 26638 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851566.1 protein_id gnl|my_center|LOCUS_00710 26652 26951 gene locus_tag LOCUS_00720 gene rpsQ 26652 26951 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851549.1 protein_id gnl|my_center|LOCUS_00720 26948 27316 gene locus_tag LOCUS_00730 gene rplN 26948 27316 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779438.1 protein_id gnl|my_center|LOCUS_00730 27316 27549 gene locus_tag LOCUS_00740 27316 27549 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000834232.1 protein_id gnl|my_center|LOCUS_00740 27553 28101 gene locus_tag LOCUS_00750 gene rplE 27553 28101 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851453.1 protein_id gnl|my_center|LOCUS_00750 28101 28286 gene locus_tag LOCUS_00760 28101 28286 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851478.1 protein_id gnl|my_center|LOCUS_00760 28296 28691 gene locus_tag LOCUS_00770 gene rpsH 28296 28691 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851353.1 protein_id gnl|my_center|LOCUS_00770 28755 29288 gene locus_tag LOCUS_00780 gene rplF 28755 29288 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851302.1 protein_id gnl|my_center|LOCUS_00780 29303 29659 gene locus_tag LOCUS_00790 gene rplR 29303 29659 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000991853.1 protein_id gnl|my_center|LOCUS_00790 29673 30113 gene locus_tag LOCUS_00800 gene rpsE 29673 30113 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779428.1 protein_id gnl|my_center|LOCUS_00800 30128 30526 gene locus_tag LOCUS_00810 gene rplO 30128 30526 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851292.1 protein_id gnl|my_center|LOCUS_00810 30590 31852 gene locus_tag LOCUS_00820 gene secY 30590 31852 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864789.1 protein_id gnl|my_center|LOCUS_00820 31852 32625 gene locus_tag LOCUS_00830 gene map 31852 32625 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858416.1 protein_id gnl|my_center|LOCUS_00830 32685 32903 gene locus_tag LOCUS_00840 gene infA 32685 32903 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781436.1 protein_id gnl|my_center|LOCUS_00840 33175 33543 gene locus_tag LOCUS_00850 gene rpsM 33175 33543 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 protein_id gnl|my_center|LOCUS_00850 33558 33950 gene locus_tag LOCUS_00860 gene rpsK 33558 33950 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779544.1 protein_id gnl|my_center|LOCUS_00860 34030 34656 gene locus_tag LOCUS_00870 gene rpsD 34030 34656 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 protein_id gnl|my_center|LOCUS_00870 >Feature sequence003 1499 699 gene locus_tag LOCUS_00880 1499 699 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481653.1 protein_id gnl|my_center|LOCUS_00880 3310 1577 gene locus_tag LOCUS_00890 3310 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 3989 3300 gene locus_tag LOCUS_00900 3989 3300 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_00900 4421 4083 gene locus_tag LOCUS_00910 gene glnB 4421 4083 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308848.1 protein_id gnl|my_center|LOCUS_00910 5608 4499 gene locus_tag LOCUS_00920 5608 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 7113 5761 gene locus_tag LOCUS_00930 7113 5761 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854402.1 protein_id gnl|my_center|LOCUS_00930 7359 8774 gene locus_tag LOCUS_00940 7359 8774 CDS product COG3014 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851858.1 protein_id gnl|my_center|LOCUS_00940 8758 9189 gene locus_tag LOCUS_00950 8758 9189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 9167 9796 gene locus_tag LOCUS_00960 gene lpoB 9167 9796 CDS product penicillin-binding protein activator LpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851945.1 protein_id gnl|my_center|LOCUS_00960 9806 11167 gene locus_tag LOCUS_00970 9806 11167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 11177 12439 gene locus_tag LOCUS_00980 11177 12439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00980 12609 14114 gene locus_tag LOCUS_00990 12609 14114 CDS product 2Fe-2S iron-sulfur cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238899.1 protein_id gnl|my_center|LOCUS_00990 14111 15394 gene locus_tag LOCUS_01000 gene nuoH 14111 15394 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964314.1 protein_id gnl|my_center|LOCUS_01000 15391 15903 gene locus_tag LOCUS_01010 gene nuoI 15391 15903 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_01010 15896 16393 gene locus_tag LOCUS_01020 15896 16393 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_01020 16393 16710 gene locus_tag LOCUS_01030 gene nuoK 16393 16710 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_01030 16707 18593 gene locus_tag LOCUS_01040 gene nuoL 16707 18593 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964310.1 protein_id gnl|my_center|LOCUS_01040 18597 20072 gene locus_tag LOCUS_01050 18597 20072 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941018.1 protein_id gnl|my_center|LOCUS_01050 20074 21579 gene locus_tag LOCUS_01060 20074 21579 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_01060 21675 23693 gene locus_tag LOCUS_01070 21675 23693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 24854 23706 gene locus_tag LOCUS_01080 24854 23706 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037106.1 protein_id gnl|my_center|LOCUS_01080 26334 25006 gene locus_tag LOCUS_01090 26334 25006 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_01090 26403 26996 gene locus_tag LOCUS_01100 gene rdgB 26403 26996 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_01100 27032 28231 gene locus_tag LOCUS_01110 27032 28231 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852026.1 protein_id gnl|my_center|LOCUS_01110 28231 28389 gene locus_tag LOCUS_01120 28231 28389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 28386 28739 gene locus_tag LOCUS_01130 28386 28739 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289449.1 protein_id gnl|my_center|LOCUS_01130 28726 29559 gene locus_tag LOCUS_01140 28726 29559 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_01140 29561 30709 gene locus_tag LOCUS_01150 gene nspC 29561 30709 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858431.1 protein_id gnl|my_center|LOCUS_01150 30757 32070 gene locus_tag LOCUS_01160 gene trkA 30757 32070 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459869.1 protein_id gnl|my_center|LOCUS_01160 32052 33506 gene locus_tag LOCUS_01170 32052 33506 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012843245.1 protein_id gnl|my_center|LOCUS_01170 34381 33515 gene locus_tag LOCUS_01180 34381 33515 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262323.1 protein_id gnl|my_center|LOCUS_01180 >Feature sequence004 743 282 gene locus_tag LOCUS_01190 743 282 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583314.1 protein_id gnl|my_center|LOCUS_01190 1340 747 gene locus_tag LOCUS_01200 gene yihA 1340 747 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852258.1 protein_id gnl|my_center|LOCUS_01200 1807 1337 gene locus_tag LOCUS_01210 1807 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 2283 1807 gene locus_tag LOCUS_01220 2283 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 2813 2316 gene locus_tag LOCUS_01230 2813 2316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 3382 2810 gene locus_tag LOCUS_01240 gene hisB 3382 2810 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921561.1 protein_id gnl|my_center|LOCUS_01240 4161 3385 gene locus_tag LOCUS_01250 4161 3385 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852227.1 protein_id gnl|my_center|LOCUS_01250 5353 4145 gene locus_tag LOCUS_01260 5353 4145 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852087.1 protein_id gnl|my_center|LOCUS_01260 6169 5390 gene locus_tag LOCUS_01270 6169 5390 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858473.1 protein_id gnl|my_center|LOCUS_01270 7703 6159 gene locus_tag LOCUS_01280 7703 6159 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871805.1 protein_id gnl|my_center|LOCUS_01280 8575 7700 gene locus_tag LOCUS_01290 8575 7700 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 protein_id gnl|my_center|LOCUS_01290 8639 9178 gene locus_tag LOCUS_01300 gene cetC 8639 9178 CDS product energy taxis response protein CetC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855880.1 protein_id gnl|my_center|LOCUS_01300 9242 11002 gene locus_tag LOCUS_01310 gene aspS 9242 11002 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871806.1 protein_id gnl|my_center|LOCUS_01310 11049 11627 gene locus_tag LOCUS_01320 11049 11627 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 protein_id gnl|my_center|LOCUS_01320 11641 12384 gene locus_tag LOCUS_01330 11641 12384 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_01330 14698 12431 gene locus_tag LOCUS_01340 gene metE 14698 12431 CDS product 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926372.1 protein_id gnl|my_center|LOCUS_01340 16238 15144 gene locus_tag LOCUS_01350 gene truD 16238 15144 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851259.1 protein_id gnl|my_center|LOCUS_01350 16488 18236 gene locus_tag LOCUS_01360 16488 18236 CDS product aldehyde ferredoxin oxidoreductase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546166.1 protein_id gnl|my_center|LOCUS_01360 18226 18468 gene locus_tag LOCUS_01370 18226 18468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 19297 18479 gene locus_tag LOCUS_01380 19297 18479 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130232873.1 protein_id gnl|my_center|LOCUS_01380 19478 21199 gene locus_tag LOCUS_01390 gene sdhA 19478 21199 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930843.1 protein_id gnl|my_center|LOCUS_01390 21307 22284 gene locus_tag LOCUS_01400 21307 22284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 22294 23172 gene locus_tag LOCUS_01410 22294 23172 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933695.1 protein_id gnl|my_center|LOCUS_01410 23267 23659 gene locus_tag LOCUS_01420 23267 23659 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870246.1 protein_id gnl|my_center|LOCUS_01420 23841 24509 gene locus_tag LOCUS_01430 23841 24509 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228142.1 protein_id gnl|my_center|LOCUS_01430 24684 25889 gene locus_tag LOCUS_01440 24684 25889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853393.1 protein_id gnl|my_center|LOCUS_01440 26312 26079 gene locus_tag LOCUS_01450 26312 26079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 26807 26424 gene locus_tag LOCUS_01460 26807 26424 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_01460 27836 26808 gene locus_tag LOCUS_01470 27836 26808 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852104.1 protein_id gnl|my_center|LOCUS_01470 27944 28657 gene locus_tag LOCUS_01480 27944 28657 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545318.1 protein_id gnl|my_center|LOCUS_01480 28716 29534 gene locus_tag LOCUS_01490 gene peb4 28716 29534 CDS product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence005 301 98 gene locus_tag LOCUS_01500 301 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 258 410 gene locus_tag LOCUS_01510 258 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 1569 823 gene locus_tag LOCUS_01520 1569 823 CDS product amino acid ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262110.1 protein_id gnl|my_center|LOCUS_01520 2663 1578 gene locus_tag LOCUS_01530 2663 1578 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266808.1 protein_id gnl|my_center|LOCUS_01530 3819 2665 gene locus_tag LOCUS_01540 3819 2665 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266807.1 protein_id gnl|my_center|LOCUS_01540 4909 3887 gene locus_tag LOCUS_01550 4909 3887 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284567.1 protein_id gnl|my_center|LOCUS_01550 7208 5130 gene locus_tag LOCUS_01560 gene fusA 7208 5130 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779472.1 protein_id gnl|my_center|LOCUS_01560 7690 7223 gene locus_tag LOCUS_01570 gene rpsG 7690 7223 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779471.1 protein_id gnl|my_center|LOCUS_01570 8132 7761 gene locus_tag LOCUS_01580 gene rpsL 8132 7761 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002782934.1 protein_id gnl|my_center|LOCUS_01580 13051 8534 gene locus_tag LOCUS_01590 gene rpoC 13051 8534 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858508.1 protein_id gnl|my_center|LOCUS_01590 17183 13035 gene locus_tag LOCUS_01600 gene rpoB 17183 13035 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891860.1 protein_id gnl|my_center|LOCUS_01600 17691 17323 gene locus_tag LOCUS_01610 gene rplL 17691 17323 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858569.1 protein_id gnl|my_center|LOCUS_01610 18292 17804 gene locus_tag LOCUS_01620 gene rplJ 18292 17804 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858610.1 protein_id gnl|my_center|LOCUS_01620 19108 18377 gene locus_tag LOCUS_01630 gene rplA 19108 18377 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854928.1 protein_id gnl|my_center|LOCUS_01630 19556 19131 gene locus_tag LOCUS_01640 gene rplK 19556 19131 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779452.1 protein_id gnl|my_center|LOCUS_01640 20227 19697 gene locus_tag LOCUS_01650 gene nusG 20227 19697 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851098.1 protein_id gnl|my_center|LOCUS_01650 20420 20241 gene locus_tag LOCUS_01660 gene secE 20420 20241 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854985.1 protein_id gnl|my_center|LOCUS_01660 20551 20476 gene locus_tag LOCUS_t00020 20551 20476 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 20733 20575 gene locus_tag LOCUS_01670 gene rpmG 20733 20575 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002793551.1 protein_id gnl|my_center|LOCUS_01670 21988 20789 gene locus_tag LOCUS_01680 gene tuf 21988 20789 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040579.1 protein_id gnl|my_center|LOCUS_01680 22147 22073 gene locus_tag LOCUS_t00030 22147 22073 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 22354 22278 gene locus_tag LOCUS_t00040 22354 22278 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 22449 22364 gene locus_tag LOCUS_t00050 22449 22364 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 22572 22497 gene locus_tag LOCUS_t00060 22572 22497 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 23282 23121 gene locus_tag LOCUS_01690 23282 23121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 23976 23665 gene locus_tag LOCUS_01700 23976 23665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 24245 23976 gene locus_tag LOCUS_01710 24245 23976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence006 931 728 gene locus_tag LOCUS_01720 931 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 2229 958 gene locus_tag LOCUS_01730 2229 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 2685 2290 gene locus_tag LOCUS_01740 2685 2290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 3998 2739 gene locus_tag LOCUS_01750 3998 2739 CDS product McrC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891837.1 protein_id gnl|my_center|LOCUS_01750 6403 4001 gene locus_tag LOCUS_01760 6403 4001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 6865 6629 gene locus_tag LOCUS_01770 6865 6629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 9152 6852 gene locus_tag LOCUS_01780 9152 6852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 9627 9208 gene locus_tag LOCUS_01790 9627 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 10185 9730 gene locus_tag LOCUS_01800 10185 9730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 10992 10240 gene locus_tag LOCUS_01810 10992 10240 CDS product NAD-dependent deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864286.1 protein_id gnl|my_center|LOCUS_01810 11805 11050 gene locus_tag LOCUS_01820 11805 11050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 12584 11802 gene locus_tag LOCUS_01830 gene exoX 12584 11802 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816172.1 protein_id gnl|my_center|LOCUS_01830 13494 12763 gene locus_tag LOCUS_01840 13494 12763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 14186 13491 gene locus_tag LOCUS_01850 14186 13491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 15112 14660 gene locus_tag LOCUS_01860 15112 14660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 17301 15109 gene locus_tag LOCUS_01870 17301 15109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 18142 17360 gene locus_tag LOCUS_01880 gene exoX 18142 17360 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816172.1 protein_id gnl|my_center|LOCUS_01880 18645 18343 gene locus_tag LOCUS_01890 18645 18343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 19501 18806 gene locus_tag LOCUS_01900 19501 18806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114933.1 protein_id gnl|my_center|LOCUS_01900 21748 19637 gene locus_tag LOCUS_01910 21748 19637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 >Feature sequence007 1371 589 gene locus_tag LOCUS_01920 1371 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 2802 1420 gene locus_tag LOCUS_01930 gene pglK 2802 1420 CDS product ABC-type lipopolysaccharide transporter PglK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858308.1 protein_id gnl|my_center|LOCUS_01930 4422 3127 gene locus_tag LOCUS_01940 4422 3127 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963428.1 protein_id gnl|my_center|LOCUS_01940 4850 4545 gene locus_tag LOCUS_01950 4850 4545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 5529 4927 gene locus_tag LOCUS_01960 5529 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 5598 6521 gene locus_tag LOCUS_01970 5598 6521 CDS product manganese-dependent inorganic pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073874.1 protein_id gnl|my_center|LOCUS_01970 6622 8733 gene locus_tag LOCUS_01980 6622 8733 CDS product ribonucleoside triphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111559.1 protein_id gnl|my_center|LOCUS_01980 8723 8902 gene locus_tag LOCUS_01990 8723 8902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 8895 9572 gene locus_tag LOCUS_02000 8895 9572 CDS product anaerobic ribonucleoside-triphosphate reductase activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392958.1 protein_id gnl|my_center|LOCUS_02000 9908 9582 gene locus_tag LOCUS_02010 9908 9582 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919725.1 protein_id gnl|my_center|LOCUS_02010 10327 9905 gene locus_tag LOCUS_02020 10327 9905 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_02020 11482 10337 gene locus_tag LOCUS_02030 11482 10337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 12228 11482 gene locus_tag LOCUS_02040 gene sufC 12228 11482 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096955.1 protein_id gnl|my_center|LOCUS_02040 13655 12225 gene locus_tag LOCUS_02050 gene sufB 13655 12225 CDS product Fe-S cluster assembly protein SufB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772922.1 protein_id gnl|my_center|LOCUS_02050 14056 13733 gene locus_tag LOCUS_02060 14056 13733 CDS product branched-chain amino acid transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005658306.1 protein_id gnl|my_center|LOCUS_02060 14732 14049 gene locus_tag LOCUS_02070 14732 14049 CDS product AzlC family ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065707.1 protein_id gnl|my_center|LOCUS_02070 15017 15286 gene locus_tag LOCUS_02080 15017 15286 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081975.1 protein_id gnl|my_center|LOCUS_02080 15533 15632 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15736 17391 gene locus_tag LOCUS_02090 15736 17391 CDS product electron transfer flavoprotein-ubiquinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947007.1 protein_id gnl|my_center|LOCUS_02090 17402 19330 gene locus_tag LOCUS_02100 17402 19330 CDS product FAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979843.1 protein_id gnl|my_center|LOCUS_02100 19871 19383 gene locus_tag LOCUS_02110 gene ruvC 19871 19383 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 protein_id gnl|my_center|LOCUS_02110 20131 21441 gene locus_tag LOCUS_02120 gene dnaA 20131 21441 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 protein_id gnl|my_center|LOCUS_02120 >Feature sequence008 3455 1512 gene locus_tag LOCUS_02130 3455 1512 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545008.1 protein_id gnl|my_center|LOCUS_02130 6049 3527 gene locus_tag LOCUS_02140 6049 3527 CDS product mannose-1-phosphate guanyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880431.1 protein_id gnl|my_center|LOCUS_02140 6354 6073 gene locus_tag LOCUS_02150 6354 6073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 8004 6367 gene locus_tag LOCUS_02160 gene glgP 8004 6367 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871155.1 protein_id gnl|my_center|LOCUS_02160 9264 8005 gene locus_tag LOCUS_02170 9264 8005 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855462.1 protein_id gnl|my_center|LOCUS_02170 10903 9266 gene locus_tag LOCUS_02180 gene pgm 10903 9266 CDS product phosphoglucomutase (alpha-D-glucose-1,6-bisphosphate-dependent) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967369.1 protein_id gnl|my_center|LOCUS_02180 11149 10913 gene locus_tag LOCUS_02190 11149 10913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 11843 11139 gene locus_tag LOCUS_02200 gene gpmA 11843 11139 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670958.1 protein_id gnl|my_center|LOCUS_02200 12856 11846 gene locus_tag LOCUS_02210 gene gap 12856 11846 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948756.1 protein_id gnl|my_center|LOCUS_02210 15019 12860 gene locus_tag LOCUS_02220 gene glgP 15019 12860 CDS product alpha-glucan family phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880430.1 protein_id gnl|my_center|LOCUS_02220 16262 14988 gene locus_tag LOCUS_02230 gene eno 16262 14988 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869074.1 protein_id gnl|my_center|LOCUS_02230 17248 16340 gene locus_tag LOCUS_02240 17248 16340 CDS product aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065835.1 protein_id gnl|my_center|LOCUS_02240 <19729 17387 gene locus_tag LOCUS_02250 <19729 17387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022627.1:phosphoenolpyruvate synthase >Feature sequence009 487 1023 gene locus_tag LOCUS_02260 487 1023 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902631.1 protein_id gnl|my_center|LOCUS_02260 2250 1009 gene locus_tag LOCUS_02270 2250 1009 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_02270 3571 2237 gene locus_tag LOCUS_02280 gene hemG 3571 2237 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_02280 4815 3625 gene locus_tag LOCUS_02290 4815 3625 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851835.1 protein_id gnl|my_center|LOCUS_02290 5621 4815 gene locus_tag LOCUS_02300 5621 4815 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853086.1 protein_id gnl|my_center|LOCUS_02300 6667 5666 gene locus_tag LOCUS_02310 6667 5666 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106543.1 protein_id gnl|my_center|LOCUS_02310 7636 6674 gene locus_tag LOCUS_02320 7636 6674 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001121932.1 protein_id gnl|my_center|LOCUS_02320 9547 7661 gene locus_tag LOCUS_02330 9547 7661 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864793.1 protein_id gnl|my_center|LOCUS_02330 10343 9489 gene locus_tag LOCUS_02340 gene rsmA 10343 9489 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_02340 10444 10881 gene locus_tag LOCUS_02350 10444 10881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 11056 11733 gene locus_tag LOCUS_02360 11056 11733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 12982 11738 gene locus_tag LOCUS_02370 gene nuoF 12982 11738 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000829484.1 protein_id gnl|my_center|LOCUS_02370 13458 12982 gene locus_tag LOCUS_02380 gene nuoE 13458 12982 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_02380 15125 13455 gene locus_tag LOCUS_02390 15125 13455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 15633 15109 gene locus_tag LOCUS_02400 15633 15109 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964321.1 protein_id gnl|my_center|LOCUS_02400 15986 15624 gene locus_tag LOCUS_02410 gene nuoA 15986 15624 CDS product NADH-quinone oxidoreductase subunit NuoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000179272.1 protein_id gnl|my_center|LOCUS_02410 17540 16062 gene locus_tag LOCUS_02420 17540 16062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 >Feature sequence010 2284 1556 gene locus_tag LOCUS_02430 2284 1556 CDS product fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282439.1 protein_id gnl|my_center|LOCUS_02430 4277 2277 gene locus_tag LOCUS_02440 4277 2277 CDS product fumarate reductase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854193.1 protein_id gnl|my_center|LOCUS_02440 5070 4279 gene locus_tag LOCUS_02450 5070 4279 CDS product fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854660.1 protein_id gnl|my_center|LOCUS_02450 6081 5266 gene locus_tag LOCUS_02460 gene lgt 6081 5266 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854600.1 protein_id gnl|my_center|LOCUS_02460 7379 6078 gene locus_tag LOCUS_02470 7379 6078 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 protein_id gnl|my_center|LOCUS_02470 8887 7517 gene locus_tag LOCUS_02480 gene hemN 8887 7517 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 protein_id gnl|my_center|LOCUS_02480 9399 8884 gene locus_tag LOCUS_02490 9399 8884 CDS product DUF2603 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853412.1 protein_id gnl|my_center|LOCUS_02490 10309 9383 gene locus_tag LOCUS_02500 gene argF 10309 9383 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858026.1 protein_id gnl|my_center|LOCUS_02500 10438 10956 gene locus_tag LOCUS_02510 10438 10956 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963244.1 protein_id gnl|my_center|LOCUS_02510 11979 11005 gene locus_tag LOCUS_02520 gene hemB 11979 11005 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 protein_id gnl|my_center|LOCUS_02520 12040 12606 gene locus_tag LOCUS_02530 gene ribA 12040 12606 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_02530 12607 13194 gene locus_tag LOCUS_02540 gene rsmG 12607 13194 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853035.1 protein_id gnl|my_center|LOCUS_02540 13187 13411 gene locus_tag LOCUS_02550 13187 13411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 13413 13793 gene locus_tag LOCUS_02560 13413 13793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853267.1 protein_id gnl|my_center|LOCUS_02560 14940 13921 gene locus_tag LOCUS_02570 14940 13921 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852617.1 protein_id gnl|my_center|LOCUS_02570 15194 14949 gene locus_tag LOCUS_02580 15194 14949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 16874 15234 gene locus_tag LOCUS_02590 16874 15234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 >Feature sequence011 114 1388 gene locus_tag LOCUS_02600 114 1388 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855132.1 protein_id