>Feature sequence001 <1 554 gene locus_tag LOCUS_00010 <1 554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107543.1:TolC family protein 560 1435 gene locus_tag LOCUS_00020 560 1435 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005481519.1 protein_id gnl|my_center|LOCUS_00020 2224 1436 gene locus_tag LOCUS_00030 2224 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00030 2413 3471 gene locus_tag LOCUS_00040 gene cobT 2413 3471 CDS product nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932626.1 protein_id gnl|my_center|LOCUS_00040 4046 3468 gene locus_tag LOCUS_00050 4046 3468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4954 4046 gene locus_tag LOCUS_00060 4954 4046 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 6566 4923 gene locus_tag LOCUS_00070 6566 4923 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546318.1 protein_id gnl|my_center|LOCUS_00070 6804 7073 gene locus_tag LOCUS_00080 gene rpsO 6804 7073 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583506.1 protein_id gnl|my_center|LOCUS_00080 7077 9191 gene locus_tag LOCUS_00090 gene pnp 7077 9191 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545734.1 protein_id gnl|my_center|LOCUS_00090 9169 10362 gene locus_tag LOCUS_00100 9169 10362 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003438321.1 protein_id gnl|my_center|LOCUS_00100 10372 11499 gene locus_tag LOCUS_00110 10372 11499 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545576.1 protein_id gnl|my_center|LOCUS_00110 11492 12418 gene locus_tag LOCUS_00120 11492 12418 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949109.1 protein_id gnl|my_center|LOCUS_00120 12411 13679 gene locus_tag LOCUS_00130 12411 13679 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966856.1 protein_id gnl|my_center|LOCUS_00130 13684 14019 gene locus_tag LOCUS_00140 13684 14019 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430911.1 protein_id gnl|my_center|LOCUS_00140 14021 14470 gene locus_tag LOCUS_00150 gene aroQ 14021 14470 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124539.1 protein_id gnl|my_center|LOCUS_00150 15536 14439 gene locus_tag LOCUS_00160 15536 14439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 16913 15597 gene locus_tag LOCUS_00170 16913 15597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 17093 18727 gene locus_tag LOCUS_00180 gene pruA 17093 18727 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404266.1 protein_id gnl|my_center|LOCUS_00180 18732 19631 gene locus_tag LOCUS_00190 18732 19631 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_00190 20755 19643 gene locus_tag LOCUS_00200 20755 19643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545363.1 protein_id gnl|my_center|LOCUS_00200 21933 20752 gene locus_tag LOCUS_00210 21933 20752 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_00210 23637 22003 gene locus_tag LOCUS_00220 23637 22003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 23809 24945 gene locus_tag LOCUS_00230 23809 24945 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944012.1 protein_id gnl|my_center|LOCUS_00230 24958 25857 gene locus_tag LOCUS_00240 24958 25857 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938014.1 protein_id gnl|my_center|LOCUS_00240 25857 26801 gene locus_tag LOCUS_00250 25857 26801 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938015.1 protein_id gnl|my_center|LOCUS_00250 26806 27576 gene locus_tag LOCUS_00260 26806 27576 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525179.1 protein_id gnl|my_center|LOCUS_00260 27569 28294 gene locus_tag LOCUS_00270 27569 28294 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938017.1 protein_id gnl|my_center|LOCUS_00270 28864 28322 gene locus_tag LOCUS_00280 28864 28322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080988.1 protein_id gnl|my_center|LOCUS_00280 30744 28879 gene locus_tag LOCUS_00290 gene metG 30744 28879 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869940.1 protein_id gnl|my_center|LOCUS_00290 31559 30741 gene locus_tag LOCUS_00300 31559 30741 CDS product stage 0 sporulation family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003404857.1 protein_id gnl|my_center|LOCUS_00300 32154 31561 gene locus_tag LOCUS_00310 32154 31561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 32768 32154 gene locus_tag LOCUS_00320 gene tmk 32768 32154 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880600.1 protein_id gnl|my_center|LOCUS_00320 33696 32737 gene locus_tag LOCUS_00330 33696 32737 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_00330 33832 34692 gene locus_tag LOCUS_00340 33832 34692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 34689 34949 gene locus_tag LOCUS_00350 34689 34949 CDS product RNA-binding S4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003567635.1 protein_id gnl|my_center|LOCUS_00350 34942 35952 gene locus_tag LOCUS_00360 gene pdxA 34942 35952 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940791.1 protein_id gnl|my_center|LOCUS_00360 35931 36659 gene locus_tag LOCUS_00370 35931 36659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 36644 38299 gene locus_tag LOCUS_00380 36644 38299 CDS product ribonuclease J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460381.1 protein_id gnl|my_center|LOCUS_00380 38299 40440 gene locus_tag LOCUS_00390 38299 40440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 40457 41686 gene locus_tag LOCUS_00400 40457 41686 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545682.1 protein_id gnl|my_center|LOCUS_00400 41697 42647 gene locus_tag LOCUS_00410 gene accA 41697 42647 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262422.1 protein_id gnl|my_center|LOCUS_00410 42617 43714 gene locus_tag LOCUS_00420 gene pheA 42617 43714 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880586.1 protein_id gnl|my_center|LOCUS_00420 44720 43674 gene locus_tag LOCUS_00430 44720 43674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00430 44875 45279 gene locus_tag LOCUS_00440 gene ruvX 44875 45279 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221197.1 protein_id gnl|my_center|LOCUS_00440 45276 46232 gene locus_tag LOCUS_00450 gene mltG 45276 46232 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941176.1 protein_id gnl|my_center|LOCUS_00450 46229 47497 gene locus_tag LOCUS_00460 gene miaB 46229 47497 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545886.1 protein_id gnl|my_center|LOCUS_00460 47508 47933 gene locus_tag LOCUS_00470 47508 47933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 47927 48973 gene locus_tag LOCUS_00480 47927 48973 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546176.1 protein_id gnl|my_center|LOCUS_00480 48948 50258 gene locus_tag LOCUS_00490 48948 50258 CDS product metallopeptidase TldD-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881223.1 protein_id gnl|my_center|LOCUS_00490 50251 51771 gene locus_tag LOCUS_00500 gene guaA 50251 51771 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_00500 51773 54007 gene locus_tag LOCUS_00510 51773 54007 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942922.1 protein_id gnl|my_center|LOCUS_00510 53979 54407 gene locus_tag LOCUS_00520 gene ybeY 53979 54407 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583684.1 protein_id gnl|my_center|LOCUS_00520 54404 55216 gene locus_tag LOCUS_00530 gene cysE 54404 55216 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943208.1 protein_id gnl|my_center|LOCUS_00530 56200 55208 gene locus_tag LOCUS_00540 gene tsaD 56200 55208 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880485.1 protein_id gnl|my_center|LOCUS_00540 56934 56197 gene locus_tag LOCUS_00550 56934 56197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 58163 56913 gene locus_tag LOCUS_00560 58163 56913 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942416.1 protein_id gnl|my_center|LOCUS_00560 59329 58160 gene locus_tag LOCUS_00570 59329 58160 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129254226.1 protein_id gnl|my_center|LOCUS_00570 60074 59316 gene locus_tag LOCUS_00580 60074 59316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 60759 60133 gene locus_tag LOCUS_00590 gene ftsE 60759 60133 CDS product cell division ATP-binding protein FtsE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544942.1 protein_id gnl|my_center|LOCUS_00590 61681 60752 gene locus_tag LOCUS_00600 61681 60752 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_00600 62495 61671 gene locus_tag LOCUS_00610 62495 61671 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546285.1 protein_id gnl|my_center|LOCUS_00610 63373 62510 gene locus_tag LOCUS_00620 63373 62510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 64250 63351 gene locus_tag LOCUS_00630 gene hemC 64250 63351 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930577.1 protein_id gnl|my_center|LOCUS_00630 65509 64226 gene locus_tag LOCUS_00640 gene hemA 65509 64226 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943895.1 protein_id gnl|my_center|LOCUS_00640 66456 65506 gene locus_tag LOCUS_00650 66456 65506 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021158.1 protein_id gnl|my_center|LOCUS_00650 68878 66446 gene locus_tag LOCUS_00660 gene gyrA 68878 66446 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583623.1 protein_id gnl|my_center|LOCUS_00660 71242 68888 gene locus_tag LOCUS_00670 gene gyrB 71242 68888 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940681.1 protein_id gnl|my_center|LOCUS_00670 72231 71239 gene locus_tag LOCUS_00680 gene recF 72231 71239 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583898.1 protein_id gnl|my_center|LOCUS_00680 73319 72228 gene locus_tag LOCUS_00690 gene dnaN 73319 72228 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546822.1 protein_id gnl|my_center|LOCUS_00690 73532 73374 gene locus_tag LOCUS_00700 73532 73374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 74778 73525 gene locus_tag LOCUS_00710 gene dnaA 74778 73525 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947895.1 protein_id gnl|my_center|LOCUS_00710 75102 75548 gene locus_tag LOCUS_00720 75102 75548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 75717 78110 gene locus_tag LOCUS_00730 gene ppsA 75717 78110 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_00730 78157 79515 gene locus_tag LOCUS_00740 78157 79515 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545210.1 protein_id gnl|my_center|LOCUS_00740 79776 80237 gene locus_tag LOCUS_00750 79776 80237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 80248 80535 gene locus_tag LOCUS_00760 gene gatC 80248 80535 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461445.1 protein_id gnl|my_center|LOCUS_00760 80539 81957 gene locus_tag LOCUS_00770 gene gatA 80539 81957 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546781.1 protein_id gnl|my_center|LOCUS_00770 81966 82340 gene locus_tag LOCUS_00780 81966 82340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 82337 82651 gene locus_tag LOCUS_00790 82337 82651 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081479.1 protein_id gnl|my_center|LOCUS_00790 82651 83376 gene locus_tag LOCUS_00800 82651 83376 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005898431.1 protein_id gnl|my_center|LOCUS_00800 83469 84140 gene locus_tag LOCUS_00810 83469 84140 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207638.1 protein_id gnl|my_center|LOCUS_00810 84298 84840 gene locus_tag LOCUS_00820 84298 84840 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903986.1 protein_id gnl|my_center|LOCUS_00820 85408 84821 gene locus_tag LOCUS_00830 gene rsmG 85408 84821 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881025.1 protein_id gnl|my_center|LOCUS_00830 87269 85383 gene locus_tag LOCUS_00840 gene mnmG 87269 85383 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546402.1 protein_id gnl|my_center|LOCUS_00840 88662 87301 gene locus_tag LOCUS_00850 gene mnmE 88662 87301 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009898860.1 protein_id gnl|my_center|LOCUS_00850 90205 88649 gene locus_tag LOCUS_00860 gene yidC 90205 88649 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944075.1 protein_id gnl|my_center|LOCUS_00860 90473 90192 gene locus_tag LOCUS_00870 gene yidD 90473 90192 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582538.1 protein_id gnl|my_center|LOCUS_00870 92008 90986 gene locus_tag LOCUS_00880 92008 90986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 92361 92005 gene locus_tag LOCUS_00890 92361 92005 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546341.1 protein_id gnl|my_center|LOCUS_00890 93268 92351 gene locus_tag LOCUS_00900 93268 92351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 93305 93937 gene locus_tag LOCUS_00910 93305 93937 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023815.1 protein_id gnl|my_center|LOCUS_00910 93930 94697 gene locus_tag LOCUS_00920 gene fetB 93930 94697 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926980.1 protein_id gnl|my_center|LOCUS_00920 94740 97034 gene locus_tag LOCUS_00930 94740 97034 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942344.1 protein_id gnl|my_center|LOCUS_00930 97065 98294 gene locus_tag LOCUS_00940 97065 98294 CDS product amino acid ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807655.1 protein_id gnl|my_center|LOCUS_00940 98357 99244 gene locus_tag LOCUS_00950 98357 99244 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931471.1 protein_id gnl|my_center|LOCUS_00950 99237 100163 gene locus_tag LOCUS_00960 99237 100163 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003807650.1 protein_id gnl|my_center|LOCUS_00960 100153 100881 gene locus_tag LOCUS_00970 100153 100881 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763251.1 protein_id gnl|my_center|LOCUS_00970 100884 101594 gene locus_tag LOCUS_00980 100884 101594 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007052444.1 protein_id gnl|my_center|LOCUS_00980 102484 101612 gene locus_tag LOCUS_00990 102484 101612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 103032 102481 gene locus_tag LOCUS_01000 103032 102481 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932674.1 protein_id gnl|my_center|LOCUS_01000 105601 103007 gene locus_tag LOCUS_01010 105601 103007 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546426.1 protein_id gnl|my_center|LOCUS_01010 106298 105579 gene locus_tag LOCUS_01020 gene queC 106298 105579 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164922142.1 protein_id gnl|my_center|LOCUS_01020 106933 106298 gene locus_tag LOCUS_01030 106933 106298 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881331.1 protein_id gnl|my_center|LOCUS_01030 107086 107658 gene locus_tag LOCUS_01040 107086 107658 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005812610.1 protein_id gnl|my_center|LOCUS_01040 107651 111250 gene locus_tag LOCUS_01050 107651 111250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 111270 112949 gene locus_tag LOCUS_01060 111270 112949 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460315.1 protein_id gnl|my_center|LOCUS_01060 112955 113275 gene locus_tag LOCUS_01070 112955 113275 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930609.1 protein_id gnl|my_center|LOCUS_01070 113266 113655 gene locus_tag LOCUS_01080 113266 113655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 113781 114203 gene locus_tag LOCUS_01090 113781 114203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 114210 115427 gene locus_tag LOCUS_01100 114210 115427 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456304.1 protein_id gnl|my_center|LOCUS_01100 115427 115774 gene locus_tag LOCUS_01110 115427 115774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 115771 116211 gene locus_tag LOCUS_01120 115771 116211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 116204 116716 gene locus_tag LOCUS_01130 116204 116716 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073805.1 protein_id gnl|my_center|LOCUS_01130 116756 117526 gene locus_tag LOCUS_01140 116756 117526 CDS product type II secretion system protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000086312.1 protein_id gnl|my_center|LOCUS_01140 117516 117893 gene locus_tag LOCUS_01150 117516 117893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 117895 118743 gene locus_tag LOCUS_01160 117895 118743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 118740 119429 gene locus_tag LOCUS_01170 118740 119429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 119435 120430 gene locus_tag LOCUS_01180 119435 120430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 120427 120972 gene locus_tag LOCUS_01190 120427 120972 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 120969 121529 gene locus_tag LOCUS_01200 120969 121529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 121526 121933 gene locus_tag LOCUS_01210 121526 121933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 122152 123096 gene locus_tag LOCUS_01220 gene mdh 122152 123096 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256789.1 protein_id gnl|my_center|LOCUS_01220 123121 123969 gene locus_tag LOCUS_01230 123121 123969 CDS product fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816933.1 protein_id gnl|my_center|LOCUS_01230 123982 124548 gene locus_tag LOCUS_01240 123982 124548 CDS product Fe-S-containing hydro-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393765.1 protein_id gnl|my_center|LOCUS_01240 124689 125072 gene locus_tag LOCUS_01250 124689 125072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 125096 125467 gene locus_tag LOCUS_01260 125096 125467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 125488 127302 gene locus_tag LOCUS_01270 gene sdhA 125488 127302 CDS product succinate dehydrogenase flavoprotein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188402.1 protein_id gnl|my_center|LOCUS_01270 127322 128044 gene locus_tag LOCUS_01280 127322 128044 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946278.1 protein_id gnl|my_center|LOCUS_01280 129414 128077 gene locus_tag LOCUS_01290 gene xseA 129414 128077 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693773.1 protein_id gnl|my_center|LOCUS_01290 129976 129404 gene locus_tag LOCUS_01300 gene ruvA 129976 129404 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005486097.1 protein_id gnl|my_center|LOCUS_01300 131121 129979 gene locus_tag LOCUS_01310 gene lapB 131121 129979 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705693.1 protein_id gnl|my_center|LOCUS_01310 131416 131123 gene locus_tag LOCUS_01320 131416 131123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 131892 131413 gene locus_tag LOCUS_01330 131892 131413 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_01330 133206 131905 gene locus_tag LOCUS_01340 133206 131905 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942374.1 protein_id gnl|my_center|LOCUS_01340 133662 133216 gene locus_tag LOCUS_01350 133662 133216 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545228.1 protein_id gnl|my_center|LOCUS_01350 133795 134808 gene locus_tag LOCUS_01360 gene gap 133795 134808 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_01360 134805 135989 gene locus_tag LOCUS_01370 gene pgk 134805 135989 CDS product phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942273.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence002 420 1085 gene locus_tag LOCUS_01380 420 1085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 1054 1806 gene locus_tag LOCUS_01390 1054 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 1825 2433 gene locus_tag LOCUS_01400 1825 2433 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583271.1 protein_id gnl|my_center|LOCUS_01400 2457 3764 gene locus_tag LOCUS_01410 2457 3764 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 protein_id gnl|my_center|LOCUS_01410 3761 5098 gene locus_tag LOCUS_01420 3761 5098 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000592994.1 protein_id gnl|my_center|LOCUS_01420 5085 5909 gene locus_tag LOCUS_01430 gene xerD 5085 5909 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546237.1 protein_id gnl|my_center|LOCUS_01430 5906 6541 gene locus_tag LOCUS_01440 gene ispD 5906 6541 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048363.1 protein_id gnl|my_center|LOCUS_01440 6526 7023 gene locus_tag LOCUS_01450 gene ispF 6526 7023 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963756.1 protein_id gnl|my_center|LOCUS_01450 7007 7228 gene locus_tag LOCUS_01460 7007 7228 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545707.1 protein_id gnl|my_center|LOCUS_01460 7241 7546 gene locus_tag LOCUS_01470 7241 7546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 7569 9173 gene locus_tag LOCUS_01480 gene secD 7569 9173 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943255.1 protein_id gnl|my_center|LOCUS_01480 9184 10158 gene locus_tag LOCUS_01490 gene secF 9184 10158 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_085009790.1 protein_id gnl|my_center|LOCUS_01490 10344 12848 gene locus_tag LOCUS_01500 10344 12848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 12845 13378 gene locus_tag LOCUS_01510 12845 13378 CDS product Maf family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869234.1 protein_id gnl|my_center|LOCUS_01510 13434 15329 gene locus_tag LOCUS_01520 13434 15329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 15326 15979 gene locus_tag LOCUS_01530 15326 15979 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880134.1 protein_id gnl|my_center|LOCUS_01530 15976 16308 gene locus_tag LOCUS_01540 15976 16308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 17558 16638 gene locus_tag LOCUS_01550 17558 16638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 18640 17597 gene locus_tag LOCUS_01560 18640 17597 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001967602.1 protein_id gnl|my_center|LOCUS_01560 18715 19887 gene locus_tag LOCUS_01570 18715 19887 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880720.1 protein_id gnl|my_center|LOCUS_01570 19888 20085 gene locus_tag LOCUS_01580 19888 20085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 20086 20589 gene locus_tag LOCUS_01590 20086 20589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 20662 21198 gene locus_tag LOCUS_01600 20662 21198 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_01600 21195 22331 gene locus_tag LOCUS_01610 21195 22331 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147320.1 protein_id gnl|my_center|LOCUS_01610 22328 23200 gene locus_tag LOCUS_01620 22328 23200 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868480.1 protein_id gnl|my_center|LOCUS_01620 23215 23508 gene locus_tag LOCUS_01630 23215 23508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 23512 25854 gene locus_tag LOCUS_01640 23512 25854 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082420.1 protein_id gnl|my_center|LOCUS_01640 25862 27007 gene locus_tag LOCUS_01650 gene aroC 25862 27007 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942670.1 protein_id gnl|my_center|LOCUS_01650 27028 27492 gene locus_tag LOCUS_01660 27028 27492 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903422.1 protein_id gnl|my_center|LOCUS_01660 27500 28360 gene locus_tag LOCUS_01670 27500 28360 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943642.1 protein_id gnl|my_center|LOCUS_01670 28357 29271 gene locus_tag LOCUS_01680 28357 29271 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545841.1 protein_id gnl|my_center|LOCUS_01680 29258 30277 gene locus_tag LOCUS_01690 gene mtnA 29258 30277 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166394793.1 protein_id gnl|my_center|LOCUS_01690 30280 31035 gene locus_tag LOCUS_01700 30280 31035 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877942.1 protein_id gnl|my_center|LOCUS_01700 31035 31946 gene locus_tag LOCUS_01710 gene ftsY 31035 31946 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546073.1 protein_id gnl|my_center|LOCUS_01710 31964 33217 gene locus_tag LOCUS_01720 gene eno 31964 33217 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948030.1 protein_id gnl|my_center|LOCUS_01720 33195 33503 gene locus_tag LOCUS_01730 33195 33503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 33510 34808 gene locus_tag LOCUS_01740 gene trmFO 33510 34808 CDS product FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase TrmFO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880411.1 protein_id gnl|my_center|LOCUS_01740 34789 35457 gene locus_tag LOCUS_01750 gene thyX 34789 35457 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583167.1 protein_id gnl|my_center|LOCUS_01750 35454 36131 gene locus_tag LOCUS_01760 gene rsmI 35454 36131 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941314.1 protein_id gnl|my_center|LOCUS_01760 36124 37560 gene locus_tag LOCUS_01770 gene murJ 36124 37560 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010896072.1 protein_id gnl|my_center|LOCUS_01770 38078 37497 gene locus_tag LOCUS_01780 38078 37497 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545242.1 protein_id gnl|my_center|LOCUS_01780 38145 38495 gene locus_tag LOCUS_01790 38145 38495 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081748.1 protein_id gnl|my_center|LOCUS_01790 38495 39091 gene locus_tag LOCUS_01800 38495 39091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 39092 41293 gene locus_tag LOCUS_01810 gene purL 39092 41293 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768344.1 protein_id gnl|my_center|LOCUS_01810 41268 41582 gene locus_tag LOCUS_01820 41268 41582 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073565.1 protein_id gnl|my_center|LOCUS_01820 41579 43387 gene locus_tag LOCUS_01830 gene uvrC 41579 43387 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436264.1 protein_id gnl|my_center|LOCUS_01830 43481 43388 gene locus_tag LOCUS_t00010 43481 43388 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 43581 43490 gene locus_tag LOCUS_t00020 43581 43490 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 44488 43637 gene locus_tag LOCUS_01840 gene metF 44488 43637 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880925.1 protein_id gnl|my_center|LOCUS_01840 45574 44507 gene locus_tag LOCUS_01850 gene mqnC 45574 44507 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880478.1 protein_id gnl|my_center|LOCUS_01850 46650 45571 gene locus_tag LOCUS_01860 gene mqnE 46650 45571 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_01860 48050 46647 gene locus_tag LOCUS_01870 48050 46647 CDS product phosphomannomutase/phosphoglucomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582491.1 protein_id gnl|my_center|LOCUS_01870 48280 49824 gene locus_tag LOCUS_01880 48280 49824 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005800651.1 protein_id gnl|my_center|LOCUS_01880 49840 51396 gene locus_tag LOCUS_01890 gene accC 49840 51396 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202499.1 protein_id gnl|my_center|LOCUS_01890 51414 51917 gene locus_tag LOCUS_01900 51414 51917 CDS product biotin/lipoyl-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107788.1 protein_id gnl|my_center|LOCUS_01900 53034 51940 gene locus_tag LOCUS_01910 53034 51940 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_01910 53195 53105 gene locus_tag LOCUS_t00030 53195 53105 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 53967 53413 gene locus_tag LOCUS_01920 53967 53413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 54024 55490 gene locus_tag LOCUS_01930 54024 55490 CDS product ASKHA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544976.1 protein_id gnl|my_center|LOCUS_01930 55483 55761 gene locus_tag LOCUS_01940 55483 55761 CDS product SemiSWEET transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089200.1 protein_id gnl|my_center|LOCUS_01940 55751 56533 gene locus_tag LOCUS_01950 gene xth 55751 56533 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140144.1 protein_id gnl|my_center|LOCUS_01950 56530 57372 gene locus_tag LOCUS_01960 56530 57372 CDS product glycine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082894.1 protein_id gnl|my_center|LOCUS_01960 57369 59381 gene locus_tag LOCUS_01970 gene glyS 57369 59381 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861551.1 protein_id gnl|my_center|LOCUS_01970 59383 60837 gene locus_tag LOCUS_01980 gene guaB 59383 60837 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583116.1 protein_id gnl|my_center|LOCUS_01980 60830 61360 gene locus_tag LOCUS_01990 60830 61360 CDS product phospholipase D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964673.1 protein_id gnl|my_center|LOCUS_01990 61336 61764 gene locus_tag LOCUS_02000 61336 61764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 61751 63550 gene locus_tag LOCUS_02010 gene lepA 61751 63550 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938004.1 protein_id gnl|my_center|LOCUS_02010 >Feature sequence003 977 486 gene locus_tag LOCUS_02020 977 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1107 1880 gene locus_tag LOCUS_02030 gene folE2 1107 1880 CDS product GTP cyclohydrolase FolE2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941152.1 protein_id gnl|my_center|LOCUS_02030 1945 2535 gene locus_tag LOCUS_02040 1945 2535 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 2788 4326 gene locus_tag LOCUS_02050 2788 4326 CDS product 4-hydroxyphenylacetate 3-hydroxylase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462074.1 protein_id gnl|my_center|LOCUS_02050 4350 5120 gene locus_tag LOCUS_02060 4350 5120 CDS product glucose 1-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462069.1 protein_id gnl|my_center|LOCUS_02060 5193 5963 gene locus_tag LOCUS_02070 5193 5963 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087972.1 protein_id gnl|my_center|LOCUS_02070 7324 5960 gene locus_tag LOCUS_02080 7324 5960 CDS product aldehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861492.1 protein_id gnl|my_center|LOCUS_02080 7561 7899 gene locus_tag LOCUS_02090 7561 7899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02090 7903 9066 gene locus_tag LOCUS_02100 7903 9066 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207481.1 protein_id gnl|my_center|LOCUS_02100 9825 9058 gene locus_tag LOCUS_02110 9825 9058 CDS product BadF/BadG/BcrA/BcrD ATPase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879451.1 protein_id gnl|my_center|LOCUS_02110 11147 9825 gene locus_tag LOCUS_02120 11147 9825 CDS product 2-hydroxyacyl-CoA dehydratase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879450.1 protein_id gnl|my_center|LOCUS_02120 12241 11144 gene locus_tag LOCUS_02130 gene hadC 12241 11144 CDS product (R)-2-hydroxyisocaproyl-CoA dehydratase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003427763.1 protein_id gnl|my_center|LOCUS_02130 13892 12228 gene locus_tag LOCUS_02140 13892 12228 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460241.1 protein_id gnl|my_center|LOCUS_02140 14006 15496 gene locus_tag LOCUS_02150 14006 15496 CDS product amidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001136108.1 protein_id gnl|my_center|LOCUS_02150 16425 15493 gene locus_tag LOCUS_02160 16425 15493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 18228 16468 gene locus_tag LOCUS_02170 18228 16468 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000416279.1 protein_id gnl|my_center|LOCUS_02170 19433 18258 gene locus_tag LOCUS_02180 19433 18258 CDS product thiolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259064.1 protein_id gnl|my_center|LOCUS_02180 21787 19448 gene locus_tag LOCUS_02190 21787 19448 CDS product 3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272544.1 protein_id gnl|my_center|LOCUS_02190 23661 21817 gene locus_tag LOCUS_02200 23661 21817 CDS product AMP-dependent synthetase/ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926994.1 protein_id