>Feature sequence0001 220 2319 gene locus_tag LOCUS_00010 220 2319 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404351.1 protein_id gnl|my_center|LOCUS_00010 2447 3277 gene locus_tag LOCUS_00020 2447 3277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 3570 5177 gene locus_tag LOCUS_00030 3570 5177 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015951.1 protein_id gnl|my_center|LOCUS_00030 <6339 5341 gene locus_tag LOCUS_00040 <6339 5341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933118.1:translation elongation factor 4 >Feature sequence0002 451 460 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1248 511 gene locus_tag LOCUS_00050 gene rpsB 1248 511 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869490.1 protein_id gnl|my_center|LOCUS_00050 1825 1439 gene locus_tag LOCUS_00060 gene rpsI 1825 1439 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546072.1 protein_id gnl|my_center|LOCUS_00060 2277 1843 gene locus_tag LOCUS_00070 gene rplM 2277 1843 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081738.1 protein_id gnl|my_center|LOCUS_00070 2740 2351 gene locus_tag LOCUS_00080 2740 2351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 2934 3734 gene locus_tag LOCUS_00090 2934 3734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00090 3789 4100 gene locus_tag LOCUS_00100 3789 4100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_00100 4343 5485 gene locus_tag LOCUS_00110 4343 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 >Feature sequence0003 >Feature sequence0004 1415 1161 gene locus_tag LOCUS_00120 1415 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 3231 1828 gene locus_tag LOCUS_00130 3231 1828 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941119.1 protein_id gnl|my_center|LOCUS_00130 3899 3228 gene locus_tag LOCUS_00140 3899 3228 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_200855686.1 protein_id gnl|my_center|LOCUS_00140 4429 3911 gene locus_tag LOCUS_00150 4429 3911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 4880 4953 gene locus_tag LOCUS_t00010 4880 4953 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0005 1283 297 gene locus_tag LOCUS_00160 1283 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00160 322 331 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1478 1942 gene locus_tag LOCUS_00170 1478 1942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 1942 3294 gene locus_tag LOCUS_00180 1942 3294 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933478.1 protein_id gnl|my_center|LOCUS_00180 3332 4345 gene locus_tag LOCUS_00190 gene cydB 3332 4345 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933479.1 protein_id gnl|my_center|LOCUS_00190 4491 4500 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 4571 4816 gene locus_tag LOCUS_00200 4571 4816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 >Feature sequence0006 <1 1159 gene locus_tag LOCUS_00210 <1 1159 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022158.1:glycosyltransferase family 4 protein 2367 3446 gene locus_tag LOCUS_00220 2367 3446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00220 >Feature sequence0007 2561 1590 gene locus_tag LOCUS_00230 gene trxB 2561 1590 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405370.1 protein_id gnl|my_center|LOCUS_00230 2752 3663 gene locus_tag LOCUS_00240 2752 3663 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404088.1 protein_id gnl|my_center|LOCUS_00240 4301 4212 gene locus_tag LOCUS_t00020 4301 4212 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0008 797 1402 gene locus_tag LOCUS_00250 797 1402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 3064 1397 gene locus_tag LOCUS_00260 3064 1397 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403085.1 protein_id gnl|my_center|LOCUS_00260 3924 3136 gene locus_tag LOCUS_00270 3924 3136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 >Feature sequence0009 208 292 gene locus_tag LOCUS_t00030 208 292 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1661 471 gene locus_tag LOCUS_00280 gene dnaJ 1661 471 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933150.1 protein_id gnl|my_center|LOCUS_00280 2295 1675 gene locus_tag LOCUS_00290 2295 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 3357 2308 gene locus_tag LOCUS_00300 gene hrcA 3357 2308 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940709.1 protein_id gnl|my_center|LOCUS_00300 4067 4423 gene locus_tag LOCUS_00310 4067 4423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 4094 4103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0010 177 1520 gene locus_tag LOCUS_00320 177 1520 CDS product citrate/2-methylcitrate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156276303.1 protein_id gnl|my_center|LOCUS_00320 1670 2095 gene locus_tag LOCUS_00330 1670 2095 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_00330 3359 2229 gene locus_tag LOCUS_00340 3359 2229 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943453.1 protein_id gnl|my_center|LOCUS_00340 4474 3362 gene locus_tag LOCUS_00350 4474 3362 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107326.1 protein_id gnl|my_center|LOCUS_00350 >Feature sequence0011 3890 4222 gene locus_tag LOCUS_00360 3890 4222 CDS product IS3 family transposase ISGsu7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941222.1 protein_id gnl|my_center|LOCUS_00360 >Feature sequence0012 2 634 gene locus_tag LOCUS_00370 2 634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 708 1646 gene locus_tag LOCUS_00380 708 1646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 1863 2804 gene locus_tag LOCUS_00390 1863 2804 CDS product TIGR01777 family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_160961434.1 protein_id gnl|my_center|LOCUS_00390 3262 2801 gene locus_tag LOCUS_00400 3262 2801 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00400 <4240 3345 gene locus_tag LOCUS_00410 <4240 3345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941497.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence0013 <1 2285 gene locus_tag LOCUS_00420 <1 2285 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840036.1:methyl-accepting chemotaxis protein 3488 2574 gene locus_tag LOCUS_00430 3488 2574 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000234354.1 protein_id gnl|my_center|LOCUS_00430 3609 3986 gene locus_tag LOCUS_00440 gene crcB 3609 3986 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941171.1 protein_id gnl|my_center|LOCUS_00440 >Feature sequence0014 1957 1568 gene locus_tag LOCUS_00450 1957 1568 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081556.1 protein_id gnl|my_center|LOCUS_00450 2906 1959 gene locus_tag LOCUS_00460 2906 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 3151 2834 gene locus_tag LOCUS_00470 3151 2834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 2934 2943 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3646 3164 gene locus_tag LOCUS_00480 3646 3164 CDS product DUF456 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688359.1 protein_id gnl|my_center|LOCUS_00480 >Feature sequence0015 <1 1526 gene locus_tag LOCUS_00490 <1 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963291.1:heavy metal translocating P-type ATPase metal-binding domain-containing protein 1537 1728 gene locus_tag LOCUS_00500 1537 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 1743 3875 gene locus_tag LOCUS_00510 gene ccoN 1743 3875 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_00510 >Feature sequence0016 401 592 gene locus_tag LOCUS_00520 401 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00520 607 2739 gene locus_tag LOCUS_00530 gene ccoN 607 2739 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963294.1 protein_id gnl|my_center|LOCUS_00530 2793 2984 gene locus_tag LOCUS_00540 2793 2984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 2977 3573 gene locus_tag LOCUS_00550 2977 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00550 >Feature sequence0017 3244 380 gene locus_tag LOCUS_00560 3244 380 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162890684.1 protein_id gnl|my_center|LOCUS_00560 3399 3408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0018 1953 205 gene locus_tag LOCUS_00570 1953 205 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064474.1 protein_id gnl|my_center|LOCUS_00570 3006 1966 gene locus_tag LOCUS_00580 3006 1966 CDS product SIR2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_167364873.1 protein_id gnl|my_center|LOCUS_00580 3189 3028 gene locus_tag LOCUS_00590 3189 3028 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 3654 3271 gene locus_tag LOCUS_00600 3654 3271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00600 >Feature sequence0019 1992 1762 gene locus_tag LOCUS_00610 1992 1762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 3534 3543 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0020 1519 542 gene locus_tag LOCUS_00620 1519 542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 1826 2596 gene locus_tag LOCUS_00630 1826 2596 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022348.1 protein_id gnl|my_center|LOCUS_00630 2618 3445 gene locus_tag LOCUS_00640 2618 3445 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_201627596.1 protein_id gnl|my_center|LOCUS_00640 >Feature sequence0021 2110 3084 gene locus_tag LOCUS_00650 2110 3084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 >Feature sequence0022 802 152 gene locus_tag LOCUS_00660 802 