gnl|my_center|LOCUS_02600 1385 2173 gene locus_tag LOCUS_02610 gene trpC 1385 2173 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854779.1 protein_id gnl|my_center|LOCUS_02610 2173 2667 gene locus_tag LOCUS_02620 2173 2667 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858543.1 protein_id gnl|my_center|LOCUS_02620 2670 2987 gene locus_tag LOCUS_02630 2670 2987 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_02630 3044 4501 gene locus_tag LOCUS_02640 gene pyk 3044 4501 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858708.1 protein_id gnl|my_center|LOCUS_02640 4498 5256 gene locus_tag LOCUS_02650 4498 5256 CDS product DnaJ family molecular chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853334.1 protein_id gnl|my_center|LOCUS_02650 6150 5251 gene locus_tag LOCUS_02660 6150 5251 CDS product aspartoacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124406.1 protein_id gnl|my_center|LOCUS_02660 6307 7560 gene locus_tag LOCUS_02670 6307 7560 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884428.1 protein_id gnl|my_center|LOCUS_02670 7547 8386 gene locus_tag LOCUS_02680 7547 8386 CDS product HemK/PrmC family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858549.1 protein_id gnl|my_center|LOCUS_02680 8447 8932 gene locus_tag LOCUS_02690 8447 8932 CDS product DUF4149 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000713359.1 protein_id gnl|my_center|LOCUS_02690 10098 8974 gene locus_tag LOCUS_02700 gene ftsZ 10098 8974 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 protein_id gnl|my_center|LOCUS_02700 11458 10109 gene locus_tag LOCUS_02710 gene ftsA 11458 10109 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_02710 12922 11459 gene locus_tag LOCUS_02720 12922 11459 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852128.1 protein_id gnl|my_center|LOCUS_02720 13002 14297 gene locus_tag LOCUS_02730 13002 14297 CDS product adenosylmethionine--8-amino-7-oxononanoate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816247.1 protein_id gnl|my_center|LOCUS_02730 14325 15524 gene locus_tag LOCUS_02740 14325 15524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 14981 15080 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 15534 16448 gene locus_tag LOCUS_02750 gene rsmH 15534 16448 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891880.1 protein_id gnl|my_center|LOCUS_02750 16441 16779 gene locus_tag LOCUS_02760 16441 16779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 >Feature sequence012 2455 1562 gene locus_tag LOCUS_02770 2455 1562 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245639.1 protein_id gnl|my_center|LOCUS_02770 3113 2460 gene locus_tag LOCUS_02780 3113 2460 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851887.1 protein_id gnl|my_center|LOCUS_02780 3232 4023 gene locus_tag LOCUS_02790 3232 4023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 4010 5773 gene locus_tag LOCUS_02800 4010 5773 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877176.1 protein_id gnl|my_center|LOCUS_02800 5782 6576 gene locus_tag LOCUS_02810 5782 6576 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_02810 7936 6728 gene locus_tag LOCUS_02820 7936 6728 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545925.1 protein_id gnl|my_center|LOCUS_02820 8589 7930 gene locus_tag LOCUS_02830 8589 7930 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546252.1 protein_id gnl|my_center|LOCUS_02830 9764 8586 gene locus_tag LOCUS_02840 9764 8586 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546795.1 protein_id gnl|my_center|LOCUS_02840 10761 9958 gene locus_tag LOCUS_02850 10761 9958 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940049.1 protein_id gnl|my_center|LOCUS_02850 11980 10772 gene locus_tag LOCUS_02860 11980 10772 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852200.1 protein_id gnl|my_center|LOCUS_02860 12146 12397 gene locus_tag LOCUS_02870 12146 12397 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002890722.1 protein_id gnl|my_center|LOCUS_02870 12390 13385 gene locus_tag LOCUS_02880 gene trpD 12390 13385 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869732.1 protein_id gnl|my_center|LOCUS_02880 13378 13791 gene locus_tag LOCUS_02890 gene tsaE 13378 13791 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852319.1 protein_id gnl|my_center|LOCUS_02890 13784 14506 gene locus_tag LOCUS_02900 gene lptB 13784 14506 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855252.1 protein_id gnl|my_center|LOCUS_02900 14623 15864 gene locus_tag LOCUS_02910 14623 15864 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852268.1 protein_id gnl|my_center|LOCUS_02910 16577 15861 gene locus_tag LOCUS_02920 gene kdsB 16577 15861 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852502.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence013 3109 1250 gene locus_tag LOCUS_02930 gene nuoL 3109 1250 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200192.1 protein_id gnl|my_center|LOCUS_02930 3414 3112 gene locus_tag LOCUS_02940 gene nuoK 3414 3112 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_02940 3977 3411 gene locus_tag LOCUS_02950 3977 3411 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464208.1 protein_id gnl|my_center|LOCUS_02950 4598 3987 gene locus_tag LOCUS_02960 gene nuoI 4598 3987 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851456.1 protein_id gnl|my_center|LOCUS_02960 5602 4610 gene locus_tag LOCUS_02970 gene nuoH 5602 4610 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277308.1 protein_id gnl|my_center|LOCUS_02970 8004 5599 gene locus_tag LOCUS_02980 8004 5599 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 protein_id gnl|my_center|LOCUS_02980 10253 8001 gene locus_tag LOCUS_02990 10253 8001 CDS product NADH-quinone oxidoreductase subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891945.1 protein_id gnl|my_center|LOCUS_02990 12279 10246 gene locus_tag LOCUS_03000 12279 10246 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941178.1 protein_id gnl|my_center|LOCUS_03000 12563 12330 gene locus_tag LOCUS_03010 12563 12330 CDS product NADH-ubiquinone oxidoreductase subunit E family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000819168.1 protein_id gnl|my_center|LOCUS_03010 13807 12581 gene locus_tag LOCUS_03020 gene nuoD 13807 12581 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864417.1 protein_id gnl|my_center|LOCUS_03020 14608 13811 gene locus_tag LOCUS_03030 14608 13811 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864416.1 protein_id gnl|my_center|LOCUS_03030 15117 14608 gene locus_tag LOCUS_03040 15117 14608 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851253.1 protein_id gnl|my_center|LOCUS_03040 15488 15099 gene locus_tag LOCUS_03050 15488 15099 CDS product NAD(P)H-quinone oxidoreductase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001183543.1 protein_id gnl|my_center|LOCUS_03050 16986 15694 gene locus_tag LOCUS_03060 16986 15694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 >Feature sequence014 273 776 gene locus_tag LOCUS_03070 gene luxS 273 776 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857890.1 protein_id gnl|my_center|LOCUS_03070 2644 794 gene locus_tag LOCUS_03080 gene ciaB 2644 794 CDS product invasion protein CiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858322.1 protein_id gnl|my_center|LOCUS_03080 2740 3861 gene locus_tag LOCUS_03090 2740 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 3870 4316 gene locus_tag LOCUS_03100 3870 4316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03100 4313 4609 gene locus_tag LOCUS_03110 4313 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 4606 5076 gene locus_tag LOCUS_03120 4606 5076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5736 5104 gene locus_tag LOCUS_03130 5736 5104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 6305 5694 gene locus_tag LOCUS_03140 6305 5694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 6747 6289 gene locus_tag LOCUS_03150 6747 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 6888 6987 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 7113 8210 gene locus_tag LOCUS_03160 7113 8210 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104091.1 protein_id gnl|my_center|LOCUS_03160 9675 8968 gene locus_tag LOCUS_03170 gene dut 9675 8968 CDS product dUTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851377.1 protein_id gnl|my_center|LOCUS_03170 10068 9844 gene locus_tag LOCUS_03180 10068 9844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 10972 10664 gene locus_tag LOCUS_03190 10972 10664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 11419 10985 gene locus_tag LOCUS_03200 gene trxC 11419 10985 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207653.1 protein_id gnl|my_center|LOCUS_03200 12231 11518 gene locus_tag LOCUS_03210 12231 11518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941615.1 protein_id gnl|my_center|LOCUS_03210 13377 12232 gene locus_tag LOCUS_03220 13377 12232 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941616.1 protein_id gnl|my_center|LOCUS_03220 14519 13374 gene locus_tag LOCUS_03230 14519 13374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03230 15772 14519 gene locus_tag LOCUS_03240 15772 14519 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930700.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence015 1163 105 gene locus_tag LOCUS_03250 1163 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 1766 1179 gene locus_tag LOCUS_03260 gene clpP 1766 1179 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806309.1 protein_id gnl|my_center|LOCUS_03260 3071 1767 gene locus_tag LOCUS_03270 gene tig 3071 1767 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851938.1 protein_id gnl|my_center|LOCUS_03270 3198 3767 gene locus_tag LOCUS_03280 gene folE 3198 3767 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 protein_id gnl|my_center|LOCUS_03280 3797 5116 gene locus_tag LOCUS_03290 gene fliI 3797 5116 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851735.1 protein_id gnl|my_center|LOCUS_03290 5326 6516 gene locus_tag LOCUS_03300 5326 6516 CDS product NifS family cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000941691.1 protein_id gnl|my_center|LOCUS_03300 6525 7499 gene locus_tag LOCUS_03310 6525 7499 CDS product iron-sulfur cluster assembly scaffold protein NifU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002840050.1 protein_id gnl|my_center|LOCUS_03310 7551 8246 gene locus_tag LOCUS_03320 7551 8246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 8280 8507 gene locus_tag LOCUS_03330 8280 8507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 8606 9277 gene locus_tag LOCUS_03340 gene dccR 8606 9277 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_03340 9321 11336 gene locus_tag LOCUS_03350 9321 11336 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880310.1 protein_id gnl|my_center|LOCUS_03350 11349 11771 gene locus_tag LOCUS_03360 gene exbB 11349 11771 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000661840.1 protein_id gnl|my_center|LOCUS_03360 11758 12126 gene locus_tag LOCUS_03370 11758 12126 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881197.1 protein_id gnl|my_center|LOCUS_03370 12128 12940 gene locus_tag LOCUS_03380 12128 12940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 13946 12924 gene locus_tag LOCUS_03390 gene galE 13946 12924 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071815.1 protein_id gnl|my_center|LOCUS_03390 15361 13943 gene locus_tag LOCUS_03400 15361 13943 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022302.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence016 7 1182 gene locus_tag LOCUS_03410 7 1182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 1185 1658 gene locus_tag LOCUS_03420 gene bcp 1185 1658 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000633710.1 protein_id gnl|my_center|LOCUS_03420 1780 2781 gene locus_tag LOCUS_03430 1780 2781 CDS product epoxyqueuosine reductase QueH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858664.1 protein_id gnl|my_center|LOCUS_03430 2818 3264 gene locus_tag LOCUS_03440 gene fabZ 2818 3264 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 protein_id gnl|my_center|LOCUS_03440 3266 4048 gene locus_tag LOCUS_03450 gene lpxA 3266 4048 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851756.1 protein_id gnl|my_center|LOCUS_03450 4126 5346 gene locus_tag LOCUS_03460 gene clpX 4126 5346 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_03460 5356 6390 gene locus_tag LOCUS_03470 5356 6390 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_03470 6383 7138 gene locus_tag LOCUS_03480 gene mreC 6383 7138 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864583.1 protein_id gnl|my_center|LOCUS_03480 7270 10539 gene locus_tag LOCUS_03490 gene carB 7270 10539 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858661.1 protein_id gnl|my_center|LOCUS_03490 10633 11082 gene locus_tag LOCUS_03500 10633 11082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851686.1 protein_id gnl|my_center|LOCUS_03500 11079 11531 gene locus_tag LOCUS_03510 11079 11531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 12137 11499 gene locus_tag LOCUS_03520 12137 11499 CDS product tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860322.1 protein_id gnl|my_center|LOCUS_03520 12931 12134 gene locus_tag LOCUS_03530 gene surE 12931 12134 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854555.1 protein_id gnl|my_center|LOCUS_03530 13042 14031 gene locus_tag LOCUS_03540 gene lpxB 13042 14031 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858730.1 protein_id gnl|my_center|LOCUS_03540 14070 14543 gene locus_tag LOCUS_03550 gene greA 14070 14543 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858660.1 protein_id gnl|my_center|LOCUS_03550 >Feature sequence017 <1 1302 gene locus_tag LOCUS_03560 <1 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113875.1:MBL fold metallo-hydrolase 1317 3953 gene locus_tag LOCUS_03570 1317 3953 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942986.1 protein_id gnl|my_center|LOCUS_03570 3987 4745 gene locus_tag LOCUS_03580 gene ppk2 3987 4745 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014894.1 protein_id gnl|my_center|LOCUS_03580 4872 6125 gene locus_tag LOCUS_03590 4872 6125 CDS product DUF4010 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767135.1 protein_id gnl|my_center|LOCUS_03590 6127 7047 gene locus_tag LOCUS_03600 6127 7047 CDS product LOG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188687.1 protein_id gnl|my_center|LOCUS_03600 7040 7825 gene locus_tag LOCUS_03610 7040 7825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 7822 8508 gene locus_tag LOCUS_03620 7822 8508 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107418.1 protein_id gnl|my_center|LOCUS_03620 8897 8499 gene locus_tag LOCUS_03630 8897 8499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 9306 8911 gene locus_tag LOCUS_03640 9306 8911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 10290 9328 gene locus_tag LOCUS_03650 10290 9328 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856867.1 protein_id gnl|my_center|LOCUS_03650 10420 11490 gene locus_tag LOCUS_03660 gene gcvT 10420 11490 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941043.1 protein_id gnl|my_center|LOCUS_03660 11503 11871 gene locus_tag LOCUS_03670 gene gcvH 11503 11871 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865076.1 protein_id gnl|my_center|LOCUS_03670 11892 13223 gene locus_tag LOCUS_03680 gene gcvPA 11892 13223 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941045.1 protein_id gnl|my_center|LOCUS_03680 13220 14659 gene locus_tag LOCUS_03690 gene gcvPB 13220 14659 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941046.1 protein_id gnl|my_center|LOCUS_03690 14653 15291 gene locus_tag LOCUS_03700 14653 15291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 >Feature sequence018 99 1358 gene locus_tag LOCUS_03710 99 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060384854.1 protein_id gnl|my_center|LOCUS_03710 1374 1676 gene locus_tag LOCUS_03720 1374 1676 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003565641.1 protein_id gnl|my_center|LOCUS_03720 1676 2281 gene locus_tag LOCUS_03730 1676 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552477.1 protein_id gnl|my_center|LOCUS_03730 2303 2809 gene locus_tag LOCUS_03740 2303 2809 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904001.1 protein_id gnl|my_center|LOCUS_03740 3574 3825 gene locus_tag LOCUS_03750 3574 3825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03750 4425 4604 gene locus_tag LOCUS_03760 4425 4604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 4589 4840 gene locus_tag LOCUS_03770 4589 4840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 5112 7061 gene locus_tag LOCUS_03780 5112 7061 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 protein_id gnl|my_center|LOCUS_03780 7866 7078 gene locus_tag LOCUS_03790 gene flgG 7866 7078 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000946438.1 protein_id gnl|my_center|LOCUS_03790 8682 7876 gene locus_tag LOCUS_03800 8682 7876 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858501.1 protein_id gnl|my_center|LOCUS_03800 8789 9340 gene locus_tag LOCUS_03810 8789 9340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 9518 10354 gene locus_tag LOCUS_03820 gene purU 9518 10354 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852510.1 protein_id gnl|my_center|LOCUS_03820 10399 10869 gene locus_tag LOCUS_03830 10399 10869 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_03830 10979 12814 gene locus_tag LOCUS_03840 gene rpoD 10979 12814 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 protein_id gnl|my_center|LOCUS_03840 12874 14439 gene locus_tag LOCUS_03850 12874 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 >Feature sequence019 1579 689 gene locus_tag LOCUS_03860 gene htrB 1579 689 CDS product lipid A biosynthesis lauroyl acyltransferase HtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858051.1 protein_id gnl|my_center|LOCUS_03860 2561 1572 gene locus_tag LOCUS_03870 gene waaC 2561 1572 CDS product lipopolysaccharide heptosyltransferase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858077.1 protein_id gnl|my_center|LOCUS_03870 2634 3413 gene locus_tag LOCUS_03880 2634 3413 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853812.1 protein_id gnl|my_center|LOCUS_03880 3410 4735 gene locus_tag LOCUS_03890 3410 4735 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942461.1 protein_id gnl|my_center|LOCUS_03890 4760 5374 gene locus_tag LOCUS_03900 gene hisH 4760 5374 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949113.1 protein_id gnl|my_center|LOCUS_03900 5374 6081 gene locus_tag LOCUS_03910 gene hisA 5374 6081 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391342.1 protein_id gnl|my_center|LOCUS_03910 6137 6502 gene locus_tag LOCUS_03920 6137 6502 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 protein_id gnl|my_center|LOCUS_03920 6506 7348 gene locus_tag LOCUS_03930 6506 7348 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852657.1 protein_id gnl|my_center|LOCUS_03930 7335 9344 gene locus_tag LOCUS_03940 gene ftsH 7335 9344 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852796.1 protein_id gnl|my_center|LOCUS_03940 9347 9994 gene locus_tag LOCUS_03950 9347 9994 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_03950 10031 10771 gene locus_tag LOCUS_03960 gene pssA 10031 10771 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_03960 10949 12466 gene locus_tag LOCUS_03970 gene leuA 10949 12466 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930807.1 protein_id gnl|my_center|LOCUS_03970 13766 12486 gene locus_tag LOCUS_03980 13766 12486 CDS product serine dehydratase subunit alpha family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005902828.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence020 791 126 gene locus_tag LOCUS_03990 791 126 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891856.1 protein_id gnl|my_center|LOCUS_03990 2682 865 gene locus_tag LOCUS_04000 2682 865 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932766.1 protein_id gnl|my_center|LOCUS_04000 4000 2684 gene locus_tag LOCUS_04010 4000 2684 CDS product ATP citrate lyase citrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932767.1 protein_id gnl|my_center|LOCUS_04010 5294 4092 gene locus_tag LOCUS_04020 5294 4092 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_04020 5863 5291 gene locus_tag LOCUS_04030 5863 5291 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004415847.1 protein_id gnl|my_center|LOCUS_04030 6927 5860 gene locus_tag LOCUS_04040 gene mqnE 6927 5860 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858079.1 protein_id gnl|my_center|LOCUS_04040 7016 8299 gene locus_tag LOCUS_04050 7016 8299 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000505472.1 protein_id gnl|my_center|LOCUS_04050 8308 8748 gene locus_tag LOCUS_04060 8308 8748 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852389.1 protein_id gnl|my_center|LOCUS_04060 8757 11306 gene locus_tag LOCUS_04070 8757 11306 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858387.1 protein_id gnl|my_center|LOCUS_04070 11294 13102 gene locus_tag LOCUS_04080 gene glmS 11294 13102 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858421.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence021 51 590 gene locus_tag LOCUS_04090 51 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 599 1123 gene locus_tag LOCUS_04100 gene folK 599 1123 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851803.1 protein_id gnl|my_center|LOCUS_04100 1104 2363 gene locus_tag LOCUS_04110 1104 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2344 3216 gene locus_tag LOCUS_04120 gene flhG 2344 3216 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_04120 3230 3568 gene locus_tag LOCUS_04130 3230 3568 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851727.1 protein_id gnl|my_center|LOCUS_04130 3540 4253 gene locus_tag LOCUS_04140 3540 4253 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859753.1 protein_id gnl|my_center|LOCUS_04140 4246 5295 gene locus_tag LOCUS_04150 gene fliM 4246 5295 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851710.1 protein_id gnl|my_center|LOCUS_04150 5310 6170 gene locus_tag LOCUS_04160 gene fliY 5310 6170 CDS product flagellar motor switch protein FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851810.1 protein_id gnl|my_center|LOCUS_04160 6219 7235 gene locus_tag LOCUS_04170 gene mnmA 6219 7235 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851977.1 protein_id gnl|my_center|LOCUS_04170 7223 7402 gene locus_tag LOCUS_04180 7223 7402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 9422 7392 gene locus_tag LOCUS_04190 9422 7392 CDS product thioredoxin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966811.1 protein_id gnl|my_center|LOCUS_04190 9551 10066 gene locus_tag LOCUS_04200 9551 10066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 10173 11513 gene locus_tag LOCUS_04210 gene ffh 10173 11513 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852163.1 protein_id gnl|my_center|LOCUS_04210 11593 11826 gene locus_tag LOCUS_04220 gene rpsP 11593 11826 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216125.1 protein_id gnl|my_center|LOCUS_04220 11828 12073 gene locus_tag LOCUS_04230 11828 12073 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852144.1 protein_id gnl|my_center|LOCUS_04230 12083 12616 gene locus_tag LOCUS_04240 gene rimM 12083 12616 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852323.1 protein_id gnl|my_center|LOCUS_04240 12613 13320 gene locus_tag LOCUS_04250 gene trmD 12613 13320 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868040.1 protein_id gnl|my_center|LOCUS_04250 13310 13669 gene locus_tag LOCUS_04260 gene rplS 13310 13669 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852307.1 protein_id gnl|my_center|LOCUS_04260 13901 14110 gene locus_tag LOCUS_04270 13901 14110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04270 >Feature sequence022 1662 919 gene locus_tag LOCUS_04280 1662 919 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 protein_id gnl|my_center|LOCUS_04280 2347 1649 gene locus_tag LOCUS_04290 gene pfs 2347 1649 CDS product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859787.1 protein_id gnl|my_center|LOCUS_04290 3111 2344 gene locus_tag LOCUS_04300 3111 2344 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933160.1 protein_id gnl|my_center|LOCUS_04300 4073 3135 gene locus_tag LOCUS_04310 gene fabD 4073 3135 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 protein_id gnl|my_center|LOCUS_04310 4832 4077 gene locus_tag LOCUS_04320 4832 4077 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546767.1 protein_id gnl|my_center|LOCUS_04320 5325 4819 gene locus_tag LOCUS_04330 5325 4819 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851661.1 protein_id gnl|my_center|LOCUS_04330 6317 5421 gene locus_tag LOCUS_04340 6317 5421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04340 6995 6414 gene locus_tag LOCUS_04350 gene pal 6995 6414 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851617.1 protein_id gnl|my_center|LOCUS_04350 8319 7045 gene locus_tag LOCUS_04360 gene tolB 8319 7045 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_04360 9106 8330 gene locus_tag LOCUS_04370 9106 8330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 9501 9109 gene locus_tag LOCUS_04380 9501 9109 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001105106.1 protein_id gnl|my_center|LOCUS_04380 10091 9498 gene locus_tag LOCUS_04390 10091 9498 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854361.1 protein_id gnl|my_center|LOCUS_04390 10487 10095 gene locus_tag LOCUS_04400 gene atpC 10487 10095 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851752.1 protein_id gnl|my_center|LOCUS_04400 11925 10525 gene locus_tag LOCUS_04410 gene atpD 11925 10525 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 protein_id gnl|my_center|LOCUS_04410 12838 11954 gene locus_tag LOCUS_04420 gene atpG 12838 11954 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 protein_id gnl|my_center|LOCUS_04420 <14022 12847 gene locus_tag LOCUS_04430 <14022 12847 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851836.1:F0F1 ATP synthase subunit alpha >Feature sequence023 534 956 gene locus_tag LOCUS_04440 534 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 1015 1653 gene locus_tag LOCUS_04450 1015 1653 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858312.1 protein_id gnl|my_center|LOCUS_04450 1917 3188 gene locus_tag LOCUS_04460 gene purD 1917 3188 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853212.1 protein_id gnl|my_center|LOCUS_04460 3192 3641 gene locus_tag LOCUS_04470 3192 3641 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008633066.1 protein_id gnl|my_center|LOCUS_04470 3634 5697 gene locus_tag LOCUS_04480 3634 5697 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 protein_id gnl|my_center|LOCUS_04480 5694 5963 gene locus_tag LOCUS_04490 5694 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 6157 8373 gene locus_tag LOCUS_04500 6157 8373 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853182.1 protein_id gnl|my_center|LOCUS_04500 8512 8847 gene locus_tag LOCUS_04510 8512 8847 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853292.1 protein_id gnl|my_center|LOCUS_04510 8886 8970 gene locus_tag LOCUS_t00070 8886 8970 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 9000 9557 gene locus_tag LOCUS_04520 9000 9557 CDS product alkylphosphonate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071746.1 protein_id gnl|my_center|LOCUS_04520 9673 10107 gene locus_tag LOCUS_04530 9673 10107 CDS product MarR family winged helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048563.1 protein_id gnl|my_center|LOCUS_04530 10236 11462 gene locus_tag LOCUS_04540 10236 11462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 11459 12592 gene locus_tag LOCUS_04550 gene mdtE 11459 12592 CDS product multidrug transporter subunit MdtE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001081984.