gnl|my_center|LOCUS_02200 23963 24934 gene locus_tag LOCUS_02210 23963 24934 CDS product nitronate monooxygenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085927.1 protein_id gnl|my_center|LOCUS_02210 27007 24995 gene locus_tag LOCUS_02220 27007 24995 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462072.1 protein_id gnl|my_center|LOCUS_02220 28235 27075 gene locus_tag LOCUS_02230 28235 27075 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_02230 29025 28246 gene locus_tag LOCUS_02240 29025 28246 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942026.1 protein_id gnl|my_center|LOCUS_02240 29889 29041 gene locus_tag LOCUS_02250 29889 29041 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918601.1 protein_id gnl|my_center|LOCUS_02250 31076 29901 gene locus_tag LOCUS_02260 31076 29901 CDS product acetyl-CoA C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357329.1 protein_id gnl|my_center|LOCUS_02260 32062 31151 gene locus_tag LOCUS_02270 32062 31151 CDS product electron transfer flavoprotein subunit alpha/FixB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933795.1 protein_id gnl|my_center|LOCUS_02270 32841 32074 gene locus_tag LOCUS_02280 32841 32074 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986814.1 protein_id gnl|my_center|LOCUS_02280 33009 33407 gene locus_tag LOCUS_02290 33009 33407 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000276566.1 protein_id gnl|my_center|LOCUS_02290 33504 34715 gene locus_tag LOCUS_02300 gene sucC 33504 34715 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881049.1 protein_id gnl|my_center|LOCUS_02300 34719 35603 gene locus_tag LOCUS_02310 gene sucD 34719 35603 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881050.1 protein_id gnl|my_center|LOCUS_02310 36084 35632 gene locus_tag LOCUS_02320 gene rnhA 36084 35632 CDS product ribonuclease HI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947113.1 protein_id gnl|my_center|LOCUS_02320 37976 36081 gene locus_tag LOCUS_02330 gene feoB 37976 36081 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545132.1 protein_id gnl|my_center|LOCUS_02330 38200 37976 gene locus_tag LOCUS_02340 38200 37976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 38413 38228 gene locus_tag LOCUS_02350 38413 38228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 39360 38410 gene locus_tag LOCUS_02360 39360 38410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 40362 39427 gene locus_tag LOCUS_02370 40362 39427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 40560 40934 gene locus_tag LOCUS_02380 40560 40934 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250155.1 protein_id gnl|my_center|LOCUS_02380 41210 40959 gene locus_tag LOCUS_02390 41210 40959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 42370 41213 gene locus_tag LOCUS_02400 42370 41213 CDS product cofactor-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545558.1 protein_id gnl|my_center|LOCUS_02400 42762 42373 gene locus_tag LOCUS_02410 42762 42373 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_02410 42855 43517 gene locus_tag LOCUS_02420 42855 43517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 43531 44328 gene locus_tag LOCUS_02430 gene minD 43531 44328 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392079.1 protein_id gnl|my_center|LOCUS_02430 44334 44573 gene locus_tag LOCUS_02440 gene minE 44334 44573 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814252.1 protein_id gnl|my_center|LOCUS_02440 45432 44566 gene locus_tag LOCUS_02450 45432 44566 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867793.1 protein_id gnl|my_center|LOCUS_02450 45598 45425 gene locus_tag LOCUS_02460 45598 45425 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_02460 46110 45595 gene locus_tag LOCUS_02470 46110 45595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 46169 46534 gene locus_tag LOCUS_tm00010 46169 46534 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 46592 46666 gene locus_tag LOCUS_t00040 46592 46666 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence004 211 136 gene locus_tag LOCUS_t00050 211 136 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 297 221 gene locus_tag LOCUS_t00060 297 221 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 397 312 gene locus_tag LOCUS_t00070 397 312 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 476 401 gene locus_tag LOCUS_t00080 476 401 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1879 674 gene locus_tag LOCUS_02480 gene argJ 1879 674 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435168.1 protein_id gnl|my_center|LOCUS_02480 2883 1876 gene locus_tag LOCUS_02490 gene argC 2883 1876 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546077.1 protein_id gnl|my_center|LOCUS_02490 3313 2924 gene locus_tag LOCUS_02500 gene rpsI 3313 2924 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227269.1 protein_id gnl|my_center|LOCUS_02500 3751 3323 gene locus_tag LOCUS_02510 gene rplM 3751 3323 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421107.1 protein_id gnl|my_center|LOCUS_02510 3896 3973 gene locus_tag LOCUS_t00090 3896 3973 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3983 4059 gene locus_tag LOCUS_t00100 3983 4059 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 4345 4269 gene locus_tag LOCUS_t00110 4345 4269 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5052 4381 gene locus_tag LOCUS_02520 5052 4381 CDS product GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870180.1 protein_id gnl|my_center|LOCUS_02520 5307 5092 gene locus_tag LOCUS_02530 5307 5092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 5672 6010 gene locus_tag LOCUS_02540 5672 6010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 6003 6884 gene locus_tag LOCUS_02550 6003 6884 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392639.1 protein_id gnl|my_center|LOCUS_02550 6881 7762 gene locus_tag LOCUS_02560 6881 7762 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256294.1 protein_id gnl|my_center|LOCUS_02560 7810 8079 gene locus_tag LOCUS_02570 7810 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 8119 8913 gene locus_tag LOCUS_02580 8119 8913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 8891 9637 gene locus_tag LOCUS_02590 8891 9637 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496890.1 protein_id gnl|my_center|LOCUS_02590 11806 11003 gene locus_tag LOCUS_02600 gene amrB 11806 11003 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880539.1 protein_id gnl|my_center|LOCUS_02600 12069 11815 gene locus_tag LOCUS_02610 12069 11815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 14668 12071 gene locus_tag LOCUS_02620 gene alaS 14668 12071 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545089.1 protein_id gnl|my_center|LOCUS_02620 15098 14652 gene locus_tag LOCUS_02630 15098 14652 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865419.1 protein_id gnl|my_center|LOCUS_02630 16168 15095 gene locus_tag LOCUS_02640 16168 15095 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940822.1 protein_id gnl|my_center|LOCUS_02640 17171 16158 gene locus_tag LOCUS_02650 gene recA 17171 16158 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940821.1 protein_id gnl|my_center|LOCUS_02650 17727 17164 gene locus_tag LOCUS_02660 gene thpR 17727 17164 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_02660 18740 17724 gene locus_tag LOCUS_02670 18740 17724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 19201 18737 gene locus_tag LOCUS_02680 19201 18737 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880153.1 protein_id gnl|my_center|LOCUS_02680 20370 19198 gene locus_tag LOCUS_02690 20370 19198 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_02690 21902 20460 gene locus_tag LOCUS_02700 21902 20460 CDS product NADH-quinone oxidoreductase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941019.1 protein_id gnl|my_center|LOCUS_02700 23482 21917 gene locus_tag LOCUS_02710 23482 21917 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_02710 25400 23499 gene locus_tag LOCUS_02720 gene nuoL 25400 23499 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546379.1 protein_id gnl|my_center|LOCUS_02720 25706 25413 gene locus_tag LOCUS_02730 gene nuoK 25706 25413 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941016.1 protein_id gnl|my_center|LOCUS_02730 26220 25717 gene locus_tag LOCUS_02740 26220 25717 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061937.1 protein_id gnl|my_center|LOCUS_02740 26645 26226 gene locus_tag LOCUS_02750 gene nuoI 26645 26226 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941014.1 protein_id gnl|my_center|LOCUS_02750 27651 26659 gene locus_tag LOCUS_02760 gene nuoH 27651 26659 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546488.1 protein_id gnl|my_center|LOCUS_02760 30005 27654 gene locus_tag LOCUS_02770 30005 27654 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941177.1 protein_id gnl|my_center|LOCUS_02770 31214 30018 gene locus_tag LOCUS_02780 gene nuoD 31214 30018 CDS product NADH dehydrogenase (quinone) subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941009.1 protein_id gnl|my_center|LOCUS_02780 31758 31228 gene locus_tag LOCUS_02790 31758 31228 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546766.1 protein_id gnl|my_center|LOCUS_02790 32236 31775 gene locus_tag LOCUS_02800 32236 31775 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941007.1 protein_id gnl|my_center|LOCUS_02800 32577 32227 gene locus_tag LOCUS_02810 32577 32227 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941006.1 protein_id gnl|my_center|LOCUS_02810 34168 32753 gene locus_tag LOCUS_02820 gene gltA 34168 32753 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272418.1 protein_id gnl|my_center|LOCUS_02820 35010 34168 gene locus_tag LOCUS_02830 35010 34168 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065799.1 protein_id gnl|my_center|LOCUS_02830 35628 35041 gene locus_tag LOCUS_02840 35628 35041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02840 36346 35615 gene locus_tag LOCUS_02850 36346 35615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 37412 36333 gene locus_tag LOCUS_02860 gene aroB 37412 36333 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942668.1 protein_id gnl|my_center|LOCUS_02860 38458 37385 gene locus_tag LOCUS_02870 38458 37385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 39084 38455 gene locus_tag LOCUS_02880 39084 38455 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_02880 39700 39059 gene locus_tag LOCUS_02890 gene hisG 39700 39059 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943722.1 protein_id gnl|my_center|LOCUS_02890 40932 39682 gene locus_tag LOCUS_02900 gene murA 40932 39682 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940516.1 protein_id gnl|my_center|LOCUS_02900 41390 40932 gene locus_tag LOCUS_02910 41390 40932 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_02910 42378 41392 gene locus_tag LOCUS_02920 gene fliY 42378 41392 CDS product flagellar motor switch protein FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150629.1 protein_id gnl|my_center|LOCUS_02920 43371 42388 gene locus_tag LOCUS_02930 gene fliM 43371 42388 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851710.1 protein_id gnl|my_center|LOCUS_02930 44460 43378 gene locus_tag LOCUS_02940 44460 43378 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545234.1 protein_id gnl|my_center|LOCUS_02940 44551 46542 gene locus_tag LOCUS_02950 44551 46542 CDS product aconitate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881159.1 protein_id gnl|my_center|LOCUS_02950 46567 46917 gene locus_tag LOCUS_02960 46567 46917 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496603.1 protein_id gnl|my_center|LOCUS_02960 >Feature sequence005 1382 816 gene locus_tag LOCUS_02970 1382 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 1826 1383 gene locus_tag LOCUS_02980 1826 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 3844 1841 gene locus_tag LOCUS_02990 gene pcrA 3844 1841 CDS product DNA helicase PcrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000992924.1 protein_id gnl|my_center|LOCUS_02990 5600 3810 gene locus_tag LOCUS_03000 5600 3810 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878912.1 protein_id gnl|my_center|LOCUS_03000 7414 5597 gene locus_tag LOCUS_03010 gene glmS 7414 5597 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545099.1 protein_id gnl|my_center|LOCUS_03010 9224 7449 gene locus_tag LOCUS_03020 9224 7449 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119127.1 protein_id gnl|my_center|LOCUS_03020 10580 9225 gene locus_tag LOCUS_03030 gene glmU 10580 9225 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931068.1 protein_id gnl|my_center|LOCUS_03030 12097 10592 gene locus_tag LOCUS_03040 gene purH 12097 10592 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881280.1 protein_id gnl|my_center|LOCUS_03040 13736 12459 gene locus_tag LOCUS_03050 gene purD 13736 12459 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545691.1 protein_id gnl|my_center|LOCUS_03050 15361 13751 gene locus_tag LOCUS_03060 15361 13751 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546101.1 protein_id gnl|my_center|LOCUS_03060 16066 15392 gene locus_tag LOCUS_03070 16066 15392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 16923 16066 gene locus_tag LOCUS_03080 16923 16066 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545992.1 protein_id gnl|my_center|LOCUS_03080 18124 16916 gene locus_tag LOCUS_03090 gene flhF 18124 16916 CDS product flagellar biosynthesis protein FlhF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965445.1 protein_id gnl|my_center|LOCUS_03090 20178 18121 gene locus_tag LOCUS_03100 gene flhA 20178 18121 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206768427.1 protein_id gnl|my_center|LOCUS_03100 20433 20227 gene locus_tag LOCUS_03110 20433 20227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 20357 20614 gene locus_tag LOCUS_03120 20357 20614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 20900 21223 gene locus_tag LOCUS_03130 20900 21223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 22498 21479 gene locus_tag LOCUS_03140 22498 21479 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461253.1 protein_id gnl|my_center|LOCUS_03140 23541 22495 gene locus_tag LOCUS_03150 23541 22495 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491176.1 protein_id gnl|my_center|LOCUS_03150 24336 23548 gene locus_tag LOCUS_03160 24336 23548 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072060.1 protein_id gnl|my_center|LOCUS_03160 24423 24689 gene locus_tag LOCUS_03170 24423 24689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 24652 25413 gene locus_tag LOCUS_03180 24652 25413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 25410 26156 gene locus_tag LOCUS_03190 25410 26156 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942686.1 protein_id gnl|my_center|LOCUS_03190 26158 27207 gene locus_tag LOCUS_03200 26158 27207 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546094.1 protein_id gnl|my_center|LOCUS_03200 27898 27170 gene locus_tag LOCUS_03210 27898 27170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 29480 28554 gene locus_tag LOCUS_03220 gene fmt 29480 28554 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546616.1 protein_id gnl|my_center|LOCUS_03220 29992 29477 gene locus_tag LOCUS_03230 gene def 29992 29477 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545479.1 protein_id gnl|my_center|LOCUS_03230 31130 30036 gene locus_tag LOCUS_03240 31130 30036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 31850 31140 gene locus_tag LOCUS_03250 31850 31140 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_03250 31771 32358 gene locus_tag LOCUS_03260 31771 32358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03260 32788 32528 gene locus_tag LOCUS_03270 32788 32528 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_03270 33711 32905 gene locus_tag LOCUS_03280 33711 32905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 33950 34966 gene locus_tag LOCUS_03290 33950 34966 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545158.1 protein_id gnl|my_center|LOCUS_03290 34963 36366 gene locus_tag LOCUS_03300 34963 36366 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249805.1 protein_id gnl|my_center|LOCUS_03300 36350 37339 gene locus_tag LOCUS_03310 gene cbiB 36350 37339 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491348.1 protein_id gnl|my_center|LOCUS_03310 37878 37411 gene locus_tag LOCUS_03320 37878 37411 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944306.1 protein_id gnl|my_center|LOCUS_03320 38538 37894 gene locus_tag LOCUS_03330 38538 37894 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927082.1 protein_id gnl|my_center|LOCUS_03330 38806 39147 gene locus_tag LOCUS_03340 38806 39147 CDS product DUF5320 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064827.1 protein_id gnl|my_center|LOCUS_03340 39192 39521 gene locus_tag LOCUS_03350 39192 39521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 39535 40371 gene locus_tag LOCUS_03360 39535 40371 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079932.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence006 3897 2164 gene locus_tag LOCUS_03370 gene recJ 3897 2164 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943252.1 protein_id gnl|my_center|LOCUS_03370 5716 3881 gene locus_tag LOCUS_03380 5716 3881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7007 5709 gene locus_tag LOCUS_03390 7007 5709 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545264.1 protein_id gnl|my_center|LOCUS_03390 8105 7077 gene locus_tag LOCUS_03400 gene aroF 8105 7077 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546648.1 protein_id gnl|my_center|LOCUS_03400 8492 9832 gene locus_tag LOCUS_03410 8492 9832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 9777 10241 gene locus_tag LOCUS_03420 gene ruvC 9777 10241 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121356.1 protein_id gnl|my_center|LOCUS_03420 11264 10236 gene locus_tag LOCUS_03430 gene rlmN 11264 10236 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941772.1 protein_id gnl|my_center|LOCUS_03430 12111 11257 gene locus_tag LOCUS_03440 12111 11257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024135.1 protein_id gnl|my_center|LOCUS_03440 12486 12112 gene locus_tag LOCUS_03450 12486 12112 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 protein_id gnl|my_center|LOCUS_03450 13211 12483 gene locus_tag LOCUS_03460 gene cheZ 13211 12483 CDS product protein phosphatase CheZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000191026.1 protein_id gnl|my_center|LOCUS_03460 13701 13213 gene locus_tag LOCUS_03470 13701 13213 CDS product chemotaxis protein CheX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937609.1 protein_id gnl|my_center|LOCUS_03470 14678 13719 gene locus_tag LOCUS_03480 14678 13719 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851778.1 protein_id gnl|my_center|LOCUS_03480 15255 14671 gene locus_tag LOCUS_03490 15255 14671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03490 17649 15277 gene locus_tag LOCUS_03500 17649 15277 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891851.1 protein_id gnl|my_center|LOCUS_03500 18836 17652 gene locus_tag LOCUS_03510 18836 17652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 19857 18829 gene locus_tag LOCUS_03520 19857 18829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 21199 19904 gene locus_tag LOCUS_03530 gene purB 21199 19904 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942277.1 protein_id gnl|my_center|LOCUS_03530 22411 21326 gene locus_tag LOCUS_03540 gene rodA 22411 21326 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546334.1 protein_id gnl|my_center|LOCUS_03540 23196 22411 gene locus_tag LOCUS_03550 23196 22411 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545272.1 protein_id gnl|my_center|LOCUS_03550 23611 24600 gene locus_tag LOCUS_03560 gene fbp 23611 24600 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001171118.1 protein_id gnl|my_center|LOCUS_03560 >Feature sequence007 1719 991 gene locus_tag LOCUS_03570 gene kdsB 1719 991 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016663.1 protein_id gnl|my_center|LOCUS_03570 2651 1716 gene locus_tag LOCUS_03580 gene rfaE1 2651 1716 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880334.1 protein_id gnl|my_center|LOCUS_03580 3339 2653 gene locus_tag LOCUS_03590 3339 2653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5879 3336 gene locus_tag LOCUS_03600 5879 3336 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337000.1 protein_id gnl|my_center|LOCUS_03600 6221 5883 gene locus_tag LOCUS_03610 gene glnB 6221 5883 CDS product nitrogen regulator P-II GlnB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880011.1 protein_id gnl|my_center|LOCUS_03610 6632 6222 gene locus_tag LOCUS_03620 6632 6222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 7188 6622 gene locus_tag LOCUS_03630 7188 6622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 8032 7181 gene locus_tag LOCUS_03640 8032 7181 CDS product UbiA-like polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205587.1 protein_id gnl|my_center|LOCUS_03640 8537 8019 gene locus_tag LOCUS_03650 gene pgsA 8537 8019 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869392.1 protein_id gnl|my_center|LOCUS_03650 9010 8531 gene locus_tag LOCUS_03660 9010 8531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 10806 9151 gene locus_tag LOCUS_03670 10806 9151 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924857.1 protein_id gnl|my_center|LOCUS_03670 11863 10790 gene locus_tag LOCUS_03680 gene ispG 11863 10790 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986795.1 protein_id gnl|my_center|LOCUS_03680 12945 11860 gene locus_tag LOCUS_03690 gene rseP 12945 11860 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545838.1 protein_id gnl|my_center|LOCUS_03690 14093 12942 gene locus_tag LOCUS_03700 14093 12942 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931819.1 protein_id gnl|my_center|LOCUS_03700 14854 14072 gene locus_tag LOCUS_03710 14854 14072 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583559.1 protein_id gnl|my_center|LOCUS_03710 15558 14851 gene locus_tag LOCUS_03720 15558 14851 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964194.1 protein_id gnl|my_center|LOCUS_03720 16124 15555 gene locus_tag LOCUS_03730 gene frr 16124 15555 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545660.1 protein_id gnl|my_center|LOCUS_03730 16800 16141 gene locus_tag LOCUS_03740 gene pyrH 16800 16141 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392548.1 protein_id gnl|my_center|LOCUS_03740 17454 16858 gene locus_tag LOCUS_03750 gene tsf 17454 16858 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_03750 18263 17457 gene locus_tag LOCUS_03760 gene rpsB 18263 17457 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942566.1 protein_id gnl|my_center|LOCUS_03760 20354 18354 gene locus_tag LOCUS_03770 gene pglB 20354 18354 CDS product undecaprenyl-diphosphooligosaccharide--protein glycotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852780.1 protein_id gnl|my_center|LOCUS_03770 20962 20351 gene locus_tag LOCUS_03780 20962 20351 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000018313.1 protein_id gnl|my_center|LOCUS_03780 21795 20971 gene locus_tag LOCUS_03790 21795 20971 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582910.1 protein_id gnl|my_center|LOCUS_03790 22516 21788 gene locus_tag LOCUS_03800 gene hisA 22516 21788 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897810.1 protein_id gnl|my_center|LOCUS_03800 23136 22513 gene locus_tag LOCUS_03810 gene hisH 23136 22513 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_03810 23776 23129 gene locus_tag LOCUS_03820 23776 23129 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545248.1 protein_id gnl|my_center|LOCUS_03820 24537 23776 gene locus_tag LOCUS_03830 24537 23776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 <25591 24839 gene locus_tag LOCUS_03840 <25591 24839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003565159.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase >Feature sequence008 1783 1857 gene locus_tag LOCUS_t00120 1783 1857 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 3646 1862 gene locus_tag LOCUS_03850 gene aspS 3646 1862 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942109.1 protein_id gnl|my_center|LOCUS_03850 4872 3637 gene locus_tag LOCUS_03860 gene hisS 4872 3637 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545147.1 protein_id gnl|my_center|LOCUS_03860 5084 5437 gene locus_tag LOCUS_03870 gene glnB 5084 5437 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002231018.1 protein_id gnl|my_center|LOCUS_03870 5421 6713 gene locus_tag LOCUS_03880 5421 6713 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545822.1 protein_id gnl|my_center|LOCUS_03880 6840 8132 gene locus_tag LOCUS_03890 6840 8132 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060874.1 protein_id gnl|my_center|LOCUS_03890 9277 8147 gene locus_tag LOCUS_03900 gene fsr 9277 8147 CDS product fosmidomycin MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001251611.1 protein_id gnl|my_center|LOCUS_03900 9854 9285 gene locus_tag LOCUS_03910 gene efp 9854 9285 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880878.1 protein_id gnl|my_center|LOCUS_03910 10423 9872 gene locus_tag LOCUS_03920 10423 9872 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_03920 10571 11011 gene locus_tag LOCUS_03930 10571 11011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 11647 12546 gene locus_tag LOCUS_03940 11647 12546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 12561 13355 gene locus_tag LOCUS_03950 12561 13355 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061316.1 protein_id gnl|my_center|LOCUS_03950 13425 13736 gene locus_tag LOCUS_03960 13425 13736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 14184 13801 gene locus_tag LOCUS_03970 14184 13801 CDS product desulfoferrodoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878336.1 protein_id gnl|my_center|LOCUS_03970 14708 14205 gene locus_tag LOCUS_03980 14708 14205 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878337.1 protein_id gnl|my_center|LOCUS_03980 15225 14719 gene locus_tag LOCUS_03990 15225 14719 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249478.1 protein_id gnl|my_center|LOCUS_03990 15691 15209 gene locus_tag LOCUS_04000 gene bcp 15691 15209 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582794.1 protein_id gnl|my_center|LOCUS_04000 16872 15688 gene locus_tag LOCUS_04010 16872 15688 CDS product FprA family A-type flavoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584117.1 protein_id gnl|my_center|LOCUS_04010 17575 16865 gene locus_tag LOCUS_04020 17575 16865 CDS product flavin reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062281989.1 protein_id gnl|my_center|LOCUS_04020 18223 17585 gene locus_tag LOCUS_04030 18223 17585 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016533.1 protein_id gnl|my_center|LOCUS_04030 18363 19709 gene locus_tag LOCUS_04040 18363 19709 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545858.1 protein_id gnl|my_center|LOCUS_04040 19873 22668 gene locus_tag LOCUS_04050 19873 22668 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932183.1 protein_id gnl|my_center|LOCUS_04050 22684 23292 gene locus_tag LOCUS_04060 22684 23292 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932182.1 protein_id gnl|my_center|LOCUS_04060 23305 24174 gene locus_tag LOCUS_04070 gene nrfD 23305 24174 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932181.1 protein_id gnl|my_center|LOCUS_04070 24253 24328 gene locus_tag LOCUS_t00130 24253 24328 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 24470 24898 gene locus_tag LOCUS_04080 24470 24898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence009 <1 3269 gene locus_tag LOCUS_04090 <1 3269 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000384831.1:class I SAM-dependent DNA methyltransferase 3760 3365 gene locus_tag LOCUS_04100 3760 3365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 4424 3753 gene locus_tag LOCUS_04110 4424 3753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 7515 4408 gene locus_tag LOCUS_04120 7515 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 8169 7519 gene locus_tag LOCUS_04130 8169 7519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 10154 8166 gene locus_tag LOCUS_04140 10154 8166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 11222 10767 gene locus_tag LOCUS_04150 11222 10767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 12611 11553 gene locus_tag LOCUS_04160 12611 11553 CDS product Fic/DOC family N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_124794669.1 protein_id gnl|my_center|LOCUS_04160 13617 13150 gene locus_tag LOCUS_04170 13617 13150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 14106 13888 gene locus_tag LOCUS_04180 14106 13888 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 14517 14275 gene locus_tag LOCUS_04190 14517 14275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 14911 14579 gene locus_tag LOCUS_04200 14911 14579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 15123 15362 gene locus_tag LOCUS_04210 15123 15362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 15382 15654 gene locus_tag LOCUS_04220 15382 15654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 15654 15887 gene locus_tag LOCUS_04230 15654 15887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 15877 16131 gene locus_tag LOCUS_04240 15877 16131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 16228 16659 gene locus_tag LOCUS_04250 16228 16659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 19194 16819 gene locus_tag LOCUS_04260 19194 16819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 21040 19178 gene locus_tag LOCUS_04270 21040 19178 CDS product DUF262 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_040066179.1 protein_id gnl|my_center|LOCUS_04270 22029 21103 gene locus_tag LOCUS_04280 22029 21103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 23213 22077 gene locus_tag LOCUS_04290 23213 22077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 >Feature sequence010 2728 1532 gene locus_tag LOCUS_04300 2728 1532 CDS product L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496703.1 protein_id gnl|my_center|LOCUS_04300 3610 2744 gene locus_tag LOCUS_04310 3610 2744 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081450.1 protein_id gnl|my_center|LOCUS_04310 3707 4285 gene locus_tag LOCUS_04320 3707 4285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04320 4363 4710 gene locus_tag LOCUS_04330 4363 4710 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060865.1 protein_id gnl|my_center|LOCUS_04330 5790 4690 gene locus_tag LOCUS_04340 gene rlmD 5790 4690 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546143.1 protein_id gnl|my_center|LOCUS_04340 5839 6957 gene locus_tag LOCUS_04350 gene hemW 5839 6957 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099423.1 protein_id gnl|my_center|LOCUS_04350 7000 7087 gene locus_tag LOCUS_t00140 7000 7087 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 7113 8273 gene locus_tag LOCUS_04360 gene metK 7113 8273 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546806.1 protein_id gnl|my_center|LOCUS_04360 8274 9530 gene locus_tag LOCUS_04370 gene ahcY 8274 9530 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880742.1 protein_id gnl|my_center|LOCUS_04370 9544 10569 gene locus_tag LOCUS_04380 9544 10569 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228099.1 protein_id gnl|my_center|LOCUS_04380 10579 11247 gene locus_tag LOCUS_04390 10579 11247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 11244 12491 gene