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 3273 799 gene locus_tag LOCUS_00670 3273 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 3779 3462 gene locus_tag LOCUS_00680 3779 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 >Feature sequence0023 1458 2243 gene locus_tag LOCUS_00690 1458 2243 CDS product DeoR/GlpR family DNA-binding transcription regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582797.1 protein_id gnl|my_center|LOCUS_00690 <3742 2474 gene locus_tag LOCUS_00700 <3742 2474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941019.1:NADH-quinone oxidoreductase subunit N >Feature sequence0024 >Feature sequence0025 1133 1495 gene locus_tag LOCUS_00710 1133 1495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 2554 3039 gene locus_tag LOCUS_00720 2554 3039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00720 3032 3637 gene locus_tag LOCUS_00730 3032 3637 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 >Feature sequence0026 >Feature sequence0027 318 1622 gene locus_tag LOCUS_00740 318 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00740 >Feature sequence0028 194 997 gene locus_tag LOCUS_00750 194 997 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392303.1 protein_id gnl|my_center|LOCUS_00750 2330 1482 gene locus_tag LOCUS_00760 2330 1482 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_00760 3406 2357 gene locus_tag LOCUS_00770 3406 2357 CDS product CapA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940714.1 protein_id gnl|my_center|LOCUS_00770 >Feature sequence0029 2966 624 gene locus_tag LOCUS_00780 2966 624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 >Feature sequence0030 2957 1860 gene locus_tag LOCUS_00790 2957 1860 CDS product phosphomevalonate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011254368.1 protein_id gnl|my_center|LOCUS_00790 >Feature sequence0031 1239 223 gene locus_tag LOCUS_00800 gene glpX 1239 223 CDS product class II fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176742217.1 protein_id gnl|my_center|LOCUS_00800 2253 1285 gene locus_tag LOCUS_00810 gene fba 2253 1285 CDS product class II fructose-1,6-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582459.1 protein_id gnl|my_center|LOCUS_00810 <3499 2266 gene locus_tag LOCUS_00820 <3499 2266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207301211.1:transketolase >Feature sequence0032 <1 1037 gene locus_tag LOCUS_00830 <1 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990130.1:DNA primase 1055 1873 gene locus_tag LOCUS_00840 gene panB 1055 1873 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933009.1 protein_id gnl|my_center|LOCUS_00840 2039 3463 gene locus_tag LOCUS_00850 2039 3463 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071202.1 protein_id gnl|my_center|LOCUS_00850 >Feature sequence0033 1 195 gene locus_tag LOCUS_00860 1 195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 345 1265 gene locus_tag LOCUS_00870 gene phnD 345 1265 CDS product phosphate/phosphite/phosphonate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255931.1 protein_id gnl|my_center|LOCUS_00870 1262 2821 gene locus_tag LOCUS_00880 1262 2821 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937430.1 protein_id gnl|my_center|LOCUS_00880 >Feature sequence0034 432 1400 gene locus_tag LOCUS_00890 432 1400 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403763.1 protein_id gnl|my_center|LOCUS_00890 1417 2460 gene locus_tag LOCUS_00900 1417 2460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 >Feature sequence0035 17 1342 gene locus_tag LOCUS_00910 17 1342 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_00910 1412 2476 gene locus_tag LOCUS_00920 1412 2476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 2406 2684 gene locus_tag LOCUS_00930 2406 2684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00930 2413 2422 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2838 3197 gene locus_tag LOCUS_00940 2838 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 3268 3356 gene locus_tag LOCUS_t00040 3268 3356 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0036 1337 141 gene locus_tag LOCUS_00950 1337 141 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084205626.1 protein_id gnl|my_center|LOCUS_00950 3179 1416 gene locus_tag LOCUS_00960 3179 1416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 >Feature sequence0037 1295 2896 gene locus_tag LOCUS_00970 1295 2896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 >Feature sequence0038 2475 1213 gene locus_tag LOCUS_00980 2475 1213 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275358.1 protein_id gnl|my_center|LOCUS_00980 >Feature sequence0039 2867 1998 gene locus_tag LOCUS_00990 2867 1998 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_00990 3298 2867 gene locus_tag LOCUS_01000 3298 2867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 >Feature sequence0040 2727 1639 gene locus_tag LOCUS_01010 gene gmd 2727 1639 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937755.1 protein_id gnl|my_center|LOCUS_01010 <3288 2766 gene locus_tag LOCUS_01020 <3288 2766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088212.1:GDP-L-fucose synthase >Feature sequence0041 <1 531 gene locus_tag LOCUS_01030 <1 531 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938258.1:replicative DNA helicase 630 2153 gene locus_tag LOCUS_01040 gene fumA 630 2153 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000413523.1 protein_id gnl|my_center|LOCUS_01040 2430 2439 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2457 2966 gene locus_tag LOCUS_01050 2457 2966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 >Feature sequence0042 2949 1600 gene locus_tag LOCUS_01060 gene hpnE 2949 1600 CDS product hydroxysqualene dehydroxylase HpnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003691141.1 protein_id gnl|my_center|LOCUS_01060 >Feature sequence0043 1616 570 gene locus_tag LOCUS_01070 gene porV 1616 570 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013061738.1 protein_id gnl|my_center|LOCUS_01070 >Feature sequence0044 235 44 gene locus_tag LOCUS_01080 235 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 230 1186 gene locus_tag LOCUS_01090 gene metF 230 1186 CDS product methylenetetrahydrofolate reductase [NAD(P)H] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404822.1 protein_id gnl|my_center|LOCUS_01090 1269 1342 gene locus_tag LOCUS_t00050 1269 1342 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0045 23 1423 gene locus_tag LOCUS_01100 23 1423 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 1491 1706 gene locus_tag LOCUS_01110 1491 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 2237 2392 gene locus_tag LOCUS_01120 2237 2392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 2801 3013 gene locus_tag LOCUS_01130 2801 3013 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868295.1 protein_id gnl|my_center|LOCUS_01130 >Feature sequence0046 <1 584 gene locus_tag LOCUS_01140 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393992.1:ParB/RepB/Spo0J family partition protein 590 1366 gene locus_tag LOCUS_01150 590 1366 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545938.1 protein_id gnl|my_center|LOCUS_01150 1390 1815 gene locus_tag LOCUS_01160 1390 1815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 1907 2089 gene locus_tag LOCUS_01170 1907 2089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 2079 2465 gene locus_tag LOCUS_01180 2079 2465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 >Feature sequence0047 667 260 gene locus_tag LOCUS_01190 667 260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 1282 791 gene locus_tag LOCUS_01200 1282 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 1698 1363 gene locus_tag LOCUS_01210 1698 1363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 2762 1773 gene locus_tag LOCUS_01220 2762 1773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 >Feature sequence0048 372 1925 gene locus_tag LOCUS_01230 372 1925 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932358.1 protein_id gnl|my_center|LOCUS_01230 1912 2199 gene locus_tag LOCUS_01240 1912 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 2196 2420 gene locus_tag LOCUS_01250 2196 2420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 2609 2812 gene locus_tag LOCUS_01260 2609 2812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 >Feature sequence0049 1888 467 gene locus_tag LOCUS_01270 1888 467 CDS product NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000127254.1 protein_id gnl|my_center|LOCUS_01270 2173 1892 gene locus_tag LOCUS_01280 2173 1892 CDS product NAD(P) transhydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000434762.1 protein_id gnl|my_center|LOCUS_01280 <3126 2191 gene locus_tag LOCUS_01290 <3126 2191 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056541.1:Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha >Feature sequence0050 880 101 gene locus_tag LOCUS_01300 gene lpxA 880 101 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933664.1 protein_id gnl|my_center|LOCUS_01300 2315 891 gene locus_tag LOCUS_01310 2315 891 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933326.1 protein_id gnl|my_center|LOCUS_01310 <3098 2308 gene locus_tag LOCUS_01320 <3098 2308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583184.