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence024 186 195 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 464 1291 gene locus_tag LOCUS_04560 464 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 1291 1986 gene locus_tag LOCUS_04570 1291 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 1989 3908 gene locus_tag LOCUS_04580 1989 3908 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858576.1 protein_id gnl|my_center|LOCUS_04580 5403 3973 gene locus_tag LOCUS_04590 gene glnA 5403 3973 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858636.1 protein_id gnl|my_center|LOCUS_04590 6249 5470 gene locus_tag LOCUS_04600 6249 5470 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_04600 6334 7008 gene locus_tag LOCUS_04610 6334 7008 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852254.1 protein_id gnl|my_center|LOCUS_04610 7020 8291 gene locus_tag LOCUS_04620 7020 8291 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852318.1 protein_id gnl|my_center|LOCUS_04620 8296 8790 gene locus_tag LOCUS_04630 gene purE 8296 8790 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_04630 8801 9268 gene locus_tag LOCUS_04640 8801 9268 CDS product DUF3972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852251.1 protein_id gnl|my_center|LOCUS_04640 9287 9541 gene locus_tag LOCUS_04650 9287 9541 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_04650 9544 10416 gene locus_tag LOCUS_04660 gene glyQ 9544 10416 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852069.1 protein_id gnl|my_center|LOCUS_04660 10394 11116 gene locus_tag LOCUS_04670 10394 11116 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_04670 11138 11857 gene locus_tag LOCUS_04680 11138 11857 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence025 <1 4560 gene locus_tag LOCUS_04690 <1 4560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001123087.1:DUF11 domain-containing protein 4554 5237 gene locus_tag LOCUS_04700 4554 5237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 5234 6136 gene locus_tag LOCUS_04710 5234 6136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 6133 6564 gene locus_tag LOCUS_04720 6133 6564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 6640 7179 gene locus_tag LOCUS_04730 6640 7179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 8945 7194 gene locus_tag LOCUS_04740 gene recG 8945 7194 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858588.1 protein_id gnl|my_center|LOCUS_04740 10205 8964 gene locus_tag LOCUS_04750 10205 8964 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000714010.1 protein_id gnl|my_center|LOCUS_04750 11308 10256 gene locus_tag LOCUS_04760 11308 10256 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851090.1 protein_id gnl|my_center|LOCUS_04760 11468 12358 gene locus_tag LOCUS_04770 gene rarD 11468 12358 CDS product EamA family transporter RarD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000339107.1 protein_id gnl|my_center|LOCUS_04770 >Feature sequence026 48 551 gene locus_tag LOCUS_04780 48 551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 1872 1051 gene locus_tag LOCUS_04790 gene fabI 1872 1051 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780456.1 protein_id gnl|my_center|LOCUS_04790 2582 1875 gene locus_tag LOCUS_04800 2582 1875 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855528.1 protein_id gnl|my_center|LOCUS_04800 3778 2579 gene locus_tag LOCUS_04810 3778 2579 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891932.1 protein_id gnl|my_center|LOCUS_04810 4786 3782 gene locus_tag LOCUS_04820 gene gap 4786 3782 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780453.1 protein_id gnl|my_center|LOCUS_04820 4846 5403 gene locus_tag LOCUS_04830 gene nadD 4846 5403 CDS product nicotinate (nicotinamide) nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780449.1 protein_id gnl|my_center|LOCUS_04830 5396 5737 gene locus_tag LOCUS_04840 gene rsfS 5396 5737 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858238.1 protein_id gnl|my_center|LOCUS_04840 7328 5742 gene locus_tag LOCUS_04850 gene argS 7328 5742 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891916.1 protein_id gnl|my_center|LOCUS_04850 7564 7337 gene locus_tag LOCUS_04860 7564 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 7902 7696 gene locus_tag LOCUS_04870 7902 7696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 8209 7982 gene locus_tag LOCUS_04880 gene tatA 8209 7982 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000508588.1 protein_id gnl|my_center|LOCUS_04880 9305 8253 gene locus_tag LOCUS_04890 9305 8253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 8826 8925 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 10139 9375 gene locus_tag LOCUS_04900 gene fliR 10139 9375 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852712.1 protein_id gnl|my_center|LOCUS_04900 10840 10139 gene locus_tag LOCUS_04910 10840 10139 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891917.1 protein_id gnl|my_center|LOCUS_04910 11944 10877 gene locus_tag LOCUS_04920 gene tsf 11944 10877 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864836.1 protein_id gnl|my_center|LOCUS_04920 <12740 11944 gene locus_tag LOCUS_04930 <12740 11944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002892710.1:30S ribosomal protein S2 >Feature sequence027 <1 1142 gene locus_tag LOCUS_04940 <1 1142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000467802.1:chemotaxis chemoreceptor TlpD 1746 1129 gene locus_tag LOCUS_04950 1746 1129 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853153.1 protein_id gnl|my_center|LOCUS_04950 3145 1670 gene locus_tag LOCUS_04960 3145 1670 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 protein_id gnl|my_center|LOCUS_04960 3362 3457 gene locus_tag LOCUS_t00080 3362 3457 tRNA product tRNA-SeC inference COORDINATES:profile:Aragorn:1.2.38 4159 3464 gene locus_tag LOCUS_04970 4159 3464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 5406 4675 gene locus_tag LOCUS_04980 5406 4675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 5508 5607 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5957 7198 gene locus_tag LOCUS_04990 5957 7198 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_04990 7258 7815 gene locus_tag LOCUS_05000 gene bcrC 7258 7815 CDS product undecaprenyl-diphosphate phosphatase BcrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243362.1 protein_id gnl|my_center|LOCUS_05000 7848 8633 gene locus_tag LOCUS_05010 7848 8633 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189857.1 protein_id gnl|my_center|LOCUS_05010 8682 9701 gene locus_tag LOCUS_05020 8682 9701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 9822 11261 gene locus_tag LOCUS_05030 9822 11261 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946372.1 protein_id gnl|my_center|LOCUS_05030 11267 11680 gene locus_tag LOCUS_05040 11267 11680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 11670 12617 gene locus_tag LOCUS_05050 11670 12617 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001170714.1 protein_id gnl|my_center|LOCUS_05050 >Feature sequence028 332 2716 gene locus_tag LOCUS_05060 332 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 2718 3395 gene locus_tag LOCUS_05070 2718 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 3380 4651 gene locus_tag LOCUS_05080 3380 4651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 4717 5046 gene locus_tag LOCUS_05090 4717 5046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05090 5109 7418 gene locus_tag LOCUS_05100 5109 7418 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546592.1 protein_id gnl|my_center|LOCUS_05100 7418 8089 gene locus_tag LOCUS_05110 7418 8089 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073773.1 protein_id gnl|my_center|LOCUS_05110 9926 8091 gene locus_tag LOCUS_05120 gene selB 9926 8091 CDS product selenocysteine-specific translation elongation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857930.1 protein_id gnl|my_center|LOCUS_05120 11260 9923 gene locus_tag LOCUS_05130 gene selA 11260 9923 CDS product L-seryl-tRNA(Sec) selenium transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858009.1 protein_id gnl|my_center|LOCUS_05130 11945 11253 gene locus_tag LOCUS_05140 11945 11253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_05140 <12617 11949 gene locus_tag LOCUS_05150 <12617 11949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:PAS domain-containing sensor histidine kinase >Feature sequence029 413 1027 gene locus_tag LOCUS_05160 413 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 1195 3078 gene locus_tag LOCUS_05170 gene hyfB 1195 3078 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_05170 3075 4007 gene locus_tag LOCUS_05180 3075 4007 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089080.1 protein_id gnl|my_center|LOCUS_05180 4004 4603 gene locus_tag LOCUS_05190 4004 4603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 4596 5999 gene locus_tag LOCUS_05200 4596 5999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 6001 7128 gene locus_tag LOCUS_05210 6001 7128 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868444.1 protein_id gnl|my_center|LOCUS_05210 7125 8489 gene locus_tag LOCUS_05220 7125 8489 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024251.1 protein_id gnl|my_center|LOCUS_05220 8522 9028 gene locus_tag LOCUS_05230 8522 9028 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089084.1 protein_id gnl|my_center|LOCUS_05230 10131 9127 gene locus_tag LOCUS_05240 10131 9127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 11794 10307 gene locus_tag LOCUS_05250 11794 10307 CDS product DUF3373 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942839.1 protein_id gnl|my_center|LOCUS_05250 12025 12336 gene locus_tag LOCUS_05260 12025 12336 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262024.1 protein_id gnl|my_center|LOCUS_05260 >Feature sequence030 360 998 gene locus_tag LOCUS_05270 360 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 1036 1752 gene locus_tag LOCUS_05280 1036 1752 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012660467.1 protein_id gnl|my_center|LOCUS_05280 1774 3078 gene locus_tag LOCUS_05290 1774 3078 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_05290 3134 3694 gene locus_tag LOCUS_05300 3134 3694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3709 5025 gene locus_tag LOCUS_05310 3709 5025 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022265.1 protein_id gnl|my_center|LOCUS_05310 5039 6760 gene locus_tag LOCUS_05320 5039 6760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 8169 6805 gene locus_tag LOCUS_05330 gene lpdA 8169 6805 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545965.1 protein_id gnl|my_center|LOCUS_05330 9025 8180 gene locus_tag LOCUS_05340 gene lipA 9025 8180 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941048.1 protein_id gnl|my_center|LOCUS_05340 9681 9109 gene locus_tag LOCUS_05350 gene recR 9681 9109 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853214.1 protein_id gnl|my_center|LOCUS_05350 9849 10979 gene locus_tag LOCUS_05360 gene dnaJ 9849 10979 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853203.1 protein_id gnl|my_center|LOCUS_05360 10993 11532 gene locus_tag LOCUS_05370 10993 11532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 <12435 11555 gene locus_tag LOCUS_05380 <12435 11555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858644.1:DNA polymerase I >Feature sequence031 <1 417 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaaatccctgtgggatatattttaac 1558 551 gene locus_tag LOCUS_05390 gene cas1b 1558 551 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545370.1 protein_id gnl|my_center|LOCUS_05390 1845 1567 gene locus_tag LOCUS_05400 gene cas2 1845 1567 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_05400 2357 1854 gene locus_tag LOCUS_05410 gene cas4 2357 1854 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082345.1 protein_id gnl|my_center|LOCUS_05410 4546 2354 gene locus_tag LOCUS_05420 4546 2354 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_05420 5402 4533 gene locus_tag LOCUS_05430 5402 4533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 6357 5407 gene locus_tag LOCUS_05440 gene cas7b 6357 5407 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082348.1 protein_id gnl|my_center|LOCUS_05440 6805 6350 gene locus_tag LOCUS_05450 6805 6350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 8371 6809 gene locus_tag LOCUS_05460 8371 6809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 9042 8368 gene locus_tag LOCUS_05470 9042 8368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 9180 9104 gene locus_tag LOCUS_t00090 9180 9104 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 9265 9192 gene locus_tag LOCUS_t00100 9265 9192 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 9400 10047 gene locus_tag LOCUS_05480 gene nth 9400 10047 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852225.1 protein_id gnl|my_center|LOCUS_05480 10684 10121 gene locus_tag LOCUS_05490 10684 10121 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054459.1 protein_id gnl|my_center|LOCUS_05490 11961 10687 gene locus_tag LOCUS_05500 11961 10687 CDS product M20/M25/M40 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853369.1 protein_id gnl|my_center|LOCUS_05500 12009 12194 gene locus_tag LOCUS_05510 12009 12194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 >Feature sequence032 93 938 gene locus_tag LOCUS_05520 93 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 1339 989 gene locus_tag LOCUS_05530 1339 989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 2670 1342 gene locus_tag LOCUS_05540 2670 1342 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858001.1 protein_id gnl|my_center|LOCUS_05540 3133 2690 gene locus_tag LOCUS_05550 gene accB 3133 2690 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853623.1 protein_id gnl|my_center|LOCUS_05550 3223 3783 gene locus_tag LOCUS_05560 gene dcd 3223 3783 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854086.1 protein_id gnl|my_center|LOCUS_05560 4546 3767 gene locus_tag LOCUS_05570 4546 3767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 5752 4547 gene locus_tag LOCUS_05580 5752 4547 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_05580 6265 5822 gene locus_tag LOCUS_05590 6265 5822 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781229.1 protein_id gnl|my_center|LOCUS_05590 6488 6267 gene locus_tag LOCUS_05600 6488 6267 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_05600 7172 6789 gene locus_tag LOCUS_05610 7172 6789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 7432 7163 gene locus_tag LOCUS_05620 7432 7163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 8154 7504 gene locus_tag LOCUS_05630 8154 7504 CDS product menaquinone biosynthetic enzyme MqnA/MqnD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210707.1 protein_id gnl|my_center|LOCUS_05630 9735 8155 gene locus_tag LOCUS_05640 9735 8155 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788346.1 protein_id gnl|my_center|LOCUS_05640 9827 10396 gene locus_tag LOCUS_05650 9827 10396 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943410.1 protein_id gnl|my_center|LOCUS_05650 10396 11490 gene locus_tag LOCUS_05660 10396 11490 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_05660 11477 11641 gene locus_tag LOCUS_05670 11477 11641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 >Feature sequence033 <1 897 gene locus_tag LOCUS_05680 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870579.1:UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase 894 1829 gene locus_tag LOCUS_05690 894 1829 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000833936.1 protein_id gnl|my_center|LOCUS_05690 1860 2708 gene locus_tag LOCUS_05700 gene argB 1860 2708 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544977.1 protein_id gnl|my_center|LOCUS_05700 2734 4218 gene locus_tag LOCUS_05710 gene thrC 2734 4218 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852451.1 protein_id gnl|my_center|LOCUS_05710 5482 4271 gene locus_tag LOCUS_05720 gene ilvA 5482 4271 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_05720 5936 5505 gene locus_tag LOCUS_05730 5936 5505 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846164.1 protein_id gnl|my_center|LOCUS_05730 7044 5926 gene locus_tag LOCUS_05740 gene trmA 7044 5926 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206575.1 protein_id gnl|my_center|LOCUS_05740 7802 7071 gene locus_tag LOCUS_05750 gene fliP 7802 7071 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_05750 8625 7828 gene locus_tag LOCUS_05760 8625 7828 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939503.1 protein_id gnl|my_center|LOCUS_05760 9408 8641 gene locus_tag LOCUS_05770 9408 8641 CDS product motility protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870068.1 protein_id gnl|my_center|LOCUS_05770 9563 10861 gene locus_tag LOCUS_05780 gene glmU 9563 10861 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852530.1 protein_id gnl|my_center|LOCUS_05780 >Feature sequence034 1089 433 gene locus_tag LOCUS_05790 gene dccR 1089 433 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_05790 1181 4669 gene locus_tag LOCUS_05800 gene metH 1181 4669 CDS product methionine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140480.1 protein_id gnl|my_center|LOCUS_05800 4716 4815 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5250 6167 gene locus_tag LOCUS_05810 5250 6167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 6223 6414 gene locus_tag LOCUS_05820 6223 6414 CDS product YwbE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014309.1 protein_id gnl|my_center|LOCUS_05820 6414 6866 gene locus_tag LOCUS_05830 6414 6866 CDS product YaiI/YqxD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945850.1 protein_id gnl|my_center|LOCUS_05830 6868 7620 gene locus_tag LOCUS_05840 6868 7620 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007329295.1 protein_id gnl|my_center|LOCUS_05840 7702 8286 gene locus_tag LOCUS_05850 7702 8286 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944038.1 protein_id gnl|my_center|LOCUS_05850 9027 8302 gene locus_tag LOCUS_05860 9027 8302 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263502.1 protein_id gnl|my_center|LOCUS_05860 9807 9043 gene locus_tag LOCUS_05870 9807 9043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 10253 9816 gene locus_tag LOCUS_05880 10253 9816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05880 10873 10304 gene locus_tag LOCUS_05890 10873 10304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 <11912 10870 gene locus_tag LOCUS_05900 <11912 10870 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023036708.1:TonB-dependent receptor >Feature sequence035 1045 563 gene locus_tag LOCUS_05910 gene aroQ 1045 563 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_05910 1679 1173 gene locus_tag LOCUS_05920 1679 1173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1800 2669 gene locus_tag LOCUS_05930 1800 2669 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852714.1 protein_id gnl|my_center|LOCUS_05930 3159 2662 gene locus_tag LOCUS_05940 3159 2662 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391477.1 protein_id gnl|my_center|LOCUS_05940 3388 5130 gene locus_tag LOCUS_05950 3388 5130 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891907.1 protein_id gnl|my_center|LOCUS_05950 5150 5581 gene locus_tag LOCUS_05960 5150 5581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 6494 5595 gene locus_tag LOCUS_05970 6494 5595 CDS product selenium metabolism-associated LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545377.1 protein_id gnl|my_center|LOCUS_05970 6752 8806 gene locus_tag LOCUS_05980 6752 8806 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_05980 8803 9633 gene locus_tag LOCUS_05990 gene truB 8803 9633 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 protein_id gnl|my_center|LOCUS_05990 9627 9860 gene locus_tag LOCUS_06000 9627 9860 CDS product carbon storage regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000906447.1 protein_id gnl|my_center|LOCUS_06000 9857 10654 gene locus_tag LOCUS_06010 9857 10654 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 protein_id gnl|my_center|LOCUS_06010 10647 11102 gene locus_tag LOCUS_06020 gene smpB 10647 11102 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_06020 11162 11476 gene locus_tag LOCUS_06030 11162 11476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 >Feature sequence036 <1 564 gene locus_tag LOCUS_06040 <1 564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261778.1:GPR1/FUN34/YaaH family transporter 603 2546 gene locus_tag LOCUS_06050 gene acs 603 2546 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851288.1 protein_id gnl|my_center|LOCUS_06050 2563 2751 gene locus_tag LOCUS_06060 2563 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3880 2789 gene locus_tag LOCUS_06070 3880 2789 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858516.1 protein_id gnl|my_center|LOCUS_06070 3969 4499 gene locus_tag LOCUS_06080 3969 4499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06080 6364 4496 gene locus_tag LOCUS_06090 gene thiC 6364 4496 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095696.1 protein_id gnl|my_center|LOCUS_06090 6923 8053 gene locus_tag LOCUS_06100 gene cfa 6923 8053 CDS product cyclopropane fatty acyl phospholipid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444610.1 protein_id gnl|my_center|LOCUS_06100 8202 10844 gene locus_tag LOCUS_06110 8202 10844 CDS product valine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864150.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence037 1711 116 gene locus_tag LOCUS_06120 1711 116 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389262.1 protein_id gnl|my_center|LOCUS_06120 1844 2332 gene locus_tag LOCUS_06130 gene leuD 1844 2332 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_06130 2464 3531 gene locus_tag LOCUS_06140 gene leuB 2464 3531 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_06140 3537 3785 gene locus_tag LOCUS_06150 3537 3785 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891888.1 protein_id gnl|my_center|LOCUS_06150 3776 4087 gene locus_tag LOCUS_06160 3776 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 4077 5234 gene locus_tag LOCUS_06170 4077 5234 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868507.1 protein_id gnl|my_center|LOCUS_06170 5851 6537 gene locus_tag LOCUS_06180 5851 6537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 7007 6534 gene locus_tag LOCUS_06190 7007 6534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06190 7278 6997 gene locus_tag LOCUS_06200 7278 6997 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001010071.1 protein_id gnl|my_center|LOCUS_06200 8569 7283 gene locus_tag LOCUS_06210 gene hemL 8569 7283 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421462.1 protein_id gnl|my_center|LOCUS_06210 8922 8566 gene locus_tag LOCUS_06220 8922 8566 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235932.1 protein_id gnl|my_center|LOCUS_06220 8981 9817 gene locus_tag LOCUS_06230 gene folD 8981 9817 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_06230 9836 10693 gene locus_tag LOCUS_06240 gene lepB 9836 10693 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_06240 10702 11328 gene locus_tag LOCUS_06250 10702 11328 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159394.1 protein_id gnl|my_center|LOCUS_06250 >Feature sequence038 <1 620 gene locus_tag LOCUS_06260 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000807891.1:cytochrome bc complex cytochrome b subunit 622 1566 gene locus_tag LOCUS_06270 622 1566 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657605.1 protein_id gnl|my_center|LOCUS_06270 1712 2704 gene locus_tag LOCUS_06280 gene amrS 1712 2704 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228858.1 protein_id gnl|my_center|LOCUS_06280 2701 3498 gene locus_tag LOCUS_06290 2701 3498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 3509 4138 gene locus_tag LOCUS_06300 3509 4138 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877550.1 protein_id gnl|my_center|LOCUS_06300 4138 4425 gene locus_tag LOCUS_06310 4138 4425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 4669 7104 gene locus_tag LOCUS_06320 gene torA 4669 7104 CDS product trimethylamine-N-oxide reductase TorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389042.1 protein_id gnl|my_center|LOCUS_06320 7111 7722 gene locus_tag LOCUS_06330 7111 7722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 8068 7763 gene locus_tag LOCUS_06340 8068 7763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 10799 8076 gene locus_tag LOCUS_06350 10799 8076 CDS product RecB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864468.1 protein_id gnl|my_center|LOCUS_06350 <11474 10799 gene locus_tag LOCUS_06360 <11474 10799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891938.1:PD-(D/E)XK nuclease family protein >Feature sequence039 449 919 gene locus_tag LOCUS_06370 449 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 916 1743 gene locus_tag LOCUS_06380 916 1743 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808202.1 protein_id gnl|my_center|LOCUS_06380 1779 2234 gene locus_tag LOCUS_06390 1779 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2288 2758 gene locus_tag LOCUS_06400 2288 2758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 2931 3632 gene locus_tag LOCUS_06410 2931 3632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 3644 3949 gene locus_tag LOCUS_06420 3644 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 4135 3956 gene locus_tag LOCUS_06430 4135 3956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 4140 5138 gene locus_tag LOCUS_06440 4140 5138 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941915.1 protein_id gnl|my_center|LOCUS_06440 5135 5803 gene locus_tag LOCUS_06450 5135 5803 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941916.1 protein_id gnl|my_center|LOCUS_06450 5800 6762 gene locus_tag LOCUS_06460 5800 6762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941917.1 protein_id gnl|my_center|LOCUS_06460 6759 7253 gene locus_tag LOCUS_06470 6759 7253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 9432 8050 gene locus_tag LOCUS_06480 9432 8050 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852810.1 protein_id gnl|my_center|LOCUS_06480 10164 9436 gene locus_tag LOCUS_06490 10164 9436 CDS product plasminogen-binding N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852692.1 protein_id gnl|my_center|LOCUS_06490 10269 11438 gene locus_tag LOCUS_06500 10269 11438 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852845.1 protein_id gnl|my_center|LOCUS_06500 >Feature sequence040 428 1900 gene locus_tag LOCUS_06510 428 1900 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941686.1 protein_id gnl|my_center|LOCUS_06510 1901 3817 gene locus_tag LOCUS_06520 gene glgB 1901 3817 CDS product 1,4-alpha-glucan branching protein GlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545591.1 protein_id gnl|my_center|LOCUS_06520 4598 3801 gene locus_tag LOCUS_06530 4598 3801 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 protein_id gnl|my_center|LOCUS_06530 6034 4622 gene locus_tag LOCUS_06540 gene trpE 6034 4622 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_06540 6753 6040 gene locus_tag LOCUS_06550 6753 6040 CDS product SPOR domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864776.1 protein_id gnl|my_center|LOCUS_06550 7353 6811 gene locus_tag LOCUS_06560 7353 6811 CDS product DUF1882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859481.1 protein_id gnl|my_center|LOCUS_06560 8612 7365 gene locus_tag LOCUS_06570 8612 7365 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_06570 10114 8609 gene locus_tag LOCUS_06580 gene lysS 10114 8609 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858694.1 protein_id gnl|my_center|LOCUS_06580 10590 10111 gene locus_tag LOCUS_06590 10590 10111 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_06590 11159 10596 gene locus_tag LOCUS_06600 11159 10596 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858643.