locus_tag LOCUS_04400 11244 12491 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957326.1 protein_id gnl|my_center|LOCUS_04400 12493 13419 gene locus_tag LOCUS_04410 12493 13419 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930648.1 protein_id gnl|my_center|LOCUS_04410 13394 13729 gene locus_tag LOCUS_04420 13394 13729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 13869 15281 gene locus_tag LOCUS_04430 13869 15281 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881104.1 protein_id gnl|my_center|LOCUS_04430 15274 15984 gene locus_tag LOCUS_04440 15274 15984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 15972 17621 gene locus_tag LOCUS_04450 15972 17621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04450 18646 17630 gene locus_tag LOCUS_04460 gene pstS 18646 17630 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881320.1 protein_id gnl|my_center|LOCUS_04460 18812 19735 gene locus_tag LOCUS_04470 gene pstC 18812 19735 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545177.1 protein_id gnl|my_center|LOCUS_04470 19732 20577 gene locus_tag LOCUS_04480 gene pstA 19732 20577 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546243.1 protein_id gnl|my_center|LOCUS_04480 20570 21325 gene locus_tag LOCUS_04490 gene pstB 20570 21325 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546432.1 protein_id gnl|my_center|LOCUS_04490 21340 22002 gene locus_tag LOCUS_04500 gene phoU 21340 22002 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391291.1 protein_id gnl|my_center|LOCUS_04500 21999 22673 gene locus_tag LOCUS_04510 21999 22673 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003434299.1 protein_id gnl|my_center|LOCUS_04510 >Feature sequence011 317 1234 gene locus_tag LOCUS_04520 gene cas1b 317 1234 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861768.1 protein_id gnl|my_center|LOCUS_04520 1231 1500 gene locus_tag LOCUS_04530 1231 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 1497 1781 gene locus_tag LOCUS_04540 1497 1781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 1840 4263 gene locus_tag LOCUS_04550 gene cas10 1840 4263 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545463.1 protein_id gnl|my_center|LOCUS_04550 4263 4727 gene locus_tag LOCUS_04560 gene csm2 4263 4727 CDS product type III-A CRISPR-associated protein Csm2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546668.1 protein_id gnl|my_center|LOCUS_04560 4748 5458 gene locus_tag LOCUS_04570 gene csm3 4748 5458 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545508.1 protein_id gnl|my_center|LOCUS_04570 5464 6387 gene locus_tag LOCUS_04580 5464 6387 CDS product CRISPR-associated protein, Csm4 family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546365.1 protein_id gnl|my_center|LOCUS_04580 6388 7596 gene locus_tag LOCUS_04590 gene csm5 6388 7596 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082354.1 protein_id gnl|my_center|LOCUS_04590 7724 7987 gene locus_tag LOCUS_04600 7724 7987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 7989 9179 gene locus_tag LOCUS_04610 7989 9179 CDS product DUF1887 family CARF protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545976.1 protein_id gnl|my_center|LOCUS_04610 9166 9981 gene locus_tag LOCUS_04620 9166 9981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 11406 9961 gene locus_tag LOCUS_04630 11406 9961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 12251 11403 gene locus_tag LOCUS_04640 12251 11403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 12874 12248 gene locus_tag LOCUS_04650 12874 12248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 13346 12867 gene locus_tag LOCUS_04660 13346 12867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 13774 13448 gene locus_tag LOCUS_04670 13774 13448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 15198 13810 gene locus_tag LOCUS_04680 15198 13810 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878630.1 protein_id gnl|my_center|LOCUS_04680 16141 15323 gene locus_tag LOCUS_04690 16141 15323 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878847.1 protein_id gnl|my_center|LOCUS_04690 16297 17736 gene locus_tag LOCUS_04700 16297 17736 CDS product hydroxymethylglutaryl-CoA synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919307.1 protein_id gnl|my_center|LOCUS_04700 17749 18948 gene locus_tag LOCUS_04710 17749 18948 CDS product acetyl-CoA acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919308.1 protein_id gnl|my_center|LOCUS_04710 20726 18945 gene locus_tag LOCUS_04720 20726 18945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 21204 20803 gene locus_tag LOCUS_04730 21204 20803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 21508 21197 gene locus_tag LOCUS_04740 21508 21197 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064179.1 protein_id gnl|my_center|LOCUS_04740 22628 21600 gene locus_tag LOCUS_04750 gene rhuM 22628 21600 CDS product RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957909.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence012 973 368 gene locus_tag LOCUS_04760 gene recR 973 368 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143488.1 protein_id gnl|my_center|LOCUS_04760 1303 974 gene locus_tag LOCUS_04770 1303 974 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009887752.1 protein_id gnl|my_center|LOCUS_04770 2559 1333 gene locus_tag LOCUS_04780 2559 1333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 2782 2706 gene locus_tag LOCUS_t00150 2782 2706 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2899 2805 gene locus_tag LOCUS_t00160 2899 2805 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4168 2954 gene locus_tag LOCUS_04790 4168 2954 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460337.1 protein_id gnl|my_center|LOCUS_04790 4661 4179 gene locus_tag LOCUS_04800 4661 4179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 5118 4723 gene locus_tag LOCUS_04810 5118 4723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 5237 5989 gene locus_tag LOCUS_04820 5237 5989 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496898.1 protein_id gnl|my_center|LOCUS_04820 5993 6946 gene locus_tag LOCUS_04830 5993 6946 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249654.1 protein_id gnl|my_center|LOCUS_04830 6959 7948 gene locus_tag LOCUS_04840 6959 7948 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932731.1 protein_id gnl|my_center|LOCUS_04840 7948 9141 gene locus_tag LOCUS_04850 7948 9141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 9134 9526 gene locus_tag LOCUS_04860 gene ybgC 9134 9526 CDS product tol-pal system-associated acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001091290.1 protein_id gnl|my_center|LOCUS_04860 9528 11195 gene locus_tag LOCUS_04870 gene ilvD 9528 11195 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966447.1 protein_id gnl|my_center|LOCUS_04870 11215 13662 gene locus_tag LOCUS_04880 gene leuS 11215 13662 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942849.1 protein_id gnl|my_center|LOCUS_04880 13662 14165 gene locus_tag LOCUS_04890 13662 14165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 14167 14523 gene locus_tag LOCUS_04900 14167 14523 CDS product phage holin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227874.1 protein_id gnl|my_center|LOCUS_04900 14516 15613 gene locus_tag LOCUS_04910 14516 15613 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939342.1 protein_id gnl|my_center|LOCUS_04910 15640 17463 gene locus_tag LOCUS_04920 gene typA 15640 17463 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939506.1 protein_id gnl|my_center|LOCUS_04920 17450 18748 gene locus_tag LOCUS_04930 gene rimO 17450 18748 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880515.1 protein_id gnl|my_center|LOCUS_04930 19276 18788 gene locus_tag LOCUS_04940 19276 18788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 19389 21491 gene locus_tag LOCUS_04950 19389 21491 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 protein_id gnl|my_center|LOCUS_04950 21491 21739 gene locus_tag LOCUS_04960 21491 21739 CDS product EscU/YscU/HrcU family type III secretion system export apparatus switch protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545507.1 protein_id gnl|my_center|LOCUS_04960 <22739 21727 gene locus_tag LOCUS_04970 <22739 21727 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881164.1:sigma-54-dependent Fis family transcriptional regulator >Feature sequence013 302 1141 gene locus_tag LOCUS_04980 gene ispE 302 1141 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947969.1 protein_id gnl|my_center|LOCUS_04980 1165 1449 gene locus_tag LOCUS_04990 gene spoVG 1165 1449 CDS product septation regulator SpoVG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966499.1 protein_id gnl|my_center|LOCUS_04990 1485 1558 gene locus_tag LOCUS_t00170 1485 1558 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1584 2528 gene locus_tag LOCUS_05000 1584 2528 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546354.1 protein_id gnl|my_center|LOCUS_05000 2548 3141 gene locus_tag LOCUS_05010 2548 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3145 3732 gene locus_tag LOCUS_05020 gene pth 3145 3732 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966493.1 protein_id gnl|my_center|LOCUS_05020 3719 4741 gene locus_tag LOCUS_05030 3719 4741 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545714.1 protein_id gnl|my_center|LOCUS_05030 4751 5194 gene locus_tag LOCUS_05040 4751 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 7221 5218 gene locus_tag LOCUS_05050 gene fusA 7221 5218 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546422.1 protein_id gnl|my_center|LOCUS_05050 7859 7239 gene locus_tag LOCUS_05060 7859 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 8475 7990 gene locus_tag LOCUS_05070 8475 7990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 10972 8555 gene locus_tag LOCUS_05080 10972 8555 CDS product glycyl radical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048172.1 protein_id gnl|my_center|LOCUS_05080 11733 10975 gene locus_tag LOCUS_05090 11733 10975 CDS product glycyl-radical enzyme activating protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012099515.1 protein_id gnl|my_center|LOCUS_05090 13131 11953 gene locus_tag LOCUS_05100 13131 11953 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_05100 13299 14915 gene locus_tag LOCUS_05110 13299 14915 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940904.1 protein_id gnl|my_center|LOCUS_05110 15570 14935 gene locus_tag LOCUS_05120 15570 14935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146928.1 protein_id gnl|my_center|LOCUS_05120 16453 15560 gene locus_tag LOCUS_05130 16453 15560 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868361.1 protein_id gnl|my_center|LOCUS_05130 16731 16450 gene locus_tag LOCUS_05140 16731 16450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146930.1 protein_id gnl|my_center|LOCUS_05140 18433 16709 gene locus_tag LOCUS_05150 18433 16709 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868362.1 protein_id gnl|my_center|LOCUS_05150 >Feature sequence014 3 818 gene locus_tag LOCUS_05160 3 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 828 1487 gene locus_tag LOCUS_05170 828 1487 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545723.1 protein_id gnl|my_center|LOCUS_05170 2532 1471 gene locus_tag LOCUS_05180 gene zapE 2532 1471 CDS product AFG1/ZapE family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926026.1 protein_id gnl|my_center|LOCUS_05180 3561 2596 gene locus_tag LOCUS_05190 3561 2596 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942081.1 protein_id gnl|my_center|LOCUS_05190 5629 3530 gene locus_tag LOCUS_05200 5629 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 5719 6117 gene locus_tag LOCUS_05210 gene flgB 5719 6117 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347783.1 protein_id gnl|my_center|LOCUS_05210 6135 6548 gene locus_tag LOCUS_05220 gene flgC 6135 6548 CDS product flagellar basal body rod protein FlgC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858484.1 protein_id gnl|my_center|LOCUS_05220 6583 6879 gene locus_tag LOCUS_05230 gene fliE 6583 6879 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147918.1 protein_id gnl|my_center|LOCUS_05230 6930 8591 gene locus_tag LOCUS_05240 gene fliF 6930 8591 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364750.1 protein_id gnl|my_center|LOCUS_05240 8595 9629 gene locus_tag LOCUS_05250 gene fliG 8595 9629 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_05250 9629 10390 gene locus_tag LOCUS_05260 9629 10390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 10383 11684 gene locus_tag LOCUS_05270 gene fliI 10383 11684 CDS product flagellar protein export ATPase FliI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870076.1 protein_id gnl|my_center|LOCUS_05270 11681 12136 gene locus_tag LOCUS_05280 11681 12136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 12087 12665 gene locus_tag LOCUS_05290 12087 12665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 13785 12652 gene locus_tag LOCUS_05300 13785 12652 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942379.1 protein_id gnl|my_center|LOCUS_05300 14238 13804 gene locus_tag LOCUS_05310 14238 13804 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942381.1 protein_id gnl|my_center|LOCUS_05310 15549 14248 gene locus_tag LOCUS_05320 15549 14248 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942382.1 protein_id gnl|my_center|LOCUS_05320 15815 15558 gene locus_tag LOCUS_05330 15815 15558 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582458.1 protein_id gnl|my_center|LOCUS_05330 17390 15879 gene locus_tag LOCUS_05340 gene ilvA 17390 15879 CDS product threonine ammonia-lyase, biosynthetic inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815155.1 protein_id gnl|my_center|LOCUS_05340 17480 17405 gene locus_tag LOCUS_t00180 17480 17405 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence015 306 1604 gene locus_tag LOCUS_05350 306 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 1623 3686 gene locus_tag LOCUS_05360 1623 3686 CDS product sodium-translocating pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943902.1 protein_id gnl|my_center|LOCUS_05360 3731 4444 gene locus_tag LOCUS_05370 3731 4444 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817239.1 protein_id gnl|my_center|LOCUS_05370 4447 4674 gene locus_tag LOCUS_05380 gene purS 4447 4674 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014878466.1 protein_id gnl|my_center|LOCUS_05380 4671 5342 gene locus_tag LOCUS_05390 gene purQ 4671 5342 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583773.1 protein_id gnl|my_center|LOCUS_05390 5345 6652 gene locus_tag LOCUS_05400 gene hemL 5345 6652 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941005.1 protein_id gnl|my_center|LOCUS_05400 6642 6896 gene locus_tag LOCUS_05410 6642 6896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 6847 7230 gene locus_tag LOCUS_05420 6847 7230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 7240 7911 gene locus_tag LOCUS_05430 7240 7911 CDS product F0F1 ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941002.1 protein_id gnl|my_center|LOCUS_05430 7956 8315 gene locus_tag LOCUS_05440 7956 8315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 10499 8331 gene locus_tag LOCUS_05450 gene topA 10499 8331 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_203473432.1 protein_id gnl|my_center|LOCUS_05450 11518 10517 gene locus_tag LOCUS_05460 gene dprA 11518 10517 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082954.1 protein_id gnl|my_center|LOCUS_05460 12137 11505 gene locus_tag LOCUS_05470 12137 11505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 12686 12306 gene locus_tag LOCUS_05480 12686 12306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 14017 12713 gene locus_tag LOCUS_05490 14017 12713 CDS product anaerobic C4-dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262748.1 protein_id gnl|my_center|LOCUS_05490 15429 14026 gene locus_tag LOCUS_05500 gene aspA 15429 14026 CDS product aspartate ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851742.1 protein_id gnl|my_center|LOCUS_05500 15633 17057 gene locus_tag LOCUS_05510 15633 17057 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_05510 17085 17957 gene locus_tag LOCUS_05520 17085 17957 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965832.1 protein_id gnl|my_center|LOCUS_05520 >Feature sequence016 326 99 gene locus_tag LOCUS_05530 326 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 678 382 gene locus_tag LOCUS_05540 678 382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 1394 675 gene locus_tag LOCUS_05550 1394 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 1445 1768 gene locus_tag LOCUS_05560 1445 1768 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 1910 1740 gene locus_tag LOCUS_05570 1910 1740 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 2392 2069 gene locus_tag LOCUS_05580 2392 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 2645 2382 gene locus_tag LOCUS_05590 2645 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 2913 2632 gene locus_tag LOCUS_05600 2913 2632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 3271 3492 gene locus_tag LOCUS_05610 3271 3492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 3708 4349 gene locus_tag LOCUS_05620 3708 4349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4877 4626 gene locus_tag LOCUS_05630 4877 4626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 5023 5493 gene locus_tag LOCUS_05640 5023 5493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 5539 5721 gene locus_tag LOCUS_05650 5539 5721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 5708 6469 gene locus_tag LOCUS_05660 5708 6469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 6471 6956 gene locus_tag LOCUS_05670 6471 6956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 7182 6964 gene locus_tag LOCUS_05680 7182 6964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 7558 7223 gene locus_tag LOCUS_05690 7558 7223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 7760 7560 gene locus_tag LOCUS_05700 7760 7560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 8254 8766 gene locus_tag LOCUS_05710 8254 8766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 9238 8993 gene locus_tag LOCUS_05720 9238 8993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 9474 9728 gene locus_tag LOCUS_05730 9474 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05730 9721 10956 gene locus_tag LOCUS_05740 9721 10956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 10953 11693 gene locus_tag LOCUS_05750 10953 11693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000054493.1 protein_id gnl|my_center|LOCUS_05750 11693 12280 gene locus_tag LOCUS_05760 11693 12280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 12430 13122 gene locus_tag LOCUS_05770 12430 13122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 13115 14992 gene locus_tag LOCUS_05780 13115 14992 CDS product phage terminase large subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272394.1 protein_id gnl|my_center|LOCUS_05780 15003 15203 gene locus_tag LOCUS_05790 15003 15203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 15760 15353 gene locus_tag LOCUS_05800 15760 15353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 16611 15757 gene locus_tag LOCUS_05810 16611 15757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 17070 16723 gene locus_tag LOCUS_05820 17070 16723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 17201 17452 gene locus_tag LOCUS_05830 17201 17452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 >Feature sequence017 367 717 gene locus_tag LOCUS_05840 367 717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 728 1918 gene locus_tag LOCUS_05850 728 1918 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582673.1 protein_id gnl|my_center|LOCUS_05850 1922 2878 gene locus_tag LOCUS_05860 1922 2878 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545618.1 protein_id gnl|my_center|LOCUS_05860 4108 2906 gene locus_tag LOCUS_05870 4108 2906 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272524.1 protein_id gnl|my_center|LOCUS_05870 4433 4101 gene locus_tag LOCUS_05880 gene acpS 4433 4101 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933592.1 protein_id gnl|my_center|LOCUS_05880 5149 4418 gene locus_tag LOCUS_05890 gene pdxJ 5149 4418 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098315.1 protein_id gnl|my_center|LOCUS_05890 6642 5146 gene locus_tag LOCUS_05900 6642 5146 CDS product bifunctional aminoglycoside phosphotransferase/ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546491.1 protein_id gnl|my_center|LOCUS_05900 7768 6611 gene locus_tag LOCUS_05910 7768 6611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 8634 7747 gene locus_tag LOCUS_05920 8634 7747 CDS product DUF89 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082811.1 protein_id gnl|my_center|LOCUS_05920 8687 10144 gene locus_tag LOCUS_05930 8687 10144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 10817 10134 gene locus_tag LOCUS_05940 10817 10134 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020382.1 protein_id gnl|my_center|LOCUS_05940 11950 10901 gene locus_tag LOCUS_05950 11950 10901 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393322.1 protein_id gnl|my_center|LOCUS_05950 12707 11943 gene locus_tag LOCUS_05960 12707 11943 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392949.1 protein_id gnl|my_center|LOCUS_05960 12944 13561 gene locus_tag LOCUS_05970 12944 13561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 14351 13551 gene locus_tag LOCUS_05980 14351 13551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 17041 15095 gene locus_tag LOCUS_05990 17041 15095 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073766.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence018 492 52 gene locus_tag LOCUS_06000 492 52 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880607.1 protein_id gnl|my_center|LOCUS_06000 1912 494 gene locus_tag LOCUS_06010 1912 494 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880071.1 protein_id gnl|my_center|LOCUS_06010 2629 1970 gene locus_tag LOCUS_06020 2629 1970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3132 2629 gene locus_tag LOCUS_06030 3132 2629 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938826.1 protein_id gnl|my_center|LOCUS_06030 3414 3274 gene locus_tag LOCUS_06040 3414 3274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7019 3399 gene locus_tag LOCUS_06050 7019 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 10489 7031 gene locus_tag LOCUS_06060 10489 7031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 16691 10500 gene locus_tag LOCUS_06070 16691 10500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 >Feature sequence019 <1 1068 gene locus_tag LOCUS_06080 <1 1068 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011089911.1:TRAP transporter large permease subunit 1077 1814 gene locus_tag LOCUS_06090 gene cobB 1077 1814 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_06090 1795 3471 gene locus_tag LOCUS_06100 1795 3471 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940210.1 protein_id gnl|my_center|LOCUS_06100 3464 3949 gene locus_tag LOCUS_06110 gene ybaK 3464 3949 CDS product Cys-tRNA(Pro) deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189587.1 protein_id gnl|my_center|LOCUS_06110 4452 3946 gene locus_tag LOCUS_06120 4452 3946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 4532 7066 gene locus_tag LOCUS_06130 4532 7066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 7069 7680 gene locus_tag LOCUS_06140 7069 7680 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583746.1 protein_id gnl|my_center|LOCUS_06140 7703 8209 gene locus_tag LOCUS_06150 gene cobU 7703 8209 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_017869446.1 protein_id gnl|my_center|LOCUS_06150 10128 8206 gene locus_tag LOCUS_06160 10128 8206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 11617 10574 gene locus_tag LOCUS_06170 11617 10574 CDS product ABC transporter substrate binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924795.1 protein_id gnl|my_center|LOCUS_06170 11756 15211 gene locus_tag LOCUS_06180 11756 15211 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880933.1 protein_id gnl|my_center|LOCUS_06180 15925 15227 gene locus_tag LOCUS_06190 gene sfsA 15925 15227 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141732.1 protein_id gnl|my_center|LOCUS_06190 15988 16296 gene locus_tag LOCUS_06200 15988 16296 CDS product antibiotic biosynthesis monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249692.1 protein_id gnl|my_center|LOCUS_06200 >Feature sequence020 480 3248 gene locus_tag LOCUS_06210 480 3248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 4834 3245 gene locus_tag LOCUS_06220 gene serA 4834 3245 CDS product phosphoglycerate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285096.1 protein_id gnl|my_center|LOCUS_06220 5322 4822 gene locus_tag LOCUS_06230 5322 4822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 6680 5328 gene locus_tag LOCUS_06240 gene glmM 6680 5328 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942450.1 protein_id gnl|my_center|LOCUS_06240 8062 6677 gene locus_tag LOCUS_06250 gene mgtE 8062 6677 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939093.1 protein_id gnl|my_center|LOCUS_06250 8958 8065 gene locus_tag LOCUS_06260 gene era 8958 8065 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047995.1 protein_id gnl|my_center|LOCUS_06260 9637 8951 gene locus_tag LOCUS_06270 gene rnc 9637 8951 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002670498.1 protein_id gnl|my_center|LOCUS_06270 10487 9630 gene locus_tag LOCUS_06280 gene cysK 10487 9630 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965533.1 protein_id gnl|my_center|LOCUS_06280 12040 10484 gene locus_tag LOCUS_06290 gene nadB 12040 10484 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545397.1 protein_id gnl|my_center|LOCUS_06290 12276 14186 gene locus_tag LOCUS_06300 12276 14186 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878885.1 protein_id gnl|my_center|LOCUS_06300 14893 14198 gene locus_tag LOCUS_06310 14893 14198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 15042 15296 gene locus_tag LOCUS_06320 15042 15296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 15297 16316 gene locus_tag LOCUS_06330 gene mnmA 15297 16316 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583059.1 protein_id gnl|my_center|LOCUS_06330 >Feature sequence021 397 1071 gene locus_tag LOCUS_06340 gene flgD 397 1071 CDS product flagellar hook assembly protein FlgD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082153.1 protein_id gnl|my_center|LOCUS_06340 1074 2840 gene locus_tag LOCUS_06350 1074 2840 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805291.1 protein_id gnl|my_center|LOCUS_06350 2857 5028 gene locus_tag LOCUS_06360 gene flgE 2857 5028 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002882660.1 protein_id gnl|my_center|LOCUS_06360 6175 5018 gene locus_tag LOCUS_06370 gene mqnF 6175 5018 CDS product aminofutalosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155847.1 protein_id gnl|my_center|LOCUS_06370 6554 6156 gene locus_tag LOCUS_06380 6554 6156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06380 6952 7086 gene locus_tag LOCUS_06390 6952 7086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 8861 7491 gene locus_tag LOCUS_06400 8861 7491 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881132.1 protein_id gnl|my_center|LOCUS_06400 9399 8848 gene locus_tag LOCUS_06410 9399 8848 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858643.1 protein_id gnl|my_center|LOCUS_06410 10813 9386 gene locus_tag LOCUS_06420 10813 9386 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016576.1 protein_id gnl|my_center|LOCUS_06420 11207 11004 gene locus_tag LOCUS_06430 11207 11004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 13169 11250 gene locus_tag LOCUS_06440 13169 11250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 14061 13177 gene locus_tag LOCUS_06450 14061 13177 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937446.1 protein_id gnl|my_center|LOCUS_06450 14252 14058 gene locus_tag LOCUS_06460 14252 14058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06460 14333 14776 gene locus_tag LOCUS_06470 14333 14776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 14778 15521 gene locus_tag LOCUS_06480 14778 15521 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880557.1 protein_id gnl|my_center|LOCUS_06480 >Feature sequence022 <1 696 gene locus_tag LOCUS_06490 <1 696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082880.1:6-phosphofructokinase 710 2296 gene locus_tag LOCUS_06500 gene pckA 710 2296 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227826.1 protein_id gnl|my_center|LOCUS_06500 2317 2922 gene locus_tag LOCUS_06510 2317 2922 CDS product TRIC cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902175.1 protein_id gnl|my_center|LOCUS_06510 4135 2924 gene locus_tag LOCUS_06520 gene xcpS 4135 2924 CDS product GspF family T2SS innner membrane protein variant XcpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091376.1 protein_id gnl|my_center|LOCUS_06520 5605 4139 gene locus_tag LOCUS_06530 5605 4139 CDS product GspE/PulE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880955.1 protein_id gnl|my_center|LOCUS_06530 7391 5586 gene locus_tag LOCUS_06540 gene gspD 7391 5586 CDS product type II secretion system secretin GspD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880822.1 protein_id gnl|my_center|LOCUS_06540 8246 7401 gene locus_tag LOCUS_06550 8246 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 8825 8247 gene locus_tag LOCUS_06560 8825 8247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 9304 8822 gene locus_tag LOCUS_06570 9304 8822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 10325 9297 gene locus_tag LOCUS_06580 10325 9297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 11190 10318 gene locus_tag LOCUS_06590 11190 10318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 11636 11187 gene locus_tag LOCUS_06600 11636 11187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 12027 11695 gene locus_tag LOCUS_06610 12027 11695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 12421 12017 gene locus_tag LOCUS_06620 12421 12017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06620 12849 12418 gene locus_tag LOCUS_06630 gene gspG 12849 12418 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196811.1 protein_id gnl|my_center|LOCUS_06630 14439 12868 gene locus_tag LOCUS_06640 14439 12868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 >Feature sequence023 648 190 gene locus_tag LOCUS_06650 gene ribE 648 190 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942334.1 protein_id gnl|my_center|LOCUS_06650 1864 659 gene locus_tag LOCUS_06660 1864 659 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_06660 2562 1933 gene locus_tag LOCUS_06670 2562 1933 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881107.1 protein_id gnl|my_center|LOCUS_06670 3629 2562 gene locus_tag LOCUS_06680 gene ribD 3629 2562 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038059103.1 protein_id gnl|my_center|LOCUS_06680 7146 3718 gene locus_tag LOCUS_06690 gene pyc 7146 3718 CDS product pyruvate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244778.1 protein_id gnl|my_center|LOCUS_06690 7480 8613 gene locus_tag LOCUS_06700 7480 8613 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080272.1 protein_id gnl|my_center|LOCUS_06700 8671 9567 gene locus_tag LOCUS_06710 8671 9567 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852952.1 protein_id gnl|my_center|LOCUS_06710 9571 10608 gene locus_tag LOCUS_06720 9571 10608 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853049.1 protein_id gnl|my_center|LOCUS_06720 10615 11388 gene locus_tag LOCUS_06730 10615 11388 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925352.1 protein_id gnl|my_center|LOCUS_06730 11381 12082 gene locus_tag LOCUS_06740 11381 12082 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_06740 12126 12674 gene locus_tag LOCUS_06750 12126 12674 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393500.1 protein_id gnl|my_center|LOCUS_06750 12738 13052 gene locus_tag LOCUS_06760 12738 13052 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002438113.1 protein_id gnl|my_center|LOCUS_06760 13052 13783 gene locus_tag LOCUS_06770 13052 13783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 13796 14725 gene locus_tag LOCUS_06780 gene argF 13796 14725 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868438.