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase >Feature sequence0051 748 1134 gene locus_tag LOCUS_01330 748 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01330 759 768 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1115 2155 gene locus_tag LOCUS_01340 1115 2155 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032807985.1 protein_id gnl|my_center|LOCUS_01340 >Feature sequence0052 1291 503 gene locus_tag LOCUS_01350 1291 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 1441 1731 gene locus_tag LOCUS_01360 1441 1731 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257426.1 protein_id gnl|my_center|LOCUS_01360 1836 1910 gene locus_tag LOCUS_t00060 1836 1910 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1921 1996 gene locus_tag LOCUS_t00070 1921 1996 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2221 2490 gene locus_tag LOCUS_01370 2221 2490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 2392 2401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2447 2977 gene locus_tag LOCUS_01380 2447 2977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 >Feature sequence0053 496 1338 gene locus_tag LOCUS_01390 496 1338 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943778.1 protein_id gnl|my_center|LOCUS_01390 1328 2338 gene locus_tag LOCUS_01400 1328 2338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 2537 2821 gene locus_tag LOCUS_01410 2537 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 >Feature sequence0054 674 683 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 734 1381 gene locus_tag LOCUS_01420 gene aroE 734 1381 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010990140.1 protein_id gnl|my_center|LOCUS_01420 1382 2662 gene locus_tag LOCUS_01430 gene aroA 1382 2662 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005171024.1 protein_id gnl|my_center|LOCUS_01430 >Feature sequence0055 973 269 gene locus_tag LOCUS_01440 973 269 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728716.1 protein_id gnl|my_center|LOCUS_01440 1286 993 gene locus_tag LOCUS_01450 1286 993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 >Feature sequence0056 <1 1036 gene locus_tag LOCUS_01460 <1 1036 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942985.1:potassium transporter Kup 1061 2221 gene locus_tag LOCUS_01470 1061 2221 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143072.1 protein_id gnl|my_center|LOCUS_01470 >Feature sequence0057 834 2450 gene locus_tag LOCUS_01480 834 2450 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099686814.1 protein_id gnl|my_center|LOCUS_01480 >Feature sequence0058 3 527 gene locus_tag LOCUS_01490 3 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 1780 1926 gene locus_tag LOCUS_01500 1780 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01500 1908 2108 gene locus_tag LOCUS_01510 1908 2108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 <2971 2437 gene locus_tag LOCUS_01520 <2971 2437 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941223.1:IS3 family transposase >Feature sequence0059 >Feature sequence0060 366 1331 gene locus_tag LOCUS_01530 366 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 2357 1350 gene locus_tag LOCUS_01540 2357 1350 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257502.1 protein_id gnl|my_center|LOCUS_01540 2923 2378 gene locus_tag LOCUS_01550 2923 2378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 >Feature sequence0061 58 582 gene locus_tag LOCUS_01560 gene rpsE 58 582 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933825.1 protein_id gnl|my_center|LOCUS_01560 597 800 gene locus_tag LOCUS_01570 gene rpmD 597 800 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003860590.1 protein_id gnl|my_center|LOCUS_01570 985 1260 gene locus_tag LOCUS_01580 985 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 1257 2582 gene locus_tag LOCUS_01590 gene secY 1257 2582 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933822.1 protein_id gnl|my_center|LOCUS_01590 >Feature sequence0062 2175 1075 gene locus_tag LOCUS_01600 2175 1075 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880392.1 protein_id gnl|my_center|LOCUS_01600 >Feature sequence0063 987 76 gene locus_tag LOCUS_01610 987 76 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 2131 998 gene locus_tag LOCUS_01620 2131 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence0064 693 388 gene locus_tag LOCUS_01630 gene nuoK 693 388 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001015281.1 protein_id gnl|my_center|LOCUS_01630 1215 706 gene locus_tag LOCUS_01640 1215 706 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941015.1 protein_id gnl|my_center|LOCUS_01640 2270 1233 gene locus_tag LOCUS_01650 gene nuoH 2270 1233 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001104353.1 protein_id gnl|my_center|LOCUS_01650 <2908 2331 gene locus_tag LOCUS_01660 <2908 2331 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941012.1:molybdopterin-dependent oxidoreductase >Feature sequence0065 <2892 233 gene locus_tag LOCUS_01670 <2892 233 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence0066 1739 1293 gene locus_tag LOCUS_01680 1739 1293 CDS product arginine repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932791.1 protein_id gnl|my_center|LOCUS_01680 <2879 1871 gene locus_tag LOCUS_01690 <2879 1871 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258815.1:pyruvate, phosphate dikinase >Feature sequence0067 377 174 gene locus_tag LOCUS_01700 377 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 1402 1545 gene locus_tag LOCUS_01710 1402 1545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence0068 847 674 gene locus_tag LOCUS_01720 847 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01720 1148 819 gene locus_tag LOCUS_01730 1148 819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01730 823 832 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0069 <1 758 gene locus_tag LOCUS_01740 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258378.1:chorismate synthase 755 1501 gene locus_tag LOCUS_01750 755 1501 CDS product prephenate dehydrogenase/arogenate dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957934.1 protein_id gnl|my_center|LOCUS_01750 1563 2453 gene locus_tag LOCUS_01760 1563 2453 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_223294680.1 protein_id gnl|my_center|LOCUS_01760 >Feature sequence0070 142 273 gene locus_tag LOCUS_01770 142 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 >Feature sequence0071 <1 637 gene locus_tag LOCUS_01780 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942233.1:translation initiation factor IF-2 644 925 gene locus_tag LOCUS_01790 644 925 CDS product DUF503 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257138.1 protein_id gnl|my_center|LOCUS_01790 941 1303 gene locus_tag LOCUS_01800 gene rbfA 941 1303 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003428234.1 protein_id gnl|my_center|LOCUS_01800 1281 1985 gene locus_tag LOCUS_01810 1281 1985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence0072 >Feature sequence0073 1784 441 gene locus_tag LOCUS_01820 1784 441 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545697.1 protein_id gnl|my_center|LOCUS_01820 >Feature sequence0074 3 1775 gene locus_tag LOCUS_01830 3 1775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence0075 1942 908 gene locus_tag LOCUS_01840 gene aroF 1942 908 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392848.1 protein_id gnl|my_center|LOCUS_01840 2616 2269 gene locus_tag LOCUS_01850 2616 2269 CDS product Hpt domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405144.1 protein_id gnl|my_center|LOCUS_01850 >Feature sequence0076 726 577 gene locus_tag LOCUS_01860 726 577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 612 621 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1665 823 gene locus_tag LOCUS_01870 1665 823 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392942.1 protein_id gnl|my_center|LOCUS_01870 >Feature sequence0077 <1 1147 gene locus_tag LOCUS_01880 <1 1147 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942715.1:putative Ig domain-containing protein note possible pseudo, frameshifted 1105 1114 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1120 2058 gene locus_tag LOCUS_01890 1120 2058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01890 >Feature sequence0078 1228 188 gene locus_tag LOCUS_01900 1228 188 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404416.1 protein_id gnl|my_center|LOCUS_01900 2217 1228 gene locus_tag LOCUS_01910 2217 1228 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251073.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence0079 <1 587 gene locus_tag LOCUS_01920 <1 587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002287441.1:23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB 676 1446 gene locus_tag LOCUS_01930 gene mazG 676 1446 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583864.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence0080 99 830 gene locus_tag LOCUS_01940 gene radC 99 830 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405057.1 protein_id gnl|my_center|LOCUS_01940 855 2432 gene locus_tag LOCUS_01950 855 2432 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258223.1 protein_id gnl|my_center|LOCUS_01950 >Feature sequence0081 434 443 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1547 765 gene locus_tag LOCUS_01960 1547 765 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002557338.1 protein_id gnl|my_center|LOCUS_01960 2476 1628 gene locus_tag LOCUS_01970 2476 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01970 1747 1756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0082 2653 2402 gene locus_tag LOCUS_01980 2653 2402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 >Feature sequence0083 636 1607 gene locus_tag LOCUS_01990 636 1607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 >Feature sequence0084 >Feature sequence0085 699 2051 gene locus_tag LOCUS_02000 gene ltrA 699 2051 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000561483.