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence041 1 489 gene locus_tag LOCUS_06610 1 489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 557 745 gene locus_tag LOCUS_06620 557 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 770 1381 gene locus_tag LOCUS_06630 770 1381 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028787344.1 protein_id gnl|my_center|LOCUS_06630 1445 1963 gene locus_tag LOCUS_06640 1445 1963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 3757 1982 gene locus_tag LOCUS_06650 gene soxB 3757 1982 CDS product thiosulfohydrolase SoxB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926971.1 protein_id gnl|my_center|LOCUS_06650 4168 3764 gene locus_tag LOCUS_06660 4168 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 5088 4180 gene locus_tag LOCUS_06670 gene soxA 5088 4180 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 protein_id gnl|my_center|LOCUS_06670 5400 5107 gene locus_tag LOCUS_06680 5400 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 5906 5451 gene locus_tag LOCUS_06690 5906 5451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 6276 5920 gene locus_tag LOCUS_06700 gene soxX 6276 5920 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028172677.1 protein_id gnl|my_center|LOCUS_06700 7392 6289 gene locus_tag LOCUS_06710 7392 6289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 8710 7373 gene locus_tag LOCUS_06720 gene soxC 8710 7373 CDS product sulfite dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011086300.1 protein_id gnl|my_center|LOCUS_06720 9752 8928 gene locus_tag LOCUS_06730 9752 8928 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891838.1 protein_id gnl|my_center|LOCUS_06730 10534 9752 gene locus_tag LOCUS_06740 10534 9752 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891839.1 protein_id gnl|my_center|LOCUS_06740 <11132 10527 gene locus_tag LOCUS_06750 <11132 10527 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011020082.1:zinc ABC transporter substrate-binding protein >Feature sequence042 <1 826 gene locus_tag LOCUS_06760 <1 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858599.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 865 1608 gene locus_tag LOCUS_06770 gene fabG 865 1608 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_06770 1670 1900 gene locus_tag LOCUS_06780 gene acpP 1670 1900 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854831.1 protein_id gnl|my_center|LOCUS_06780 1973 3193 gene locus_tag LOCUS_06790 1973 3193 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858574.1 protein_id gnl|my_center|LOCUS_06790 3198 4133 gene locus_tag LOCUS_06800 gene accA 3198 4133 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_06800 5310 4138 gene locus_tag LOCUS_06810 5310 4138 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972086.1 protein_id gnl|my_center|LOCUS_06810 6695 5310 gene locus_tag LOCUS_06820 6695 5310 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529683.1 protein_id gnl|my_center|LOCUS_06820 8112 6721 gene locus_tag LOCUS_06830 8112 6721 CDS product glutamine synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947961.1 protein_id gnl|my_center|LOCUS_06830 9184 8258 gene locus_tag LOCUS_06840 9184 8258 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000657605.1 protein_id gnl|my_center|LOCUS_06840 10464 9181 gene locus_tag LOCUS_06850 10464 9181 CDS product cytochrome bc complex cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852758.1 protein_id gnl|my_center|LOCUS_06850 >Feature sequence043 <1 3558 gene locus_tag LOCUS_06860 <1 3558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870177.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 3572 4570 gene locus_tag LOCUS_06870 3572 4570 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257947.1 protein_id gnl|my_center|LOCUS_06870 4580 5923 gene locus_tag LOCUS_06880 4580 5923 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083195.1 protein_id gnl|my_center|LOCUS_06880 7719 5992 gene locus_tag LOCUS_06890 7719 5992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 7837 8502 gene locus_tag LOCUS_06900 7837 8502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 8584 9546 gene locus_tag LOCUS_06910 gene trpS 8584 9546 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858719.1 protein_id gnl|my_center|LOCUS_06910 9548 10792 gene locus_tag LOCUS_06920 gene serS 9548 10792 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858681.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence044 1337 1762 gene locus_tag LOCUS_06930 gene perR 1337 1762 CDS product peroxide-responsive transcriptional repressor PerR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858684.1 protein_id gnl|my_center|LOCUS_06930 2524 1832 gene locus_tag LOCUS_06940 2524 1832 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852965.1 protein_id gnl|my_center|LOCUS_06940 3284 2517 gene locus_tag LOCUS_06950 3284 2517 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852992.1 protein_id gnl|my_center|LOCUS_06950 4303 3281 gene locus_tag LOCUS_06960 4303 3281 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853049.1 protein_id gnl|my_center|LOCUS_06960 5206 4313 gene locus_tag LOCUS_06970 5206 4313 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852952.1 protein_id gnl|my_center|LOCUS_06970 6478 5348 gene locus_tag LOCUS_06980 6478 5348 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_06980 9070 6695 gene locus_tag LOCUS_06990 9070 6695 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865087.1 protein_id gnl|my_center|LOCUS_06990 10407 9064 gene locus_tag LOCUS_07000 gene purB 10407 9064 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865088.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence045 2181 2498 gene locus_tag LOCUS_07010 gene trxA 2181 2498 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851800.1 protein_id gnl|my_center|LOCUS_07010 2567 2953 gene locus_tag LOCUS_07020 2567 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2964 3896 gene locus_tag LOCUS_07030 gene trxB 2964 3896 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851648.1 protein_id gnl|my_center|LOCUS_07030 3906 4676 gene locus_tag LOCUS_07040 gene dapB 3906 4676 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_07040 4772 6115 gene locus_tag LOCUS_07050 gene purF 4772 6115 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 protein_id gnl|my_center|LOCUS_07050 6658 6119 gene locus_tag LOCUS_07060 6658 6119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 7185 6670 gene locus_tag LOCUS_07070 7185 6670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 7892 7194 gene locus_tag LOCUS_07080 gene hisIE 7892 7194 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208235.1 protein_id gnl|my_center|LOCUS_07080 8946 7882 gene locus_tag LOCUS_07090 8946 7882 CDS product prohibitin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858687.1 protein_id gnl|my_center|LOCUS_07090 9876 8962 gene locus_tag LOCUS_07100 gene ilvE 9876 8962 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851928.1 protein_id gnl|my_center|LOCUS_07100 >Feature sequence046 <1 804 gene locus_tag LOCUS_07110 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858651.1:motility protein PflB 807 2033 gene locus_tag LOCUS_07120 807 2033 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_178371730.1 protein_id gnl|my_center|LOCUS_07120 2050 2562 gene locus_tag LOCUS_07130 2050 2562 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_07130 2559 4262 gene locus_tag LOCUS_07140 2559 4262 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858782.1 protein_id gnl|my_center|LOCUS_07140 4728 4255 gene locus_tag LOCUS_07150 4728 4255 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000357337.1 protein_id gnl|my_center|LOCUS_07150 5939 4740 gene locus_tag LOCUS_07160 5939 4740 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851486.1 protein_id gnl|my_center|LOCUS_07160 6813 5917 gene locus_tag LOCUS_07170 6813 5917 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_07170 8034 6892 gene locus_tag LOCUS_07180 8034 6892 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_07180 8139 9266 gene locus_tag LOCUS_07190 8139 9266 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851177.1 protein_id gnl|my_center|LOCUS_07190 10021 9332 gene locus_tag LOCUS_07200 10021 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence047 3 200 gene locus_tag LOCUS_07210 3 200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 193 1059 gene locus_tag LOCUS_07220 193 1059 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880486.1 protein_id gnl|my_center|LOCUS_07220 1056 2360 gene locus_tag LOCUS_07230 1056 2360 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880487.1 protein_id gnl|my_center|LOCUS_07230 2494 3651 gene locus_tag LOCUS_07240 2494 3651 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853195.1 protein_id gnl|my_center|LOCUS_07240 3666 5402 gene locus_tag LOCUS_07250 3666 5402 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853190.1 protein_id gnl|my_center|LOCUS_07250 5412 6104 gene locus_tag LOCUS_07260 gene cybH 5412 6104 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853164.1 protein_id gnl|my_center|LOCUS_07260 6123 6668 gene locus_tag LOCUS_07270 gene hydD 6123 6668 CDS product hydrogenase biosynthesis protein HydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078602.1 protein_id gnl|my_center|LOCUS_07270 6665 8503 gene locus_tag LOCUS_07280 6665 8503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 >Feature sequence048 396 866 gene locus_tag LOCUS_07290 396 866 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024203.1 protein_id gnl|my_center|LOCUS_07290 859 1065 gene locus_tag LOCUS_07300 859 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1244 2329 gene locus_tag LOCUS_07310 1244 2329 CDS product YbdK family carboxylate-amine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948418.1 protein_id gnl|my_center|LOCUS_07310 2332 3849 gene locus_tag LOCUS_07320 2332 3849 CDS product gamma-glutamyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142355.1 protein_id gnl|my_center|LOCUS_07320 4268 3870 gene locus_tag LOCUS_07330 gene ruvX 4268 3870 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852281.1 protein_id gnl|my_center|LOCUS_07330 5041 4268 gene locus_tag LOCUS_07340 5041 4268 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874287.1 protein_id gnl|my_center|LOCUS_07340 6095 5013 gene locus_tag LOCUS_07350 6095 5013 CDS product divergent polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002873647.1 protein_id gnl|my_center|LOCUS_07350 7167 6145 gene locus_tag LOCUS_07360 gene ilvC 7167 6145 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858483.1 protein_id gnl|my_center|LOCUS_07360 7292 8104 gene locus_tag LOCUS_07370 7292 8104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 8101 10020 gene locus_tag LOCUS_07380 8101 10020 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 protein_id gnl|my_center|LOCUS_07380 >Feature sequence049 1616 639 gene locus_tag LOCUS_07390 1616 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 2569 1616 gene locus_tag LOCUS_07400 gene wtpA 2569 1616 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870699.1 protein_id gnl|my_center|LOCUS_07400 3821 2580 gene locus_tag LOCUS_07410 3821 2580 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856962.1 protein_id gnl|my_center|LOCUS_07410 4601 3849 gene locus_tag LOCUS_07420 4601 3849 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002822570.1 protein_id gnl|my_center|LOCUS_07420 5389 4601 gene locus_tag LOCUS_07430 gene fdhD 5389 4601 CDS product formate dehydrogenase accessory sulfurtransferase FdhD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851178.1 protein_id gnl|my_center|LOCUS_07430 6488 5565 gene locus_tag LOCUS_07440 6488 5565 CDS product formate dehydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851174.1 protein_id gnl|my_center|LOCUS_07440 7091 6498 gene locus_tag LOCUS_07450 gene fdh3B 7091 6498 CDS product formate dehydrogenase FDH3 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851264.1 protein_id gnl|my_center|LOCUS_07450 9939 7102 gene locus_tag LOCUS_07460 9939 7102 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891941.1 transl_except (pos:complement(9382..9384),aa:Sec) note codon on position 186 is selenocysteine opal codon. protein_id gnl|my_center|LOCUS_07460 10154 9951 gene locus_tag LOCUS_07470 10154 9951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 >Feature sequence050 464 2350 gene locus_tag LOCUS_07480 gene mnmG 464 2350 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864546.1 protein_id gnl|my_center|LOCUS_07480 2723 2385 gene locus_tag LOCUS_07490 gene glnB 2723 2385 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005436810.1 protein_id gnl|my_center|LOCUS_07490 3998 2733 gene locus_tag LOCUS_07500 3998 2733 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545822.1 protein_id gnl|my_center|LOCUS_07500 4142 5371 gene locus_tag LOCUS_07510 4142 5371 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_07510 5364 6227 gene locus_tag LOCUS_07520 gene sppA 5364 6227 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851869.1 protein_id gnl|my_center|LOCUS_07520 7475 6222 gene locus_tag LOCUS_07530 gene xseA 7475 6222 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382848.1 protein_id gnl|my_center|LOCUS_07530 8212 7502 gene locus_tag LOCUS_07540 gene ubiE 8212 7502 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858648.1 protein_id gnl|my_center|LOCUS_07540 9703 8297 gene locus_tag LOCUS_07550 9703 8297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 9741 10052 gene locus_tag LOCUS_07560 9741 10052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence051 1134 112 gene locus_tag LOCUS_07570 1134 112 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453999.1 protein_id gnl|my_center|LOCUS_07570 2137 1139 gene locus_tag LOCUS_07580 gene purM 2137 1139 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 protein_id gnl|my_center|LOCUS_07580 2372 2151 gene locus_tag LOCUS_07590 2372 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 2442 3035 gene locus_tag LOCUS_07600 gene coaE 2442 3035 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000243282.1 protein_id gnl|my_center|LOCUS_07600 3016 3771 gene locus_tag LOCUS_07610 gene dapF 3016 3771 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_07610 3785 4537 gene locus_tag LOCUS_07620 3785 4537 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851407.1 protein_id gnl|my_center|LOCUS_07620 5613 4546 gene locus_tag LOCUS_07630 gene prfA 5613 4546 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851189.1 protein_id gnl|my_center|LOCUS_07630 5910 5635 gene locus_tag LOCUS_07640 gene rpsT 5910 5635 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_07640 7213 5972 gene locus_tag LOCUS_07650 7213 5972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 8474 7317 gene locus_tag LOCUS_07660 8474 7317 CDS product N(5)-(carboxyethyl)ornithine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013225455.1 protein_id gnl|my_center|LOCUS_07660 9158 8673 gene locus_tag LOCUS_07670 9158 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 10033 9281 gene locus_tag LOCUS_07680 gene nfsA 10033 9281 CDS product oxygen-insensitive NADPH nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234479.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence052 149 556 gene locus_tag LOCUS_07690 149 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 940 2307 gene locus_tag LOCUS_07700 940 2307 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868347.1 protein_id gnl|my_center|LOCUS_07700 2338 3483 gene locus_tag LOCUS_07710 gene gmd 2338 3483 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000659810.1 protein_id gnl|my_center|LOCUS_07710 3492 4451 gene locus_tag LOCUS_07720 3492 4451 CDS product GDP-L-fucose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000410273.1 protein_id gnl|my_center|LOCUS_07720 4610 5635 gene locus_tag LOCUS_07730 gene recA 4610 5635 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851424.1 protein_id gnl|my_center|LOCUS_07730 5632 6900 gene locus_tag LOCUS_07740 gene eno 5632 6900 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955673.1 protein_id gnl|my_center|LOCUS_07740 6903 7175 gene locus_tag LOCUS_07750 6903 7175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 7184 7888 gene locus_tag LOCUS_07760 7184 7888 CDS product AMIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260967.1 protein_id gnl|my_center|LOCUS_07760 9024 7867 gene locus_tag LOCUS_07770 9024 7867 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855678.1 protein_id gnl|my_center|LOCUS_07770 9874 9035 gene locus_tag LOCUS_07780 9874 9035 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851400.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence053 234 983 gene locus_tag LOCUS_07790 234 983 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858657.1 protein_id gnl|my_center|LOCUS_07790 1008 1964 gene locus_tag LOCUS_07800 1008 1964 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851778.1 protein_id gnl|my_center|LOCUS_07800 1964 4276 gene locus_tag LOCUS_07810 1964 4276 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_07810 4280 4786 gene locus_tag LOCUS_07820 4280 4786 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826355.1 protein_id gnl|my_center|LOCUS_07820 5689 4769 gene locus_tag LOCUS_07830 5689 4769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 5806 6426 gene locus_tag LOCUS_07840 gene serB 5806 6426 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_07840 6435 7427 gene locus_tag LOCUS_07850 6435 7427 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851728.1 protein_id gnl|my_center|LOCUS_07850 7433 8602 gene locus_tag LOCUS_07860 7433 8602 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_07860 8644 9180 gene locus_tag LOCUS_07870 8644 9180 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002791314.1 protein_id gnl|my_center|LOCUS_07870 9182 9754 gene locus_tag LOCUS_07880 gene pth 9182 9754 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858659.1 protein_id gnl|my_center|LOCUS_07880 >Feature sequence054 262 137 gene locus_tag LOCUS_07890 262 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 501 310 gene locus_tag LOCUS_07900 501 310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1457 1287 gene locus_tag LOCUS_07910 1457 1287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 1680 1438 gene locus_tag LOCUS_07920 1680 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2254 1673 gene locus_tag LOCUS_07930 2254 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 3542 2244 gene locus_tag LOCUS_07940 3542 2244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4789 3539 gene locus_tag LOCUS_07950 4789 3539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5024 4791 gene locus_tag LOCUS_07960 5024 4791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 6869 5025 gene locus_tag LOCUS_07970 6869 5025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7477 6866 gene locus_tag LOCUS_07980 7477 6866 CDS product TraX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130487.1 protein_id gnl|my_center|LOCUS_07980 7595 7470 gene locus_tag LOCUS_07990 7595 7470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 8090 7596 gene locus_tag LOCUS_08000 8090 7596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 8120 8416 gene locus_tag LOCUS_08010 8120 8416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 8650 8363 gene locus_tag LOCUS_08020 8650 8363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 9278 8661 gene locus_tag LOCUS_08030 9278 8661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 >Feature sequence055 508 1848 gene locus_tag LOCUS_08040 gene clcA 508 1848 CDS product H(+)/Cl(-) exchange transporter ClcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005463563.1 protein_id gnl|my_center|LOCUS_08040 3258 1843 gene locus_tag LOCUS_08050 3258 1843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 5059 3260 gene locus_tag LOCUS_08060 5059 3260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 5647 5063 gene locus_tag LOCUS_08070 5647 5063 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_08070 6516 5656 gene locus_tag LOCUS_08080 6516 5656 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868911.1 protein_id gnl|my_center|LOCUS_08080 7962 6577 gene locus_tag LOCUS_08090 7962 6577 CDS product GTPase/DUF3482 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269201.1 protein_id gnl|my_center|LOCUS_08090 9461 8085 gene locus_tag LOCUS_08100 9461 8085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 >Feature sequence056 1498 617 gene locus_tag LOCUS_08110 1498 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 1599 2264 gene locus_tag LOCUS_08120 1599 2264 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002358569.1 protein_id gnl|my_center|LOCUS_08120 2877 2254 gene locus_tag LOCUS_08130 gene thiE 2877 2254 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939368.1 protein_id gnl|my_center|LOCUS_08130 3998 2874 gene locus_tag LOCUS_08140 gene thiH 3998 2874 CDS product 2-iminoacetate synthase ThiH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393166.1 protein_id gnl|my_center|LOCUS_08140 4761 3991 gene locus_tag LOCUS_08150 4761 3991 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393165.1 protein_id gnl|my_center|LOCUS_08150 4966 4763 gene locus_tag LOCUS_08160 4966 4763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 5750 4959 gene locus_tag LOCUS_08170 gene thiD 5750 4959 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948213.1 protein_id gnl|my_center|LOCUS_08170 6183 5947 gene locus_tag LOCUS_08180 6183 5947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 7142 6192 gene locus_tag LOCUS_08190 gene lpxD 7142 6192 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852180.1 protein_id gnl|my_center|LOCUS_08190 7615 7145 gene locus_tag LOCUS_08200 gene ilvN 7615 7145 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852211.1 protein_id gnl|my_center|LOCUS_08200 9359 7668 gene locus_tag LOCUS_08210 9359 7668 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852093.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence057 <1 734 gene locus_tag LOCUS_08220 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891884.1:HrcA family transcriptional regulator 736 1281 gene locus_tag LOCUS_08230 gene grpE 736 1281 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780052.1 protein_id gnl|my_center|LOCUS_08230 1309 3207 gene locus_tag LOCUS_08240 gene dnaK 1309 3207 CDS product molecular chaperone DnaK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826316.1 protein_id gnl|my_center|LOCUS_08240 3200 3679 gene locus_tag LOCUS_08250 3200 3679 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853175.1 protein_id gnl|my_center|LOCUS_08250 3792 5687 gene locus_tag LOCUS_08260 gene dsbD 3792 5687 CDS product protein-disulfide reductase DsbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958394.1 protein_id gnl|my_center|LOCUS_08260 5738 6949 gene locus_tag LOCUS_08270 5738 6949 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864549.1 protein_id gnl|my_center|LOCUS_08270 6959 8194 gene locus_tag LOCUS_08280 6959 8194 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542453.1 protein_id gnl|my_center|LOCUS_08280 8191 8772 gene locus_tag LOCUS_08290 8191 8772 CDS product dipeptide/oligopeptide/nickel ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002439671.1 protein_id gnl|my_center|LOCUS_08290 8775 9230 gene locus_tag LOCUS_08300 8775 9230 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence058 383 1279 gene locus_tag LOCUS_08310 gene ppk2 383 1279 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_08310 1290 2144 gene locus_tag LOCUS_08320 gene ppk2 1290 2144 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_08320 2224 3153 gene locus_tag LOCUS_08330 2224 3153 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853293.1 protein_id gnl|my_center|LOCUS_08330 3235 5028 gene locus_tag LOCUS_08340 gene lepA 3235 5028 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002837927.1 protein_id gnl|my_center|LOCUS_08340 5047 5625 gene locus_tag LOCUS_08350 5047 5625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 5679 6254 gene locus_tag LOCUS_08360 5679 6254 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852959.1 protein_id gnl|my_center|LOCUS_08360 6303 8789 gene locus_tag LOCUS_08370 gene gyrA 6303 8789 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001153763.