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence024 <1 266 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttgcactatttccgtttctgaagggaattacgac 550 1692 gene locus_tag LOCUS_06790 550 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2598 1699 gene locus_tag LOCUS_06800 2598 1699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06800 3173 2595 gene locus_tag LOCUS_06810 3173 2595 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761174.1 protein_id gnl|my_center|LOCUS_06810 3314 4321 gene locus_tag LOCUS_06820 3314 4321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4321 4869 gene locus_tag LOCUS_06830 4321 4869 CDS product ATP/GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881202.1 protein_id gnl|my_center|LOCUS_06830 4943 5263 gene locus_tag LOCUS_06840 gene trxA 4943 5263 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545412.1 protein_id gnl|my_center|LOCUS_06840 5311 6228 gene locus_tag LOCUS_06850 gene trxB 5311 6228 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583127.1 protein_id gnl|my_center|LOCUS_06850 7004 6225 gene locus_tag LOCUS_06860 7004 6225 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392445.1 protein_id gnl|my_center|LOCUS_06860 7779 6985 gene locus_tag LOCUS_06870 7779 6985 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082707.1 protein_id gnl|my_center|LOCUS_06870 8633 7776 gene locus_tag LOCUS_06880 8633 7776 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584028.1 protein_id gnl|my_center|LOCUS_06880 9421 8630 gene locus_tag LOCUS_06890 9421 8630 CDS product inorganic polyphosphate/ATP-NAD kinase (Poly(P)/ATP NAD kinase) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546481.1 protein_id gnl|my_center|LOCUS_06890 10245 9418 gene locus_tag LOCUS_06900 gene ispH 10245 9418 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943241.1 protein_id gnl|my_center|LOCUS_06900 10870 10226 gene locus_tag LOCUS_06910 gene cmk 10870 10226 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003230555.1 protein_id gnl|my_center|LOCUS_06910 11699 10863 gene locus_tag LOCUS_06920 11699 10863 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930760.1 protein_id gnl|my_center|LOCUS_06920 12783 11692 gene locus_tag LOCUS_06930 gene hisC 12783 11692 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392052.1 protein_id gnl|my_center|LOCUS_06930 13739 12795 gene locus_tag LOCUS_06940 13739 12795 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880410.1 protein_id gnl|my_center|LOCUS_06940 14709 13729 gene locus_tag LOCUS_06950 14709 13729 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020721.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence025 72 147 gene locus_tag LOCUS_t00190 72 147 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 191 868 gene locus_tag LOCUS_06960 191 868 CDS product 2,3-bisphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883498.1 protein_id gnl|my_center|LOCUS_06960 873 1271 gene locus_tag LOCUS_06970 873 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06970 1268 2005 gene locus_tag LOCUS_06980 1268 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 2599 2000 gene locus_tag LOCUS_06990 2599 2000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 3797 2607 gene locus_tag LOCUS_07000 3797 2607 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_07000 5608 3794 gene locus_tag LOCUS_07010 5608 3794 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869226.1 protein_id gnl|my_center|LOCUS_07010 6083 5610 gene locus_tag LOCUS_07020 6083 5610 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392242.1 protein_id gnl|my_center|LOCUS_07020 7337 6129 gene locus_tag LOCUS_07030 7337 6129 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879946.1 protein_id gnl|my_center|LOCUS_07030 7445 8656 gene locus_tag LOCUS_07040 7445 8656 CDS product tetracycline resistance MFS efflux pump inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011126010.1 protein_id gnl|my_center|LOCUS_07040 9299 8649 gene locus_tag LOCUS_07050 9299 8649 CDS product GGDEF domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546596.1 protein_id gnl|my_center|LOCUS_07050 12406 9845 gene locus_tag LOCUS_07060 12406 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 12647 13441 gene locus_tag LOCUS_07070 gene flgF 12647 13441 CDS product flagellar basal-body rod protein FlgF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943677.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence026 2873 2466 gene locus_tag LOCUS_07080 2873 2466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 3258 2887 gene locus_tag LOCUS_07090 3258 2887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 4157 3273 gene locus_tag LOCUS_07100 4157 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 4590 4144 gene locus_tag LOCUS_07110 4590 4144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 4741 4816 gene locus_tag LOCUS_t00200 4741 4816 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 4843 4918 gene locus_tag LOCUS_t00210 4843 4918 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 4947 5534 gene locus_tag LOCUS_07120 4947 5534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5527 6684 gene locus_tag LOCUS_07130 5527 6684 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880128.1 protein_id gnl|my_center|LOCUS_07130 6677 7153 gene locus_tag LOCUS_07140 gene folK 6677 7153 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545434.1 protein_id gnl|my_center|LOCUS_07140 7293 8087 gene locus_tag LOCUS_07150 gene panB 7293 8087 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545863.1 protein_id gnl|my_center|LOCUS_07150 8097 8939 gene locus_tag LOCUS_07160 gene panC 8097 8939 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080408.1 protein_id gnl|my_center|LOCUS_07160 8957 9322 gene locus_tag LOCUS_07170 8957 9322 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688909.1 protein_id gnl|my_center|LOCUS_07170 9322 10653 gene locus_tag LOCUS_07180 9322 10653 CDS product acyclic terpene utilization AtuA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000124259.1 protein_id gnl|my_center|LOCUS_07180 10650 10940 gene locus_tag LOCUS_07190 10650 10940 CDS product DUF4387 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583697.1 protein_id gnl|my_center|LOCUS_07190 10937 11875 gene locus_tag LOCUS_07200 10937 11875 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881122.1 protein_id gnl|my_center|LOCUS_07200 11920 12801 gene locus_tag LOCUS_07210 11920 12801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 13168 12791 gene locus_tag LOCUS_07220 gene queD 13168 12791 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_07220 <13680 13161 gene locus_tag LOCUS_07230 <13680 13161 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004081856.1:DUF1015 domain-containing protein >Feature sequence027 2270 1497 gene locus_tag LOCUS_07240 2270 1497 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546427.1 protein_id gnl|my_center|LOCUS_07240 3133 2267 gene locus_tag LOCUS_07250 3133 2267 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_07250 3057 3272 gene locus_tag LOCUS_07260 3057 3272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 4287 3238 gene locus_tag LOCUS_07270 4287 3238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 5528 4299 gene locus_tag LOCUS_07280 5528 4299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 7720 5846 gene locus_tag LOCUS_07290 gene dxs 7720 5846 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941346.1 protein_id gnl|my_center|LOCUS_07290 8561 7728 gene locus_tag LOCUS_07300 gene cpoB 8561 7728 CDS product cell division protein CpoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165506.1 protein_id gnl|my_center|LOCUS_07300 9112 8573 gene locus_tag LOCUS_07310 gene pal 9112 8573 CDS product peptidoglycan-associated lipoprotein Pal inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546782.1 protein_id gnl|my_center|LOCUS_07310 9703 9128 gene locus_tag LOCUS_07320 9703 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07320 10980 9718 gene locus_tag LOCUS_07330 gene tolB 10980 9718 CDS product Tol-Pal system beta propeller repeat protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932320.1 protein_id gnl|my_center|LOCUS_07330 11735 10977 gene locus_tag LOCUS_07340 11735 10977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 12118 11732 gene locus_tag LOCUS_07350 gene tolR 12118 11732 CDS product protein TolR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546534.1 protein_id gnl|my_center|LOCUS_07350 12684 12115 gene locus_tag LOCUS_07360 gene tolQ 12684 12115 CDS product protein TolQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924836.1 protein_id gnl|my_center|LOCUS_07360 >Feature sequence028 680 306 gene locus_tag LOCUS_07370 gene rpsL 680 306 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_07370 5298 745 gene locus_tag LOCUS_07380 gene rpoC 5298 745 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858508.1 protein_id gnl|my_center|LOCUS_07380 9392 5310 gene locus_tag LOCUS_07390 gene rpoB 9392 5310 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943493.1 protein_id gnl|my_center|LOCUS_07390 9883 9497 gene locus_tag LOCUS_07400 gene rplL 9883 9497 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_07400 10418 9897 gene locus_tag LOCUS_07410 gene rplJ 10418 9897 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810195.1 protein_id gnl|my_center|LOCUS_07410 11215 10523 gene locus_tag LOCUS_07420 gene rplA 11215 10523 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393948.1 protein_id gnl|my_center|LOCUS_07420 11695 11264 gene locus_tag LOCUS_07430 gene rplK 11695 11264 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081512.1 protein_id gnl|my_center|LOCUS_07430 12247 11708 gene locus_tag LOCUS_07440 gene nusG 12247 11708 CDS product transcription termination/antitermination protein NusG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546677.1 protein_id gnl|my_center|LOCUS_07440 12445 12263 gene locus_tag LOCUS_07450 12445 12263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 12534 12458 gene locus_tag LOCUS_t00220 12534 12458 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence029 1225 650 gene locus_tag LOCUS_07460 1225 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 1275 1586 gene locus_tag LOCUS_07470 1275 1586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 3226 1718 gene locus_tag LOCUS_07480 3226 1718 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393450.1 protein_id gnl|my_center|LOCUS_07480 4361 3282 gene locus_tag LOCUS_07490 4361 3282 CDS product BMP family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276126.1 protein_id gnl|my_center|LOCUS_07490 4494 6899 gene locus_tag LOCUS_07500 gene secA 4494 6899 CDS product preprotein translocase subunit SecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947996.1 protein_id gnl|my_center|LOCUS_07500 6892 7356 gene locus_tag LOCUS_07510 6892 7356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 7361 8068 gene locus_tag LOCUS_07520 7361 8068 CDS product SIMPL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072997.1 protein_id gnl|my_center|LOCUS_07520 9800 8061 gene locus_tag LOCUS_07530 9800 8061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 10174 11313 gene locus_tag LOCUS_07540 10174 11313 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048186.1 protein_id gnl|my_center|LOCUS_07540 11327 11848 gene locus_tag LOCUS_07550 11327 11848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 >Feature sequence030 482 757 gene locus_tag LOCUS_07560 482 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 757 1683 gene locus_tag LOCUS_07570 757 1683 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545566.1 protein_id gnl|my_center|LOCUS_07570 1680 2738 gene locus_tag LOCUS_07580 1680 2738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 2872 3171 gene locus_tag LOCUS_07590 gene rplU 2872 3171 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545103.1 protein_id gnl|my_center|LOCUS_07590 3182 3430 gene locus_tag LOCUS_07600 gene rpmA 3182 3430 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419086.1 protein_id gnl|my_center|LOCUS_07600 3431 4393 gene locus_tag LOCUS_07610 gene obgE 3431 4393 CDS product GTPase ObgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545625.1 protein_id gnl|my_center|LOCUS_07610 4372 5493 gene locus_tag LOCUS_07620 gene proB 4372 5493 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546492.1 protein_id gnl|my_center|LOCUS_07620 5486 5962 gene locus_tag LOCUS_07630 5486 5962 CDS product MaoC family dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940911.1 protein_id gnl|my_center|LOCUS_07630 5972 7225 gene locus_tag LOCUS_07640 5972 7225 CDS product glutamate-5-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083010.1 protein_id gnl|my_center|LOCUS_07640 7222 7851 gene locus_tag LOCUS_07650 gene nadD 7222 7851 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028841927.1 protein_id gnl|my_center|LOCUS_07650 7848 8168 gene locus_tag LOCUS_07660 gene rsfS 7848 8168 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038431718.1 protein_id gnl|my_center|LOCUS_07660 8158 9897 gene locus_tag LOCUS_07670 8158 9897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 9966 10042 gene locus_tag LOCUS_t00230 9966 10042 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 10050 10817 gene locus_tag LOCUS_07680 10050 10817 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047988.1 protein_id gnl|my_center|LOCUS_07680 10835 11551 gene locus_tag LOCUS_07690 10835 11551 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_07690 11555 12079 gene locus_tag LOCUS_07700 11555 12079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 >Feature sequence031 <1 1224 gene locus_tag LOCUS_07710 <1 1224 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583175.1:serine hydroxymethyltransferase 1455 3407 gene locus_tag LOCUS_07720 1455 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 3404 4501 gene locus_tag LOCUS_07730 3404 4501 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545659.1 protein_id gnl|my_center|LOCUS_07730 4498 5127 gene locus_tag LOCUS_07740 4498 5127 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943737.1 protein_id gnl|my_center|LOCUS_07740 5120 5884 gene locus_tag LOCUS_07750 5120 5884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 5881 8988 gene locus_tag LOCUS_07760 5881 8988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 10344 9145 gene locus_tag LOCUS_07770 10344 9145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 12067 10328 gene locus_tag LOCUS_07780 12067 10328 CDS product ABC transporter transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938960.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence032 1579 764 gene locus_tag LOCUS_07790 1579 764 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948944.1 protein_id gnl|my_center|LOCUS_07790 3236 1581 gene locus_tag LOCUS_07800 3236 1581 CDS product spore photoproduct lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016733.1 protein_id gnl|my_center|LOCUS_07800 3735 3205 gene locus_tag LOCUS_07810 3735 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 4603 3683 gene locus_tag LOCUS_07820 4603 3683 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545671.1 protein_id gnl|my_center|LOCUS_07820 5319 4588 gene locus_tag LOCUS_07830 5319 4588 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942400.1 protein_id gnl|my_center|LOCUS_07830 5786 5316 gene locus_tag LOCUS_07840 gene greA 5786 5316 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545525.1 protein_id gnl|my_center|LOCUS_07840 8988 5779 gene locus_tag LOCUS_07850 gene carB 8988 5779 CDS product carbamoyl-phosphate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878769.1 protein_id gnl|my_center|LOCUS_07850 9496 9050 gene locus_tag LOCUS_07860 gene smpB 9496 9050 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057764.1 protein_id gnl|my_center|LOCUS_07860 11319 9499 gene locus_tag LOCUS_07870 11319 9499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07870 >Feature sequence033 420 779 gene locus_tag LOCUS_07880 420 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 779 919 gene locus_tag LOCUS_07890 779 919 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1068 1490 gene locus_tag LOCUS_07900 1068 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1758 1609 gene locus_tag LOCUS_07910 1758 1609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480562.1 protein_id gnl|my_center|LOCUS_07910 1843 2199 gene locus_tag LOCUS_07920 1843 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07920 2203 2994 gene locus_tag LOCUS_07930 2203 2994 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_07930 3004 3522 gene locus_tag LOCUS_07940 3004 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 4989 4462 gene locus_tag LOCUS_07950 4989 4462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5332 4979 gene locus_tag LOCUS_07960 5332 4979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 5942 5568 gene locus_tag LOCUS_07970 5942 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 7906 5945 gene locus_tag LOCUS_07980 7906 5945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 10308 7906 gene locus_tag LOCUS_07990 10308 7906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_057443144.1 protein_id gnl|my_center|LOCUS_07990 11793 10315 gene locus_tag LOCUS_08000 11793 10315 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105143.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence034 736 128 gene locus_tag LOCUS_08010 736 128 CDS product endonuclease III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870952.1 protein_id gnl|my_center|LOCUS_08010 843 1964 gene locus_tag LOCUS_08020 gene alr 843 1964 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545322.1 protein_id gnl|my_center|LOCUS_08020 1966 2730 gene locus_tag LOCUS_08030 1966 2730 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880179.1 protein_id gnl|my_center|LOCUS_08030 2733 3479 gene locus_tag LOCUS_08040 2733 3479 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_08040 3472 4890 gene locus_tag LOCUS_08050 3472 4890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 5632 4883 gene locus_tag LOCUS_08060 5632 4883 CDS product menaquinone biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545998.1 protein_id gnl|my_center|LOCUS_08060 6717 5629 gene locus_tag LOCUS_08070 6717 5629 CDS product branched-chain amino acid aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070705.1 protein_id gnl|my_center|LOCUS_08070 8291 6762 gene locus_tag LOCUS_08080 8291 6762 CDS product DHA2 family efflux MFS transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546639.1 protein_id gnl|my_center|LOCUS_08080 9259 8288 gene locus_tag LOCUS_08090 9259 8288 CDS product HlyD family secretion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545031.1 protein_id gnl|my_center|LOCUS_08090 9731 9249 gene locus_tag LOCUS_08100 9731 9249 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861879.1 protein_id gnl|my_center|LOCUS_08100 9927 10346 gene locus_tag LOCUS_08110 9927 10346 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048199.1 protein_id gnl|my_center|LOCUS_08110 11452 10343 gene locus_tag LOCUS_08120 11452 10343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence035 <1 680 gene locus_tag LOCUS_08130 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390005.1:enoyl-CoA hydratase 726 802 gene locus_tag LOCUS_t00240 726 802 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 1866 811 gene locus_tag LOCUS_08140 1866 811 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583399.1 protein_id gnl|my_center|LOCUS_08140 3311 1863 gene locus_tag LOCUS_08150 3311 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 3416 4717 gene locus_tag LOCUS_08160 3416 4717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4727 5734 gene locus_tag LOCUS_08170 gene trpS 4727 5734 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546811.1 protein_id gnl|my_center|LOCUS_08170 5697 6218 gene locus_tag LOCUS_08180 5697 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 7558 6215 gene locus_tag LOCUS_08190 7558 6215 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966833.1 protein_id gnl|my_center|LOCUS_08190 8046 7558 gene locus_tag LOCUS_08200 gene accB 8046 7558 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942663.1 protein_id gnl|my_center|LOCUS_08200 10238 8106 gene locus_tag LOCUS_08210 10238 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 <11267 10283 gene locus_tag LOCUS_08220 <11267 10283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_065525186.1:DUF4084 domain-containing protein >Feature sequence036 <1 651 gene locus_tag LOCUS_08230 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545793.1:phospholipase D family protein 959 681 gene locus_tag LOCUS_08240 gene rpsT 959 681 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_08240 1223 1486 gene locus_tag LOCUS_08250 1223 1486 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582457.1 protein_id gnl|my_center|LOCUS_08250 1504 3147 gene locus_tag LOCUS_08260 gene groL 1504 3147 CDS product chaperonin GroEL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545192.1 protein_id gnl|my_center|LOCUS_08260 3824 3204 gene locus_tag LOCUS_08270 3824 3204 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545606.1 protein_id gnl|my_center|LOCUS_08270 4176 3892 gene locus_tag LOCUS_08280 4176 3892 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391609.1 protein_id gnl|my_center|LOCUS_08280 5474 4173 gene locus_tag LOCUS_08290 5474 4173 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054936956.1 protein_id gnl|my_center|LOCUS_08290 6501 5488 gene locus_tag LOCUS_08300 6501 5488 CDS product electron transfer flavoprotein subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005811679.1 protein_id gnl|my_center|LOCUS_08300 7338 6517 gene locus_tag LOCUS_08310 7338 6517 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459802.1 protein_id gnl|my_center|LOCUS_08310 9375 7510 gene locus_tag LOCUS_08320 gene hyfB 9375 7510 CDS product hydrogenase 4 subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393678.1 protein_id gnl|my_center|LOCUS_08320 9827 9372 gene locus_tag LOCUS_08330 9827 9372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 11066 9837 gene locus_tag LOCUS_08340 11066 9837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 >Feature sequence037 916 272 gene locus_tag LOCUS_08350 916 272 CDS product YchE family NAAT transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199909.1 protein_id gnl|my_center|LOCUS_08350 1039 1893 gene locus_tag LOCUS_08360 1039 1893 CDS product 3-hydroxyacyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_027479748.1 protein_id gnl|my_center|LOCUS_08360 1976 2320 gene locus_tag LOCUS_08370 1976 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08370 2813 3223 gene locus_tag LOCUS_08380 2813 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 3446 3371 gene locus_tag LOCUS_t00250 3446 3371 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 4416 3499 gene locus_tag LOCUS_08390 4416 3499 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022002.1 protein_id gnl|my_center|LOCUS_08390 4486 4572 gene locus_tag LOCUS_t00260 4486 4572 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 4715 5416 gene locus_tag LOCUS_08400 4715 5416 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 protein_id gnl|my_center|LOCUS_08400 5963 5460 gene locus_tag LOCUS_08410 5963 5460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08410 6120 6899 gene locus_tag LOCUS_08420 6120 6899 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546717.1 protein_id gnl|my_center|LOCUS_08420 6905 7750 gene locus_tag LOCUS_08430 6905 7750 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545130.1 protein_id gnl|my_center|LOCUS_08430 7761 8231 gene locus_tag LOCUS_08440 gene purE 7761 8231 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003357851.1 protein_id gnl|my_center|LOCUS_08440 8221 9060 gene locus_tag LOCUS_08450 8221 9060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978692.1 protein_id gnl|my_center|LOCUS_08450 9048 9881 gene locus_tag LOCUS_08460 9048 9881 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857952.1 protein_id gnl|my_center|LOCUS_08460 >Feature sequence038 144 638 gene locus_tag LOCUS_08470 144 638 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582555.1 protein_id gnl|my_center|LOCUS_08470 1659 628 gene locus_tag LOCUS_08480 gene queA 1659 628 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627822.1 protein_id gnl|my_center|LOCUS_08480 1844 3319 gene locus_tag LOCUS_08490 1844 3319 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545267.1 protein_id gnl|my_center|LOCUS_08490 3316 4029 gene locus_tag LOCUS_08500 gene rluB 3316 4029 CDS product 23S rRNA pseudouridine(2605) synthase RluB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000440556.1 protein_id gnl|my_center|LOCUS_08500 4026 5000 gene locus_tag LOCUS_08510 gene ruvB 4026 5000 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393202.1 protein_id gnl|my_center|LOCUS_08510 5894 5019 gene locus_tag LOCUS_08520 5894 5019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 7481 5979 gene locus_tag LOCUS_08530 7481 5979 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080829.1 protein_id gnl|my_center|LOCUS_08530 10147 7622 gene locus_tag LOCUS_08540 10147 7622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 >Feature sequence039 <1 1367 gene locus_tag LOCUS_08550 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941895.1:glutamate synthase-related protein 1378 1818 gene locus_tag LOCUS_08560 1378 1818 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941894.1 protein_id gnl|my_center|LOCUS_08560 1830 3089 gene locus_tag LOCUS_08570 1830 3089 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_08570 3101 4228 gene locus_tag LOCUS_08580 3101 4228 CDS product glutamine amidotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392807.1 protein_id gnl|my_center|LOCUS_08580 4221 4967 gene locus_tag LOCUS_08590 4221 4967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083223.1 protein_id gnl|my_center|LOCUS_08590 5197 5739 gene locus_tag LOCUS_08600 5197 5739 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166687.1 protein_id gnl|my_center|LOCUS_08600 5743 7305 gene locus_tag LOCUS_08610 gene rny 5743 7305 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986783.1 protein_id gnl|my_center|LOCUS_08610 7295 8080 gene locus_tag LOCUS_08620 gene ymdB 7295 8080 CDS product 2',3'-cyclic-nucleotide 2'-phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245138.1 protein_id gnl|my_center|LOCUS_08620 8196 8795 gene locus_tag LOCUS_08630 8196 8795 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940756.1 protein_id gnl|my_center|LOCUS_08630 8809 9351 gene locus_tag LOCUS_08640 8809 9351 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence040 2026 890 gene locus_tag LOCUS_08650 2026 890 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790984.1 protein_id gnl|my_center|LOCUS_08650 2253 2744 gene locus_tag LOCUS_08660 2253 2744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 3683 2751 gene locus_tag LOCUS_08670 3683 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 4471 3803 gene locus_tag LOCUS_08680 4471 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4751 4449 gene locus_tag LOCUS_08690 4751 4449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 7246 4970 gene locus_tag LOCUS_08700 7246 4970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 7644 7426 gene locus_tag LOCUS_08710 7644 7426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 8250 7732 gene locus_tag LOCUS_08720 8250 7732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 9060 8260 gene locus_tag LOCUS_08730 9060 8260 CDS product NERD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206820009.1 protein_id gnl|my_center|LOCUS_08730 9456 9064 gene locus_tag LOCUS_08740 9456 9064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 >Feature sequence041 2596 1274 gene locus_tag LOCUS_08750 gene rpoN 2596 1274 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421965.1 protein_id gnl|my_center|LOCUS_08750 3309 2593 gene locus_tag LOCUS_08760 gene lptB 3309 2593 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927114.1 protein_id gnl|my_center|LOCUS_08760 4073 3330 gene locus_tag LOCUS_08770 4073 3330 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881424.1 protein_id gnl|my_center|LOCUS_08770 4617 4054 gene locus_tag LOCUS_08780 4617 4054 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881077.1 protein_id gnl|my_center|LOCUS_08780 5212 4601 gene locus_tag LOCUS_08790 5212 4601 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943605.1 protein_id gnl|my_center|LOCUS_08790 6881 5193 gene locus_tag LOCUS_08800 6881 5193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 9174 6913 gene locus_tag LOCUS_08810 9174 6913 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001833037.1 protein_id gnl|my_center|LOCUS_08810 >Feature sequence042 1883 2914 gene locus_tag LOCUS_08820 1883 2914 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029491176.1 protein_id gnl|my_center|LOCUS_08820 2929 4014 gene locus_tag LOCUS_08830 2929 4014 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582960.1 protein_id gnl|my_center|LOCUS_08830 4007 4963 gene locus_tag LOCUS_08840 4007 4963 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868277.1 protein_id gnl|my_center|LOCUS_08840 4960 5505 gene locus_tag LOCUS_08850 4960 5505 CDS product macro domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545295.1 protein_id gnl|my_center|LOCUS_08850 5631 6374 gene locus_tag LOCUS_08860 5631 6374 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942378.1 protein_id gnl|my_center|LOCUS_08860 6375 7301 gene locus_tag LOCUS_08870 6375 7301 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942377.1 protein_id gnl|my_center|LOCUS_08870 7280 8038 gene locus_tag LOCUS_08880 7280 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08880 8038 8748 gene locus_tag LOCUS_08890 8038 8748 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080267.