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence0086 747 756 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2274 1141 gene locus_tag LOCUS_02010 2274 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence0087 340 349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1253 2002 gene locus_tag LOCUS_02020 1253 2002 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 >Feature sequence0088 421 1044 gene locus_tag LOCUS_02030 421 1044 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02030 1093 2412 gene locus_tag LOCUS_02040 1093 2412 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940356.1 protein_id gnl|my_center|LOCUS_02040 >Feature sequence0089 <1 942 gene locus_tag LOCUS_02050 <1 942 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459079.1:DNA repair protein RadA >Feature sequence0090 1571 744 gene locus_tag LOCUS_02060 gene larE 1571 744 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941204.1 protein_id gnl|my_center|LOCUS_02060 <2571 1636 gene locus_tag LOCUS_02070 <2571 1636 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881281.1:RIP metalloprotease RseP >Feature sequence0091 2565 466 gene locus_tag LOCUS_02080 gene recG 2565 466 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403048.1 protein_id gnl|my_center|LOCUS_02080 >Feature sequence0092 451 224 gene locus_tag LOCUS_02090 gene rpsR 451 224 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583715.1 protein_id gnl|my_center|LOCUS_02090 1009 464 gene locus_tag LOCUS_02100 1009 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 <2555 1134 gene locus_tag LOCUS_02110 <2555 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392862.1:sodium-translocating pyrophosphatase >Feature sequence0093 1238 2038 gene locus_tag LOCUS_02120 1238 2038 CDS product TIGR01458 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000971814.1 protein_id gnl|my_center|LOCUS_02120 2113 2427 gene locus_tag LOCUS_02130 2113 2427 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000637521.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence0094 21 869 gene locus_tag LOCUS_02140 21 869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 885 1250 gene locus_tag LOCUS_02150 885 1250 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000695903.1 protein_id gnl|my_center|LOCUS_02150 1474 2166 gene locus_tag LOCUS_02160 gene nfi 1474 2166 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082416.1 protein_id gnl|my_center|LOCUS_02160 >Feature sequence0095 <1 620 gene locus_tag LOCUS_02170 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005422351.1:sodium/sugar symporter 703 1089 gene locus_tag LOCUS_02180 703 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 1086 2315 gene locus_tag LOCUS_02190 1086 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 >Feature sequence0096 >Feature sequence0097 1896 232 gene locus_tag LOCUS_02200 1896 232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 2221 2024 gene locus_tag LOCUS_02210 2221 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 >Feature sequence0098 1572 1051 gene locus_tag LOCUS_02220 1572 1051 CDS product cytochrome c3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001064927.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence0099 <1 1342 gene locus_tag LOCUS_02230 <1 1342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152945460.1:efflux RND transporter permease subunit 1858 1358 gene locus_tag LOCUS_02240 1858 1358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 <2528 1831 gene locus_tag LOCUS_02250 <2528 1831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013227842.1:DNA alkylation repair protein >Feature sequence0100 81 788 gene locus_tag LOCUS_02260 gene trmD 81 788 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583884.1 protein_id gnl|my_center|LOCUS_02260 805 1149 gene locus_tag LOCUS_02270 gene rplS 805 1149 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012897519.1 protein_id gnl|my_center|LOCUS_02270 2089 1226 gene locus_tag LOCUS_02280 2089 1226 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010886863.1 protein_id gnl|my_center|LOCUS_02280 >Feature sequence0101 >Feature sequence0102 2117 1257 gene locus_tag LOCUS_02290 2117 1257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839904.1 protein_id gnl|my_center|LOCUS_02290 >Feature sequence0103 12 494 gene locus_tag LOCUS_02300 12 494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 391 400 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 436 1092 gene locus_tag LOCUS_02310 436 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence0104 95 1099 gene locus_tag LOCUS_02320 95 1099 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404542.1 protein_id gnl|my_center|LOCUS_02320 1670 1110 gene locus_tag LOCUS_02330 gene rfbC 1670 1110 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_036472525.1 protein_id gnl|my_center|LOCUS_02330 >Feature sequence0105 80 739 gene locus_tag LOCUS_02340 80 739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 983 1723 gene locus_tag LOCUS_02350 gene rsmI 983 1723 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546504.1 protein_id gnl|my_center|LOCUS_02350 1713 2360 gene locus_tag LOCUS_02360 1713 2360 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762243.1 protein_id gnl|my_center|LOCUS_02360 >Feature sequence0106 715 624 gene locus_tag LOCUS_t00080 715 624 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1245 805 gene locus_tag LOCUS_02370 1245 805 CDS product heme-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000726283.1 protein_id gnl|my_center|LOCUS_02370 2174 1263 gene locus_tag LOCUS_02380 gene rocF 2174 1263 CDS product arginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808692.1 protein_id gnl|my_center|LOCUS_02380 >Feature sequence0107 1455 16 gene locus_tag LOCUS_02390 1455 16 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 <2494 1436 gene locus_tag LOCUS_02400 <2494 1436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107959.1:family 10 glycosylhydrolase 1459 1468 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0108 1474 443 gene locus_tag LOCUS_02410 1474 443 CDS product dipeptide ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584051.1 protein_id gnl|my_center|LOCUS_02410 <2480 1471 gene locus_tag LOCUS_02420 <2480 1471 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001196486.1:dipeptide ABC transporter ATP-binding protein >Feature sequence0109 <1 1088 gene locus_tag LOCUS_02430 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391795.1:excinuclease ABC subunit UvrB >Feature sequence0110 <1 2282 gene locus_tag LOCUS_02440 <1 2282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458974.1:Sec-dependent nitrous-oxide reductase >Feature sequence0111 1821 784 gene locus_tag LOCUS_02450 1821 784 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404861.1 protein_id gnl|my_center|LOCUS_02450 2344 1793 gene locus_tag LOCUS_02460 2344 1793 CDS product cyclic nucleotide-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000645314.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence0112 25 1050 gene locus_tag LOCUS_02470 25 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 1111 2103 gene locus_tag LOCUS_02480 1111 2103 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012255934.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence0113 1538 723 gene locus_tag LOCUS_02490 1538 723 CDS product sulfotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529050.1 protein_id gnl|my_center|LOCUS_02490 >Feature sequence0114 <1 818 gene locus_tag LOCUS_02500 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933444.1:ribosome biogenesis GTPase Der 831 2084 gene locus_tag LOCUS_02510 831 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02510 1942 1951 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0115 1302 61 gene locus_tag LOCUS_02520 gene trpB 1302 61 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082734.1 protein_id gnl|my_center|LOCUS_02520 1658 1299 gene locus_tag LOCUS_02530 1658 1299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02530 1629 1638 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0116 >Feature sequence0117 >Feature sequence0118 <1 1092 gene locus_tag LOCUS_02540 <1 1092 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071046.1:TonB-dependent receptor 2411 1458 gene locus_tag LOCUS_02550 2411 1458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02550 >Feature sequence0119 271 582 gene locus_tag LOCUS_02560 271 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 586 2334 gene locus_tag LOCUS_02570 586 2334 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459981.1 protein_id gnl|my_center|LOCUS_02570 >Feature sequence0120 382 987 gene locus_tag LOCUS_02580 382 987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 970 979 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0121 486 64 gene locus_tag LOCUS_02590 486 64 CDS product ferritin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173532.1 protein_id gnl|my_center|LOCUS_02590 983 774 gene locus_tag LOCUS_02600 983 774 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002217533.1 protein_id gnl|my_center|LOCUS_02600 <2383 1167 gene locus_tag LOCUS_02610 <2383 1167 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839941.1:ABC transporter permease >Feature sequence0122 1185 319 gene locus_tag LOCUS_02620 gene lipA 1185 319 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963587.1 protein_id gnl|my_center|LOCUS_02620 <2372 1203 gene locus_tag LOCUS_02630 <2372 1203 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766153.1:dihydrolipoamide acetyltransferase family protein >Feature sequence0123 <1 1445 gene locus_tag LOCUS_02640 <1 1445 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012870177.