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence059 2282 969 gene locus_tag LOCUS_08380 gene rimO 2282 969 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 protein_id gnl|my_center|LOCUS_08380 2882 2292 gene locus_tag LOCUS_08390 2882 2292 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003132255.1 protein_id gnl|my_center|LOCUS_08390 3735 2911 gene locus_tag LOCUS_08400 gene panC 3735 2911 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264323.1 protein_id gnl|my_center|LOCUS_08400 3802 4902 gene locus_tag LOCUS_08410 gene prfB 3802 4902 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851475.1 protein_id gnl|my_center|LOCUS_08410 4918 5247 gene locus_tag LOCUS_08420 4918 5247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 6864 5257 gene locus_tag LOCUS_08430 6864 5257 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891914.1 protein_id gnl|my_center|LOCUS_08430 7678 6926 gene locus_tag LOCUS_08440 gene murI 7678 6926 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851499.1 protein_id gnl|my_center|LOCUS_08440 9023 7671 gene locus_tag LOCUS_08450 gene rho 9023 7671 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852852.1 protein_id gnl|my_center|LOCUS_08450 >Feature sequence060 33 773 gene locus_tag LOCUS_08460 33 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 842 1027 gene locus_tag LOCUS_08470 842 1027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1805 1032 gene locus_tag LOCUS_08480 1805 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 2299 1958 gene locus_tag LOCUS_08490 gene hypA 2299 1958 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072153.1 protein_id gnl|my_center|LOCUS_08490 3297 2299 gene locus_tag LOCUS_08500 gene hypE 3297 2299 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072154.1 protein_id gnl|my_center|LOCUS_08500 3677 3306 gene locus_tag LOCUS_08510 3677 3306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 4835 3711 gene locus_tag LOCUS_08520 gene hypD 4835 3711 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072155.1 protein_id gnl|my_center|LOCUS_08520 5076 4822 gene locus_tag LOCUS_08530 5076 4822 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776342.1 protein_id gnl|my_center|LOCUS_08530 5825 5076 gene locus_tag LOCUS_08540 gene hypB 5825 5076 CDS product hydrogenase nickel incorporation protein HypB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072157.1 protein_id gnl|my_center|LOCUS_08540 6865 5840 gene locus_tag LOCUS_08550 6865 5840 CDS product HoxN/HupN/NixA family nickel/cobalt transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780430.1 protein_id gnl|my_center|LOCUS_08550 6992 7645 gene locus_tag LOCUS_08560 6992 7645 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08560 7712 8899 gene locus_tag LOCUS_08570 7712 8899 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089820.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence061 2369 1179 gene locus_tag LOCUS_08580 2369 1179 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941028.1 protein_id gnl|my_center|LOCUS_08580 3925 2426 gene locus_tag LOCUS_08590 3925 2426 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_08590 5536 3992 gene locus_tag LOCUS_08600 5536 3992 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022095.1 protein_id gnl|my_center|LOCUS_08600 6072 5683 gene locus_tag LOCUS_08610 gene rpsI 6072 5683 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851459.1 protein_id gnl|my_center|LOCUS_08610 6509 6075 gene locus_tag LOCUS_08620 gene rplM 6509 6075 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 protein_id gnl|my_center|LOCUS_08620 6656 7696 gene locus_tag LOCUS_08630 6656 7696 CDS product phospholipase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864239.1 protein_id gnl|my_center|LOCUS_08630 7841 8395 gene locus_tag LOCUS_08640 gene petA 7841 8395 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852880.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence062 383 264 gene locus_tag LOCUS_08650 383 264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 493 2193 gene locus_tag LOCUS_08660 493 2193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 >Feature sequence063 413 1036 gene locus_tag LOCUS_08670 413 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 1033 2568 gene locus_tag LOCUS_08680 gene purH 1033 2568 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853339.1 protein_id gnl|my_center|LOCUS_08680 2968 2549 gene locus_tag LOCUS_08690 2968 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 4212 2977 gene locus_tag LOCUS_08700 4212 2977 CDS product ArsS family sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853241.1 protein_id gnl|my_center|LOCUS_08700 4900 4223 gene locus_tag LOCUS_08710 4900 4223 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853196.1 protein_id gnl|my_center|LOCUS_08710 6364 4913 gene locus_tag LOCUS_08720 gene htrA 6364 4913 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853235.1 protein_id gnl|my_center|LOCUS_08720 6521 7402 gene locus_tag LOCUS_08730 6521 7402 CDS product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853234.1 protein_id gnl|my_center|LOCUS_08730 7404 7778 gene locus_tag LOCUS_08740 gene hspR 7404 7778 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_08740 7847 8077 gene locus_tag LOCUS_08750 7847 8077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 >Feature sequence064 <1 731 gene locus_tag LOCUS_08760 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964573.1:cation diffusion facilitator family transporter 811 2067 gene locus_tag LOCUS_08770 gene arsB 811 2067 CDS product arsenite efflux transporter membrane subunit ArsB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002455949.1 protein_id gnl|my_center|LOCUS_08770 2076 2840 gene locus_tag LOCUS_08780 2076 2840 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851426.1 protein_id gnl|my_center|LOCUS_08780 2854 3873 gene locus_tag LOCUS_08790 2854 3873 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002185292.1 protein_id gnl|my_center|LOCUS_08790 4062 3874 gene locus_tag LOCUS_08800 4062 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 4460 4062 gene locus_tag LOCUS_08810 4460 4062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 4501 4600 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 6255 4858 gene locus_tag LOCUS_08820 6255 4858 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002678947.1 protein_id gnl|my_center|LOCUS_08820 7772 6270 gene locus_tag LOCUS_08830 7772 6270 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851902.1 protein_id gnl|my_center|LOCUS_08830 8294 7776 gene locus_tag LOCUS_08840 gene def 8294 7776 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851936.1 protein_id gnl|my_center|LOCUS_08840 >Feature sequence065 1455 640 gene locus_tag LOCUS_08850 gene nadC 1455 640 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405980.1 protein_id gnl|my_center|LOCUS_08850 1604 1703 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2221 2859 gene locus_tag LOCUS_08860 gene plsY 2221 2859 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 protein_id gnl|my_center|LOCUS_08860 2871 3215 gene locus_tag LOCUS_08870 2871 3215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 3212 4744 gene locus_tag LOCUS_08880 3212 4744 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_138361510.1 protein_id gnl|my_center|LOCUS_08880 4741 6243 gene locus_tag LOCUS_08890 4741 6243 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_08890 6327 6998 gene locus_tag LOCUS_08900 gene hsrA 6327 6998 CDS product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 protein_id gnl|my_center|LOCUS_08900 6977 8290 gene locus_tag LOCUS_08910 6977 8290 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_08910 >Feature sequence066 <1 794 gene locus_tag LOCUS_08920 <1 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010939854.1:magnesium transporter CorA family protein 1697 801 gene locus_tag LOCUS_08930 1697 801 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_08930 1788 3032 gene locus_tag LOCUS_08940 1788 3032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 2192 2291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3121 3630 gene locus_tag LOCUS_08950 gene tpx 3121 3630 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_08950 5692 3740 gene locus_tag LOCUS_08960 5692 3740 CDS product potassium transporter Kup inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942985.1 protein_id gnl|my_center|LOCUS_08960 8081 5829 gene locus_tag LOCUS_08970 8081 5829 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404537.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence067 <1 1701 gene locus_tag LOCUS_08980 <1 1701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858717.1:1-deoxy-D-xylulose-5-phosphate synthase 2310 1714 gene locus_tag LOCUS_08990 2310 1714 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854219.1 protein_id gnl|my_center|LOCUS_08990 2462 3619 gene locus_tag LOCUS_09000 gene metK 2462 3619 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000655178.1 protein_id gnl|my_center|LOCUS_09000 3676 3954 gene locus_tag LOCUS_09010 3676 3954 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_09010 4105 4518 gene locus_tag LOCUS_09020 gene ndk 4105 4518 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_09020 4598 4753 gene locus_tag LOCUS_09030 gene rpmF 4598 4753 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858674.1 protein_id gnl|my_center|LOCUS_09030 4753 5751 gene locus_tag LOCUS_09040 gene plsX 4753 5751 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 protein_id gnl|my_center|LOCUS_09040 5761 6753 gene locus_tag LOCUS_09050 5761 6753 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_09050 6825 7772 gene locus_tag LOCUS_09060 6825 7772 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence068 <1 852 gene locus_tag LOCUS_09070 <1 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002888538.1:homoserine kinase 857 1105 gene locus_tag LOCUS_09080 857 1105 CDS product YlxR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001232480.1 protein_id gnl|my_center|LOCUS_09080 1098 3698 gene locus_tag LOCUS_09090 gene infB 1098 3698 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864659.1 protein_id gnl|my_center|LOCUS_09090 3691 4065 gene locus_tag LOCUS_09100 gene rbfA 3691 4065 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778650.1 protein_id gnl|my_center|LOCUS_09100 4055 4486 gene locus_tag LOCUS_09110 gene rimP 4055 4486 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 protein_id gnl|my_center|LOCUS_09110 4480 5490 gene locus_tag LOCUS_09120 gene ribD 4480 5490 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891948.1 protein_id gnl|my_center|LOCUS_09120 6942 5482 gene locus_tag LOCUS_09130 6942 5482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 5914 6013 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 8059 7040 gene locus_tag LOCUS_09140 8059 7040 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459299.1 protein_id gnl|my_center|LOCUS_09140 >Feature sequence069 668 153 gene locus_tag LOCUS_09150 668 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 1411 692 gene locus_tag LOCUS_09160 1411 692 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921582.1 protein_id gnl|my_center|LOCUS_09160 2416 1421 gene locus_tag LOCUS_09170 2416 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 3092 2406 gene locus_tag LOCUS_09180 3092 2406 CDS product EI24 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002819467.1 protein_id gnl|my_center|LOCUS_09180 4447 3140 gene locus_tag LOCUS_09190 4447 3140 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_09190 5096 4437 gene locus_tag LOCUS_09200 5096 4437 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963972.1 protein_id gnl|my_center|LOCUS_09200 5561 5124 gene locus_tag LOCUS_09210 5561 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 6693 5650 gene locus_tag LOCUS_09220 6693 5650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 7007 6723 gene locus_tag LOCUS_09230 7007 6723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 6931 7134 gene locus_tag LOCUS_09240 6931 7134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 8130 7369 gene locus_tag LOCUS_09250 8130 7369 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030868.1 protein_id gnl|my_center|LOCUS_09250 >Feature sequence070 2 124 gene locus_tag LOCUS_09260 2 124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 121 918 gene locus_tag LOCUS_09270 121 918 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853489.1 protein_id gnl|my_center|LOCUS_09270 915 2048 gene locus_tag LOCUS_09280 915 2048 CDS product succinyldiaminopimelate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000142409.1 protein_id gnl|my_center|LOCUS_09280 2041 3348 gene locus_tag LOCUS_09290 gene murC 2041 3348 CDS product UDP-N-acetylmuramate--L-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891904.1 protein_id gnl|my_center|LOCUS_09290 3348 3689 gene locus_tag LOCUS_09300 3348 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09300 3693 5897 gene locus_tag LOCUS_09310 3693 5897 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 protein_id gnl|my_center|LOCUS_09310 5984 6475 gene locus_tag LOCUS_09320 5984 6475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 6477 7577 gene locus_tag LOCUS_09330 gene dapE 6477 7577 CDS product succinyl-diaminopimelate desuccinylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854067.1 protein_id gnl|my_center|LOCUS_09330 7581 7955 gene locus_tag LOCUS_09340 7581 7955 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000869815.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence071 595 68 gene locus_tag LOCUS_09350 595 68 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082922.1 protein_id gnl|my_center|LOCUS_09350 2657 597 gene locus_tag LOCUS_09360 gene topA 2657 597 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851268.1 protein_id gnl|my_center|LOCUS_09360 3512 2712 gene locus_tag LOCUS_09370 3512 2712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 3828 3529 gene locus_tag LOCUS_09380 3828 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 5311 3971 gene locus_tag LOCUS_09390 gene glmM 5311 3971 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860288.1 protein_id gnl|my_center|LOCUS_09390 6385 5351 gene locus_tag LOCUS_09400 6385 5351 CDS product YeiH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766269.1 protein_id gnl|my_center|LOCUS_09400 6545 7426 gene locus_tag LOCUS_09410 6545 7426 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852976.1 protein_id gnl|my_center|LOCUS_09410 7475 7552 gene locus_tag LOCUS_t00110 7475 7552 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7573 7649 gene locus_tag LOCUS_t00120 7573 7649 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 7658 7734 gene locus_tag LOCUS_t00130 7658 7734 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7751 7827 gene locus_tag LOCUS_t00140 7751 7827 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 7916 8000 gene locus_tag LOCUS_t00150 7916 8000 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence072 107 775 gene locus_tag LOCUS_09420 gene dccR 107 775 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_09420 2267 822 gene locus_tag LOCUS_09430 gene accC 2267 822 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880952.1 protein_id gnl|my_center|LOCUS_09430 3488 2286 gene locus_tag LOCUS_09440 gene trpB 3488 2286 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002722206.1 protein_id gnl|my_center|LOCUS_09440 4103 3489 gene locus_tag LOCUS_09450 4103 3489 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858199.1 protein_id gnl|my_center|LOCUS_09450 6273 4174 gene locus_tag LOCUS_09460 gene recQ 6273 4174 CDS product DNA helicase RecQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957598.1 protein_id gnl|my_center|LOCUS_09460 6358 7773 gene locus_tag LOCUS_09470 6358 7773 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence073 2289 841 gene locus_tag LOCUS_09480 gene guaB 2289 841 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852968.1 protein_id gnl|my_center|LOCUS_09480 3659 2304 gene locus_tag LOCUS_09490 gene gatA 3659 2304 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853884.1 protein_id gnl|my_center|LOCUS_09490 3901 3689 gene locus_tag LOCUS_09500 3901 3689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 6563 3786 gene locus_tag LOCUS_09510 gene ileS 6563 3786 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002907389.1 protein_id gnl|my_center|LOCUS_09510 >Feature sequence074 <1 1236 gene locus_tag LOCUS_09520 <1 1236 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852577.1:3-phosphoshikimate 1-carboxyvinyltransferase 1226 2050 gene locus_tag LOCUS_09530 1226 2050 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_09530 2148 3833 gene locus_tag LOCUS_09540 2148 3833 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852520.1 protein_id gnl|my_center|LOCUS_09540 3875 4366 gene locus_tag LOCUS_09550 3875 4366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 4392 5978 gene locus_tag LOCUS_09560 gene serA 4392 5978 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852643.1 protein_id gnl|my_center|LOCUS_09560 6070 7440 gene locus_tag LOCUS_09570 6070 7440 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555881.1 protein_id gnl|my_center|LOCUS_09570 >Feature sequence075 656 57 gene locus_tag LOCUS_09580 656 57 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880156.1 protein_id gnl|my_center|LOCUS_09580 2127 745 gene locus_tag LOCUS_09590 2127 745 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852536.1 protein_id gnl|my_center|LOCUS_09590 2786 2121 gene locus_tag LOCUS_09600 2786 2121 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860529.1 protein_id gnl|my_center|LOCUS_09600 3451 2789 gene locus_tag LOCUS_09610 3451 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 4236 3451 gene locus_tag LOCUS_09620 gene pstB 4236 3451 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546432.1 protein_id gnl|my_center|LOCUS_09620 5051 4239 gene locus_tag LOCUS_09630 gene pstA 5051 4239 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005650601.1 protein_id gnl|my_center|LOCUS_09630 5909 5055 gene locus_tag LOCUS_09640 gene pstC 5909 5055 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545177.1 protein_id gnl|my_center|LOCUS_09640 7005 6013 gene locus_tag LOCUS_09650 gene pstS 7005 6013 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881320.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence076 <1 877 gene locus_tag LOCUS_09660 <1 877 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858826.1:cytochrome ubiquinol oxidase subunit I 877 2001 gene locus_tag LOCUS_09670 gene cydB 877 2001 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851984.1 protein_id gnl|my_center|LOCUS_09670 2010 2132 gene locus_tag LOCUS_09680 2010 2132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2144 3949 gene locus_tag LOCUS_09690 gene uvrC 2144 3949 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774319.1 protein_id gnl|my_center|LOCUS_09690 4544 3936 gene locus_tag LOCUS_09700 gene hisG 4544 3936 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000956489.1 protein_id gnl|my_center|LOCUS_09700 5191 4556 gene locus_tag LOCUS_09710 5191 4556 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864777.1 protein_id gnl|my_center|LOCUS_09710 5492 5163 gene locus_tag LOCUS_09720 5492 5163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 6336 5509 gene locus_tag LOCUS_09730 gene xerD 6336 5509 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583825.1 protein_id gnl|my_center|LOCUS_09730 7355 6345 gene locus_tag LOCUS_09740 7355 6345 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858656.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence077 <1 558 gene locus_tag LOCUS_09750 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858833.1:DNA topoisomerase (ATP-hydrolyzing) subunit B 759 1967 gene locus_tag LOCUS_09760 759 1967 CDS product GGDEF domain-containing phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454122.1 protein_id gnl|my_center|LOCUS_09760 1979 2368 gene locus_tag LOCUS_09770 gene queF 1979 2368 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 protein_id gnl|my_center|LOCUS_09770 2346 3554 gene locus_tag LOCUS_09780 2346 3554 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_09780 3826 4911 gene locus_tag LOCUS_09790 3826 4911 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483136.1 protein_id gnl|my_center|LOCUS_09790 4943 5695 gene locus_tag LOCUS_09800 4943 5695 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760113.1 protein_id gnl|my_center|LOCUS_09800 5692 7053 gene locus_tag LOCUS_09810 5692 7053 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121485.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence078 1629 631 gene locus_tag LOCUS_09820 gene pyrC 1629 631 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852008.1 protein_id gnl|my_center|LOCUS_09820 2993 1626 gene locus_tag LOCUS_09830 2993 1626 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000355104.1 protein_id gnl|my_center|LOCUS_09830 3093 3168 gene locus_tag LOCUS_t00160 3093 3168 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3334 5154 gene locus_tag LOCUS_09840 gene thrS 3334 5154 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 protein_id gnl|my_center|LOCUS_09840 5151 5672 gene locus_tag LOCUS_09850 gene infC 5151 5672 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 protein_id gnl|my_center|LOCUS_09850 5763 5954 gene locus_tag LOCUS_09860 gene rpmI 5763 5954 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002553160.1 protein_id gnl|my_center|LOCUS_09860 6070 6420 gene locus_tag LOCUS_09870 gene rplT 6070 6420 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_09870 6469 6681 gene locus_tag LOCUS_09880 gene rpsU 6469 6681 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780697.1 protein_id gnl|my_center|LOCUS_09880 >Feature sequence079 155 832 gene locus_tag LOCUS_09890 155 832 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864474.1 protein_id gnl|my_center|LOCUS_09890 1003 2001 gene locus_tag LOCUS_09900 1003 2001 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089174.1 protein_id gnl|my_center|LOCUS_09900 2626 2725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2792 3445 gene locus_tag LOCUS_09910 2792 3445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 3734 3955 gene locus_tag LOCUS_09920 3734 3955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 3937 4068 gene locus_tag LOCUS_09930 3937 4068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4260 5558 gene locus_tag LOCUS_09940 4260 5558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5713 6492 gene locus_tag LOCUS_09950 5713 6492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 6489 6848 gene locus_tag LOCUS_09960 6489 6848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 >Feature sequence080 947 291 gene locus_tag LOCUS_09970 947 291 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853081.1 protein_id gnl|my_center|LOCUS_09970 1747 986 gene locus_tag LOCUS_09980 1747 986 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_09980 2153 1737 gene locus_tag LOCUS_09990 2153 1737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 2529 2167 gene locus_tag LOCUS_10000 2529 2167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 5617 2522 gene locus_tag LOCUS_10010 5617 2522 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_10010 6670 5621 gene locus_tag LOCUS_10020 6670 5621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence081 1323 670 gene locus_tag LOCUS_10030 gene dccR 1323 670 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_10030 1317 2027 gene locus_tag LOCUS_10040 1317 2027 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948163.1 protein_id gnl|my_center|LOCUS_10040 3408 2017 gene locus_tag LOCUS_10050 3408 2017 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963764.1 protein_id gnl|my_center|LOCUS_10050 3587 3512 gene locus_tag LOCUS_t00170 3587 3512 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4842 3628 gene locus_tag LOCUS_10060 gene murD 4842 3628 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_10060 5912 4848 gene locus_tag LOCUS_10070 gene mraY 5912 4848 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence082 <1 1110 gene locus_tag LOCUS_10080 <1 1110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880660.1:EmrA/EmrK family multidrug efflux transporter periplasmic adaptor subunit 1107 2663 gene locus_tag LOCUS_10090 1107 2663 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880661.1 protein_id gnl|my_center|LOCUS_10090 2660 3949 gene locus_tag LOCUS_10100 2660 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 4052 4522 gene locus_tag LOCUS_10110 4052 4522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 4500 4688 gene locus_tag LOCUS_10120 4500 4688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 6037 4820 gene locus_tag LOCUS_10130 6037 4820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 <6788 6178 gene locus_tag LOCUS_10140 <6788 6178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902175.1:TRIC cation channel family protein >Feature sequence083 <1 1736 gene locus_tag LOCUS_10150 <1 1736 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_211204934.1:site-specific DNA-methyltransferase 1737 3860 gene locus_tag LOCUS_10160 1737 3860 CDS product KAP family P-loop domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080141.1 protein_id gnl|my_center|LOCUS_10160 3864 4682 gene locus_tag LOCUS_10170 3864 4682 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_10170 >Feature sequence084 1620 43 gene locus_tag LOCUS_10180 gene recJ 1620 43 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 protein_id gnl|my_center|LOCUS_10180 3247 1613 gene locus_tag LOCUS_10190 3247 1613 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853102.1 protein_id gnl|my_center|LOCUS_10190 3852 3418 gene locus_tag LOCUS_10200 3852 3418 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986893.1 protein_id gnl|my_center|LOCUS_10200 4490 3849 gene locus_tag LOCUS_10210 4490 3849 CDS product NAAT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871201.1 protein_id gnl|my_center|LOCUS_10210 6257 4563 gene locus_tag LOCUS_10220 gene ilvD 6257 4563 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 protein_id gnl|my_center|LOCUS_10220 6349 6423 gene locus_tag LOCUS_t00180 6349 6423 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence085 1337 510 gene locus_tag LOCUS_10230 gene xerC 1337 510 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_10230 1668 1321 gene locus_tag LOCUS_10240 1668 1321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2396 1770 gene locus_tag LOCUS_10250 2396 1770 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867614.1 protein_id gnl|my_center|LOCUS_10250 3705 2389 gene locus_tag LOCUS_10260 gene miaB 3705 2389 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858634.1 protein_id gnl|my_center|LOCUS_10260 3959 3717 gene locus_tag LOCUS_10270 3959 3717 CDS product HP0268 family nuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859022.1 protein_id gnl|my_center|LOCUS_10270 4120 5235 gene locus_tag LOCUS_10280 gene nusA 4120 5235 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858478.1 protein_id gnl|my_center|LOCUS_10280 5253 6065 gene locus_tag LOCUS_10290 gene moeB 5253 6065 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942003.1 protein_id gnl|my_center|LOCUS_10290 6062 6289 gene locus_tag LOCUS_10300 6062 6289 CDS product sulfurtransferase TusA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393466.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence086 711 484 gene locus_tag LOCUS_10310 711 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1072 686 gene locus_tag LOCUS_10320 gene fliS 1072 686 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776169.1 protein_id gnl|my_center|LOCUS_10320 1333 1076 gene locus_tag LOCUS_10330 1333 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 1798 1897 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3054 2683 gene locus_tag LOCUS_10340 3054 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 3178 3543 gene locus_tag LOCUS_10350 3178 3543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851272.1 protein_id gnl|my_center|LOCUS_10350 3533 4111 gene locus_tag LOCUS_10360 3533 4111 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 protein_id gnl|my_center|LOCUS_10360 4164 5213 gene locus_tag LOCUS_10370 4164 5213 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858049.1 protein_id gnl|my_center|LOCUS_10370 5223 5510 gene locus_tag LOCUS_10380 5223 5510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 5565 5762 gene locus_tag LOCUS_10390 5565 5762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 5797 6225 gene locus_tag LOCUS_10400 5797 6225 CDS product flagellar protein FlgN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779263.