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence043 216 2282 gene locus_tag LOCUS_08900 216 2282 CDS product LUD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545063.1 protein_id gnl|my_center|LOCUS_08900 2283 3524 gene locus_tag LOCUS_08910 gene lysA 2283 3524 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545292.1 protein_id gnl|my_center|LOCUS_08910 3521 4357 gene locus_tag LOCUS_08920 gene dapF 3521 4357 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881196.1 protein_id gnl|my_center|LOCUS_08920 4376 5254 gene locus_tag LOCUS_08930 gene dapA 4376 5254 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545135.1 protein_id gnl|my_center|LOCUS_08930 5264 6067 gene locus_tag LOCUS_08940 gene dapB 5264 6067 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545687.1 protein_id gnl|my_center|LOCUS_08940 6068 7408 gene locus_tag LOCUS_08950 gene purF 6068 7408 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546301.1 protein_id gnl|my_center|LOCUS_08950 >Feature sequence044 351 911 gene locus_tag LOCUS_08960 351 911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 914 1123 gene locus_tag LOCUS_08970 914 1123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08970 1165 1359 gene locus_tag LOCUS_08980 gene rpmB 1165 1359 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012547624.1 protein_id gnl|my_center|LOCUS_08980 1883 1356 gene locus_tag LOCUS_08990 1883 1356 CDS product DUF2148 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545519.1 protein_id gnl|my_center|LOCUS_08990 2580 1876 gene locus_tag LOCUS_09000 gene whiG 2580 1876 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_09000 2888 2577 gene locus_tag LOCUS_09010 2888 2577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 4892 2889 gene locus_tag LOCUS_09020 gene ligA 4892 2889 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545963.1 protein_id gnl|my_center|LOCUS_09020 5584 4895 gene locus_tag LOCUS_09030 5584 4895 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943095.1 protein_id gnl|my_center|LOCUS_09030 6126 5581 gene locus_tag LOCUS_09040 6126 5581 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080389.1 protein_id gnl|my_center|LOCUS_09040 6637 6218 gene locus_tag LOCUS_09050 6637 6218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 7266 6664 gene locus_tag LOCUS_09060 7266 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 8126 7263 gene locus_tag LOCUS_09070 8126 7263 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880940.1 protein_id gnl|my_center|LOCUS_09070 <9162 8108 gene locus_tag LOCUS_09080 <9162 8108 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546384.1:cysteine--tRNA ligase >Feature sequence045 355 2373 gene locus_tag LOCUS_09090 355 2373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 3589 2396 gene locus_tag LOCUS_09100 3589 2396 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence046 926 2170 gene locus_tag LOCUS_09110 926 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 2233 3555 gene locus_tag LOCUS_09120 2233 3555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 3999 4214 gene locus_tag LOCUS_09130 3999 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 4265 4780 gene locus_tag LOCUS_09140 4265 4780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 4792 5058 gene locus_tag LOCUS_09150 4792 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09150 5055 5576 gene locus_tag LOCUS_09160 5055 5576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 5690 6271 gene locus_tag LOCUS_09170 5690 6271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 6406 6624 gene locus_tag LOCUS_09180 6406 6624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 6818 7750 gene locus_tag LOCUS_09190 6818 7750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 7878 8267 gene locus_tag LOCUS_09200 7878 8267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence047 378 46 gene locus_tag LOCUS_09210 378 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09210 1382 459 gene locus_tag LOCUS_09220 1382 459 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_09220 2549 1386 gene locus_tag LOCUS_09230 gene purT 2549 1386 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496844.1 protein_id gnl|my_center|LOCUS_09230 4366 2603 gene locus_tag LOCUS_09240 4366 2603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5689 4418 gene locus_tag LOCUS_09250 5689 4418 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_09250 6378 5710 gene locus_tag LOCUS_09260 6378 5710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 7564 6389 gene locus_tag LOCUS_09270 7564 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 7818 7917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence048 1188 631 gene locus_tag LOCUS_09280 1188 631 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596512.1 protein_id gnl|my_center|LOCUS_09280 2303 1212 gene locus_tag LOCUS_09290 gene lpxB 2303 1212 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942901.1 protein_id gnl|my_center|LOCUS_09290 3079 2300 gene locus_tag LOCUS_09300 gene lpxA 3079 2300 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546244.1 protein_id gnl|my_center|LOCUS_09300 3538 3080 gene locus_tag LOCUS_09310 gene fabZ 3538 3080 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939641.1 protein_id gnl|my_center|LOCUS_09310 4559 3525 gene locus_tag LOCUS_09320 gene lpxD 4559 3525 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546116.1 protein_id gnl|my_center|LOCUS_09320 5074 4556 gene locus_tag LOCUS_09330 5074 4556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 7342 5099 gene locus_tag LOCUS_09340 gene bamA 7342 5099 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546857.1 protein_id gnl|my_center|LOCUS_09340 8003 7329 gene locus_tag LOCUS_09350 8003 7329 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966824.1 protein_id gnl|my_center|LOCUS_09350 >Feature sequence049 575 1282 gene locus_tag LOCUS_09360 gene flgH 575 1282 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864738.1 protein_id gnl|my_center|LOCUS_09360 1296 2399 gene locus_tag LOCUS_09370 1296 2399 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943673.1 protein_id gnl|my_center|LOCUS_09370 2401 3177 gene locus_tag LOCUS_09380 2401 3177 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965965.1 protein_id gnl|my_center|LOCUS_09380 3229 3531 gene locus_tag LOCUS_09390 3229 3531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 3524 3991 gene locus_tag LOCUS_09400 3524 3991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 3992 5731 gene locus_tag LOCUS_09410 gene flgK 3992 5731 CDS product flagellar hook-associated protein FlgK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236616092.1 protein_id gnl|my_center|LOCUS_09410 >Feature sequence050 381 106 gene locus_tag LOCUS_09420 381 106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 866 561 gene locus_tag LOCUS_09430 866 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 1076 2134 gene locus_tag LOCUS_09440 1076 2134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 2444 2836 gene locus_tag LOCUS_09450 2444 2836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 2833 3261 gene locus_tag LOCUS_09460 2833 3261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 3352 3660 gene locus_tag LOCUS_09470 3352 3660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 3718 4038 gene locus_tag LOCUS_09480 3718 4038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09480 4250 4597 gene locus_tag LOCUS_09490 4250 4597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 4671 4880 gene locus_tag LOCUS_09500 4671 4880 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4939 5640 gene locus_tag LOCUS_09510 4939 5640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 5704 6198 gene locus_tag LOCUS_09520 5704 6198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 6195 6389 gene locus_tag LOCUS_09530 6195 6389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 6675 7379 gene locus_tag LOCUS_09540 6675 7379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 7442 7858 gene locus_tag LOCUS_09550 7442 7858 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 >Feature sequence051 2099 348 gene locus_tag LOCUS_09560 2099 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09560 3430 2180 gene locus_tag LOCUS_09570 3430 2180 CDS product flagellar hook protein FlgE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941087.1 protein_id gnl|my_center|LOCUS_09570 4108 3440 gene locus_tag LOCUS_09580 4108 3440 CDS product flagellar basal body rod modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805290.1 protein_id gnl|my_center|LOCUS_09580 5424 4120 gene locus_tag LOCUS_09590 5424 4120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 7128 5458 gene locus_tag LOCUS_09600 gene dnaG 7128 5458 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601638.1 protein_id gnl|my_center|LOCUS_09600 7333 7136 gene locus_tag LOCUS_09610 7333 7136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 >Feature sequence052 2826 208 gene locus_tag LOCUS_09620 2826 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 4761 2827 gene locus_tag LOCUS_09630 4761 2827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4824 6947 gene locus_tag LOCUS_09640 4824 6947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 7662 6958 gene locus_tag LOCUS_09650 7662 6958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09650 >Feature sequence053 893 255 gene locus_tag LOCUS_09660 893 255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09660 1981 893 gene locus_tag LOCUS_09670 1981 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 2787 2176 gene locus_tag LOCUS_09680 2787 2176 CDS product lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261513.1 protein_id gnl|my_center|LOCUS_09680 2895 3806 gene locus_tag LOCUS_09690 2895 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964370.1 protein_id gnl|my_center|LOCUS_09690 3819 4964 gene locus_tag LOCUS_09700 3819 4964 CDS product beta-ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964369.1 protein_id gnl|my_center|LOCUS_09700 4965 5381 gene locus_tag LOCUS_09710 4965 5381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5368 6375 gene locus_tag LOCUS_09720 5368 6375 CDS product BtrH N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964365.1 protein_id gnl|my_center|LOCUS_09720 6372 7247 gene locus_tag LOCUS_09730 6372 7247 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963494.1 protein_id gnl|my_center|LOCUS_09730 >Feature sequence054 485 3088 gene locus_tag LOCUS_09740 485 3088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 3185 3970 gene locus_tag LOCUS_09750 3185 3970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 3978 5201 gene locus_tag LOCUS_09760 3978 5201 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_09760 5191 5979 gene locus_tag LOCUS_09770 gene napG 5191 5979 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_09770 5972 6541 gene locus_tag LOCUS_09780 5972 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 6538 7053 gene locus_tag LOCUS_09790 6538 7053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 7064 7648 gene locus_tag LOCUS_09800 7064 7648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 >Feature sequence055 <1 966 gene locus_tag LOCUS_09810 <1 966 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545202.1:dihydroorotase 968 1792 gene locus_tag LOCUS_09820 gene accD 968 1792 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 protein_id gnl|my_center|LOCUS_09820 1794 2147 gene locus_tag LOCUS_09830 1794 2147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 2151 3131 gene locus_tag LOCUS_09840 gene gyaR 2151 3131 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_09840 3113 3385 gene locus_tag LOCUS_09850 3113 3385 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081975.1 protein_id gnl|my_center|LOCUS_09850 3376 3921 gene locus_tag LOCUS_09860 3376 3921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 3914 4882 gene locus_tag LOCUS_09870 3914 4882 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_09870 4882 5403 gene locus_tag LOCUS_09880 4882 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 5390 5926 gene locus_tag LOCUS_09890 5390 5926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 5914 7182 gene locus_tag LOCUS_09900 gene aroA 5914 7182 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545275.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence056 229 612 gene locus_tag LOCUS_09910 229 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 609 4445 gene locus_tag LOCUS_09920 609 4445 CDS product PilC/PilY family type IV pilus protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545300.1 protein_id gnl|my_center|LOCUS_09920 4445 5011 gene locus_tag LOCUS_09930 4445 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 4989 5372 gene locus_tag LOCUS_09940 4989 5372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 5365 6453 gene locus_tag LOCUS_09950 5365 6453 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942678.1 protein_id gnl|my_center|LOCUS_09950 6458 7072 gene locus_tag LOCUS_09960 6458 7072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 7439 7095 gene locus_tag LOCUS_09970 7439 7095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence057 6387 5644 gene locus_tag LOCUS_09980 gene fabG 6387 5644 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_09980 6844 6503 gene locus_tag LOCUS_09990 6844 6503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 <7455 6929 gene locus_tag LOCUS_10000 <7455 6929 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000057737.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase >Feature sequence058 <1 848 gene locus_tag LOCUS_10010 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891936.1:ATP-grasp fold amidoligase family protein 841 3069 gene locus_tag LOCUS_10020 841 3069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 3069 6323 gene locus_tag LOCUS_10030 3069 6323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 6410 7285 gene locus_tag LOCUS_10040 6410 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence059 809 2941 gene locus_tag LOCUS_10050 809 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3002 4030 gene locus_tag LOCUS_10060 3002 4030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 4564 4061 gene locus_tag LOCUS_10070 4564 4061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 5152 4655 gene locus_tag LOCUS_10080 5152 4655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 5254 6465 gene locus_tag LOCUS_10090 5254 6465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence060 144 1310 gene locus_tag LOCUS_10100 144 1310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1669 1307 gene locus_tag LOCUS_10110 1669 1307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938727.1 protein_id gnl|my_center|LOCUS_10110 1913 1671 gene locus_tag LOCUS_10120 1913 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 2370 2014 gene locus_tag LOCUS_10130 gene rplS 2370 2014 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545830.1 protein_id gnl|my_center|LOCUS_10130 3019 2363 gene locus_tag LOCUS_10140 gene trmD 3019 2363 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_10140 3264 3034 gene locus_tag LOCUS_10150 3264 3034 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_10150 3504 3271 gene locus_tag LOCUS_10160 gene rpsP 3504 3271 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965062.1 protein_id gnl|my_center|LOCUS_10160 4841 3516 gene locus_tag LOCUS_10170 gene ffh 4841 3516 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861160.1 protein_id gnl|my_center|LOCUS_10170 5393 4908 gene locus_tag LOCUS_10180 5393 4908 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937904.1 protein_id gnl|my_center|LOCUS_10180 5392 6399 gene locus_tag LOCUS_10190 gene galE 5392 6399 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858414.1 protein_id gnl|my_center|LOCUS_10190 6797 6396 gene locus_tag LOCUS_10200 6797 6396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10200 >Feature sequence061 2482 401 gene locus_tag LOCUS_10210 2482 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 4484 2898 gene locus_tag LOCUS_10220 4484 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 5018 4818 gene locus_tag LOCUS_10230 5018 4818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10230 5334 5029 gene locus_tag LOCUS_10240 5334 5029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 6650 5412 gene locus_tag LOCUS_10250 6650 5412 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence062 1940 741 gene locus_tag LOCUS_10260 1940 741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 3492 1924 gene locus_tag LOCUS_10270 3492 1924 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257681.1 protein_id gnl|my_center|LOCUS_10270 3815 3606 gene locus_tag LOCUS_10280 3815 3606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 4767 3832 gene locus_tag LOCUS_10290 4767 3832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 5334 5020 gene locus_tag LOCUS_10300 5334 5020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 6134 5448 gene locus_tag LOCUS_10310 6134 5448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 6734 6147 gene locus_tag LOCUS_10320 6734 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 >Feature sequence063 1556 387 gene locus_tag LOCUS_10330 1556 387 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000285020.1 protein_id gnl|my_center|LOCUS_10330 2385 1549 gene locus_tag LOCUS_10340 2385 1549 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880152.1 protein_id gnl|my_center|LOCUS_10340 2516 2929 gene locus_tag LOCUS_10350 2516 2929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 2933 4666 gene locus_tag LOCUS_10360 2933 4666 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942106.1 protein_id gnl|my_center|LOCUS_10360 4663 6024 gene locus_tag LOCUS_10370 4663 6024 CDS product aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083171.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence064 1065 274 gene locus_tag LOCUS_10380 gene kdsA 1065 274 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545456.1 protein_id gnl|my_center|LOCUS_10380 2344 1085 gene locus_tag LOCUS_10390 gene radA 2344 1085 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545683.1 protein_id gnl|my_center|LOCUS_10390 2458 3636 gene locus_tag LOCUS_10400 2458 3636 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941766.1 protein_id gnl|my_center|LOCUS_10400 3633 3983 gene locus_tag LOCUS_10410 3633 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 3994 4347 gene locus_tag LOCUS_10420 3994 4347 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082362.1 protein_id gnl|my_center|LOCUS_10420 4363 4875 gene locus_tag LOCUS_10430 gene raiA 4363 4875 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938920.1 protein_id gnl|my_center|LOCUS_10430 4872 5342 gene locus_tag LOCUS_10440 4872 5342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 5349 6203 gene locus_tag LOCUS_10450 gene rapZ 5349 6203 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130943.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence065 3113 210 gene locus_tag LOCUS_10460 3113 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10460 5095 3110 gene locus_tag LOCUS_10470 5095 3110 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000893345.1 protein_id gnl|my_center|LOCUS_10470 5236 5160 gene locus_tag LOCUS_t00270 5236 5160 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 6372 5347 gene locus_tag LOCUS_10480 gene cydB 6372 5347 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942286.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence066 2072 399 gene locus_tag LOCUS_10490 2072 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 2302 3855 gene locus_tag LOCUS_10500 2302 3855 CDS product 30S ribosomal protein S1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943240.1 protein_id gnl|my_center|LOCUS_10500 3863 4699 gene locus_tag LOCUS_10510 gene sppA 3863 4699 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545082.1 protein_id gnl|my_center|LOCUS_10510 4696 5643 gene locus_tag LOCUS_10520 4696 5643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 5634 5711 gene locus_tag LOCUS_t00280 5634 5711 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 <6838 6077 gene locus_tag LOCUS_10530 <6838 6077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541103.1:sulfite exporter TauE/SafE family protein >Feature sequence067 714 283 gene locus_tag LOCUS_10540 714 283 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 2318 711 gene locus_tag LOCUS_10550 2318 711 CDS product S8 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139328039.1 protein_id gnl|my_center|LOCUS_10550 5921 2385 gene locus_tag LOCUS_10560 5921 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 <6834 5933 gene locus_tag LOCUS_10570 <6834 5933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein >Feature sequence068 <1 1320 gene locus_tag LOCUS_10580 <1 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881326.1:HD domain-containing protein 1317 2720 gene locus_tag LOCUS_10590 1317 2720 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017035.1 protein_id gnl|my_center|LOCUS_10590 2717 3217 gene locus_tag LOCUS_10600 2717 3217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 3204 4259 gene locus_tag LOCUS_10610 3204 4259 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483418.1 protein_id gnl|my_center|LOCUS_10610 4364 5074 gene locus_tag LOCUS_10620 4364 5074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10620 5065 5598 gene locus_tag LOCUS_10630 5065 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 5568 6167 gene locus_tag LOCUS_10640 gene thiE 5568 6167 CDS product thiamine phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584007.1 protein_id gnl|my_center|LOCUS_10640 >Feature sequence069 2783 2349 gene locus_tag LOCUS_10650 2783 2349 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_10650 2995 3849 gene locus_tag LOCUS_10660 2995 3849 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056135.1 protein_id gnl|my_center|LOCUS_10660 3853 4227 gene locus_tag LOCUS_10670 3853 4227 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880418.1 protein_id gnl|my_center|LOCUS_10670 5037 4234 gene locus_tag LOCUS_10680 gene proC 5037 4234 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023994.1 protein_id gnl|my_center|LOCUS_10680 5443 5117 gene locus_tag LOCUS_10690 5443 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 <6508 5471 gene locus_tag LOCUS_10700 <6508 5471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:PilC/PilY family type IV pilus protein >Feature sequence070 788 552 gene locus_tag LOCUS_10710 gene acpP 788 552 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_10710 1560 817 gene locus_tag LOCUS_10720 gene fabG 1560 817 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428442.1 protein_id gnl|my_center|LOCUS_10720 2477 1557 gene locus_tag LOCUS_10730 gene fabD 2477 1557 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245314.1 protein_id gnl|my_center|LOCUS_10730 3439 2492 gene locus_tag LOCUS_10740 gene fabK 3439 2492 CDS product enoyl-[acyl-carrier-protein] reductase FabK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966839.1 protein_id gnl|my_center|LOCUS_10740 4417 3443 gene locus_tag LOCUS_10750 4417 3443 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942246.1 protein_id gnl|my_center|LOCUS_10750 5445 4414 gene locus_tag LOCUS_10760 gene plsX 5445 4414 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_10760 5625 5446 gene locus_tag LOCUS_10770 gene rpmF 5625 5446 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_10770 6057 5641 gene locus_tag LOCUS_10780 gene ndk 6057 5641 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545240.1 protein_id gnl|my_center|LOCUS_10780 6319 6050 gene locus_tag LOCUS_10790 6319 6050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence071 1345 296 gene locus_tag LOCUS_10800 1345 296 CDS product MlaE family lipid ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772900.1 protein_id gnl|my_center|LOCUS_10800 2009 1323 gene locus_tag LOCUS_10810 2009 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 2591 2229 gene locus_tag LOCUS_10820 2591 2229 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881204.1 protein_id gnl|my_center|LOCUS_10820 3463 2660 gene locus_tag LOCUS_10830 3463 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 4065 3613 gene locus_tag LOCUS_10840 4065 3613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10840 4168 4479 gene locus_tag LOCUS_10850 4168 4479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 4690 4400 gene locus_tag LOCUS_10860 4690 4400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 5058 4798 gene locus_tag LOCUS_10870 5058 4798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10870 5846 5340 gene locus_tag LOCUS_10880 5846 5340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 <6460 5931 gene locus_tag LOCUS_10890 <6460 5931 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878782.1:AMP-binding protein >Feature sequence072 688 155 gene locus_tag LOCUS_10900 688 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10900 1714 701 gene locus_tag LOCUS_10910 1714 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 2487 1711 gene locus_tag LOCUS_10920 2487 1711 CDS product NRDE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941457.1 protein_id gnl|my_center|LOCUS_10920 2561 3529 gene locus_tag LOCUS_10930 gene wtpA 2561 3529 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870699.1 protein_id gnl|my_center|LOCUS_10930 3526 4461 gene locus_tag LOCUS_10940 3526 4461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 4620 5222 gene locus_tag LOCUS_10950 4620 5222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 5219 6241 gene locus_tag LOCUS_10960 5219 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10960 >Feature sequence073 2545 1157 gene locus_tag LOCUS_10970 2545 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 3926 2610 gene locus_tag LOCUS_10980 3926 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 4395 3928 gene locus_tag LOCUS_10990 4395 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4978 4406 gene locus_tag LOCUS_11000 4978 4406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 5555 4971 gene locus_tag LOCUS_11010 5555 4971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 <6354 5564 gene locus_tag LOCUS_11020 <6354 5564 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263698.1:cellulose synthase subunit BcsC-related outer membrane protein >Feature sequence074 93 17 gene locus_tag LOCUS_t00290 93 17 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 967 158 gene locus_tag LOCUS_11030 967 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1267 1479 gene locus_tag LOCUS_11040 gene tatA 1267 1479 CDS product twin-arginine translocase TatA/TatE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933280.1 protein_id gnl|my_center|LOCUS_11040 1488 3113 gene locus_tag LOCUS_11050 gene argS 1488 3113 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546374.1 protein_id gnl|my_center|LOCUS_11050 3123 3959 gene locus_tag LOCUS_11060 3123 3959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 3952 4746 gene locus_tag LOCUS_11070 gene lgt 3952 4746 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545160.1 protein_id gnl|my_center|LOCUS_11070 4715 5278 gene locus_tag LOCUS_11080 4715 5278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 >Feature sequence075 <1 1491 gene locus_tag LOCUS_11090 <1 1491 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880933.1:EAL domain-containing protein 1637 1981 gene locus_tag LOCUS_11100 gene dksA 1637 1981 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_11100 2202 2663 gene locus_tag LOCUS_11110 2202 2663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 2761 3096 gene locus_tag LOCUS_11120 gene rpsF 2761 3096 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420522.1 protein_id gnl|my_center|LOCUS_11120 3089 3484 gene locus_tag LOCUS_11130 gene ssb 3089 3484 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545299.1 protein_id gnl|my_center|LOCUS_11130 3496 3762 gene locus_tag LOCUS_11140 gene rpsR 3496 3762 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869404.1 protein_id gnl|my_center|LOCUS_11140 3773 4228 gene locus_tag LOCUS_11150 gene rplI 3773 4228 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545246.1 protein_id gnl|my_center|LOCUS_11150 4218 5609 gene locus_tag LOCUS_11160 gene dnaB 4218 5609 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546182.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence076 <1 1343 gene locus_tag LOCUS_11170 <1 1343 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053741.1:NAD(P)-binding protein 1343 2485 gene locus_tag LOCUS_11180 1343 2485 CDS product pyruvate ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147320.1 protein_id gnl|my_center|LOCUS_11180 2496 3368 gene locus_tag LOCUS_11190 gene porB 2496 3368 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762255.1 protein_id gnl|my_center|LOCUS_11190 3368 4432 gene locus_tag LOCUS_11200 gene buk 3368 4432 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048334.1 protein_id gnl|my_center|LOCUS_11200 4442 5932 gene locus_tag LOCUS_11210 4442 5932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence077 1479 4 gene locus_tag LOCUS_11220 1479 4 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256247.1 protein_id gnl|my_center|LOCUS_11220 2993 1476 gene locus_tag LOCUS_11230 2993 1476 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256246.1 protein_id gnl|my_center|LOCUS_11230 3096 3800 gene locus_tag LOCUS_11240 3096 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 <6059 3794 gene locus_tag LOCUS_11250 <6059 3794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963916.1:efflux RND transporter permease subunit >Feature sequence078 <1 1392 gene locus_tag LOCUS_11260 <1 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788346.1:TrkA C-terminal domain-containing protein 2121 1381 gene locus_tag LOCUS_11270 2121 1381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3409 2573 gene locus_tag LOCUS_11280 gene xerC 3409 2573 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545085.1 protein_id gnl|my_center|LOCUS_11280 3881 3393 gene locus_tag LOCUS_11290 gene rfaE2 3881 3393 CDS product D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880070.1 protein_id gnl|my_center|LOCUS_11290 4428 3865 gene locus_tag LOCUS_11300 4428 3865 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_11300 4552 5472 gene locus_tag LOCUS_11310 gene epmA 4552 5472 CDS product EF-P lysine aminoacylase EpmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207420.1 protein_id gnl|my_center|LOCUS_11310 >Feature sequence079 384 226 gene locus_tag LOCUS_11320 384 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 671 381 gene locus_tag LOCUS_11330 671 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 1117 713 gene locus_tag LOCUS_11340 1117 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 1497 1114 gene locus_tag LOCUS_11350 1497 1114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 1805 1494 gene locus_tag LOCUS_11360 1805 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 2266 2772 gene locus_tag LOCUS_11370 2266 2772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2778 3827 gene locus_tag LOCUS_11380 2778 3827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 3820 5475 gene locus_tag LOCUS_11390 3820 5475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence080 638 1306 gene locus_tag LOCUS_11400 638 1306 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_11400 1306 2709 gene locus_tag LOCUS_11410 1306 2709 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545380.1 protein_id gnl|my_center|LOCUS_11410 2766 2966 gene locus_tag LOCUS_11420 2766 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 2976 4358 gene locus_tag LOCUS_11430 2976 4358 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940999.1 protein_id gnl|my_center|LOCUS_11430 4969 4382 gene locus_tag LOCUS_11440 gene pyrE 4969 4382 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583288.1 protein_id gnl|my_center|LOCUS_11440 5672 4956 gene locus_tag LOCUS_11450 gene pyrF 5672 4956 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545803.1 protein_id gnl|my_center|LOCUS_11450 >Feature sequence081 357 2777 gene locus_tag LOCUS_11460 357 2777 CDS product homocysteine S-methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943552.1 protein_id gnl|my_center|LOCUS_11460 2770 3930 gene locus_tag LOCUS_11470 2770 3930 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028842237.1 protein_id gnl|my_center|LOCUS_11470 4380 3958 gene locus_tag LOCUS_11480 4380 3958 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939839.