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence0124 1045 314 gene locus_tag LOCUS_02650 1045 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 <2359 1082 gene locus_tag LOCUS_02660 <2359 1082 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546592.1:molybdopterin-dependent oxidoreductase >Feature sequence0125 1955 597 gene locus_tag LOCUS_02670 1955 597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 1486 1495 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0126 629 1981 gene locus_tag LOCUS_02680 629 1981 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 >Feature sequence0127 150 410 gene locus_tag LOCUS_02690 150 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 524 1297 gene locus_tag LOCUS_02700 524 1297 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405283.1 protein_id gnl|my_center|LOCUS_02700 >Feature sequence0128 1585 2136 gene locus_tag LOCUS_02710 1585 2136 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228920.1 protein_id gnl|my_center|LOCUS_02710 >Feature sequence0129 146 751 gene locus_tag LOCUS_02720 146 751 CDS product thymidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840180.1 protein_id gnl|my_center|LOCUS_02720 762 1589 gene locus_tag LOCUS_02730 762 1589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 2343 1648 gene locus_tag LOCUS_02740 gene sfsA 2343 1648 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943351.1 protein_id gnl|my_center|LOCUS_02740 >Feature sequence0130 <2341 1655 gene locus_tag LOCUS_02750 <2341 1655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051010823.1:DNA-directed RNA polymerase subunit beta >Feature sequence0131 2077 1142 gene locus_tag LOCUS_02760 2077 1142 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256872.1 protein_id gnl|my_center|LOCUS_02760 >Feature sequence0132 29 2328 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttcagcatacctatgagggattgaaac >Feature sequence0133 168 482 gene locus_tag LOCUS_02770 gene rplU 168 482 CDS product 50S ribosomal protein L21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869646.1 protein_id gnl|my_center|LOCUS_02770 494 751 gene locus_tag LOCUS_02780 gene rpmA 494 751 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545975.1 protein_id gnl|my_center|LOCUS_02780 2272 959 gene locus_tag LOCUS_02790 2272 959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 >Feature sequence0134 730 1617 gene locus_tag LOCUS_02800 730 1617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 2182 1733 gene locus_tag LOCUS_02810 2182 1733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02810 >Feature sequence0135 1945 821 gene locus_tag LOCUS_02820 1945 821 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_02820 >Feature sequence0136 1900 2223 gene locus_tag LOCUS_02830 1900 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 >Feature sequence0137 <1 725 gene locus_tag LOCUS_02840 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404376.1:signal recognition particle protein 764 1276 gene locus_tag LOCUS_02850 764 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 1336 1566 gene locus_tag LOCUS_02860 1336 1566 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546040.1 protein_id gnl|my_center|LOCUS_02860 1621 2124 gene locus_tag LOCUS_02870 gene rimM 1621 2124 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870156.1 protein_id gnl|my_center|LOCUS_02870 >Feature sequence0138 1719 409 gene locus_tag LOCUS_02880 gene gabT 1719 409 CDS product 4-aminobutyrate--2-oxoglutarate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001093009.1 protein_id gnl|my_center|LOCUS_02880 2317 1841 gene locus_tag LOCUS_02890 2317 1841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 >Feature sequence0139 257 1624 gene locus_tag LOCUS_02900 257 1624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02900 >Feature sequence0140 2009 927 gene locus_tag LOCUS_02910 2009 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 >Feature sequence0141 2212 662 gene locus_tag LOCUS_02920 gene guaA 2212 662 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545424.1 protein_id gnl|my_center|LOCUS_02920 >Feature sequence0142 685 1863 gene locus_tag LOCUS_02930 685 1863 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546667.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence0143 918 1835 gene locus_tag LOCUS_02940 918 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02940 1908 1917 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0144 215 2005 gene locus_tag LOCUS_02950 215 2005 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933059.1 protein_id gnl|my_center|LOCUS_02950 >Feature sequence0145 <1 1449 gene locus_tag LOCUS_02960 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880520.1:tetratricopeptide repeat protein >Feature sequence0146 223 726 gene locus_tag LOCUS_02970 223 726 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_02970 867 1805 gene locus_tag LOCUS_02980 867 1805 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049979583.1 protein_id gnl|my_center|LOCUS_02980 >Feature sequence0147 <1 731 gene locus_tag LOCUS_02990 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963906.1:YfhO family protein 733 2043 gene locus_tag LOCUS_03000 733 2043 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103038479.1 protein_id gnl|my_center|LOCUS_03000 >Feature sequence0148 >Feature sequence0149 1944 250 gene locus_tag LOCUS_03010 1944 250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 >Feature sequence0150 1798 1124 gene locus_tag LOCUS_03020 1798 1124 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025775002.1 protein_id gnl|my_center|LOCUS_03020 1911 1920 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0151 <1 1178 gene locus_tag LOCUS_03030 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838502.1:FlgD immunoglobulin-like domain containing protein <2271 1244 gene locus_tag LOCUS_03040 <2271 1244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933791.1:glycosyltransferase family 9 protein >Feature sequence0152 1845 1854 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0153 1 561 gene locus_tag LOCUS_03050 1 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 >Feature sequence0154 1627 1121 gene locus_tag LOCUS_03060 1627 1121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 <2262 1650 gene locus_tag LOCUS_03070 <2262 1650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877513.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence0155 <2259 464 gene locus_tag LOCUS_03080 <2259 464 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000574006.1:Cu(+)/Ag(+) efflux RND transporter permease subunit CusA 1103 1112 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1606 1615 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0156 35 415 gene locus_tag LOCUS_03090 35 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 1422 412 gene locus_tag LOCUS_03100 1422 412 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_03100 1469 1954 gene locus_tag LOCUS_03110 1469 1954 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258016.1 protein_id gnl|my_center|LOCUS_03110 2139 1951 gene locus_tag LOCUS_03120 2139 1951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 >Feature sequence0157 392 958 gene locus_tag LOCUS_03130 392 958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03130 955 1755 gene locus_tag LOCUS_03140 955 1755 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_03140 1706 1715 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0158 1511 681 gene locus_tag LOCUS_03150 1511 681 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258850.1 protein_id gnl|my_center|LOCUS_03150 <2247 1551 gene locus_tag LOCUS_03160 <2247 1551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258849.1:rhomboid family intramembrane serine protease >Feature sequence0159 <1 568 gene locus_tag LOCUS_03170 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143270.1:adenylosuccinate synthase 838 629 gene locus_tag LOCUS_03180 838 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 1492 854 gene locus_tag LOCUS_03190 1492 854 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020502.1 protein_id gnl|my_center|LOCUS_03190 >Feature sequence0160 <1 1352 gene locus_tag LOCUS_03200 <1 1352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838696.1:Na+/H+ antiporter NhaC family protein >Feature sequence0161 426 677 gene locus_tag LOCUS_03210 426 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 1492 701 gene locus_tag LOCUS_03220 1492 701 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011028151.1 protein_id gnl|my_center|LOCUS_03220 <2239 1494 gene locus_tag LOCUS_03230 <2239 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545714.1:aspartate-semialdehyde dehydrogenase >Feature sequence0162 1521 310 gene locus_tag