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence087 2201 1524 gene locus_tag LOCUS_10410 2201 1524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 2980 2198 gene locus_tag LOCUS_10420 2980 2198 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851821.1 protein_id gnl|my_center|LOCUS_10420 3146 3373 gene locus_tag LOCUS_10430 3146 3373 CDS product SHOCT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021345.1 protein_id gnl|my_center|LOCUS_10430 3589 3413 gene locus_tag LOCUS_10440 3589 3413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 3768 3574 gene locus_tag LOCUS_10450 3768 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10450 4705 3782 gene locus_tag LOCUS_10460 4705 3782 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003974806.1 protein_id gnl|my_center|LOCUS_10460 4978 4715 gene locus_tag LOCUS_10470 4978 4715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 5376 4996 gene locus_tag LOCUS_10480 5376 4996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10480 5525 5866 gene locus_tag LOCUS_10490 5525 5866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 >Feature sequence088 999 787 gene locus_tag LOCUS_10500 999 787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1396 1076 gene locus_tag LOCUS_10510 1396 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1496 1672 gene locus_tag LOCUS_10520 1496 1672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 1659 3104 gene locus_tag LOCUS_10530 gene nadB 1659 3104 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_10530 3115 4485 gene locus_tag LOCUS_10540 gene nhaD 3115 4485 CDS product sodium:proton antiporter NhaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482814.1 protein_id gnl|my_center|LOCUS_10540 4513 6048 gene locus_tag LOCUS_10550 gene guaA 4513 6048 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853189.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence089 880 2 gene locus_tag LOCUS_10560 880 2 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853261.1 protein_id gnl|my_center|LOCUS_10560 993 1139 gene locus_tag LOCUS_10570 993 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1155 1382 gene locus_tag LOCUS_10580 1155 1382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 1524 1745 gene locus_tag LOCUS_10590 1524 1745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1807 2244 gene locus_tag LOCUS_10600 1807 2244 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053808215.1 protein_id gnl|my_center|LOCUS_10600 2437 2670 gene locus_tag LOCUS_10610 2437 2670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 2663 4762 gene locus_tag LOCUS_10620 gene feoB 2663 4762 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_10620 4818 5105 gene locus_tag LOCUS_10630 4818 5105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 6088 5210 gene locus_tag LOCUS_10640 6088 5210 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853697.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence090 1037 261 gene locus_tag LOCUS_10650 1037 261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 2073 1045 gene locus_tag LOCUS_10660 gene fliG 2073 1045 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_10660 3791 2070 gene locus_tag LOCUS_10670 gene fliF 3791 2070 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364750.1 protein_id gnl|my_center|LOCUS_10670 4921 3794 gene locus_tag LOCUS_10680 gene hisC 4921 3794 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 protein_id gnl|my_center|LOCUS_10680 5976 4918 gene locus_tag LOCUS_10690 gene pheA 5976 4918 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_10690 >Feature sequence091 865 209 gene locus_tag LOCUS_10700 865 209 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933408.1 protein_id gnl|my_center|LOCUS_10700 1455 940 gene locus_tag LOCUS_10710 1455 940 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932996.1 protein_id gnl|my_center|LOCUS_10710 1640 2398 gene locus_tag LOCUS_10720 gene hisF 1640 2398 CDS product imidazole glycerol phosphate synthase subunit HisF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880065.1 protein_id gnl|my_center|LOCUS_10720 2398 2925 gene locus_tag LOCUS_10730 2398 2925 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853142.1 protein_id gnl|my_center|LOCUS_10730 2912 4000 gene locus_tag LOCUS_10740 gene rlmN 2912 4000 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_10740 5036 4155 gene locus_tag LOCUS_10750 5036 4155 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891825.1 protein_id gnl|my_center|LOCUS_10750 6004 5036 gene locus_tag LOCUS_10760 6004 5036 CDS product integron integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035598.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence092 53 2026 gene locus_tag LOCUS_10770 gene uvrB 53 2026 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855027.1 protein_id gnl|my_center|LOCUS_10770 2071 4167 gene locus_tag LOCUS_10780 2071 4167 CDS product RNA degradosome polyphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860421.1 protein_id gnl|my_center|LOCUS_10780 4203 4724 gene locus_tag LOCUS_10790 4203 4724 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851622.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence093 1486 665 gene locus_tag LOCUS_10800 1486 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 4289 1488 gene locus_tag LOCUS_10810 gene uvrA 4289 1488 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858721.1 protein_id gnl|my_center|LOCUS_10810 5032 4289 gene locus_tag LOCUS_10820 5032 4289 CDS product TSUP family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858695.1 protein_id gnl|my_center|LOCUS_10820 5140 5571 gene locus_tag LOCUS_10830 5140 5571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 5572 5874 gene locus_tag LOCUS_10840 gene fliN 5572 5874 CDS product flagellar motor switch protein FliN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824739.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence094 <1 765 gene locus_tag LOCUS_10850 <1 765 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852574.1:4-hydroxy-tetrahydrodipicolinate synthase 767 1552 gene locus_tag LOCUS_10860 767 1552 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891889.1 protein_id gnl|my_center|LOCUS_10860 1567 2103 gene locus_tag LOCUS_10870 gene pgsA 1567 2103 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_10870 2118 3170 gene locus_tag LOCUS_10880 gene rseP 2118 3170 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_10880 3767 3866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3890 4078 gene locus_tag LOCUS_10890 3890 4078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10890 5010 4360 gene locus_tag LOCUS_10900 5010 4360 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003719245.1 protein_id gnl|my_center|LOCUS_10900 <5961 5007 gene locus_tag LOCUS_10910 <5961 5007 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864101.1:TrkH family potassium uptake protein >Feature sequence095 <1 587 gene locus_tag LOCUS_10920 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002805290.1:flagellar basal body rod modification protein 599 2065 gene locus_tag LOCUS_10930 599 2065 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805291.1 protein_id gnl|my_center|LOCUS_10930 2132 3895 gene locus_tag LOCUS_10940 2132 3895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 3988 4599 gene locus_tag LOCUS_10950 gene thyX 3988 4599 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853111.1 protein_id gnl|my_center|LOCUS_10950 <5911 4631 gene locus_tag LOCUS_10960 <5911 4631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000289187.1:NADP-specific glutamate dehydrogenase >Feature sequence096 1331 813 gene locus_tag LOCUS_10970 1331 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 1936 1328 gene locus_tag LOCUS_10980 1936 1328 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 2720 1929 gene locus_tag LOCUS_10990 gene napG 2720 1929 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_10990 3942 2710 gene locus_tag LOCUS_11000 3942 2710 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_11000 4730 3951 gene locus_tag LOCUS_11010 4730 3951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 <5907 4875 gene locus_tag LOCUS_11020 <5907 4875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458974.1:Sec-dependent nitrous-oxide reductase >Feature sequence097 600 193 gene locus_tag LOCUS_11030 600 193 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_11030 1022 600 gene locus_tag LOCUS_11040 1022 600 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392051.1 protein_id gnl|my_center|LOCUS_11040 2320 1019 gene locus_tag LOCUS_11050 2320 1019 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162490120.1 protein_id gnl|my_center|LOCUS_11050 2841 2320 gene locus_tag LOCUS_11060 2841 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 4658 2838 gene locus_tag LOCUS_11070 4658 2838 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545125.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence098 231 1634 gene locus_tag LOCUS_11080 231 1634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 3024 1639 gene locus_tag LOCUS_11090 gene cysS 3024 1639 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471359.1 protein_id gnl|my_center|LOCUS_11090 4420 3011 gene locus_tag LOCUS_11100 gene murJ 4420 3011 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611242.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence099 1199 99 gene locus_tag LOCUS_11110 gene ychF 1199 99 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858396.1 protein_id gnl|my_center|LOCUS_11110 2680 1199 gene locus_tag LOCUS_11120 2680 1199 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853317.1 protein_id gnl|my_center|LOCUS_11120 3258 2677 gene locus_tag LOCUS_11130 3258 2677 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393406.1 protein_id gnl|my_center|LOCUS_11130 4485 3280 gene locus_tag LOCUS_11140 gene trpB 4485 3280 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966435.1 protein_id gnl|my_center|LOCUS_11140 5039 4485 gene locus_tag LOCUS_11150 gene apt 5039 4485 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853297.1 protein_id gnl|my_center|LOCUS_11150 5396 5064 gene locus_tag LOCUS_11160 5396 5064 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853247.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence100 39 650 gene locus_tag LOCUS_11170 39 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 663 1367 gene locus_tag LOCUS_11180 663 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1364 2722 gene locus_tag LOCUS_11190 1364 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 2789 3676 gene locus_tag LOCUS_11200 2789 3676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 3934 4155 gene locus_tag LOCUS_11210 3934 4155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 4432 5361 gene locus_tag LOCUS_11220 4432 5361 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 protein_id gnl|my_center|LOCUS_11220 5361 5618 gene locus_tag LOCUS_11230 5361 5618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence101 686 228 gene locus_tag LOCUS_11240 gene guaD 686 228 CDS product guanine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245084.1 protein_id gnl|my_center|LOCUS_11240 1878 700 gene locus_tag LOCUS_11250 1878 700 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611261.1 protein_id gnl|my_center|LOCUS_11250 3990 1888 gene locus_tag LOCUS_11260 gene pta 3990 1888 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940288.1 protein_id gnl|my_center|LOCUS_11260 5492 4050 gene locus_tag LOCUS_11270 5492 4050 CDS product UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852462.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence102 1131 259 gene locus_tag LOCUS_11280 1131 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 1486 1091 gene locus_tag LOCUS_11290 1486 1091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 3199 1496 gene locus_tag LOCUS_11300 3199 1496 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891863.1 protein_id gnl|my_center|LOCUS_11300 4540 3200 gene locus_tag LOCUS_11310 gene hemA 4540 3200 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002878972.1 protein_id gnl|my_center|LOCUS_11310 5446 4550 gene locus_tag LOCUS_11320 5446 4550 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence103 1344 382 gene locus_tag LOCUS_11330 1344 382 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103696.1 protein_id gnl|my_center|LOCUS_11330 2754 1354 gene locus_tag LOCUS_11340 2754 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 3080 3259 gene locus_tag LOCUS_11350 3080 3259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 4904 3555 gene locus_tag LOCUS_11360 4904 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 4164 4263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5335 4901 gene locus_tag LOCUS_11370 gene rnhA 5335 4901 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851277.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence104 2975 408 gene locus_tag LOCUS_11380 gene alaS 2975 408 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858583.1 protein_id gnl|my_center|LOCUS_11380 3167 4348 gene locus_tag LOCUS_11390 gene nhaA 3167 4348 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002799206.1 protein_id gnl|my_center|LOCUS_11390 4645 4328 gene locus_tag LOCUS_11400 4645 4328 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482886.1 protein_id gnl|my_center|LOCUS_11400 5391 4648 gene locus_tag LOCUS_11410 5391 4648 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence105 12 1214 gene locus_tag LOCUS_11420 12 1214 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891865.1 protein_id gnl|my_center|LOCUS_11420 1214 1768 gene locus_tag LOCUS_11430 1214 1768 CDS product HobA family DNA replication regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852154.1 protein_id gnl|my_center|LOCUS_11430 1765 2385 gene locus_tag LOCUS_11440 1765 2385 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 protein_id gnl|my_center|LOCUS_11440 2385 3284 gene locus_tag LOCUS_11450 2385 3284 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867793.1 protein_id gnl|my_center|LOCUS_11450 3275 4423 gene locus_tag LOCUS_11460 gene folP 3275 4423 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858587.1 protein_id gnl|my_center|LOCUS_11460 4791 5471 gene locus_tag LOCUS_11470 gene queC 4791 5471 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000435648.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence106 <1 730 gene locus_tag LOCUS_11480 <1 730 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853038.1:fla regulon two-component system response regulator 740 1771 gene locus_tag LOCUS_11490 740 1771 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 protein_id gnl|my_center|LOCUS_11490 1771 2283 gene locus_tag LOCUS_11500 1771 2283 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_11500 2294 3319 gene locus_tag LOCUS_11510 gene hemE 2294 3319 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 protein_id gnl|my_center|LOCUS_11510 3321 4247 gene locus_tag LOCUS_11520 3321 4247 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853222.1 protein_id gnl|my_center|LOCUS_11520 5200 4250 gene locus_tag LOCUS_11530 5200 4250 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261092.1 protein_id gnl|my_center|LOCUS_11530 5387 5461 gene locus_tag LOCUS_t00190 5387 5461 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence107 127 1389 gene locus_tag LOCUS_11540 127 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1364 2464 gene locus_tag LOCUS_11550 1364 2464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 2451 3473 gene locus_tag LOCUS_11560 2451 3473 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545557.1 protein_id gnl|my_center|LOCUS_11560 3460 4401 gene locus_tag LOCUS_11570 gene waaF 3460 4401 CDS product lipopolysaccharide heptosyltransferase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875425.1 protein_id gnl|my_center|LOCUS_11570 4933 4367 gene locus_tag LOCUS_11580 gene gmhA 4933 4367 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858021.1 protein_id gnl|my_center|LOCUS_11580 <5459 4933 gene locus_tag LOCUS_11590 <5459 4933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858114.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence108 1414 11 gene locus_tag LOCUS_11600 1414 11 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 2635 1451 gene locus_tag LOCUS_11610 gene lhgO 2635 1451 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546485.1 protein_id gnl|my_center|LOCUS_11610 2669 5332 gene locus_tag LOCUS_11620 2669 5332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 >Feature sequence109 19 732 gene locus_tag LOCUS_11630 19 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 735 2372 gene locus_tag LOCUS_11640 735 2372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11640 2369 4042 gene locus_tag LOCUS_11650 2369 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11650 4052 4624 gene locus_tag LOCUS_11660 gene efp 4052 4624 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855210.1 protein_id gnl|my_center|LOCUS_11660 4657 5214 gene locus_tag LOCUS_11670 4657 5214 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence110 149 1708 gene locus_tag LOCUS_11680 149 1708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2396 1821 gene locus_tag LOCUS_11690 2396 1821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2774 2412 gene locus_tag LOCUS_tm00010 2774 2412 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 3527 2790 gene locus_tag LOCUS_11700 gene trpA 3527 2790 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966434.1 protein_id gnl|my_center|LOCUS_11700 3971 3558 gene locus_tag LOCUS_11710 3971 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 4052 4840 gene locus_tag LOCUS_11720 gene panB 4052 4840 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062669.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence111 339 1025 gene locus_tag LOCUS_11730 339 1025 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851883.1 protein_id gnl|my_center|LOCUS_11730 1026 1610 gene locus_tag LOCUS_11740 1026 1610 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858675.1 protein_id gnl|my_center|LOCUS_11740 4509 1828 gene locus_tag LOCUS_11750 4509 1828 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013223297.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence112 <1 592 gene locus_tag LOCUS_11760 <1 592 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891885.1:biosynthetic arginine decarboxylase 585 1304 gene locus_tag LOCUS_11770 gene cysE 585 1304 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852612.1 protein_id gnl|my_center|LOCUS_11770 1308 2465 gene locus_tag LOCUS_11780 1308 2465 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967300.1 protein_id gnl|my_center|LOCUS_11780 2455 2892 gene locus_tag LOCUS_11790 2455 2892 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015698.1 protein_id gnl|my_center|LOCUS_11790 3444 2887 gene locus_tag LOCUS_11800 3444 2887 CDS product PAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963243.1 protein_id gnl|my_center|LOCUS_11800 <5231 3422 gene locus_tag LOCUS_11810 <5231 3422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:PAS domain-containing sensor histidine kinase >Feature sequence113 349 275 gene locus_tag LOCUS_t00200 349 275 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1513 407 gene locus_tag LOCUS_11820 1513 407 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880235.1 protein_id gnl|my_center|LOCUS_11820 2167 1541 gene locus_tag LOCUS_11830 2167 1541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 3209 2238 gene locus_tag LOCUS_11840 gene moaA 3209 2238 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868437.1 protein_id gnl|my_center|LOCUS_11840 3306 3809 gene locus_tag LOCUS_11850 gene cetB 3306 3809 CDS product bipartate energy taxis response protein CetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002777340.1 protein_id gnl|my_center|LOCUS_11850 >Feature sequence114 2184 1093 gene locus_tag LOCUS_11860 2184 1093 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857924.1 protein_id gnl|my_center|LOCUS_11860 3384 2185 gene locus_tag LOCUS_11870 gene tyrS 3384 2185 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_11870 <5073 3404 gene locus_tag LOCUS_11880 <5073 3404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858057.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase >Feature sequence115 2464 2964 gene locus_tag LOCUS_11890 2464 2964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 2961 3281 gene locus_tag LOCUS_11900 2961 3281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 <5025 3317 gene locus_tag LOCUS_11910 <5025 3317 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_061293285.1:EAL domain-containing protein >Feature sequence116 241 984 gene locus_tag LOCUS_11920 241 984 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 protein_id gnl|my_center|LOCUS_11920 1700 981 gene locus_tag LOCUS_11930 1700 981 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376795.1 protein_id gnl|my_center|LOCUS_11930 1806 2156 gene locus_tag LOCUS_11940 gene secG 1806 2156 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851915.1 protein_id gnl|my_center|LOCUS_11940 2125 3132 gene locus_tag LOCUS_11950 2125 3132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 3119 3679 gene locus_tag LOCUS_11960 gene frr 3119 3679 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864198.1 protein_id gnl|my_center|LOCUS_11960 3681 4289 gene locus_tag LOCUS_11970 gene pyrE 3681 4289 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 protein_id gnl|my_center|LOCUS_11970 4289 4747 gene locus_tag LOCUS_11980 4289 4747 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851998.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence117 3727 2723 gene locus_tag LOCUS_11990 3727 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 4911 3724 gene locus_tag LOCUS_12000 4911 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 >Feature sequence118 1141 335 gene locus_tag LOCUS_12010 1141 335 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904003.1 protein_id gnl|my_center|LOCUS_12010 1257 1181 gene locus_tag LOCUS_t00210 1257 1181 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 2429 1326 gene locus_tag LOCUS_12020 2429 1326 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 protein_id gnl|my_center|LOCUS_12020 2478 3431 gene locus_tag LOCUS_12030 2478 3431 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858282.1 protein_id gnl|my_center|LOCUS_12030 3379 4632 gene locus_tag LOCUS_12040 3379 4632 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891920.1 protein_id gnl|my_center|LOCUS_12040 >Feature sequence119 55 1269 gene locus_tag LOCUS_12050 55 1269 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851675.1 protein_id gnl|my_center|LOCUS_12050 1270 2532 gene locus_tag LOCUS_12060 1270 2532 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746824.1 protein_id gnl|my_center|LOCUS_12060 2536 4611 gene locus_tag LOCUS_12070 gene fdhF 2536 4611 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_12070 >Feature sequence120 1729 1091 gene locus_tag LOCUS_12080 gene upp 1729 1091 CDS product uracil phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815407.1 protein_id gnl|my_center|LOCUS_12080 1849 3129 gene locus_tag LOCUS_12090 1849 3129 CDS product uracil-xanthine permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072791.1 protein_id gnl|my_center|LOCUS_12090 3166 4071 gene locus_tag LOCUS_12100 3166 4071 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940938.1 protein_id gnl|my_center|LOCUS_12100 >Feature sequence121 411 1460 gene locus_tag LOCUS_12110 411 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 1465 4548 gene locus_tag LOCUS_12120 1465 4548 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461050.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence122 112 1233 gene locus_tag LOCUS_12130 gene tgt 112 1233 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853029.1 protein_id gnl|my_center|LOCUS_12130 1261 2850 gene locus_tag LOCUS_12140 1261 2850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 4147 2861 gene locus_tag LOCUS_12150 gene hisD 4147 2861 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546313.1 protein_id gnl|my_center|LOCUS_12150 <4739 4134 gene locus_tag LOCUS_12160 <4739 4134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072070.1:pyridoxal-phosphate dependent enzyme >Feature sequence123 <1 897 gene locus_tag LOCUS_12170 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013383523.1:DNA recombination protein RmuC 952 4449 gene locus_tag LOCUS_12180 gene dnaE 952 4449 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852165.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence124 <1 1071 gene locus_tag LOCUS_12190 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016374.1:type III restriction-modification system endonuclease 1683 1408 gene locus_tag LOCUS_12200 1683 1408 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931826.1 protein_id gnl|my_center|LOCUS_12200 4220 1848 gene locus_tag LOCUS_12210 4220 1848 CDS product RND family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858465.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence125 2060 132 gene locus_tag LOCUS_12220 gene metG 2060 132 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852639.1 protein_id gnl|my_center|LOCUS_12220 2290 2078 gene locus_tag LOCUS_12230 2290 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 3132 2287 gene locus_tag LOCUS_12240 3132 2287 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_12240 3622 3125 gene locus_tag LOCUS_12250 gene mobB 3622 3125 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 protein_id gnl|my_center|LOCUS_12250 3759 4262 gene locus_tag LOCUS_12260 3759 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence126 505 1671 gene locus_tag LOCUS_12270 505 1671 CDS product calcium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972133.1 protein_id gnl|my_center|LOCUS_12270 1724 2800 gene locus_tag LOCUS_12280 1724 2800 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918468.1 protein_id gnl|my_center|LOCUS_12280 2858 3397 gene locus_tag LOCUS_12290 2858 3397 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001257143.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence127 <1 965 gene locus_tag LOCUS_12300 <1 965 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864240.1:NFACT family protein 977 1303 gene locus_tag LOCUS_12310 977 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 1348 2097 gene locus_tag LOCUS_12320 1348 2097 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656886.1 protein_id gnl|my_center|LOCUS_12320 2098 3183 gene locus_tag LOCUS_12330 gene dxr 2098 3183 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864243.1 protein_id gnl|my_center|LOCUS_12330 3184 4182 gene locus_tag LOCUS_12340 gene tsaD 3184 4182 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864246.