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence082 1743 1309 gene locus_tag LOCUS_11490 1743 1309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 1940 1755 gene locus_tag LOCUS_11500 1940 1755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11500 2350 1937 gene locus_tag LOCUS_11510 2350 1937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 2915 2508 gene locus_tag LOCUS_11520 2915 2508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 3014 2939 gene locus_tag LOCUS_t00300 3014 2939 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3753 3034 gene locus_tag LOCUS_11530 3753 3034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 5131 3803 gene locus_tag LOCUS_11540 5131 3803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 <5774 5202 gene locus_tag LOCUS_11550 <5774 5202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000236875.1:6-pyruvoyl tetrahydropterin synthase family protein >Feature sequence083 912 16 gene locus_tag LOCUS_11560 912 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 3043 1061 gene locus_tag LOCUS_11570 3043 1061 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 4477 3176 gene locus_tag LOCUS_11580 4477 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4772 4491 gene locus_tag LOCUS_11590 4772 4491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 4787 5593 gene locus_tag LOCUS_11600 4787 5593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence084 474 1094 gene locus_tag LOCUS_11610 gene clpP 474 1094 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880859.1 protein_id gnl|my_center|LOCUS_11610 1072 2334 gene locus_tag LOCUS_11620 gene clpX 1072 2334 CDS product ATP-dependent protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229613.1 protein_id gnl|my_center|LOCUS_11620 2335 2871 gene locus_tag LOCUS_11630 gene hslV 2335 2871 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114726.1 protein_id gnl|my_center|LOCUS_11630 2876 4228 gene locus_tag LOCUS_11640 gene hslU 2876 4228 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_181406033.1 protein_id gnl|my_center|LOCUS_11640 4864 4223 gene locus_tag LOCUS_11650 gene yihA 4864 4223 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081764.1 protein_id gnl|my_center|LOCUS_11650 5259 4786 gene locus_tag LOCUS_11660 5259 4786 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082922.1 protein_id gnl|my_center|LOCUS_11660 >Feature sequence085 900 175 gene locus_tag LOCUS_11670 900 175 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881298.1 protein_id gnl|my_center|LOCUS_11670 1020 1229 gene locus_tag LOCUS_11680 1020 1229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3424 1307 gene locus_tag LOCUS_11690 3424 1307 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081682.1 protein_id gnl|my_center|LOCUS_11690 3626 3699 gene locus_tag LOCUS_t00310 3626 3699 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3980 5506 gene locus_tag LOCUS_11700 3980 5506 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080231.1 protein_id gnl|my_center|LOCUS_11700 >Feature sequence086 1656 1569 gene locus_tag LOCUS_t00320 1656 1569 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1741 1666 gene locus_tag LOCUS_t00330 1741 1666 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1839 1764 gene locus_tag LOCUS_t00340 1839 1764 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 3571 1913 gene locus_tag LOCUS_11710 3571 1913 CDS product putative manganese-dependent inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461447.1 protein_id gnl|my_center|LOCUS_11710 4184 3582 gene locus_tag LOCUS_11720 4184 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 5090 4185 gene locus_tag LOCUS_11730 5090 4185 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707859.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence087 1250 48 gene locus_tag LOCUS_11740 1250 48 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_11740 1753 1247 gene locus_tag LOCUS_11750 gene coaD 1753 1247 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074274.1 protein_id gnl|my_center|LOCUS_11750 2279 1746 gene locus_tag LOCUS_11760 gene rsmD 2279 1746 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_11760 3462 2254 gene locus_tag LOCUS_11770 3462 2254 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089322349.1 protein_id gnl|my_center|LOCUS_11770 5070 3493 gene locus_tag LOCUS_11780 5070 3493 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545621.1 protein_id gnl|my_center|LOCUS_11780 >Feature sequence088 1277 759 gene locus_tag LOCUS_11790 gene cobO 1277 759 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081762.1 protein_id gnl|my_center|LOCUS_11790 1875 1270 gene locus_tag LOCUS_11800 1875 1270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11800 2109 3038 gene locus_tag LOCUS_11810 2109 3038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 3039 5018 gene locus_tag LOCUS_11820 3039 5018 CDS product hydantoinase/oxoprolinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880423.1 protein_id gnl|my_center|LOCUS_11820 >Feature sequence089 982 302 gene locus_tag LOCUS_11830 982 302 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010906333.1 protein_id gnl|my_center|LOCUS_11830 1489 1175 gene locus_tag LOCUS_11840 1489 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071742188.1 protein_id gnl|my_center|LOCUS_11840 2807 1902 gene locus_tag LOCUS_11850 gene lpxC 2807 1902 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555040.1 protein_id gnl|my_center|LOCUS_11850 3942 2830 gene locus_tag LOCUS_11860 gene carA 3942 2830 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880225.1 protein_id gnl|my_center|LOCUS_11860 4217 3939 gene locus_tag LOCUS_11870 4217 3939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11870 4495 4214 gene locus_tag LOCUS_11880 4495 4214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 5120 4533 gene locus_tag LOCUS_11890 gene plsY 5120 4533 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941175.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence090 2371 1115 gene locus_tag LOCUS_11900 gene ftsA 2371 1115 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_11900 3153 2368 gene locus_tag LOCUS_11910 3153 2368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 4034 3150 gene locus_tag LOCUS_11920 4034 3150 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546449.1 protein_id gnl|my_center|LOCUS_11920 4831 4031 gene locus_tag LOCUS_11930 gene murB 4831 4031 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003232182.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence091 415 5 gene locus_tag LOCUS_11940 415 5 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082892.1 protein_id gnl|my_center|LOCUS_11940 1463 426 gene locus_tag LOCUS_11950 1463 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 1810 1505 gene locus_tag LOCUS_11960 1810 1505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 1698 2027 gene locus_tag LOCUS_11970 1698 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 2094 2252 gene locus_tag LOCUS_11980 2094 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 2283 2708 gene locus_tag LOCUS_11990 2283 2708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 3264 2701 gene locus_tag LOCUS_12000 3264 2701 CDS product CoA pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943986.1 protein_id gnl|my_center|LOCUS_12000 3334 3951 gene locus_tag LOCUS_12010 3334 3951 CDS product pyrimidine 5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010970854.1 protein_id gnl|my_center|LOCUS_12010 4771 3938 gene locus_tag LOCUS_12020 gene speB 4771 3938 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001209831.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence092 18 1040 gene locus_tag LOCUS_12030 18 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1044 1262 gene locus_tag LOCUS_12040 1044 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1225 1599 gene locus_tag LOCUS_12050 1225 1599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 1589 3841 gene locus_tag LOCUS_12060 1589 3841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence093 607 182 gene locus_tag LOCUS_12070 gene speD 607 182 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583813.1 protein_id gnl|my_center|LOCUS_12070 803 2689 gene locus_tag LOCUS_12080 803 2689 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877962.1 protein_id gnl|my_center|LOCUS_12080 2728 3015 gene locus_tag LOCUS_12090 2728 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 3026 3409 gene locus_tag LOCUS_12100 3026 3409 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_12100 3902 3387 gene locus_tag LOCUS_12110 3902 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 4005 4355 gene locus_tag LOCUS_12120 4005 4355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12120 4429 4605 gene locus_tag LOCUS_12130 4429 4605 CDS product MarR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064556.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence094 132 353 gene locus_tag LOCUS_12140 132 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12140 331 669 gene locus_tag LOCUS_12150 331 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12150 858 1766 gene locus_tag LOCUS_12160 gene prfB 858 1766 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197551829.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12160 1770 3266 gene locus_tag LOCUS_12170 gene lysS 1770 3266 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545717.1 protein_id gnl|my_center|LOCUS_12170 3263 3649 gene locus_tag LOCUS_12180 3263 3649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12180 3646 4035 gene locus_tag LOCUS_12190 3646 4035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12190 <5029 4043 gene locus_tag LOCUS_12200 <5029 4043 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870209.1:TrkH family potassium uptake protein >Feature sequence095 1742 366 gene locus_tag LOCUS_12210 1742 366 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011949035.1 protein_id gnl|my_center|LOCUS_12210 3465 1789 gene locus_tag LOCUS_12220 3465 1789 CDS product acyl--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545924.1 protein_id gnl|my_center|LOCUS_12220 4930 3584 gene locus_tag LOCUS_12230 4930 3584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 >Feature sequence096 682 335 gene locus_tag LOCUS_12240 682 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 1263 679 gene locus_tag LOCUS_12250 1263 679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 2204 1320 gene locus_tag LOCUS_12260 2204 1320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 >Feature sequence097 2721 568 gene locus_tag LOCUS_12270 gene recG 2721 568 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583501.1 protein_id gnl|my_center|LOCUS_12270 3390 2722 gene locus_tag LOCUS_12280 3390 2722 CDS product nitroreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022654.1 protein_id gnl|my_center|LOCUS_12280 <4881 3387 gene locus_tag LOCUS_12290 <4881 3387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545977.1:menaquinone biosynthesis decarboxylase >Feature sequence098 >Feature sequence099 1604 366 gene locus_tag LOCUS_12300 1604 366 CDS product GumC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930608.1 protein_id gnl|my_center|LOCUS_12300 1735 1809 gene locus_tag LOCUS_t00350 1735 1809 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1832 3694 gene locus_tag LOCUS_12310 gene thrS 1832 3694 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360261.1 protein_id gnl|my_center|LOCUS_12310 3678 4226 gene locus_tag LOCUS_12320 gene infC 3678 4226 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391235.1 protein_id gnl|my_center|LOCUS_12320 4236 4436 gene locus_tag LOCUS_12330 4236 4436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 4446 4790 gene locus_tag LOCUS_12340 gene rplT 4446 4790 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880587.1 protein_id gnl|my_center|LOCUS_12340 >Feature sequence100 684 319 gene locus_tag LOCUS_12350 gene arsC 684 319 CDS product arsenate reductase (thioredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107585880.1 protein_id gnl|my_center|LOCUS_12350 1424 732 gene locus_tag LOCUS_12360 1424 732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 1542 3809 gene locus_tag LOCUS_12370 1542 3809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 4099 3806 gene locus_tag LOCUS_12380 4099 3806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12380 <4764 4096 gene locus_tag LOCUS_12390 <4764 4096 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879868.1:ATP-binding protein >Feature sequence101 616 452 gene locus_tag LOCUS_12400 616 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 991 1863 gene locus_tag LOCUS_12410 991 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 3570 1864 gene locus_tag LOCUS_12420 3570 1864 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966799.1 protein_id gnl|my_center|LOCUS_12420 4035 3811 gene locus_tag LOCUS_12430 4035 3811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 4523 4053 gene locus_tag LOCUS_12440 4523 4053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence102 >Feature sequence103 224 835 gene locus_tag LOCUS_12450 224 835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 847 2037 gene locus_tag LOCUS_12460 847 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 2024 2587 gene locus_tag LOCUS_12470 2024 2587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2686 3474 gene locus_tag LOCUS_12480 2686 3474 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020166.1 protein_id gnl|my_center|LOCUS_12480 3458 4255 gene locus_tag LOCUS_12490 3458 4255 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865121.1 protein_id gnl|my_center|LOCUS_12490 >Feature sequence104 428 1963 gene locus_tag LOCUS_12500 gene recN 428 1963 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016269.1 protein_id gnl|my_center|LOCUS_12500 1960 3000 gene locus_tag LOCUS_12510 gene murG 1960 3000 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545433.1 protein_id gnl|my_center|LOCUS_12510 2997 3743 gene locus_tag LOCUS_12520 gene soj 2997 3743 CDS product sporulation initiation inhibitor protein Soj inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003219244.1 protein_id gnl|my_center|LOCUS_12520 3736 4539 gene locus_tag LOCUS_12530 3736 4539 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546849.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence105 1351 917 gene locus_tag LOCUS_12540 gene rplO 1351 917 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881064.1 protein_id gnl|my_center|LOCUS_12540 1546 1367 gene locus_tag LOCUS_12550 gene rpmD 1546 1367 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002936638.1 protein_id gnl|my_center|LOCUS_12550 2028 1555 gene locus_tag LOCUS_12560 gene rpsE 2028 1555 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000113851.1 protein_id gnl|my_center|LOCUS_12560 2402 2040 gene locus_tag LOCUS_12570 gene rplR 2402 2040 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000628816.1 protein_id gnl|my_center|LOCUS_12570 2961 2416 gene locus_tag LOCUS_12580 gene rplF 2961 2416 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938613.1 protein_id gnl|my_center|LOCUS_12580 3376 2975 gene locus_tag LOCUS_12590 gene rpsH 3376 2975 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549038.1 protein_id gnl|my_center|LOCUS_12590 3569 3384 gene locus_tag LOCUS_12600 3569 3384 CDS product type Z 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583358.1 protein_id gnl|my_center|LOCUS_12600 4141 3581 gene locus_tag LOCUS_12610 gene rplE 4141 3581 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943474.1 protein_id gnl|my_center|LOCUS_12610 4476 4156 gene locus_tag LOCUS_12620 gene rplX 4476 4156 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081814.1 protein_id gnl|my_center|LOCUS_12620 >Feature sequence106 2055 775 gene locus_tag LOCUS_12630 2055 775 CDS product DUF445 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930567.1 protein_id gnl|my_center|LOCUS_12630 3149 2052 gene locus_tag LOCUS_12640 gene dnaJ 3149 2052 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940712.1 protein_id gnl|my_center|LOCUS_12640 <4629 3251 gene locus_tag LOCUS_12650 <4629 3251 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545409.1:molecular chaperone DnaK >Feature sequence107 1179 358 gene locus_tag LOCUS_12660 1179 358 CDS product amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041213497.1 protein_id gnl|my_center|LOCUS_12660 2129 1302 gene locus_tag LOCUS_12670 2129 1302 CDS product transporter substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938265.1 protein_id gnl|my_center|LOCUS_12670 2298 2146 gene locus_tag LOCUS_12680 2298 2146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2632 2447 gene locus_tag LOCUS_12690 2632 2447 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_12690 3073 2714 gene locus_tag LOCUS_12700 3073 2714 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546385.1 protein_id gnl|my_center|LOCUS_12700 4346 3066 gene locus_tag LOCUS_12710 4346 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 >Feature sequence108 378 1973 gene locus_tag LOCUS_12720 378 1973 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545536.1 protein_id gnl|my_center|LOCUS_12720 2165 2320 gene locus_tag LOCUS_12730 2165 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 2446 3363 gene locus_tag LOCUS_12740 gene nadA 2446 3363 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583121.1 protein_id gnl|my_center|LOCUS_12740 3363 4190 gene locus_tag LOCUS_12750 gene nadC 3363 4190 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880528.1 protein_id gnl|my_center|LOCUS_12750 >Feature sequence109 252 512 gene locus_tag LOCUS_12760 252 512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 725 877 gene locus_tag LOCUS_12770 725 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12770 883 3678 gene locus_tag LOCUS_12780 883 3678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 >Feature sequence110 <1 1184 gene locus_tag LOCUS_12790 <1 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257821.1:response regulator 2721 1189 gene locus_tag LOCUS_12800 2721 1189 CDS product NAD(P)H-hydrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164924808.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence111 <1 701 gene locus_tag LOCUS_12810 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044948.1:histidine kinase N-terminal 7TM domain-containing protein 780 1631 gene locus_tag LOCUS_12820 gene argB 780 1631 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002551508.1 protein_id gnl|my_center|LOCUS_12820 1628 1849 gene locus_tag LOCUS_12830 1628 1849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12830 1849 2883 gene locus_tag LOCUS_12840 1849 2883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 2949 3164 gene locus_tag LOCUS_12850 2949 3164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 3473 3775 gene locus_tag LOCUS_12860 3473 3775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12860 3883 4185 gene locus_tag LOCUS_12870 3883 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 >Feature sequence112 1977 1111 gene locus_tag LOCUS_12880 1977 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12880 2654 1968 gene locus_tag LOCUS_12890 2654 1968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2953 2651 gene locus_tag LOCUS_12900 2953 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 <4444 2943 gene locus_tag LOCUS_12910 <4444 2943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964371.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence113 1979 681 gene locus_tag LOCUS_12920 1979 681 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938556.1 protein_id gnl|my_center|LOCUS_12920 3425 2076 gene locus_tag LOCUS_12930 3425 2076 CDS product L-serine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957429.1 protein_id gnl|my_center|LOCUS_12930 3926 3441 gene locus_tag LOCUS_12940 3926 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 >Feature sequence114 1610 861 gene locus_tag LOCUS_12950 gene pssA 1610 861 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942552.1 protein_id gnl|my_center|LOCUS_12950 2260 1607 gene locus_tag LOCUS_12960 2260 1607 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_12960 3266 2244 gene locus_tag LOCUS_12970 gene ilvC 3266 2244 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545824.1 protein_id gnl|my_center|LOCUS_12970 3763 3281 gene locus_tag LOCUS_12980 gene ilvN 3763 3281 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942555.1 protein_id gnl|my_center|LOCUS_12980 4351 3779 gene locus_tag LOCUS_12990 4351 3779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12990 >Feature sequence115 21 2165 gene locus_tag LOCUS_13000 21 2165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 2162 3211 gene locus_tag LOCUS_13010 2162 3211 CDS product NAD-dependent epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931922.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence116 1147 503 gene locus_tag LOCUS_13020 1147 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1359 1144 gene locus_tag LOCUS_13030 1359 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 2309 1362 gene locus_tag LOCUS_13040 2309 1362 CDS product hemolytic protein HlpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058218.1 protein_id gnl|my_center|LOCUS_13040 3177 2311 gene locus_tag LOCUS_13050 3177 2311 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867427.1 protein_id gnl|my_center|LOCUS_13050 3347 3207 gene locus_tag LOCUS_13060 3347 3207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 4054 3647 gene locus_tag LOCUS_13070 4054 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13070 >Feature sequence117 1683 1309 gene locus_tag LOCUS_13080 1683 1309 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_13080 2625 1687 gene locus_tag LOCUS_13090 gene rfbD 2625 1687 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786018.1 protein_id gnl|my_center|LOCUS_13090 3193 2618 gene locus_tag LOCUS_13100 gene rfbC 3193 2618 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_13100 <4124 3193 gene locus_tag LOCUS_13110 <4124 3193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107280.1:glucose-1-phosphate thymidylyltransferase RfbA >Feature sequence118 3408 2629 gene locus_tag LOCUS_13120 3408 2629 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080966.1 protein_id gnl|my_center|LOCUS_13120 <4091 3395 gene locus_tag LOCUS_13130 <4091 3395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877751.1:adenine deaminase >Feature sequence119 <1 584 gene locus_tag LOCUS_13140 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937797.1:HD-GYP domain-containing protein 2206 581 gene locus_tag LOCUS_13150 2206 581 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048171175.1 protein_id gnl|my_center|LOCUS_13150 2754 2203 gene locus_tag LOCUS_13160 2754 2203 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_13160 3671 2751 gene locus_tag LOCUS_13170 3671 2751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 >Feature sequence120 1913 240 gene locus_tag LOCUS_13180 1913 240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 2155 2889 gene locus_tag LOCUS_13190 2155 2889 CDS product zinc dependent phospholipase C family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_169309459.1 protein_id gnl|my_center|LOCUS_13190 >Feature sequence121 208 1359 gene locus_tag LOCUS_13200 208 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1445 1912 gene locus_tag LOCUS_13210 1445 1912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13210 1965 2420 gene locus_tag LOCUS_13220 1965 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13220 2410 3513 gene locus_tag LOCUS_13230 2410 3513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 3624 3800 gene locus_tag LOCUS_13240 3624 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 >Feature sequence122 1487 1032 gene locus_tag LOCUS_13250 1487 1032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 2265 1498 gene locus_tag LOCUS_13260 2265 1498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13260 2819 2265 gene locus_tag LOCUS_13270 2819 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13270 3460 2801 gene locus_tag LOCUS_13280 3460 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 <3985 3457 gene locus_tag LOCUS_13290 <3985 3457 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104531.1:baseplate J/gp47 family protein >Feature sequence123 1261 176 gene locus_tag LOCUS_13300 gene wlbC 1261 176 CDS product O-antigen biosynthesis protein WlbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010929614.1 protein_id gnl|my_center|LOCUS_13300 1911 1258 gene locus_tag LOCUS_13310 1911 1258 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_13310 2875 1913 gene locus_tag LOCUS_13320 2875 1913 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_13320 <3951 2878 gene locus_tag LOCUS_13330 <3951 2878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963428.1:nucleotide sugar dehydrogenase >Feature sequence124 96 653 gene locus_tag LOCUS_13340 96 653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13340 640 1167 gene locus_tag LOCUS_13350 640 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13350 1157 1459 gene locus_tag LOCUS_13360 1157 1459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13360 1891 1445 gene locus_tag LOCUS_13370 1891 1445 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925080.1 protein_id gnl|my_center|LOCUS_13370 2318 1884 gene locus_tag LOCUS_13380 2318 1884 CDS product nucleoside recognition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868940.1 protein_id gnl|my_center|LOCUS_13380 3285 2296 gene locus_tag LOCUS_13390 3285 2296 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005807926.1 protein_id gnl|my_center|LOCUS_13390 >Feature sequence125 1630 137 gene locus_tag LOCUS_13400 1630 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13400 >Feature sequence126 715 353 gene locus_tag LOCUS_13410 715 353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13410 1442 789 gene locus_tag LOCUS_13420 1442 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13420 1610 1903 gene locus_tag LOCUS_13430 1610 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 1903 2355 gene locus_tag LOCUS_13440 1903 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13440 2569 2390 gene locus_tag LOCUS_13450 2569 2390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13450 2876 2730 gene locus_tag LOCUS_13460 2876 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13460 3377 3018 gene locus_tag LOCUS_13470 3377 3018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence127 972 139 gene locus_tag LOCUS_13480 972 139 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392942.1 protein_id gnl|my_center|LOCUS_13480 1478 1014 gene locus_tag LOCUS_13490 1478 1014 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939932.1 protein_id gnl|my_center|LOCUS_13490 1744 3051 gene locus_tag LOCUS_13500 1744 3051 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence128 <1 1082 gene locus_tag LOCUS_13510 <1 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011476099.1:glycosyltransferase family 4 protein 1205 2320 gene locus_tag LOCUS_13520 gene gmd 1205 2320 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000048190.1 protein_id gnl|my_center|LOCUS_13520 2593 3180 gene locus_tag LOCUS_13530 2593 3180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 3212 3331 gene locus_tag LOCUS_13540 3212 3331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13540 >Feature sequence129 339 1643 gene locus_tag LOCUS_13550 339 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13550 1668 2411 gene locus_tag LOCUS_13560 1668 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_13560 2499 3416 gene locus_tag LOCUS_13570 2499 3416 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868404.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence130 942 2819 gene locus_tag LOCUS_13580 gene mrdA 942 2819 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942721.1 protein_id gnl|my_center|LOCUS_13580 3719 2730 gene locus_tag LOCUS_13590 3719 2730 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942139.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence131 324 851 gene locus_tag LOCUS_13600 324 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13600 1174 929 gene locus_tag LOCUS_13610 1174 929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13610 1636 1490 gene locus_tag LOCUS_13620 1636 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13620 2675 1623 gene locus_tag LOCUS_13630 2675 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13630 >Feature sequence132 <1 1040 gene locus_tag LOCUS_13640 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940999.1:DegQ family serine endoprotease 1065 1817 gene locus_tag LOCUS_13650 1065 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13650 1818 2489 gene locus_tag LOCUS_13660 1818 2489 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930841.1 protein_id gnl|my_center|LOCUS_13660 >Feature sequence133 307 35 gene locus_tag LOCUS_13670 307 35 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13670 532 323 gene locus_tag LOCUS_13680 gene rpmE 532 323 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002669000.1 protein_id gnl|my_center|LOCUS_13680 1524 601 gene locus_tag LOCUS_13690 1524 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1886 1515 gene locus_tag LOCUS_13700 1886 1515 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150530.1 protein_id gnl|my_center|LOCUS_13700 2497 1883 gene locus_tag LOCUS_13710 gene nth 2497 1883 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964008.1 protein_id gnl|my_center|LOCUS_13710 <3687 2481 gene locus_tag LOCUS_13720 <3687 2481 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016201.1:ribosome biogenesis GTPase Der >Feature sequence134 88 471 gene locus_tag LOCUS_13730 88 471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 444 453 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 497 1138 gene locus_tag LOCUS_13740 497 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1149 1517 gene locus_tag LOCUS_13750 1149 1517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1531 2472 gene locus_tag LOCUS_13760 1531 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 2484 2936 gene locus_tag LOCUS_13770 2484 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 2926 3360 gene locus_tag LOCUS_13780 2926 3360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence135 115 1248 gene locus_tag LOCUS_13790 gene rffA 115 1248 CDS product dTDP-4-amino-4,6-dideoxygalactose transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176203.1 protein_id gnl|my_center|LOCUS_13790 1252 2121 gene locus_tag LOCUS_13800 gene rfbA 1252 2121 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073074.1 protein_id gnl|my_center|LOCUS_13800 2114 3124 gene locus_tag LOCUS_13810 gene rfbB 2114 3124 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989656.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence136 78 2351 gene locus_tag LOCUS_13820 gene lon 78 2351 CDS product endopeptidase La inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545466.1 protein_id gnl|my_center|LOCUS_13820 2348 3541 gene locus_tag LOCUS_13830 2348 3541 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939648.