LOCUS_03240 1521 310 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190526.1 protein_id gnl|my_center|LOCUS_03240 >Feature sequence0163 >Feature sequence0164 301 1368 gene locus_tag LOCUS_03250 301 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 >Feature sequence0165 <1 1256 gene locus_tag LOCUS_03260 <1 1256 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001150496.1:DNA polymerase III subunit alpha 254 263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1278 1745 gene locus_tag LOCUS_03270 gene dtd 1278 1745 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002289097.1 protein_id gnl|my_center|LOCUS_03270 >Feature sequence0166 >Feature sequence0167 441 78 gene locus_tag LOCUS_tm00010 441 78 tmRNA product transfer-messenger RNA inference COORDINATES:profile:Aragorn:1.2.38 836 763 gene locus_tag LOCUS_t00090 836 763 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0168 680 99 gene locus_tag LOCUS_03280 680 99 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005903986.1 protein_id gnl|my_center|LOCUS_03280 2168 747 gene locus_tag LOCUS_03290 2168 747 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941769.1 protein_id gnl|my_center|LOCUS_03290 >Feature sequence0169 694 182 gene locus_tag LOCUS_03300 694 182 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_03300 791 1465 gene locus_tag LOCUS_03310 791 1465 CDS product class II aldolase/adducin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256490.1 protein_id gnl|my_center|LOCUS_03310 <2208 1516 gene locus_tag LOCUS_03320 <2208 1516 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0170 <1 631 gene locus_tag LOCUS_03330 <1 631 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045027.1:ferrous iron transport protein B 809 1471 gene locus_tag LOCUS_03340 809 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 1675 1962 gene locus_tag LOCUS_03350 gene gatC 1675 1962 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943994.1 protein_id gnl|my_center|LOCUS_03350 >Feature sequence0171 811 116 gene locus_tag LOCUS_03360 811 116 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_03360 >Feature sequence0172 >Feature sequence0173 976 1470 gene locus_tag LOCUS_03370 976 1470 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03370 >Feature sequence0174 >Feature sequence0175 >Feature sequence0176 694 1125 gene locus_tag LOCUS_03380 694 1125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 >Feature sequence0177 1895 1071 gene locus_tag LOCUS_03390 1895 1071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 >Feature sequence0178 <1 701 gene locus_tag LOCUS_03400 <1 701 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583204.1:ABC transporter permease 711 1934 gene locus_tag LOCUS_03410 711 1934 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545399.1 protein_id gnl|my_center|LOCUS_03410 >Feature sequence0179 <1 1596 gene locus_tag LOCUS_03420 <1 1596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838192.1:Ig-like domain-containing protein 1012 1021 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0180 1175 168 gene locus_tag LOCUS_03430 1175 168 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931786.1 protein_id gnl|my_center|LOCUS_03430 <2178 1293 gene locus_tag LOCUS_03440 <2178 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942733.1:phosphoribosylaminoimidazolesuccinocarboxamide synthase >Feature sequence0181 <1 745 gene locus_tag LOCUS_03450 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404307.1:pyrroline-5-carboxylate reductase >Feature sequence0182 1255 2142 gene locus_tag LOCUS_03460 1255 2142 CDS product diacylglycerol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000977671.1 protein_id gnl|my_center|LOCUS_03460 >Feature sequence0183 40 114 gene locus_tag LOCUS_t00100 40 114 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 183 256 gene locus_tag LOCUS_t00110 183 256 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 404 1273 gene locus_tag LOCUS_03470 404 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03470 1220 1229 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1297 1746 gene locus_tag LOCUS_03480 1297 1746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03480 >Feature sequence0184 <1 886 gene locus_tag LOCUS_03490 <1 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase <2168 1356 gene locus_tag LOCUS_03500 <2168 1356 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065100.1:tetratricopeptide repeat protein >Feature sequence0185 1219 2076 gene locus_tag LOCUS_03510 1219 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence0186 >Feature sequence0187 1086 556 gene locus_tag LOCUS_03520 1086 556 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404582.1 protein_id gnl|my_center|LOCUS_03520 <2162 1112 gene locus_tag LOCUS_03530 <2162 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931958.1:outer membrane protein assembly factor BamA >Feature sequence0188 >Feature sequence0189 316 795 gene locus_tag LOCUS_03540 316 795 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228393.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence0190 767 228 gene locus_tag LOCUS_03550 gene rplF 767 228 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003435668.1 protein_id gnl|my_center|LOCUS_03550 1189 791 gene locus_tag LOCUS_03560 gene rpsH 1189 791 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003421148.1 protein_id gnl|my_center|LOCUS_03560 1960 1400 gene locus_tag LOCUS_03570 gene rplE 1960 1400 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986816.1 protein_id gnl|my_center|LOCUS_03570 >Feature sequence0191 <2144 1101 gene locus_tag LOCUS_03580 <2144 1101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0192 185 790 gene locus_tag LOCUS_03590 gene grpE 185 790 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000392710.1 protein_id gnl|my_center|LOCUS_03590 823 1461 gene locus_tag LOCUS_03600 823 1461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03600 1489 1692 gene locus_tag LOCUS_03610 1489 1692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 1868 2119 gene locus_tag LOCUS_03620 1868 2119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03620 >Feature sequence0193 660 1820 gene locus_tag LOCUS_03630 660 1820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 >Feature sequence0194 1016 552 gene locus_tag LOCUS_03640 1016 552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03640 1330 1013 gene locus_tag LOCUS_03650 1330 1013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1029 1038 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0195 448 20 gene locus_tag LOCUS_03660 448 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 1522 503 gene locus_tag LOCUS_03670 1522 503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03670 1977 1519 gene locus_tag LOCUS_03680 1977 1519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 >Feature sequence0196 598 1083 gene locus_tag LOCUS_03690 598 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 >Feature sequence0197 906 346 gene locus_tag LOCUS_03700 gene frr 906 346 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810666.1 protein_id gnl|my_center|LOCUS_03700 1628 909 gene locus_tag LOCUS_03710 gene pyrH 1628 909 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005904124.1 protein_id gnl|my_center|LOCUS_03710 2120 1632 gene locus_tag LOCUS_03720 gene tsf 2120 1632 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583563.1 protein_id gnl|my_center|LOCUS_03720 >Feature sequence0198 1236 685 gene locus_tag LOCUS_03730 gene hslV 1236 685 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932864.1 protein_id gnl|my_center|LOCUS_03730 <2119 1392 gene locus_tag LOCUS_03740 <2119 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403901.1:RNA polymerase factor sigma-54 >Feature sequence0199 <1 1518 gene locus_tag LOCUS_03750 <1 1518 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103468.1:TonB-dependent siderophore receptor >Feature sequence0200 <1 1605 gene locus_tag LOCUS_03760 <1 1605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_146584900.1:N-acetylmuramoyl-L-alanine amidase >Feature sequence0201 267 605 gene locus_tag LOCUS_03770 267 605 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081714.1 protein_id gnl|my_center|LOCUS_03770 641 1915 gene locus_tag LOCUS_03780 641 1915 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404565.1 protein_id gnl|my_center|LOCUS_03780 2101 1976 gene locus_tag LOCUS_03790 2101 1976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 >Feature sequence0202 171 1640 gene locus_tag LOCUS_03800 171 1640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03800 1578 1587 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0203 39 497 gene locus_tag LOCUS_03810 39 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 581 1765 gene locus_tag LOCUS_03820 581 1765 CDS product FAD/NAD(P)-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461847.1 protein_id gnl|my_center|LOCUS_03820 >Feature sequence0204 1374 169 gene locus_tag LOCUS_03830 1374 169 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846995.1 protein_id gnl|my_center|LOCUS_03830 2041 1406 gene locus_tag LOCUS_03840 2041 1406 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393334.1 protein_id gnl|my_center|LOCUS_03840 >Feature sequence0205 117 779 gene locus_tag LOCUS_03850 117 779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03850 746 755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 797 1369 gene locus_tag LOCUS_03860 797 