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence128 707 1051 gene locus_tag LOCUS_12350 707 1051 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037392702.1 protein_id gnl|my_center|LOCUS_12350 1173 1322 gene locus_tag LOCUS_12360 1173 1322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1340 2182 gene locus_tag LOCUS_12370 1340 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12370 2259 3077 gene locus_tag LOCUS_12380 2259 3077 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_151652833.1 protein_id gnl|my_center|LOCUS_12380 3070 3957 gene locus_tag LOCUS_12390 3070 3957 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459799.1 protein_id gnl|my_center|LOCUS_12390 >Feature sequence129 630 1124 gene locus_tag LOCUS_12400 630 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 1121 1966 gene locus_tag LOCUS_12410 gene nfo 1121 1966 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795638.1 protein_id gnl|my_center|LOCUS_12410 1986 3209 gene locus_tag LOCUS_12420 1986 3209 CDS product OmpP1/FadL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880611.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence130 <1 561 gene locus_tag LOCUS_12430 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852961.1:outer membrane protein assembly factor BamD 582 3005 gene locus_tag LOCUS_12440 gene lon 582 3005 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868636.1 protein_id gnl|my_center|LOCUS_12440 3283 3020 gene locus_tag LOCUS_12450 gene rpsR 3283 3020 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 protein_id gnl|my_center|LOCUS_12450 3795 3301 gene locus_tag LOCUS_12460 3795 3301 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865738.1 protein_id gnl|my_center|LOCUS_12460 4264 3806 gene locus_tag LOCUS_12470 gene rpsF 4264 3806 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865739.1 protein_id gnl|my_center|LOCUS_12470 >Feature sequence131 <1 561 gene locus_tag LOCUS_12480 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858726.1:flagellar biosynthesis protein FlhB 584 1519 gene locus_tag LOCUS_12490 584 1519 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016831.1 protein_id gnl|my_center|LOCUS_12490 1516 2883 gene locus_tag LOCUS_12500 1516 2883 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 protein_id gnl|my_center|LOCUS_12500 2950 3834 gene locus_tag LOCUS_12510 gene lpxC 2950 3834 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859351.1 protein_id gnl|my_center|LOCUS_12510 3849 4289 gene locus_tag LOCUS_12520 3849 4289 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851789.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence132 389 805 gene locus_tag LOCUS_12530 389 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 947 1147 gene locus_tag LOCUS_12540 gene rpmE 947 1147 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_12540 1307 2119 gene locus_tag LOCUS_12550 gene rsmI 1307 2119 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_12550 2202 2858 gene locus_tag LOCUS_12560 gene rlmB 2202 2858 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001149319.1 protein_id gnl|my_center|LOCUS_12560 2851 3804 gene locus_tag LOCUS_12570 2851 3804 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851924.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence133 <1 703 gene locus_tag LOCUS_12580 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846808.1:FAD/NAD(P)-binding oxidoreductase 752 2551 gene locus_tag LOCUS_12590 752 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 2659 2994 gene locus_tag LOCUS_12600 2659 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 2999 3463 gene locus_tag LOCUS_12610 2999 3463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 3456 4265 gene locus_tag LOCUS_12620 3456 4265 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880164.1 protein_id gnl|my_center|LOCUS_12620 4434 4270 gene locus_tag LOCUS_12630 4434 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 >Feature sequence134 220 438 gene locus_tag LOCUS_12640 220 438 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072720.1 protein_id gnl|my_center|LOCUS_12640 591 884 gene locus_tag LOCUS_12650 591 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12650 881 2020 gene locus_tag LOCUS_12660 881 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2087 2917 gene locus_tag LOCUS_12670 gene galU 2087 2917 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851421.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence135 <1 1026 gene locus_tag LOCUS_12680 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480910.1:sodium ion-translocating decarboxylase subunit beta 1042 2625 gene locus_tag LOCUS_12690 gene pckA 1042 2625 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853265.1 protein_id gnl|my_center|LOCUS_12690 2640 4034 gene locus_tag LOCUS_12700 gene argH 2640 4034 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891895.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence136 1003 2646 gene locus_tag LOCUS_12710 gene dnaG 1003 2646 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601638.1 protein_id gnl|my_center|LOCUS_12710 2633 3619 gene locus_tag LOCUS_12720 2633 3619 CDS product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851386.1 protein_id gnl|my_center|LOCUS_12720 3660 3735 gene locus_tag LOCUS_t00220 3660 3735 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence137 2472 1408 gene locus_tag LOCUS_12730 2472 1408 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880493.1 protein_id gnl|my_center|LOCUS_12730 2528 3277 gene locus_tag LOCUS_12740 2528 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12740 3299 4195 gene locus_tag LOCUS_12750 3299 4195 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891853.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence138 492 106 gene locus_tag LOCUS_12760 492 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 <4250 496 gene locus_tag LOCUS_12770 <4250 496 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482572.1:two-component sensor histidine kinase BarA >Feature sequence139 128 2563 gene locus_tag LOCUS_12780 128 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 <4131 2739 gene locus_tag LOCUS_12790 <4131 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081682.1:methyl-accepting chemotaxis protein >Feature sequence140 648 1475 gene locus_tag LOCUS_12800 648 1475 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596591.1 protein_id gnl|my_center|LOCUS_12800 1472 1942 gene locus_tag LOCUS_12810 1472 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12810 1946 2638 gene locus_tag LOCUS_12820 1946 2638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 2671 3228 gene locus_tag LOCUS_12830 2671 3228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 >Feature sequence141 <1 2923 gene locus_tag LOCUS_12840 <1 2923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858240.1:CarD family transcriptional regulator 2920 3729 gene locus_tag LOCUS_12850 gene ymdB 2920 3729 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_12850 >Feature sequence142 2836 1922 gene locus_tag LOCUS_12860 2836 1922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 2935 3141 gene locus_tag LOCUS_12870 2935 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 3148 3726 gene locus_tag LOCUS_12880 3148 3726 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence143 1470 721 gene locus_tag LOCUS_12890 1470 721 CDS product TlyA family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852328.1 protein_id gnl|my_center|LOCUS_12890 2660 1467 gene locus_tag LOCUS_12900 2660 1467 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_12900 3652 2657 gene locus_tag LOCUS_12910 3652 2657 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435117.1 protein_id gnl|my_center|LOCUS_12910 >Feature sequence144 2621 1410 gene locus_tag LOCUS_12920 gene hisS 2621 1410 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 protein_id gnl|my_center|LOCUS_12920 3201 2614 gene locus_tag LOCUS_12930 gene tmk 3201 2614 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852526.1 protein_id gnl|my_center|LOCUS_12930 3677 3192 gene locus_tag LOCUS_12940 gene coaD 3677 3192 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852633.1 protein_id gnl|my_center|LOCUS_12940 3937 3707 gene locus_tag LOCUS_12950 3937 3707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 >Feature sequence145 370 80 gene locus_tag LOCUS_12960 370 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 345 956 gene locus_tag LOCUS_12970 345 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 979 1212 gene locus_tag LOCUS_12980 979 1212 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065850.1 protein_id gnl|my_center|LOCUS_12980 1403 3856 gene locus_tag LOCUS_12990 gene leuS 1403 3856 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence146 31 1575 gene locus_tag LOCUS_13000 31 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1585 2610 gene locus_tag LOCUS_13010 1585 2610 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852576.1 protein_id gnl|my_center|LOCUS_13010 2612 2857 gene locus_tag LOCUS_13020 2612 2857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852415.1 protein_id gnl|my_center|LOCUS_13020 3412 2912 gene locus_tag LOCUS_13030 gene fldA 3412 2912 CDS product flavodoxin FldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855629.1 protein_id gnl|my_center|LOCUS_13030 >Feature sequence147 1138 188 gene locus_tag LOCUS_13040 1138 188 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238135.1 protein_id gnl|my_center|LOCUS_13040 2374 1154 gene locus_tag LOCUS_13050 2374 1154 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129867.1 protein_id gnl|my_center|LOCUS_13050 2769 2374 gene locus_tag LOCUS_13060 2769 2374 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656174.1 protein_id gnl|my_center|LOCUS_13060 3339 2782 gene locus_tag LOCUS_13070 3339 2782 CDS product pyruvate flavodoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486467.1 protein_id gnl|my_center|LOCUS_13070 >Feature sequence148 3474 1987 gene locus_tag LOCUS_13080 gene nuoN 3474 1987 CDS product NADH-quinone oxidoreductase subunit NuoN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000904307.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence149 744 85 gene locus_tag LOCUS_13090 744 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 916 2352 gene locus_tag LOCUS_13100 916 2352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 2138 2237 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2965 2405 gene locus_tag LOCUS_13110 2965 2405 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856055.1 protein_id gnl|my_center|LOCUS_13110 3637 2972 gene locus_tag LOCUS_13120 3637 2972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 3866 3639 gene locus_tag LOCUS_13130 3866 3639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence150 <1 1305 gene locus_tag LOCUS_13140 <1 1305 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000717228.1:COG3400 family protein 1330 2379 gene locus_tag LOCUS_13150 gene aroB 1330 2379 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852978.1 protein_id gnl|my_center|LOCUS_13150 2372 3616 gene locus_tag LOCUS_13160 gene mtaB 2372 3616 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_13160 >Feature sequence151 1568 1119 gene locus_tag LOCUS_13170 1568 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 1895 1710 gene locus_tag LOCUS_13180 1895 1710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2634 1879 gene locus_tag LOCUS_13190 2634 1879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 3559 2618 gene locus_tag LOCUS_13200 3559 2618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 3795 3562 gene locus_tag LOCUS_13210 3795 3562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 >Feature sequence152 <3788 1954 gene locus_tag LOCUS_13220 <3788 1954 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197693007.1:site-specific DNA-methyltransferase >Feature sequence153 1506 721 gene locus_tag LOCUS_13230 1506 721 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_13230 2161 1526 gene locus_tag LOCUS_13240 2161 1526 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 protein_id gnl|my_center|LOCUS_13240 3074 2142 gene locus_tag LOCUS_13250 gene fmt 3074 2142 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851657.1 protein_id gnl|my_center|LOCUS_13250 <3772 3053 gene locus_tag LOCUS_13260 <3772 3053 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851769.1:glutamate 5-kinase >Feature sequence154 1805 1116 gene locus_tag LOCUS_13270 gene arsR 1805 1116 CDS product acid response regulator transcription factor ArsR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573710.1 protein_id gnl|my_center|LOCUS_13270 2386 1811 gene locus_tag LOCUS_13280 2386 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 3426 2467 gene locus_tag LOCUS_13290 gene pfkA 3426 2467 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082880.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence155 50 595 gene locus_tag LOCUS_13300 50 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 600 2348 gene locus_tag LOCUS_13310 600 2348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13310 2345 3586 gene locus_tag LOCUS_13320 2345 3586 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073810.1 protein_id gnl|my_center|LOCUS_13320 >Feature sequence156 386 1897 gene locus_tag LOCUS_13330 gene mshL 386 1897 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_13330 1878 2699 gene locus_tag LOCUS_13340 1878 2699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 2692 3516 gene locus_tag LOCUS_13350 2692 3516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 3513 3641 gene locus_tag LOCUS_13360 3513 3641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 >Feature sequence157 426 3608 gene locus_tag LOCUS_13370 gene ccsA 426 3608 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963539.1 protein_id gnl|my_center|LOCUS_13370 >Feature sequence158 902 144 gene locus_tag LOCUS_13380 902 144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 2581 899 gene locus_tag LOCUS_13390 2581 899 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857979.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence159 2543 873 gene locus_tag LOCUS_13400 2543 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 3076 2540 gene locus_tag LOCUS_13410 3076 2540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 >Feature sequence160 2132 3385 gene locus_tag LOCUS_13420 gene ccoG 2132 3385 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858753.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence161 2604 2356 gene locus_tag LOCUS_13430 2604 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 3439 2771 gene locus_tag LOCUS_13440 3439 2771 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213204.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence162 784 948 gene locus_tag LOCUS_13450 784 948 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459942.1 protein_id gnl|my_center|LOCUS_13450 969 1112 gene locus_tag LOCUS_13460 969 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 1194 1727 gene locus_tag LOCUS_13470 1194 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 1735 2418 gene locus_tag LOCUS_13480 1735 2418 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_13480 2408 3412 gene locus_tag LOCUS_13490 2408 3412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence163 38 337 gene locus_tag LOCUS_13500 38 337 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939104.1 protein_id gnl|my_center|LOCUS_13500 2180 372 gene locus_tag LOCUS_13510 2180 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 2832 2173 gene locus_tag LOCUS_13520 gene dccR 2832 2173 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_13520 3384 2899 gene locus_tag LOCUS_13530 3384 2899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence164 283 1119 gene locus_tag LOCUS_13540 gene stbB 283 1119 CDS product StbB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011264012.1 protein_id gnl|my_center|LOCUS_13540 1121 1291 gene locus_tag LOCUS_13550 1121 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13550 1624 1980 gene locus_tag LOCUS_13560 1624 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 2292 1999 gene locus_tag LOCUS_13570 2292 1999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13570 2863 2294 gene locus_tag LOCUS_13580 2863 2294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 2729 2738 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3249 3058 gene locus_tag LOCUS_13590 3249 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13590 >Feature sequence165 1139 510 gene locus_tag LOCUS_13600 1139 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1828 1220 gene locus_tag LOCUS_13610 1828 1220 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018313.1 protein_id gnl|my_center|LOCUS_13610 1886 3493 gene locus_tag LOCUS_13620 1886 3493 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_13620 >Feature sequence166 1187 384 gene locus_tag LOCUS_13630 1187 384 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_13630 1313 1909 gene locus_tag LOCUS_13640 1313 1909 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852433.1 protein_id gnl|my_center|LOCUS_13640 2519 2031 gene locus_tag LOCUS_13650 2519 2031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 3458 2553 gene locus_tag LOCUS_13660 gene cmoB 3458 2553 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence167 >Feature sequence168 <1 552 gene locus_tag LOCUS_13670 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001074267.1:Ppx/GppA phosphatase family protein 2795 588 gene locus_tag LOCUS_13680 gene bamA 2795 588 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence169 199 693 gene locus_tag LOCUS_13690 gene flgC 199 693 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858484.1 protein_id gnl|my_center|LOCUS_13690 704 997 gene locus_tag LOCUS_13700 gene fliE 704 997 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147918.1 protein_id gnl|my_center|LOCUS_13700 1014 2780 gene locus_tag LOCUS_13710 1014 2780 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858598.1 protein_id gnl|my_center|LOCUS_13710 <3462 2907 gene locus_tag LOCUS_13720 <3462 2907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002855880.1:energy taxis response protein CetC >Feature sequence170 981 625 gene locus_tag LOCUS_13730 981 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 2999 978 gene locus_tag LOCUS_13740 2999 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 >Feature sequence171 1367 2683 gene locus_tag LOCUS_13750 1367 2683 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856815.1 protein_id gnl|my_center|LOCUS_13750 2680 3393 gene locus_tag LOCUS_13760 2680 3393 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858572.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence172 2078 753 gene locus_tag LOCUS_13770 gene hslU 2078 753 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 protein_id gnl|my_center|LOCUS_13770 2626 2075 gene locus_tag LOCUS_13780 gene hslV 2626 2075 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 protein_id gnl|my_center|LOCUS_13780 3076 2630 gene locus_tag LOCUS_13790 gene rplI 3076 2630 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781628.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence173 190 882 gene locus_tag LOCUS_13800 190 882 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858620.1 protein_id gnl|my_center|LOCUS_13800 879 1214 gene locus_tag LOCUS_13810 879 1214 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023831.1 protein_id gnl|my_center|LOCUS_13810 1229 1609 gene locus_tag LOCUS_13820 gene crcB 1229 1609 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858490.1 protein_id gnl|my_center|LOCUS_13820 >Feature sequence174 1068 154 gene locus_tag LOCUS_13830 gene miaA 1068 154 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851982.1 protein_id gnl|my_center|LOCUS_13830 1164 2012 gene locus_tag LOCUS_13840 1164 2012 CDS product 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851905.1 protein_id gnl|my_center|LOCUS_13840 2014 2535 gene locus_tag LOCUS_13850 2014 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13850 2535 3026 gene locus_tag LOCUS_13860 2535 3026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 >Feature sequence175 628 1281 gene locus_tag LOCUS_13870 628 1281 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875342.1 protein_id gnl|my_center|LOCUS_13870 1187 2755 gene locus_tag LOCUS_13880 gene rny 1187 2755 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858133.1 protein_id gnl|my_center|LOCUS_13880 2921 2763 gene locus_tag LOCUS_13890 2921 2763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence176 328 1197 gene locus_tag LOCUS_13900 328 1197 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810750.1 protein_id gnl|my_center|LOCUS_13900 1202 2152 gene locus_tag LOCUS_13910 1202 2152 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_13910 2139 2966 gene locus_tag LOCUS_13920 2139 2966 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002937291.1 protein_id gnl|my_center|LOCUS_13920 >Feature sequence177 249 539 gene locus_tag LOCUS_13930 249 539 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759700.1 protein_id gnl|my_center|LOCUS_13930 532 915 gene locus_tag LOCUS_13940 532 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13940 899 1966 gene locus_tag LOCUS_13950 gene ispG 899 1966 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000892489.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence178 1272 355 gene locus_tag LOCUS_13960 gene cysK 1272 355 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461664.1 protein_id gnl|my_center|LOCUS_13960 2542 1274 gene locus_tag LOCUS_13970 2542 1274 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853122.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence179 <1 2715 gene locus_tag LOCUS_13980 <1 2715 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044948.1:histidine kinase N-terminal 7TM domain-containing protein >Feature sequence180 1108 218 gene locus_tag LOCUS_13990 1108 218 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001139790.1 protein_id gnl|my_center|LOCUS_13990 1292 2872 gene locus_tag LOCUS_14000 1292 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence181 1273 728 gene locus_tag LOCUS_14010 1273 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 1737 1270 gene locus_tag LOCUS_14020 1737 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 2708 1734 gene locus_tag LOCUS_14030 2708 1734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 >Feature sequence182 1387 431 gene locus_tag LOCUS_14040 1387 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14040 1401 1327 gene locus_tag LOCUS_t00230 1401 1327 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1684 2337 gene locus_tag LOCUS_14050 1684 2337 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853160.1 protein_id gnl|my_center|LOCUS_14050 2386 2688 gene locus_tag LOCUS_14060 2386 2688 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 >Feature sequence183 <1 1905 gene locus_tag LOCUS_14070 <1 1905 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005478977.1:EAL domain-containing protein 2071 3105 gene locus_tag LOCUS_14080 2071 3105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 >Feature sequence184 <1 1478 gene locus_tag LOCUS_14090 <1 1478 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851396.1:flagellar hook-associated protein FlgK 1512 2321 gene locus_tag LOCUS_14100 1512 2321 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_14100 2314 3060 gene locus_tag LOCUS_14110 2314 3060 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_14110 >Feature sequence185 131 1522 gene locus_tag LOCUS_14120 gene gltX 131 1522 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858284.1 protein_id gnl|my_center|LOCUS_14120 1524 2789 gene locus_tag LOCUS_14130 1524 2789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence186 1936 395 gene locus_tag LOCUS_14140 gene mshL 1936 395 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_14140 2337 1933 gene locus_tag LOCUS_14150 2337 1933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2969 2334 gene locus_tag LOCUS_14160 2969 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14160 >Feature sequence187 <1 1377 gene locus_tag LOCUS_14170 <1 1377 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852196.1:penicillin-binding protein 2 2309 1374 gene locus_tag LOCUS_14180 2309 1374 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869583.1 protein_id gnl|my_center|LOCUS_14180 2743 2309 gene locus_tag LOCUS_14190 gene ybeY 2743 2309 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851664.1 protein_id gnl|my_center|LOCUS_14190 >Feature sequence188 1173 202 gene locus_tag LOCUS_14200 gene secF 1173 202 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_14200 2705 1173 gene locus_tag LOCUS_14210 gene secD 2705 1173 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_14210 3018 2746 gene locus_tag LOCUS_14220 gene yajC 3018 2746 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 protein_id gnl|my_center|LOCUS_14220 >Feature sequence189 928 218 gene locus_tag LOCUS_14230 928 218 CDS product inositol monophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851687.1 protein_id gnl|my_center|LOCUS_14230 2325 925 gene locus_tag LOCUS_14240 gene gltD 2325 925 CDS product glutamate synthase subunit GltD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000081705.1 protein_id gnl|my_center|LOCUS_14240 <3028 2327 gene locus_tag LOCUS_14250 <3028 2327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103700.1:glutamate synthase large subunit >Feature sequence190 3 812 gene locus_tag LOCUS_14260 3 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence191 225 827 gene locus_tag LOCUS_14270 225 827 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940880.1 protein_id gnl|my_center|LOCUS_14270 830 1981 gene locus_tag LOCUS_14280 830 1981 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005423059.1 protein_id gnl|my_center|LOCUS_14280 2414 2956 gene locus_tag LOCUS_14290 2414 2956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 >Feature sequence192 703 1383 gene locus_tag LOCUS_14300 703 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 1505 1813 gene locus_tag LOCUS_14310 gene rplU 1505 1813 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778820.1 protein_id gnl|my_center|LOCUS_14310 1823 2080 gene locus_tag LOCUS_14320 gene rpmA 1823 2080 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800974.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence193 1627 263 gene locus_tag LOCUS_14330 1627 263 CDS product bifunctional cytidylyltransferase/SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107920.1 protein_id gnl|my_center|LOCUS_14330 2904 1624 gene locus_tag LOCUS_14340 2904 1624 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875986.1 protein_id gnl|my_center|LOCUS_14340 >Feature sequence194 1 1089 gene locus_tag LOCUS_14350 1 1089 CDS product TDT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005765115.1 protein_id gnl|my_center|LOCUS_14350 1100 2041 gene locus_tag LOCUS_14360 gene gap 1100 2041 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001122605.1 protein_id gnl|my_center|LOCUS_14360 2038 2682 gene locus_tag LOCUS_14370 gene bioD 2038 2682 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897490.