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence137 285 968 gene locus_tag LOCUS_13840 gene pyrF 285 968 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_13840 1012 1101 gene locus_tag LOCUS_t00360 1012 1101 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 2552 1350 gene locus_tag LOCUS_13850 2552 1350 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905971.1 protein_id gnl|my_center|LOCUS_13850 2901 2563 gene locus_tag LOCUS_13860 2901 2563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13860 3082 3534 gene locus_tag LOCUS_13870 3082 3534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13870 >Feature sequence138 2084 858 gene locus_tag LOCUS_13880 2084 858 CDS product beta-ketoacyl-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208361.1 protein_id gnl|my_center|LOCUS_13880 3409 2081 gene locus_tag LOCUS_13890 gene crtI 3409 2081 CDS product phytoene desaturase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963567.1 protein_id gnl|my_center|LOCUS_13890 >Feature sequence139 1087 2376 gene locus_tag LOCUS_13900 1087 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 2653 2970 gene locus_tag LOCUS_13910 2653 2970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13910 2975 3268 gene locus_tag LOCUS_13920 2975 3268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13920 3265 3519 gene locus_tag LOCUS_13930 3265 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13930 >Feature sequence140 <1 532 gene locus_tag LOCUS_13940 <1 532 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_214417904.1:DUF2829 domain-containing protein 544 759 gene locus_tag LOCUS_13950 544 759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13950 1009 3399 gene locus_tag LOCUS_13960 1009 3399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13960 >Feature sequence141 1866 784 gene locus_tag LOCUS_13970 gene nusA 1866 784 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583567.1 protein_id gnl|my_center|LOCUS_13970 2300 1878 gene locus_tag LOCUS_13980 gene rimP 2300 1878 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411704.1 protein_id gnl|my_center|LOCUS_13980 3179 2337 gene locus_tag LOCUS_13990 gene folD 3179 2337 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393025.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence142 85 546 gene locus_tag LOCUS_14000 85 546 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546200.1 protein_id gnl|my_center|LOCUS_14000 543 1820 gene locus_tag LOCUS_14010 543 1820 CDS product phenylacetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545255.1 protein_id gnl|my_center|LOCUS_14010 1872 2717 gene locus_tag LOCUS_14020 gene motA 1872 2717 CDS product flagellar motor stator protein MotA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546161.1 protein_id gnl|my_center|LOCUS_14020 >Feature sequence143 61 1575 gene locus_tag LOCUS_14030 61 1575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 2032 1577 gene locus_tag LOCUS_14040 gene dtd 2032 1577 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173028.1 protein_id gnl|my_center|LOCUS_14040 2556 2032 gene locus_tag LOCUS_14050 2556 2032 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14050 >Feature sequence144 135 389 gene locus_tag LOCUS_14060 135 389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14060 371 655 gene locus_tag LOCUS_14070 371 655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14070 1137 931 gene locus_tag LOCUS_14080 1137 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14080 1350 1150 gene locus_tag LOCUS_14090 1350 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 1508 2443 gene locus_tag LOCUS_14100 1508 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 2735 2953 gene locus_tag LOCUS_14110 2735 2953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 2954 3241 gene locus_tag LOCUS_14120 2954 3241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 >Feature sequence145 1321 950 gene locus_tag LOCUS_14130 1321 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 1481 1359 gene locus_tag LOCUS_14140 1481 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14140 2937 1759 gene locus_tag LOCUS_14150 gene nrfD 2937 1759 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817192.1 protein_id gnl|my_center|LOCUS_14150 <3463 2948 gene locus_tag LOCUS_14160 <3463 2948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073773.1:4Fe-4S dicluster domain-containing protein >Feature sequence146 409 125 gene locus_tag LOCUS_14170 409 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 981 406 gene locus_tag LOCUS_14180 981 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14180 2034 1024 gene locus_tag LOCUS_14190 2034 1024 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940417.1 protein_id gnl|my_center|LOCUS_14190 2779 2018 gene locus_tag LOCUS_14200 2779 2018 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_14200 3441 2779 gene locus_tag LOCUS_14210 3441 2779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence147 748 1305 gene locus_tag LOCUS_14220 748 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 1553 2902 gene locus_tag LOCUS_14230 1553 2902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14230 >Feature sequence148 1330 728 gene locus_tag LOCUS_14240 1330 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 2153 1626 gene locus_tag LOCUS_14250 2153 1626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 2991 2416 gene locus_tag LOCUS_14260 2991 2416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14260 >Feature sequence149 282 13 gene locus_tag LOCUS_14270 282 13 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 663 364 gene locus_tag LOCUS_14280 663 364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1279 746 gene locus_tag LOCUS_14290 1279 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14290 1708 1427 gene locus_tag LOCUS_14300 1708 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 2064 1831 gene locus_tag LOCUS_14310 2064 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14310 2423 2052 gene locus_tag LOCUS_14320 2423 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence150 2 376 gene locus_tag LOCUS_14330 2 376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 378 821 gene locus_tag LOCUS_14340 378 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 897 1313 gene locus_tag LOCUS_14350 897 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14350 1327 1863 gene locus_tag LOCUS_14360 1327 1863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14360 1863 2402 gene locus_tag LOCUS_14370 gene atpH 1863 2402 CDS product ATP synthase F1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011475836.1 protein_id gnl|my_center|LOCUS_14370 >Feature sequence151 3089 237 gene locus_tag LOCUS_14380 3089 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 >Feature sequence152 <1 638 gene locus_tag LOCUS_14390 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858396.1:redox-regulated ATPase YchF 684 1319 gene locus_tag LOCUS_14400 684 1319 CDS product paraquat-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010428234.1 protein_id gnl|my_center|LOCUS_14400 1312 1917 gene locus_tag LOCUS_14410 1312 1917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_14410 >Feature sequence153 990 580 gene locus_tag LOCUS_14420 990 580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1580 1002 gene locus_tag LOCUS_14430 1580 1002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 2254 1592 gene locus_tag LOCUS_14440 2254 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14440 2860 2255 gene locus_tag LOCUS_14450 2860 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14450 >Feature sequence154 620 2782 gene locus_tag LOCUS_14460 620 2782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14460 >Feature sequence155 <1 729 gene locus_tag LOCUS_14470 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010964702.1:phosphoribosylformylglycinamidine cyclo-ligase 722 1372 gene locus_tag LOCUS_14480 gene purN 722 1372 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065739.1 protein_id gnl|my_center|LOCUS_14480 1374 2798 gene locus_tag LOCUS_14490 gene gatB 1374 2798 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545415.1 protein_id gnl|my_center|LOCUS_14490 >Feature sequence156 977 36 gene locus_tag LOCUS_14500 977 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14500 1490 1005 gene locus_tag LOCUS_14510 1490 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence157 506 898 gene locus_tag LOCUS_14520 506 898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14520 1369 905 gene locus_tag LOCUS_14530 1369 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14530 2849 1500 gene locus_tag LOCUS_14540 2849 1500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence158 2306 1089 gene locus_tag LOCUS_14550 2306 1089 CDS product fibronectin type III domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891920.1 protein_id gnl|my_center|LOCUS_14550 <3197 2308 gene locus_tag LOCUS_14560 <3197 2308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012584158.1:RluA family pseudouridine synthase >Feature sequence159 95 1087 gene locus_tag LOCUS_14570 95 1087 CDS product DUF814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583848.1 protein_id gnl|my_center|LOCUS_14570 1080 2144 gene locus_tag LOCUS_14580 gene prfA 1080 2144 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421389.1 protein_id gnl|my_center|LOCUS_14580 >Feature sequence160 670 2730 gene locus_tag LOCUS_14590 670 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14590 >Feature sequence161 1445 453 gene locus_tag LOCUS_14600 1445 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 2225 1470 gene locus_tag LOCUS_14610 2225 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14610 >Feature sequence162 1251 157 gene locus_tag LOCUS_14620 1251 157 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_14620 2960 1263 gene locus_tag LOCUS_14630 gene pilB 2960 1263 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942137.1 protein_id gnl|my_center|LOCUS_14630 >Feature sequence163 1523 162 gene locus_tag LOCUS_14640 1523 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <3070 1517 gene locus_tag LOCUS_14650 <3070 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266827.1:TonB-dependent receptor >Feature sequence164 1746 979 gene locus_tag LOCUS_14660 1746 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14660 1859 2722 gene locus_tag LOCUS_14670 1859 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence165 589 41 gene locus_tag LOCUS_14680 589 41 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 1261 713 gene locus_tag LOCUS_14690 1261 713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 1511 1714 gene locus_tag LOCUS_14700 1511 1714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14700 1967 2293 gene locus_tag LOCUS_14710 1967 2293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14710 >Feature sequence166 >Feature sequence167 487 2109 gene locus_tag LOCUS_14720 gene hcp 487 2109 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272545.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence168 2132 1641 gene locus_tag LOCUS_14730 2132 1641 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545311.1 protein_id gnl|my_center|LOCUS_14730 <2837 2119 gene locus_tag LOCUS_14740 <2837 2119 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880065.1:imidazole glycerol phosphate synthase subunit HisF >Feature sequence169 254 1522 gene locus_tag LOCUS_14750 254 1522 CDS product hemolysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017189.1 protein_id gnl|my_center|LOCUS_14750 1515 2171 gene locus_tag LOCUS_14760 gene rpe 1515 2171 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000589966.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence170 <1 2739 gene locus_tag LOCUS_14770 <1 2739 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005458266.1:NAD-glutamate dehydrogenase >Feature sequence171 <2780 25 gene locus_tag LOCUS_14780 <2780 25 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_143960588.1:methylmalonyl-CoA mutase family protein >Feature sequence172 >Feature sequence173 852 445 gene locus_tag LOCUS_14790 852 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 1379 852 gene locus_tag LOCUS_14800 1379 852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 <2746 1698 gene locus_tag LOCUS_14810 <2746 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544913.1:AAA family ATPase >Feature sequence174 1514 534 gene locus_tag LOCUS_14820 1514 534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14820 1913 1527 gene locus_tag LOCUS_14830 1913 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 2633 1926 gene locus_tag LOCUS_14840 2633 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 >Feature sequence175 573 487 gene locus_tag LOCUS_t00370 573 487 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 670 2439 gene locus_tag LOCUS_14850 670 2439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 2609 2533 gene locus_tag LOCUS_t00380 2609 2533 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence176 <1 515 gene locus_tag LOCUS_14860 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767804.1:dTDP-4-dehydrorhamnose reductase 512 715 gene locus_tag LOCUS_14870 512 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 832 1854 gene locus_tag LOCUS_14880 gene rfbB 832 1854 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143225.1 protein_id gnl|my_center|LOCUS_14880 >Feature sequence177 1174 254 gene locus_tag LOCUS_14890 1174 254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14890 1967 1236 gene locus_tag LOCUS_14900 1967 1236 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546731.1 protein_id gnl|my_center|LOCUS_14900 2460 1930 gene locus_tag LOCUS_14910 2460 1930 CDS product cytochrome P460 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966385.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence178 1180 413 gene locus_tag LOCUS_14920 1180 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14920 1308 1069 gene locus_tag LOCUS_14930 1308 1069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 1401 1577 gene locus_tag LOCUS_14940 1401 1577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 1649 1804 gene locus_tag LOCUS_14950 1649 1804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1809 2468 gene locus_tag LOCUS_14960 1809 2468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence179 2633 1020 gene locus_tag LOCUS_14970 gene tkt 2633 1020 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_14970 >Feature sequence180 1609 518 gene locus_tag LOCUS_14980 gene mraY 1609 518 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073903.1 protein_id gnl|my_center|LOCUS_14980 <2656 1609 gene locus_tag LOCUS_14990 <2656 1609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545266.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence181 1807 320 gene locus_tag LOCUS_15000 1807 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 2078 2455 gene locus_tag LOCUS_15010 2078 2455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15010 >Feature sequence182 753 163 gene locus_tag LOCUS_15020 753 163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15020 237 246 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1499 786 gene locus_tag LOCUS_15030 1499 786 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478264.1 protein_id gnl|my_center|LOCUS_15030 1630 2010 gene locus_tag LOCUS_15040 1630 2010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 <2651 2044 gene locus_tag LOCUS_15050 <2651 2044 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005803605.1:adenosylcobinamide-phosphate synthase CbiB >Feature sequence183 2 233 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tatttttaccctacctatgaggcattgaaac 649 724 gene locus_tag LOCUS_t00390 649 724 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1792 1481 gene locus_tag LOCUS_15060 1792 1481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 2394 1711 gene locus_tag LOCUS_15070 2394 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 2531 2391 gene locus_tag LOCUS_15080 2531 2391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15080 >Feature sequence184 800 2215 gene locus_tag LOCUS_15090 gene glnA 800 2215 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942479.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence185 583 83 gene locus_tag LOCUS_15100 583 83 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15100 1025 576 gene locus_tag LOCUS_15110 1025 576 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865738.1 protein_id gnl|my_center|LOCUS_15110 1317 1018 gene locus_tag LOCUS_15120 1317 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15120 1594 1358 gene locus_tag LOCUS_15130 1594 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15130 1787 1578 gene locus_tag LOCUS_15140 1787 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 2352 2110 gene locus_tag LOCUS_15150 2352 2110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 >Feature sequence186 616 1155 gene locus_tag LOCUS_15160 616 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15160 1255 2586 gene locus_tag LOCUS_15170 1255 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence187 >Feature sequence188 >Feature sequence189 214 1083 gene locus_tag LOCUS_15180 214 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1080 2054 gene locus_tag LOCUS_15190 1080 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15190 >Feature sequence190 247 693 gene locus_tag LOCUS_15200 247 693 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545573.1 protein_id gnl|my_center|LOCUS_15200 705 1106 gene locus_tag LOCUS_15210 gene mce 705 1106 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943915.1 protein_id gnl|my_center|LOCUS_15210 1110 2462 gene locus_tag LOCUS_15220 1110 2462 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259421.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence191 >Feature sequence192 1870 440 gene locus_tag LOCUS_15230 1870 440 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010001.1 protein_id gnl|my_center|LOCUS_15230 <2526 2016 gene locus_tag LOCUS_15240 <2526 2016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000885496.1:flagellin A >Feature sequence193 369 692 gene locus_tag LOCUS_15250 gene secG 369 692 CDS product preprotein translocase subunit SecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546661.1 protein_id gnl|my_center|LOCUS_15250 770 2227 gene locus_tag LOCUS_15260 770 2227 CDS product peptide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545811.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence194 975 760 gene locus_tag LOCUS_15270 975 760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 2465 1437 gene locus_tag LOCUS_15280 2465 1437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15280 >Feature sequence195 2419 1028 gene locus_tag LOCUS_15290 2419 1028 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001972951.1 protein_id gnl|my_center|LOCUS_15290 >Feature sequence196 93 1286 gene locus_tag LOCUS_15300 93 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 1280 2338 gene locus_tag LOCUS_15310 1280 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 >Feature sequence197 1935 1105 gene locus_tag LOCUS_15320 1935 1105 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_15320 <2443 1919 gene locus_tag LOCUS_15330 <2443 1919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941312.1:carbon-nitrogen hydrolase >Feature sequence198 209 284 gene locus_tag LOCUS_t00400 209 284 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 428 1858 gene locus_tag LOCUS_15340 428 1858 CDS product flagellin B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000010001.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence199 2113 38 gene locus_tag LOCUS_15350 gene fusA 2113 38 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943489.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence200 46 122 gene locus_tag LOCUS_t00410 46 122 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 302 1603 gene locus_tag LOCUS_15360 302 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15360 1791 1973 gene locus_tag LOCUS_15370 1791 1973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence201 >Feature sequence202 696 1313 gene locus_tag LOCUS_15380 696 1313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 1315 1812 gene locus_tag LOCUS_15390 1315 1812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 1809 1994 gene locus_tag LOCUS_15400 1809 1994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15400 >Feature sequence203 <1 1014 gene locus_tag LOCUS_15410 <1 1014 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582664.1:HD domain-containing protein 1983 1003 gene locus_tag LOCUS_15420 1983 1003 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938297.1 protein_id gnl|my_center|LOCUS_15420 >Feature sequence204 1646 168 gene locus_tag LOCUS_15430 1646 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2179 1736 gene locus_tag LOCUS_15440 2179 1736 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880607.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence205 1142 789 gene locus_tag LOCUS_15450 gene rbfA 1142 789 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545236.1 protein_id gnl|my_center|LOCUS_15450 1420 1139 gene locus_tag LOCUS_15460 1420 1139 CDS product DUF503 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964058.1 protein_id gnl|my_center|LOCUS_15460 <2306 1417 gene locus_tag LOCUS_15470 <2306 1417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071541506.1:translation initiation factor IF-2 >Feature sequence206 >Feature sequence207 <1 732 gene locus_tag LOCUS_15480 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545085.1:tyrosine recombinase XerC 729 1202 gene locus_tag LOCUS_15490 729 1202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 1199 1702 gene locus_tag LOCUS_15500 1199 1702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15500 >Feature sequence208 <1 645 gene locus_tag LOCUS_15510 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010951387.1:DNA ligase 665 1087 gene locus_tag LOCUS_15520 665 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15520 1174 1614 gene locus_tag LOCUS_15530 1174 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15530 1616 2164 gene locus_tag LOCUS_15540 1616 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence209 >Feature sequence210 1054 2055 gene locus_tag LOCUS_15550 1054 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15550 >Feature sequence211 <2232 731 gene locus_tag LOCUS_15560 <2232 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058064.1:type I restriction endonuclease subunit R >Feature sequence212 3 398 gene locus_tag LOCUS_15570 3 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15570 402 770 gene locus_tag LOCUS_15580 402 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 771 1829 gene locus_tag LOCUS_15590 771 1829 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003130134.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence213 1954 641 gene locus_tag LOCUS_15600 1954 641 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880977.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence214 <2216 333 gene locus_tag LOCUS_15610 <2216 333 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_197530011.1:NB-ARC domain-containing protein >Feature sequence215 1075 806 gene locus_tag LOCUS_15620 1075 806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2034 1075 gene locus_tag LOCUS_15630 2034 1075 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081655.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence216 >Feature sequence217 900 1924 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccccttagaatcgggtcagatggtaat >Feature sequence218 >Feature sequence219 >Feature sequence220 968 309 gene locus_tag LOCUS_15640 968 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 2107 986 gene locus_tag LOCUS_15650 2107 986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15650 >Feature sequence221 253 1650 gene locus_tag LOCUS_15660 253 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence222 883 560 gene locus_tag LOCUS_15670 883 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 1831 905 gene locus_tag LOCUS_15680 1831 905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence223 1565 36 gene locus_tag LOCUS_15690 1565 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence224 <1 1884 gene locus_tag LOCUS_15700 <1 1884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence225 20 1153 gene locus_tag LOCUS_15710 20 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1888 1154 gene locus_tag LOCUS_15720 1888 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15720 >Feature sequence226 <1 1461 gene locus_tag LOCUS_15730 <1 1461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878912.1:chloride channel protein >Feature sequence227 268 486 gene locus_tag LOCUS_15740 268 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 487 783 gene locus_tag LOCUS_15750 487 783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 1196 789 gene locus_tag LOCUS_15760 1196 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 <2092 1200 gene locus_tag LOCUS_15770 <2092 1200 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545510.1:AarF/ABC1/UbiB kinase family protein 1589 1598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence228 283 1824 gene locus_tag LOCUS_15780 283 1824 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107814.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence229 235 1923 gene locus_tag LOCUS_15790 235 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 >Feature sequence230 >Feature sequence231 1547 360 gene locus_tag LOCUS_15800 1547 360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 >Feature sequence232 >Feature sequence233 <1 846 gene locus_tag LOCUS_15810 <1 846 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858028.1:UDP-N-acetylglucosamine 4,6-dehydratase (inverting) 848 1975 gene locus_tag LOCUS_15820 gene pseC 848 1975 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_15820 >Feature sequence234 124 1254 gene locus_tag LOCUS_15830 124 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15830 >Feature sequence235 113 1117 gene locus_tag LOCUS_15840 113 1117 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080232.1 protein_id gnl|my_center|LOCUS_15840 1122 2003 gene locus_tag LOCUS_15850 1122 2003 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865273.1 protein_id gnl|my_center|LOCUS_15850 >Feature sequence236 64 288 gene locus_tag LOCUS_15860 64 288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 316 933 gene locus_tag LOCUS_15870 316 933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15870 >Feature sequence237 790 359 gene locus_tag LOCUS_15880 gene flgB 790 359 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347783.1 protein_id gnl|my_center|LOCUS_15880 1018 1368 gene locus_tag LOCUS_15890 1018 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15890 1522 1962 gene locus_tag LOCUS_15900 1522 1962 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002799196.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence238 361 516 gene locus_tag LOCUS_15910 361 516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15910 620 1816 gene locus_tag LOCUS_15920 620 1816 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_15920 >Feature sequence239 >Feature sequence240 <1 515 gene locus_tag LOCUS_15930 <1 515 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869878.1:alanine dehydrogenase 512 1426 gene locus_tag LOCUS_15940 gene miaA 512 1426 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081395.1 protein_id gnl|my_center|LOCUS_15940 <2003 1397 gene locus_tag LOCUS_15950 <2003 1397 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545548.1:zinc metalloprotease HtpX >Feature sequence241 513 61 gene locus_tag LOCUS_15960 513 61 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 1715 498 gene locus_tag LOCUS_15970 1715 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15970 >Feature sequence242 <1 1419 gene locus_tag LOCUS_15980 <1 1419 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941696.1:methyl-accepting chemotaxis protein >Feature sequence243 1256 492 gene locus_tag LOCUS_15990 1256 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 1711 1538 gene locus_tag LOCUS_16000 1711 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16000 >Feature sequence244 436 308 gene locus_tag LOCUS_16010 436 308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 585 791 gene locus_tag LOCUS_16020 585 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 1851 814 gene locus_tag LOCUS_16030 gene tdt 1851 814 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870080.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence245 665 81 gene locus_tag LOCUS_16040 665 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 1549 662 gene locus_tag LOCUS_16050 1549 662 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947761.1 protein_id gnl|my_center|LOCUS_16050 >Feature sequence246 181 1095 gene locus_tag LOCUS_16060 181 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16060 1085 1780 gene locus_tag LOCUS_16070 1085 1780 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858643.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence247 1246 770 gene locus_tag LOCUS_16080 1246 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459071.1 protein_id gnl|my_center|LOCUS_16080 1764 1261 gene locus_tag LOCUS_16090 1764 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16090 >Feature sequence248 >Feature sequence249 883 1707 gene locus_tag LOCUS_16100 883 1707 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941117.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence250 1278 817 gene locus_tag LOCUS_16110 1278 817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 1687 1265 gene locus_tag LOCUS_16120 1687 1265 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002799196.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence251 251 87 gene locus_tag LOCUS_16130 251 87 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 1247 315 gene locus_tag LOCUS_16140 1247 315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 <1937 1259 gene locus_tag LOCUS_16150 <1937 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868347.1:mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase >Feature sequence252 221 829 gene locus_tag LOCUS_16160 221 829 CDS product glycosyl hydrolase 108 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206231.1 protein_id gnl|my_center|LOCUS_16160 1150 776 gene locus_tag LOCUS_16170 1150 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16170 1596 1147 gene locus_tag LOCUS_16180 1596 1147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16180 1708 1562 gene locus_tag LOCUS_16190 1708 1562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16190 >Feature sequence253 918 1 gene locus_tag LOCUS_16200 gene cmoB 918 1 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_16200 1535 921 gene locus_tag LOCUS_16210 1535 921 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010921960.1 protein_id gnl|my_center|LOCUS_16210 1846 1532 gene locus_tag LOCUS_16220 1846 1532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16220 >Feature sequence254 1547 540 gene locus_tag LOCUS_16230 1547 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16230 1648 1657 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence255 >Feature sequence256 530 1087 gene locus_tag LOCUS_16240 530 1087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16240 1557 1159 gene locus_tag LOCUS_16250 1557 1159 CDS product DUF1232 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943067.1 protein_id gnl|my_center|LOCUS_16250 1647 1572 gene locus_tag LOCUS_t00420 1647 1572 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence257 395 165 gene locus_tag LOCUS_16260 395 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 563 438 gene locus_tag LOCUS_16270 563 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 1542 595 gene locus_tag LOCUS_16280 1542 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16280 >Feature sequence258 1842 805 gene locus_tag LOCUS_16290 1842 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence259 162 1739 gene locus_tag LOCUS_16300 162 1739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16300 >Feature sequence260 305 90 gene locus_tag LOCUS_16310 305 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 1345 302 gene locus_tag LOCUS_16320 1345 302 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168631.1 protein_id gnl|my_center|LOCUS_16320 >Feature sequence261 >Feature sequence262 498 1385 gene locus_tag LOCUS_16330 498 1385 CDS product HAMP domain-containing histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545967.