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03860 >Feature sequence0206 <1 660 gene locus_tag LOCUS_03870 <1 660 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963878.1:M48 family metallopeptidase 751 1704 gene locus_tag LOCUS_03880 751 1704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence0207 410 39 gene locus_tag LOCUS_03890 410 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 593 1342 gene locus_tag LOCUS_03900 593 1342 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817158.1 protein_id gnl|my_center|LOCUS_03900 >Feature sequence0208 2029 167 gene locus_tag LOCUS_03910 2029 167 CDS product M1 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994158.1 protein_id gnl|my_center|LOCUS_03910 >Feature sequence0209 1224 1667 gene locus_tag LOCUS_03920 1224 1667 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002120966.1 protein_id gnl|my_center|LOCUS_03920 >Feature sequence0210 1755 1000 gene locus_tag LOCUS_03930 1755 1000 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256105.1 protein_id gnl|my_center|LOCUS_03930 >Feature sequence0211 <1 745 gene locus_tag LOCUS_03940 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000843487.1:exopolysaccharide biosynthesis protein VpsJ 726 1469 gene locus_tag LOCUS_03950 726 1469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 >Feature sequence0212 1513 227 gene locus_tag LOCUS_03960 1513 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 2025 1516 gene locus_tag LOCUS_03970 2025 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 >Feature sequence0213 445 921 gene locus_tag LOCUS_03980 445 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 >Feature sequence0214 456 1580 gene locus_tag LOCUS_03990 456 1580 CDS product ATP-grasp domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257876.1 protein_id gnl|my_center|LOCUS_03990 1524 1533 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1534 1671 gene locus_tag LOCUS_04000 1534 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1679 1945 gene locus_tag LOCUS_04010 1679 1945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 >Feature sequence0215 >Feature sequence0216 <1 743 gene locus_tag LOCUS_04020 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966157.1:acetyl-CoA C-acetyltransferase 264 273 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 585 594 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 730 996 gene locus_tag LOCUS_04030 730 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04030 1112 1558 gene locus_tag LOCUS_04040 gene nusB 1112 1558 CDS product N utilization substance protein NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000830249.1 protein_id gnl|my_center|LOCUS_04040 >Feature sequence0217 337 346 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 376 1731 gene locus_tag LOCUS_04050 376 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 1617 1826 gene locus_tag LOCUS_04060 1617 1826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 1701 1710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0218 746 1378 gene locus_tag LOCUS_04070 746 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 1378 1752 gene locus_tag LOCUS_04080 1378 1752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 >Feature sequence0219 1227 58 gene locus_tag LOCUS_04090 gene lysA 1227 58 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762402.1 protein_id gnl|my_center|LOCUS_04090 2047 1280 gene locus_tag LOCUS_04100 2047 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 >Feature sequence0220 >Feature sequence0221 197 1627 gene locus_tag LOCUS_04110 197 1627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 >Feature sequence0222 <1 1041 gene locus_tag LOCUS_04120 <1 1041 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545732.1:ABC transporter substrate binding protein 1034 1675 gene locus_tag LOCUS_04130 1034 1675 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546220.1 protein_id gnl|my_center|LOCUS_04130 >Feature sequence0223 514 1566 gene locus_tag LOCUS_04140 514 1566 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565746.1 protein_id gnl|my_center|LOCUS_04140 1755 1764 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0224 15 1094 gene locus_tag LOCUS_04150 15 1094 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_04150 1537 1304 gene locus_tag LOCUS_04160 1537 1304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 1634 1643 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0225 >Feature sequence0226 1287 97 gene locus_tag LOCUS_04170 gene tuf 1287 97 CDS product elongation factor Tu inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088152.1 protein_id gnl|my_center|LOCUS_04170 1446 1373 gene locus_tag LOCUS_t00120 1446 1373 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 1633 1548 gene locus_tag LOCUS_t00130 1633 1548 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0227 >Feature sequence0228 1673 429 gene locus_tag LOCUS_04180 1673 429 CDS product ROK family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107265.1 protein_id gnl|my_center|LOCUS_04180 >Feature sequence0229 1964 702 gene locus_tag LOCUS_04190 1964 702 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545872.1 protein_id gnl|my_center|LOCUS_04190 >Feature sequence0230 <1 787 gene locus_tag LOCUS_04200 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962387.1:glycosyltransferase >Feature sequence0231 393 1811 gene locus_tag LOCUS_04210 gene purF 393 1811 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880738.1 protein_id gnl|my_center|LOCUS_04210 >Feature sequence0232 309 1250 gene locus_tag LOCUS_04220 309 1250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 >Feature sequence0233 >Feature sequence0234 >Feature sequence0235 236 1852 gene locus_tag LOCUS_04230 236 1852 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099686814.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence0236 431 1186 gene locus_tag LOCUS_04240 431 1186 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257749.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence0237 >Feature sequence0238 >Feature sequence0239 >Feature sequence0240 742 317 gene locus_tag LOCUS_04250 742 317 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257827.1 protein_id gnl|my_center|LOCUS_04250 1741 830 gene locus_tag LOCUS_04260 1741 830 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010944001.1 protein_id gnl|my_center|LOCUS_04260 1794 1982 gene locus_tag LOCUS_04270 1794 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence0241 <1 530 gene locus_tag LOCUS_04280 <1 530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase 908 1762 gene locus_tag LOCUS_04290 gene hisG 908 1762 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789131.1 protein_id gnl|my_center|LOCUS_04290 >Feature sequence0242 327 1841 gene locus_tag LOCUS_04300 327 1841 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011459240.1 protein_id gnl|my_center|LOCUS_04300 >Feature sequence0243 1208 1798 gene locus_tag LOCUS_04310 1208 1798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 >Feature sequence0244 1656 451 gene locus_tag LOCUS_04320 1656 451 CDS product trypsin-like peptidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392257.1 protein_id gnl|my_center|LOCUS_04320 2000 1674 gene locus_tag LOCUS_04330 2000 1674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence0245 1370 375 gene locus_tag LOCUS_04340 1370 375 CDS product transglutaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003408265.1 protein_id gnl|my_center|LOCUS_04340 1868 1383 gene locus_tag LOCUS_04350 1868 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 >Feature sequence0246 <1 529 gene locus_tag LOCUS_04360 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545993.1:TolC family protein 550 1662 gene locus_tag LOCUS_04370 550 1662 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010926967.1 protein_id gnl|my_center|LOCUS_04370 >Feature sequence0247 27 1196 gene locus_tag LOCUS_04380 27 1196 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879939.1 protein_id gnl|my_center|LOCUS_04380 1209 1973 gene locus_tag LOCUS_04390 1209 1973 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546323.1 protein_id gnl|my_center|LOCUS_04390 >Feature sequence0248 <1 1136 gene locus_tag LOCUS_04400 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933685.1:bifunctional aspartate kinase/homoserine dehydrogenase I >Feature sequence0249 410 1531 gene locus_tag LOCUS_04410 410 1531 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391983.1 protein_id gnl|my_center|LOCUS_04410 >Feature sequence0250 769 188 gene locus_tag LOCUS_04420 769 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 1942 914 gene locus_tag LOCUS_04430 1942 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 >Feature sequence0251 868 1464 gene locus_tag LOCUS_04440 868 1464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 >Feature sequence0252 >Feature sequence0253 <1984 1434 gene locus_tag LOCUS_04450 <1984 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839899.1:ABC transporter substrate binding protein >Feature sequence0254 <1976 486 gene locus_tag LOCUS_04460 <1976 486 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044893.1:cytochrome c3 family protein >Feature sequence0255 <1975 802 gene locus_tag LOCUS_04470 <1975 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164925192.1:POTRA domain-containing protein >Feature sequence0256 >Feature sequence0257 >Feature sequence0258 1751 186 gene locus_tag