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence195 >Feature sequence196 500 889 gene locus_tag LOCUS_14380 500 889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 1237 1336 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence197 <1 889 gene locus_tag LOCUS_14390 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011861662.1:pyridoxal phosphate-dependent aminotransferase 916 1380 gene locus_tag LOCUS_14400 gene ribE 916 1380 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 protein_id gnl|my_center|LOCUS_14400 1380 1781 gene locus_tag LOCUS_14410 gene nusB 1380 1781 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_14410 1778 2461 gene locus_tag LOCUS_14420 gene pyrF 1778 2461 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_14420 >Feature sequence198 576 100 gene locus_tag LOCUS_14430 gene moaC 576 100 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851725.1 protein_id gnl|my_center|LOCUS_14430 647 1768 gene locus_tag LOCUS_14440 647 1768 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851140.1 protein_id gnl|my_center|LOCUS_14440 1771 2538 gene locus_tag LOCUS_14450 1771 2538 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011975703.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence199 1628 426 gene locus_tag LOCUS_14460 1628 426 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853860.1 protein_id gnl|my_center|LOCUS_14460 2431 1625 gene locus_tag LOCUS_14470 2431 1625 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853622.1 protein_id gnl|my_center|LOCUS_14470 <2921 2418 gene locus_tag LOCUS_14480 <2921 2418 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853534.1:ABC transporter ATP-binding protein >Feature sequence200 3 275 gene locus_tag LOCUS_14490 3 275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14490 429 283 gene locus_tag LOCUS_14500 429 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 990 487 gene locus_tag LOCUS_14510 990 487 CDS product HAD hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948159.1 protein_id gnl|my_center|LOCUS_14510 1712 951 gene locus_tag LOCUS_14520 1712 951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 2772 2131 gene locus_tag LOCUS_14530 2772 2131 CDS product hemolysin III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019082407.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence201 494 1492 gene locus_tag LOCUS_14540 494 1492 CDS product IS110 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_106069164.1 protein_id gnl|my_center|LOCUS_14540 1658 1530 gene locus_tag LOCUS_14550 1658 1530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14550 2127 1768 gene locus_tag LOCUS_14560 2127 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 2559 2179 gene locus_tag LOCUS_14570 2559 2179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence202 946 86 gene locus_tag LOCUS_14580 946 86 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257555.1 protein_id gnl|my_center|LOCUS_14580 1740 943 gene locus_tag LOCUS_14590 1740 943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948298.1 protein_id gnl|my_center|LOCUS_14590 <2826 1804 gene locus_tag LOCUS_14600 <2826 1804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003119359.1:ABC transporter ATP-binding protein >Feature sequence203 1611 331 gene locus_tag LOCUS_14610 1611 331 CDS product citrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851494.1 protein_id gnl|my_center|LOCUS_14610 2297 1650 gene locus_tag LOCUS_14620 gene pcm 2297 1650 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001084597.1 protein_id gnl|my_center|LOCUS_14620 >Feature sequence204 1091 225 gene locus_tag LOCUS_14630 1091 225 CDS product DUF488 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259391.1 protein_id gnl|my_center|LOCUS_14630 1270 1461 gene locus_tag LOCUS_14640 1270 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 >Feature sequence205 128 2563 gene locus_tag LOCUS_14650 128 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 >Feature sequence206 419 1444 gene locus_tag LOCUS_14660 gene queA 419 1444 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_14660 1736 1452 gene locus_tag LOCUS_14670 1736 1452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence207 246 2345 gene locus_tag LOCUS_14680 gene ovoA 246 2345 CDS product 5-histidylcysteine sulfoxide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074094.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence208 613 140 gene locus_tag LOCUS_14690 613 140 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852091.1 protein_id gnl|my_center|LOCUS_14690 672 1727 gene locus_tag LOCUS_14700 gene hemW 672 1727 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852262.1 protein_id gnl|my_center|LOCUS_14700 1774 2211 gene locus_tag LOCUS_14710 1774 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence209 <1 1026 gene locus_tag LOCUS_14720 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003021648.1:BatD family protein 2023 1004 gene locus_tag LOCUS_14730 gene murG 2023 1004 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_14730 <2718 2023 gene locus_tag LOCUS_14740 <2718 2023 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_209611797.1:FtsW/RodA/SpoVE family cell cycle protein >Feature sequence210 252 1262 gene locus_tag LOCUS_14750 252 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 1259 2194 gene locus_tag LOCUS_14760 1259 2194 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851926.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence211 1352 399 gene locus_tag LOCUS_14770 1352 399 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003020707.1 protein_id gnl|my_center|LOCUS_14770 2281 1349 gene locus_tag LOCUS_14780 2281 1349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence212 2323 1121 gene locus_tag LOCUS_14790 2323 1121 CDS product 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851311.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence213 <1 1404 gene locus_tag LOCUS_14800 <1 1404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852990.1:ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein 1391 1903 gene locus_tag LOCUS_14810 gene bioV 1391 1903 CDS product pimelyl-ACP methyl ester esterase BioV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001210594.1 protein_id gnl|my_center|LOCUS_14810 1894 2421 gene locus_tag LOCUS_14820 gene mog 1894 2421 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070478.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence214 347 1402 gene locus_tag LOCUS_14830 347 1402 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence215 2496 946 gene locus_tag LOCUS_14840 2496 946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence216 176 505 gene locus_tag LOCUS_14850 176 505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 582 842 gene locus_tag LOCUS_14860 582 842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 839 1537 gene locus_tag LOCUS_14870 839 1537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 1880 1728 gene locus_tag LOCUS_14880 1880 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14880 1837 2004 gene locus_tag LOCUS_14890 1837 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 2453 2001 gene locus_tag LOCUS_14900 2453 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14900 >Feature sequence217 135 1262 gene locus_tag LOCUS_14910 135 1262 CDS product RNA-directed DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164996215.1 protein_id gnl|my_center|LOCUS_14910 1228 1641 gene locus_tag LOCUS_14920 1228 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1738 2484 gene locus_tag LOCUS_14930 1738 2484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence218 998 534 gene locus_tag LOCUS_14940 998 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1149 2519 gene locus_tag LOCUS_14950 1149 2519 CDS product 3-deoxy-7-phosphoheptulonate synthase class II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104160.1 protein_id gnl|my_center|LOCUS_14950 >Feature sequence219 590 309 gene locus_tag LOCUS_14960 590 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 813 670 gene locus_tag LOCUS_14970 813 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 1097 813 gene locus_tag LOCUS_14980 1097 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 2366 1986 gene locus_tag LOCUS_14990 2366 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 >Feature sequence220 238 1401 gene locus_tag LOCUS_15000 gene purT 238 1401 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496844.1 protein_id gnl|my_center|LOCUS_15000 1401 1886 gene locus_tag LOCUS_15010 1401 1886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 1933 2430 gene locus_tag LOCUS_15020 1933 2430 CDS product YajQ family cyclic di-GMP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858699.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence221 <1 650 gene locus_tag LOCUS_15030 <1 650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002779472.1:elongation factor G 870 1892 gene locus_tag LOCUS_15040 870 1892 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001284567.1 protein_id gnl|my_center|LOCUS_15040 >Feature sequence222 <1 1038 gene locus_tag LOCUS_15050 <1 1038 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858434.1:DNA repair protein RadA 1186 1455 gene locus_tag LOCUS_15060 1186 1455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 1503 2030 gene locus_tag LOCUS_15070 gene fliL 1503 2030 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780442.1 protein_id gnl|my_center|LOCUS_15070 2031 2408 gene locus_tag LOCUS_15080 gene acpS 2031 2408 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579175.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence223 2080 1244 gene locus_tag LOCUS_15090 2080 1244 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853285.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence224 45 1733 gene locus_tag LOCUS_15100 gene typA 45 1733 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_15100 2284 1889 gene locus_tag LOCUS_15110 2284 1889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence225 2101 1109 gene locus_tag LOCUS_15120 gene pheS 2101 1109 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence226 702 1700 gene locus_tag LOCUS_15130 gene rhuM 702 1700 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070741.1 protein_id gnl|my_center|LOCUS_15130 1697 2287 gene locus_tag LOCUS_15140 1697 2287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence227 1906 1514 gene locus_tag LOCUS_15150 gene fliW 1906 1514 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862609.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence228 196 993 gene locus_tag LOCUS_15160 196 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1009 1296 gene locus_tag LOCUS_15170 1009 1296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 1300 1923 gene locus_tag LOCUS_15180 1300 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1984 2199 gene locus_tag LOCUS_15190 1984 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence229 1022 492 gene locus_tag LOCUS_15200 1022 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1522 1022 gene locus_tag LOCUS_15210 1522 1022 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 protein_id gnl|my_center|LOCUS_15210 1955 1533 gene locus_tag LOCUS_15220 1955 1533 CDS product FoF1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851812.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence230 840 496 gene locus_tag LOCUS_15230 840 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 1685 915 gene locus_tag LOCUS_15240 1685 915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15240 2104 1682 gene locus_tag LOCUS_15250 2104 1682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence231 1563 1012 gene locus_tag LOCUS_15260 gene ruvA 1563 1012 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852492.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence232 1929 934 gene locus_tag LOCUS_15270 gene rfaD 1929 934 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858041.1 protein_id gnl|my_center|LOCUS_15270 >Feature sequence233 <1 875 gene locus_tag LOCUS_15280 <1 875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853384.1:membrane protein insertase YidC 879 1580 gene locus_tag LOCUS_15290 879 1580 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence234 750 142 gene locus_tag LOCUS_15300 750 142 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867312.1 protein_id gnl|my_center|LOCUS_15300 2015 750 gene locus_tag LOCUS_15310 gene leuC 2015 750 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966450.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence235 <1 501 gene locus_tag LOCUS_15320 <1 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460337.1:HDOD domain-containing protein 836 760 gene locus_tag LOCUS_t00240 836 760 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence236 96 1424 gene locus_tag LOCUS_15330 96 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 1945 1442 gene locus_tag LOCUS_15340 gene luxS 1945 1442 CDS product S-ribosylhomocysteine lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857890.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence237 708 896 gene locus_tag LOCUS_15350 gene rpmB 708 896 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854974.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence238 704 12 gene locus_tag LOCUS_15360 704 12 CDS product aspartate/glutamate racemase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263461.1 protein_id gnl|my_center|LOCUS_15360 2043 793 gene locus_tag LOCUS_15370 2043 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence239 584 2014 gene locus_tag LOCUS_15380 584 2014 CDS product phospholipid carrier-dependent glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946372.1 protein_id gnl|my_center|LOCUS_15380 >Feature sequence240 1740 535 gene locus_tag LOCUS_15390 1740 535 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence241 573 139 gene locus_tag LOCUS_15400 573 139 CDS product DUF1566 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000252094.1 protein_id gnl|my_center|LOCUS_15400 1242 655 gene locus_tag LOCUS_15410 1242 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1577 1314 gene locus_tag LOCUS_15420 1577 1314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 <2172 1577 gene locus_tag LOCUS_15430 <2172 1577 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858390.1:F0F1 ATP synthase subunit A >Feature sequence242 707 324 gene locus_tag LOCUS_15440 707 324 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930621.1 protein_id gnl|my_center|LOCUS_15440 1398 811 gene locus_tag LOCUS_15450 1398 811 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456472.1 protein_id gnl|my_center|LOCUS_15450 1551 1961 gene locus_tag LOCUS_15460 1551 1961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15460 >Feature sequence243 1687 650 gene locus_tag LOCUS_15470 1687 650 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003227975.1 protein_id gnl|my_center|LOCUS_15470 2036 1890 gene locus_tag LOCUS_15480 2036 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 >Feature sequence244 203 2008 gene locus_tag LOCUS_15490 203 2008 CDS product biotin attachment protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858311.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence245 90 2 gene locus_tag LOCUS_t00250 90 2 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 306 1397 gene locus_tag LOCUS_15500 306 1397 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071609.1 protein_id gnl|my_center|LOCUS_15500 1394 1969 gene locus_tag LOCUS_15510 1394 1969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence246 1 780 gene locus_tag LOCUS_15520 1 780 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786519.1 protein_id gnl|my_center|LOCUS_15520 777 1571 gene locus_tag LOCUS_15530 777 1571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 2055 1609 gene locus_tag LOCUS_15540 2055 1609 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404691.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence247 395 1192 gene locus_tag LOCUS_15550 395 1192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 1445 1564 gene locus_tag LOCUS_15560 1445 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15560 >Feature sequence248 <2041 320 gene locus_tag LOCUS_15570 <2041 320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053708.1:N-6 DNA methylase >Feature sequence249 >Feature sequence250 412 92 gene locus_tag LOCUS_15580 412 92 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15580 556 741 gene locus_tag LOCUS_15590 556 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15590 738 1136 gene locus_tag LOCUS_15600 738 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 1178 2008 gene locus_tag LOCUS_15610 1178 2008 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852452.1 protein_id gnl|my_center|LOCUS_15610 >Feature sequence251 168 308 gene locus_tag LOCUS_15620 168 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 529 1941 gene locus_tag LOCUS_15630 529 1941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15630 >Feature sequence252 780 559 gene locus_tag LOCUS_15640 780 559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 1787 852 gene locus_tag LOCUS_15650 1787 852 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099334852.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence253 95 385 gene locus_tag LOCUS_15660 95 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 382 717 gene locus_tag LOCUS_15670 382 717 CDS product type II toxin-antitoxin system PemK/MazF family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829891.1 protein_id gnl|my_center|LOCUS_15670 >Feature sequence254 1193 459 gene locus_tag LOCUS_15680 1193 459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 1803 1303 gene locus_tag LOCUS_15690 1803 1303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence255 379 254 gene locus_tag LOCUS_15700 379 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 1323 511 gene locus_tag LOCUS_15710 1323 511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 <1988 1396 gene locus_tag LOCUS_15720 <1988 1396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000942070.1:ATP-binding cassette domain-containing protein >Feature sequence256 322 564 gene locus_tag LOCUS_15730 322 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 569 730 gene locus_tag LOCUS_15740 569 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 1952 723 gene locus_tag LOCUS_15750 1952 723 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256133.1 protein_id gnl|my_center|LOCUS_15750 >Feature sequence257 >Feature sequence258 1728 652 gene locus_tag LOCUS_15760 1728 652 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_15760 >Feature sequence259 1054 161 gene locus_tag LOCUS_15770 1054 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15770 1333 1055 gene locus_tag LOCUS_15780 1333 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15780 <1967 1333 gene locus_tag LOCUS_15790 <1967 1333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003233883.1:ATP-dependent helicase >Feature sequence260 520 1725 gene locus_tag LOCUS_15800 520 1725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1691 1912 gene locus_tag LOCUS_15810 1691 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 >Feature sequence261 967 71 gene locus_tag LOCUS_15820 967 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 1036 1824 gene locus_tag LOCUS_15830 1036 1824 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_15830 >Feature sequence262 513 247 gene locus_tag LOCUS_15840 513 247 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852641.1 protein_id gnl|my_center|LOCUS_15840 1682 510 gene locus_tag LOCUS_15850 1682 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence263 >Feature sequence264 436 1308 gene locus_tag LOCUS_15860 436 1308 CDS product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857964.1 protein_id gnl|my_center|LOCUS_15860 1308 1574 gene locus_tag LOCUS_15870 gene fliQ 1308 1574 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851290.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence265 <1871 115 gene locus_tag LOCUS_15880 <1871 115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852062.1:NAD-dependent DNA ligase LigA >Feature sequence266 1005 208 gene locus_tag LOCUS_15890 gene surE 1005 208 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854555.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence267 <1868 1056 gene locus_tag LOCUS_15900 <1868 1056 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858697.1:LptF/LptG family permease >Feature sequence268 537 785 gene locus_tag LOCUS_15910 537 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 796 1404 gene locus_tag LOCUS_15920 796 1404 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_15920 1418 1756 gene locus_tag LOCUS_15930 1418 1756 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762354.1 protein_id gnl|my_center|LOCUS_15930 >Feature sequence269 211 750 gene locus_tag LOCUS_15940 211 750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 765 1481 gene locus_tag LOCUS_15950 765 1481 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016734.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence270 >Feature sequence271 1441 782 gene locus_tag LOCUS_15960 1441 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1589 1443 gene locus_tag LOCUS_15970 1589 1443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence272 934 858 gene locus_tag LOCUS_t00260 934 858 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1097 1173 gene locus_tag LOCUS_t00270 1097 1173 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence273 52 735 gene locus_tag LOCUS_15980 52 735 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_15980 735 1472 gene locus_tag LOCUS_15990 735 1472 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881038.1 protein_id gnl|my_center|LOCUS_15990 >Feature sequence274 >Feature sequence275 303 1757 gene locus_tag LOCUS_16000 303 1757 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071465.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16000 >Feature sequence276 1200 490 gene locus_tag LOCUS_16010 1200 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 <1764 1181 gene locus_tag LOCUS_16020 <1764 1181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838131.1:potassium channel protein >Feature sequence277 388 191 gene locus_tag LOCUS_16030 388 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16030 1428 469 gene locus_tag LOCUS_16040 gene pfkA 1428 469 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082880.1 protein_id gnl|my_center|LOCUS_16040 >Feature sequence278 >Feature sequence279 18 1655 gene locus_tag LOCUS_16050 gene groL 18 1655 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858047.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence280 >Feature sequence281 1625 402 gene locus_tag LOCUS_16060 1625 402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891847.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence282 >Feature sequence283 1546 338 gene locus_tag LOCUS_16070 1546 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16070 >Feature sequence284 254 1390 gene locus_tag LOCUS_16080 254 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16080 >Feature sequence285 <1 1077 gene locus_tag LOCUS_16090 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011269067.1:EAL domain-containing protein 1157 1615 gene locus_tag LOCUS_16100 1157 1615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16100 >Feature sequence286 534 4 gene locus_tag LOCUS_16110 534 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1054 536 gene locus_tag LOCUS_16120 1054 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 >Feature sequence287 1159 599 gene locus_tag LOCUS_16130 1159 599 CDS product chalcone isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964030.1 protein_id gnl|my_center|LOCUS_16130 >Feature sequence288 82 1473 gene locus_tag LOCUS_16140 82 1473 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912892.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence289 255 1169 gene locus_tag LOCUS_16150 255 1169 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852073.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence290 >Feature sequence291 592 164 gene locus_tag LOCUS_16160 592 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16160 <1657 719 gene locus_tag LOCUS_16170 <1657 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260958.1:EAL domain-containing protein >Feature sequence292 >Feature sequence293 <1 546 gene locus_tag LOCUS_16180 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002859277.1:NAD(P)H-dependent glycerol-3-phosphate dehydrogenase 626 940 gene locus_tag LOCUS_16190 626 940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence294 885 448 gene locus_tag LOCUS_16200 885 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16200 <1621 974 gene locus_tag LOCUS_16210 <1621 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004523532.1:L,D-transpeptidase >Feature sequence295 >Feature sequence296 >Feature sequence297 <1 1197 gene locus_tag LOCUS_16220 <1 1197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000231086.1:peptidoglycan DD-metalloendopeptidase Csd1 1575 1198 gene locus_tag LOCUS_16230 gene acpS 1575 1198 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579175.1 protein_id gnl|my_center|LOCUS_16230 >Feature sequence298 761 901 gene locus_tag LOCUS_16240 761 901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 >Feature sequence299 <1 1321 gene locus_tag LOCUS_16250 <1 1321 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:PAS domain-containing sensor histidine kinase >Feature sequence300 >Feature sequence301 210 1163 gene locus_tag LOCUS_16260 210 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 1197 1397 gene locus_tag LOCUS_16270 1197 1397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence302 475 1212 gene locus_tag LOCUS_16280 475 1212 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_16280 >Feature sequence303 >Feature sequence304 231 1325 gene locus_tag LOCUS_16290 231 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence305 <1 1349 gene locus_tag LOCUS_16300 <1 1349 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002915726.1:phenylalanine--tRNA ligase subunit beta >Feature sequence306 785 315 gene locus_tag LOCUS_16310 785 315 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869860.1 protein_id gnl|my_center|LOCUS_16310 <1535 766 gene locus_tag LOCUS_16320 <1535 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851791.1:acetyl-CoA carboxylase, carboxyltransferase subunit beta >Feature sequence307 131 502 gene locus_tag LOCUS_16330 131 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16330 >Feature sequence308 >Feature sequence309 806 1105 gene locus_tag LOCUS_16340 806 1105 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000755879.1 protein_id gnl|my_center|LOCUS_16340 1349 1107 gene locus_tag LOCUS_16350 1349 1107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 >Feature sequence310 95 1357 gene locus_tag LOCUS_16360 gene murA 95 1357 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857102.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence311 293 203 gene locus_tag LOCUS_t00280 293 203 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38