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence263 1788 1384 gene locus_tag LOCUS_16340 1788 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence264 <1843 816 gene locus_tag LOCUS_16350 <1843 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546793.1:2-isopropylmalate synthase >Feature sequence265 682 284 gene locus_tag LOCUS_16360 682 284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16360 <1841 699 gene locus_tag LOCUS_16370 <1841 699 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943664.1:flagellar filament capping protein FliD >Feature sequence266 >Feature sequence267 246 995 gene locus_tag LOCUS_16380 246 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16380 >Feature sequence268 1259 213 gene locus_tag LOCUS_16390 1259 213 CDS product PDDEXK nuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766357.1 protein_id gnl|my_center|LOCUS_16390 >Feature sequence269 143 1330 gene locus_tag LOCUS_16400 143 1330 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048260.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence270 1345 239 gene locus_tag LOCUS_16410 1345 239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16410 >Feature sequence271 >Feature sequence272 1289 471 gene locus_tag LOCUS_16420 1289 471 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583782.1 protein_id gnl|my_center|LOCUS_16420 <1815 1302 gene locus_tag LOCUS_16430 <1815 1302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703958.1:TonB-dependent vitamin B12 receptor BtuB >Feature sequence273 446 1489 gene locus_tag LOCUS_16440 gene pilM 446 1489 CDS product type IV pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942675.1 protein_id gnl|my_center|LOCUS_16440 >Feature sequence274 >Feature sequence275 378 821 gene locus_tag LOCUS_16450 gene mraZ 378 821 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003723756.1 protein_id gnl|my_center|LOCUS_16450 821 1711 gene locus_tag LOCUS_16460 gene rsmH 821 1711 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881225.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence276 1272 871 gene locus_tag LOCUS_16470 1272 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16470 1553 1305 gene locus_tag LOCUS_16480 1553 1305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16480 >Feature sequence277 1123 383 gene locus_tag LOCUS_16490 1123 383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16490 <1764 1185 gene locus_tag LOCUS_16500 <1764 1185 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880414.1:efflux RND transporter permease subunit >Feature sequence278 >Feature sequence279 >Feature sequence280 <1761 649 gene locus_tag LOCUS_16510 <1761 649 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545418.1:glutamate--tRNA ligase >Feature sequence281 340 546 gene locus_tag LOCUS_16520 340 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence282 364 1722 gene locus_tag LOCUS_16530 364 1722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 >Feature sequence283 205 375 gene locus_tag LOCUS_16540 205 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 515 1705 gene locus_tag LOCUS_16550 gene mltB 515 1705 CDS product lytic murein transglycosylase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705439.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence284 70 147 gene locus_tag LOCUS_t00430 70 147 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 147 437 gene locus_tag LOCUS_16560 147 437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 518 1276 gene locus_tag LOCUS_16570 gene bamD 518 1276 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963942.1 protein_id gnl|my_center|LOCUS_16570 1260 1595 gene locus_tag LOCUS_16580 1260 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 >Feature sequence285 >Feature sequence286 389 874 gene locus_tag LOCUS_16590 389 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16590 877 1131 gene locus_tag LOCUS_16600 877 1131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16600 >Feature sequence287 267 1670 gene locus_tag LOCUS_16610 267 1670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16610 >Feature sequence288 >Feature sequence289 1526 501 gene locus_tag LOCUS_16620 gene pheS 1526 501 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546774.1 protein_id gnl|my_center|LOCUS_16620 >Feature sequence290 >Feature sequence291 1385 105 gene locus_tag LOCUS_16630 1385 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16630 >Feature sequence292 >Feature sequence293 593 1476 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttaataataactactatagttttggaac >Feature sequence294 110 934 gene locus_tag LOCUS_16640 gene rplB 110 934 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869925.1 protein_id gnl|my_center|LOCUS_16640 947 1228 gene locus_tag LOCUS_16650 gene rpsS 947 1228 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545511.1 protein_id gnl|my_center|LOCUS_16650 1241 1567 gene locus_tag LOCUS_16660 gene rplV 1241 1567 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005383164.1 protein_id gnl|my_center|LOCUS_16660 >Feature sequence295 <1 573 gene locus_tag LOCUS_16670 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114575.1:type 4a pilus secretin PilQ 584 754 gene locus_tag LOCUS_16680 584 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16680 >Feature sequence296 1488 559 gene locus_tag LOCUS_16690 1488 559 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002889661.1 protein_id gnl|my_center|LOCUS_16690 >Feature sequence297 328 170 gene locus_tag LOCUS_16700 328 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 1325 300 gene locus_tag LOCUS_16710 gene pseI 1325 300 CDS product pseudaminic acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987011.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence298 <1 1548 gene locus_tag LOCUS_16720 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583490.1:PBP1A family penicillin-binding protein >Feature sequence299 982 449 gene locus_tag LOCUS_16730 982 449 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124030.1 protein_id gnl|my_center|LOCUS_16730 1625 993 gene locus_tag LOCUS_16740 1625 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16740 >Feature sequence300 >Feature sequence301 <1647 154 gene locus_tag LOCUS_16750 <1647 154 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943874.1:excinuclease ABC subunit UvrB >Feature sequence302 1499 780 gene locus_tag LOCUS_16760 gene sdhB 1499 780 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878185.1 protein_id gnl|my_center|LOCUS_16760 >Feature sequence303 <1 695 gene locus_tag LOCUS_16770 <1 695 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000939580.1:flippase 695 1621 gene locus_tag LOCUS_16780 695 1621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203008.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence304 373 98 gene locus_tag LOCUS_16790 373 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 734 462 gene locus_tag LOCUS_16800 734 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16800 >Feature sequence305 403 140 gene locus_tag LOCUS_16810 403 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16810 860 414 gene locus_tag LOCUS_16820 860 414 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482414.1 protein_id gnl|my_center|LOCUS_16820 1178 1005 gene locus_tag LOCUS_16830 1178 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 >Feature sequence306 >Feature sequence307 >Feature sequence308 >Feature sequence309 831 52 gene locus_tag LOCUS_16840 831 52 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545324.1 protein_id gnl|my_center|LOCUS_16840 <1614 828 gene locus_tag LOCUS_16850 <1614 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853049.1:branched-chain amino acid ABC transporter permease >Feature sequence310 310 14 gene locus_tag LOCUS_16860 310 14 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16860 504 1256 gene locus_tag LOCUS_16870 504 1256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16870 >Feature sequence311 80 1588 gene locus_tag LOCUS_16880 80 1588 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence312 733 395 gene locus_tag LOCUS_16890 733 395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16890 1035 730 gene locus_tag LOCUS_16900 1035 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16900 >Feature sequence313 989 159 gene locus_tag LOCUS_16910 989 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16910 <1589 990 gene locus_tag LOCUS_16920 <1589 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941245.1:methyl-accepting chemotaxis protein >Feature sequence314 >Feature sequence315 877 500 gene locus_tag LOCUS_16930 877 500 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962274.1 protein_id gnl|my_center|LOCUS_16930 <1585 927 gene locus_tag LOCUS_16940 <1585 927 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107280.1:glucose-1-phosphate thymidylyltransferase RfbA >Feature sequence316 15 896 gene locus_tag LOCUS_16950 15 896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16950 >Feature sequence317 >Feature sequence318 198 515 gene locus_tag LOCUS_16960 198 515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16960 512 1063 gene locus_tag LOCUS_16970 gene dcd 512 1063 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546770.1 protein_id gnl|my_center|LOCUS_16970 >Feature sequence319 367 1494 gene locus_tag LOCUS_16980 gene pseC 367 1494 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097863.1 protein_id gnl|my_center|LOCUS_16980 >Feature sequence320 1313 369 gene locus_tag LOCUS_16990 1313 369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16990 >Feature sequence321 <1 638 gene locus_tag LOCUS_17000 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545204.1:30S ribosomal protein S3 657 1079 gene locus_tag LOCUS_17010 gene rplP 657 1079 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779441.1 protein_id gnl|my_center|LOCUS_17010 1076 1273 gene locus_tag LOCUS_17020 1076 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17020 1276 1539 gene locus_tag LOCUS_17030 gene rpsQ 1276 1539 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459100.1 protein_id gnl|my_center|LOCUS_17030 >Feature sequence322 21 638 gene locus_tag LOCUS_17040 21 638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17040 631 942 gene locus_tag LOCUS_17050 631 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 1079 1243 gene locus_tag LOCUS_17060 1079 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17060 1233 1451 gene locus_tag LOCUS_17070 1233 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17070 >Feature sequence323 <1 720 gene locus_tag LOCUS_17080 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546313.1:histidinol dehydrogenase 698 1165 gene locus_tag LOCUS_17090 698 1165 CDS product N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942702.1 protein_id gnl|my_center|LOCUS_17090 >Feature sequence324 354 139 gene locus_tag LOCUS_17100 354 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17100 384 1313 gene locus_tag LOCUS_17110 384 1313 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037718.1 protein_id gnl|my_center|LOCUS_17110 >Feature sequence325 >Feature sequence326 <1 702 gene locus_tag LOCUS_17120 <1 702 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143462.1:ABC transporter permease 704 970 gene locus_tag LOCUS_17130 704 970 CDS product phosphopantetheine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940916.1 protein_id gnl|my_center|LOCUS_17130 >Feature sequence327 <1521 917 gene locus_tag LOCUS_17140 <1521 917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398928.1:dephospho-CoA kinase >Feature sequence328 >Feature sequence329 >Feature sequence330 >Feature sequence331 <1 656 gene locus_tag LOCUS_17150 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011260949.1:class I SAM-dependent methyltransferase 736 864 gene locus_tag LOCUS_17160 736 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17160 <1504 895 gene locus_tag LOCUS_17170 <1504 895 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891889.1:enoyl-ACP reductase >Feature sequence332 1082 102 gene locus_tag LOCUS_17180 1082 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17180 1481 1095 gene locus_tag LOCUS_17190 1481 1095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17190 >Feature sequence333 1198 98 gene locus_tag LOCUS_17200 1198 98 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17200 >Feature sequence334 >Feature sequence335 >Feature sequence336 1405 221 gene locus_tag LOCUS_17210 1405 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17210 >Feature sequence337 >Feature sequence338 83 1258 gene locus_tag LOCUS_17220 83 1258 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_116269310.1 protein_id gnl|my_center|LOCUS_17220 >Feature sequence339 >Feature sequence340 <1 920 gene locus_tag LOCUS_17230 <1 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546042.1:DNA-directed RNA polymerase subunit alpha 910 1278 gene locus_tag LOCUS_17240 gene rplQ 910 1278 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385298.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence341 >Feature sequence342 >Feature sequence343 >Feature sequence344 >Feature sequence345 >Feature sequence346 37 122 gene locus_tag LOCUS_t00440 37 122 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence347 606 1271 gene locus_tag LOCUS_17250 606 1271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 >Feature sequence348 >Feature sequence349 1425 175 gene locus_tag LOCUS_17260 gene porA 1425 175 CDS product group 1 major outer membrane porin protein PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891919.1 protein_id gnl|my_center|LOCUS_17260 >Feature sequence350 >Feature sequence351 299 979 gene locus_tag LOCUS_17270 299 979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17270 >Feature sequence352 >Feature sequence353 <1412 766 gene locus_tag LOCUS_17280 <1412 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933543.1:patatin-like phospholipase family protein >Feature sequence354 728 372 gene locus_tag LOCUS_17290 728 372 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17290 >Feature sequence355 840 148 gene locus_tag LOCUS_17300 840 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17300 >Feature sequence356 >Feature sequence357 263 562 gene locus_tag LOCUS_17310 263 562 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064812.1 protein_id gnl|my_center|LOCUS_17310 555 896 gene locus_tag LOCUS_17320 555 896 CDS product DUF86 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809264.1 protein_id gnl|my_center|LOCUS_17320 922 1119 gene locus_tag LOCUS_17330 922 1119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_17330 >Feature sequence358 507 731 gene locus_tag LOCUS_17340 507 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 1379 1295 gene locus_tag LOCUS_t00450 1379 1295 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence359 >Feature sequence360 >Feature sequence361 819 1037 gene locus_tag LOCUS_17350 819 1037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 >Feature sequence362 >Feature sequence363 >Feature sequence364 1237 176 gene locus_tag LOCUS_17360 1237 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17360 >Feature sequence365 750 487 gene locus_tag LOCUS_17370 750 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 1294 767 gene locus_tag LOCUS_17380 1294 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17380 >Feature sequence366 750 487 gene locus_tag LOCUS_17390 750 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1294 767 gene locus_tag LOCUS_17400 1294 767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence367 <1350 304 gene locus_tag LOCUS_17410 <1350 304 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880302.1:glycosyltransferase >Feature sequence368 65 208 gene locus_tag LOCUS_17420 65 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 334 456 gene locus_tag LOCUS_17430 334 456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17430 1276 494 gene locus_tag LOCUS_17440 1276 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17440 >Feature sequence369 <1346 826 gene locus_tag LOCUS_17450 <1346 826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_142585345.1:SpoIIE family protein phosphatase >Feature sequence370 <1 509 gene locus_tag LOCUS_17460 <1 509 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181409382.1:amino acid ABC transporter ATP-binding protein >Feature sequence371 <1 1118 gene locus_tag LOCUS_17470 <1 1118 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041272513.1:flagellin >Feature sequence372 786 577 gene locus_tag LOCUS_17480 786 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17480 1226 786 gene locus_tag LOCUS_17490 1226 786 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013196.1 protein_id gnl|my_center|LOCUS_17490 >Feature sequence373 17 445 gene locus_tag LOCUS_17500 gene nuoB 17 445 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389176.1 protein_id gnl|my_center|LOCUS_17500 442 945 gene locus_tag LOCUS_17510 442 945 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939564.1 protein_id gnl|my_center|LOCUS_17510 >Feature sequence374 880 35 gene locus_tag LOCUS_17520 gene nfo 880 35 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932008.1 protein_id gnl|my_center|LOCUS_17520 >Feature sequence375 >Feature sequence376 332 484 gene locus_tag LOCUS_17530 332 484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17530 >Feature sequence377 >Feature sequence378 841 221 gene locus_tag LOCUS_17540 841 221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17540 >Feature sequence379 994 131 gene locus_tag LOCUS_17550 994 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17550 1129 1299 gene locus_tag LOCUS_17560 1129 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17560 >Feature sequence380 <1302 285 gene locus_tag LOCUS_17570 <1302 285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011144339.1:NB-ARC domain-containing protein >Feature sequence381 >Feature sequence382 979 62 gene locus_tag LOCUS_17580 979 62 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881122.1 protein_id gnl|my_center|LOCUS_17580 >Feature sequence383 384 992 gene locus_tag LOCUS_17590 384 992 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_17590 986 1150 gene locus_tag LOCUS_17600 986 1150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17600 1136 1145 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence384 40 426 gene locus_tag LOCUS_17610 40 426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17610 >Feature sequence385 157 1083 gene locus_tag LOCUS_17620 157 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17620 1043 1052 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence386 1104 361 gene locus_tag LOCUS_17630 1104 361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17630 >Feature sequence387 945 1274 gene locus_tag LOCUS_17640 945 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17640 >Feature sequence388 1213 95 gene locus_tag LOCUS_17650 1213 95 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17650 >Feature sequence389 <1277 220 gene locus_tag LOCUS_17660 <1277 220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080946.1:flagellin >Feature sequence390 20 1237 gene locus_tag LOCUS_17670 20 1237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17670 >Feature sequence391 278 1138 gene locus_tag LOCUS_17680 278 1138 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021255.1 protein_id gnl|my_center|LOCUS_17680 >Feature sequence392 >Feature sequence393 >Feature sequence394 229 678 gene locus_tag LOCUS_17690 229 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17690 924 1124 gene locus_tag LOCUS_17700 924 1124 CDS product type II toxin-antitoxin system HicB family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065315.1 protein_id gnl|my_center|LOCUS_17700 >Feature sequence395 <1 606 gene locus_tag LOCUS_17710 <1 606 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073342.1:sugar MFS transporter >Feature sequence396 >Feature sequence397 1156 8 gene locus_tag LOCUS_17720 1156 8 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17720 >Feature sequence398 >Feature sequence399 567 115 gene locus_tag LOCUS_17730 567 115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17730 >Feature sequence400 <1228 516 gene locus_tag LOCUS_17740 <1228 516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937649.1:NAD(P)-dependent oxidoreductase >Feature sequence401 >Feature sequence402 3 131 gene locus_tag LOCUS_17750 3 131 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17750 131 1162 gene locus_tag LOCUS_17760 131 1162 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546519.1 protein_id gnl|my_center|LOCUS_17760 >Feature sequence403 >Feature sequence404 >Feature sequence405 >Feature sequence406 395 1093 gene locus_tag LOCUS_17770 395 1093 CDS product TnsA endonuclease N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223862839.1 protein_id gnl|my_center|LOCUS_17770 >Feature sequence407 >Feature sequence408 1029 277 gene locus_tag LOCUS_17780 1029 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17780 >Feature sequence409 449 1054 gene locus_tag LOCUS_17790 449 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17790 >Feature sequence410 >Feature sequence411 602 748 gene locus_tag LOCUS_17800 602 748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17800 >Feature sequence412 165 10 gene locus_tag LOCUS_17810 165 10 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17810 589 155 gene locus_tag LOCUS_17820 589 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17820 917 564 gene locus_tag LOCUS_17830 917 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17830 >Feature sequence413 <1 809 gene locus_tag LOCUS_17840 <1 809 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864265.1:N,N'-diacetyllegionaminate synthase >Feature sequence414 167 709 gene locus_tag LOCUS_17850 167 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17850 700 954 gene locus_tag LOCUS_17860 700 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17860 >Feature sequence415 >Feature sequence416 <1 742 gene locus_tag LOCUS_17870 <1 742 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113972.1:glycerol-3-phosphate dehydrogenase/oxidase >Feature sequence417 >Feature sequence418 <1 636 gene locus_tag LOCUS_17880 <1 636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795347.1:nucleotide sugar dehydrogenase 589 598 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence419 >Feature sequence420 607 122 gene locus_tag LOCUS_17890 607 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17890 >Feature sequence421 1187 966 gene locus_tag LOCUS_17900 1187 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17900 >Feature sequence422 829 110 gene locus_tag LOCUS_17910 829 110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17910 >Feature sequence423 891 160 gene locus_tag LOCUS_17920 891 160 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003809590.1 protein_id gnl|my_center|LOCUS_17920 >Feature sequence424 >Feature sequence425 <1 691 gene locus_tag LOCUS_17930 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880405.1:F0F1 ATP synthase subunit alpha >Feature sequence426 >Feature sequence427 <1 937 gene locus_tag LOCUS_17940 <1 937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546067.1:porphobilinogen synthase >Feature sequence428 >Feature sequence429 >Feature sequence430 >Feature sequence431 >Feature sequence432 >Feature sequence433 204 46 gene locus_tag LOCUS_17950 204 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17950 <1154 451 gene locus_tag LOCUS_17960 <1154 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202675.1:DEAD/DEAH box helicase family protein >Feature sequence434 165 860 gene locus_tag LOCUS_17970 165 860 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011102938.1 protein_id gnl|my_center|LOCUS_17970 >Feature sequence435 <1 589 gene locus_tag LOCUS_17980 <1 589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545040.1:lysylphosphatidylglycerol synthase transmembrane domain-containing protein >Feature sequence436 >Feature sequence437 >Feature sequence438 >Feature sequence439 266 644 gene locus_tag LOCUS_tm00020 266 644 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 727 1110 gene locus_tag LOCUS_17990 727 1110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17990 >Feature sequence440 <1 824 gene locus_tag LOCUS_18000 <1 824 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880495.1:enoyl-CoA hydratase-related protein >Feature sequence441 1141 734 gene locus_tag LOCUS_18010 1141 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18010 >Feature sequence442 <1140 308 gene locus_tag LOCUS_18020 <1140 308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_066867760.1:UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase >Feature sequence443 <1138 94 gene locus_tag LOCUS_18030 <1138 94 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202419.1:LegC family aminotransferase >Feature sequence444 >Feature sequence445 >Feature sequence446 752 375 gene locus_tag LOCUS_18040 752 375 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18040 >Feature sequence447 >Feature sequence448 >Feature sequence449 >Feature sequence450 >Feature sequence451 101 1099 gene locus_tag LOCUS_18050 gene murG 101 1099 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_18050 >Feature sequence452 <1 973 gene locus_tag LOCUS_18060 <1 973 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_071542453.1:glutamate-5-semialdehyde dehydrogenase >Feature sequence453 742 428 gene locus_tag LOCUS_18070 742 428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18070 1105 812 gene locus_tag LOCUS_18080 1105 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18080 >Feature sequence454 >Feature sequence455 >Feature sequence456 <1 817 gene locus_tag LOCUS_18090 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852530.1:bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU >Feature sequence457 <1098 78 gene locus_tag LOCUS_18100 <1098 78 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704393.1:response regulator >Feature sequence458 >Feature sequence459 134 787 gene locus_tag LOCUS_18110 134 787 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 protein_id gnl|my_center|LOCUS_18110 >Feature sequence460 <1 1061 gene locus_tag LOCUS_18120 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000708487.1:fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca >Feature sequence461 >Feature sequence462 <1080 394 gene locus_tag LOCUS_18130 <1080 394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004804477.1:KilA-N domain-containing protein >Feature sequence463 >Feature sequence464 403 44 gene locus_tag LOCUS_18140 gene rpsM 403 44 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258255.1 protein_id gnl|my_center|LOCUS_18140 559 416 gene locus_tag LOCUS_18150 gene rpmJ 559 416 CDS product 50S ribosomal protein L36 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781429.1 protein_id gnl|my_center|LOCUS_18150 758 540 gene locus_tag LOCUS_18160 gene infA 758 540 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040194.1 protein_id gnl|my_center|LOCUS_18160 >Feature sequence465 288 297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence466 >Feature sequence467 >Feature sequence468 256 696 gene locus_tag LOCUS_18170 256 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18170 696 902 gene locus_tag LOCUS_18180 696 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18180 >Feature sequence469 >Feature sequence470 347 51 gene locus_tag LOCUS_18190 347 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010692226.1 protein_id gnl|my_center|LOCUS_18190 766 461 gene locus_tag LOCUS_18200 766 461 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963359.1 protein_id gnl|my_center|LOCUS_18200 931 812 gene locus_tag LOCUS_18210 931 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18210 >Feature sequence471 <1 907 gene locus_tag LOCUS_18220 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852890.1:leucine--tRNA ligase note possible pseudo, frameshifted 848 857 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence472 323 93 gene locus_tag LOCUS_18230 323 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18230 864 775 gene locus_tag LOCUS_t00460 864 775 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence473 1032 94 gene locus_tag LOCUS_18240 gene cydB 1032 94 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851984.1 protein_id gnl|my_center|LOCUS_18240 >Feature sequence474 >Feature sequence475 110 715 gene locus_tag LOCUS_18250 110 715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18250 746 973 gene locus_tag LOCUS_18260 746 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18260 >Feature sequence476 824 510 gene locus_tag LOCUS_18270 824 510 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015097.1 protein_id gnl|my_center|LOCUS_18270 >Feature sequence477 694 140 gene locus_tag LOCUS_18280 694 140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18280 >Feature sequence478 >Feature sequence479 <1 884 gene locus_tag LOCUS_18290 <1 884 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000142409.1:succinyldiaminopimelate transaminase >Feature sequence480 725 315 gene locus_tag LOCUS_18300 725 315 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004523514.1 protein_id gnl|my_center|LOCUS_18300 >Feature sequence481 >Feature sequence482 482 997 gene locus_tag LOCUS_18310 gene hpt 482 997 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880319.1 protein_id gnl|my_center|LOCUS_18310 >Feature sequence483 >Feature sequence484 <1 798 gene locus_tag LOCUS_18320 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_198480919.1:heat-inducible transcriptional repressor HrcA >Feature sequence485 >Feature sequence486 >Feature sequence487 >Feature sequence488 >Feature sequence489 796 608 gene locus_tag LOCUS_18330 796 608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18330 >Feature sequence490 >Feature sequence491 <1029 524 gene locus_tag LOCUS_18340 <1029 524 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943466.1:preprotein translocase subunit SecY >Feature sequence492 903 448 gene locus_tag LOCUS_18350 903 448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18350 >Feature sequence493 >Feature sequence494 >Feature sequence495 962 480 gene locus_tag LOCUS_18360 962 480 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854230.1 protein_id gnl|my_center|LOCUS_18360 >Feature sequence496 109 252 gene locus_tag LOCUS_18370 109 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18370 766 620 gene locus_tag LOCUS_18380 766 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_18380 >Feature sequence497 >Feature sequence498 >Feature sequence499 >Feature sequence500 >Feature sequence501 >Feature sequence502 <1 732 gene locus_tag LOCUS_18390 <1 732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931922.1:NAD-dependent epimerase >Feature sequence503 >Feature sequence504 >Feature sequence505 >Feature sequence506 >Feature sequence507 >Feature sequence508 >Feature sequence509 814 146 gene locus_tag LOCUS_18400 814 146 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005947811.1 protein_id gnl|my_center|LOCUS_18400 >Feature sequence510