LOCUS_04480 1751 186 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062617.1 protein_id gnl|my_center|LOCUS_04480 >Feature sequence0259 <1 1575 gene locus_tag LOCUS_04490 <1 1575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942986.1:plasma-membrane proton-efflux P-type ATPase >Feature sequence0260 1122 514 gene locus_tag LOCUS_04500 1122 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 698 707 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0261 3 227 gene locus_tag LOCUS_04510 3 227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 419 273 gene locus_tag LOCUS_04520 419 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 <1963 1184 gene locus_tag LOCUS_04530 <1963 1184 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011405097.1:AMP-dependent synthetase/ligase >Feature sequence0262 <1 552 gene locus_tag LOCUS_04540 <1 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963619.1:ketoacyl-ACP synthase III 613 699 gene locus_tag LOCUS_t00140 613 699 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1072 1081 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1961 1431 gene locus_tag LOCUS_04550 1961 1431 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393578.1 protein_id gnl|my_center|LOCUS_04550 >Feature sequence0263 927 1343 gene locus_tag LOCUS_04560 927 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 1386 1622 gene locus_tag LOCUS_04570 1386 1622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04570 >Feature sequence0264 >Feature sequence0265 1260 430 gene locus_tag LOCUS_04580 1260 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 528 537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1889 1260 gene locus_tag LOCUS_04590 1889 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 >Feature sequence0266 <1 1286 gene locus_tag LOCUS_04600 <1 1286 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103038479.1:glycosyltransferase >Feature sequence0267 1083 340 gene locus_tag LOCUS_04610 1083 340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 1636 1073 gene locus_tag LOCUS_04620 1636 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 >Feature sequence0268 1017 550 gene locus_tag LOCUS_04630 1017 550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 1070 1079 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1423 1124 gene locus_tag LOCUS_04640 1423 1124 CDS product autorepressor SdpR family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101717.1 protein_id gnl|my_center|LOCUS_04640 >Feature sequence0269 >Feature sequence0270 >Feature sequence0271 >Feature sequence0272 337 894 gene locus_tag LOCUS_04650 gene rsmD 337 894 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009933092.1 protein_id gnl|my_center|LOCUS_04650 887 1384 gene locus_tag LOCUS_04660 gene coaD 887 1384 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545514.1 protein_id gnl|my_center|LOCUS_04660 >Feature sequence0273 406 1941 gene locus_tag LOCUS_04670 406 1941 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926895.1 protein_id gnl|my_center|LOCUS_04670 >Feature sequence0274 869 144 gene locus_tag LOCUS_04680 869 144 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964460.1 protein_id gnl|my_center|LOCUS_04680 >Feature sequence0275 >Feature sequence0276 >Feature sequence0277 183 192 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 208 1179 gene locus_tag LOCUS_04690 gene fabF 208 1179 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544941.1 protein_id gnl|my_center|LOCUS_04690 >Feature sequence0278 475 1377 gene locus_tag LOCUS_04700 475 1377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 >Feature sequence0279 1458 757 gene locus_tag LOCUS_04710 1458 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 1418 1427 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0280 >Feature sequence0281 <1 939 gene locus_tag LOCUS_04720 <1 939 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962444.1:two-component regulator propeller domain-containing protein >Feature sequence0282 489 1832 gene locus_tag LOCUS_04730 489 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 >Feature sequence0283 1380 802 gene locus_tag LOCUS_04740 1380 802 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545249.1 protein_id gnl|my_center|LOCUS_04740 >Feature sequence0284 1919 342 gene locus_tag LOCUS_04750 1919 342 CDS product AarF/ABC1/UbiB kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391777.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence0285 >Feature sequence0286 812 821 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1318 893 gene locus_tag LOCUS_04760 1318 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence0287 617 1042 gene locus_tag LOCUS_04770 617 1042 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020323.1 protein_id gnl|my_center|LOCUS_04770 1790 1047 gene locus_tag LOCUS_04780 gene hisA 1790 1047 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404311.1 protein_id gnl|my_center|LOCUS_04780 >Feature sequence0288 1541 246 gene locus_tag LOCUS_04790 1541 246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 >Feature sequence0289 442 38 gene locus_tag LOCUS_04800 gene mce 442 38 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869043.1 protein_id gnl|my_center|LOCUS_04800 1905 445 gene locus_tag LOCUS_04810 gene guaB 1905 445 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942835.1 protein_id gnl|my_center|LOCUS_04810 >Feature sequence0290 623 1030 gene locus_tag LOCUS_04820 623 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 1864 1013 gene locus_tag LOCUS_04830 1864 1013 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001099029.1 protein_id gnl|my_center|LOCUS_04830 >Feature sequence0291 <1900 953 gene locus_tag LOCUS_04840 <1900 953 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0292 814 479 gene locus_tag LOCUS_04850 814 479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 499 508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1900 872 gene locus_tag LOCUS_04860 <1900 872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583453.1:electron transport complex subunit RsxC >Feature sequence0293 119 601 gene locus_tag LOCUS_04870 119 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 577 942 gene locus_tag LOCUS_04880 577 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence0294 >Feature sequence0295 <1 677 gene locus_tag LOCUS_04890 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403334.1:UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase 564 573 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 688 1338 gene locus_tag LOCUS_04900 688 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04900 1200 1209 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1224 1832 gene locus_tag LOCUS_04910 1224 1832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04910 >Feature sequence0296 922 131 gene locus_tag LOCUS_04920 922 131 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392313.1 protein_id gnl|my_center|LOCUS_04920 423 432 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1896 919 gene locus_tag LOCUS_04930 <1896 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011460748.1:flagellar biosynthesis protein FlhF >Feature sequence0297 1106 30 gene locus_tag LOCUS_04940 gene gcvT 1106 30 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_04940 <1895 1067 gene locus_tag LOCUS_04950 <1895 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867693.1:glutamate dehydrogenase 1124 1133 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0298 <1 1018 gene locus_tag LOCUS_04960 <1 1018 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010922186.1:branched-chain amino acid aminotransferase >Feature sequence0299 248 1855 gene locus_tag LOCUS_04970 248 1855 CDS product glutathione ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_224065212.1 protein_id gnl|my_center|LOCUS_04970 >Feature sequence0300 1684 656 gene locus_tag LOCUS_04980 1684 656 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942602.1 protein_id gnl|my_center|LOCUS_04980 >Feature sequence0301 >Feature sequence0302 1147 335 gene locus_tag LOCUS_04990 1147 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1799 1239 gene locus_tag LOCUS_05000 1799 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence0303 >Feature sequence0304 540 1040 gene locus_tag LOCUS_05010 540 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 >Feature sequence0305 >Feature sequence0306 >Feature sequence0307 1823 507 gene locus_tag LOCUS_05020 1823 507 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975508.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence0308 <1 1449 gene locus_tag LOCUS_05030 <1 1449 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_152945460.1:efflux RND transporter permease subunit 1874 1596 gene locus_tag LOCUS_05040 1874 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 >Feature sequence0309 1 480 gene locus_tag LOCUS_05050 1 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 806 1015 gene locus_tag LOCUS_05060 806 1015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 1105 1314 gene locus_tag LOCUS_05070 1105 1314 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082372.1 protein_id gnl|my_center|LOCUS_05070 1392 1604 gene locus_tag LOCUS_05080 1392 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence0310 >Feature sequence0311 <1865 1334 gene locus_tag LOCUS_05090 <1865 1334 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391657.1:formate--tetrahydrofolate ligase >Feature sequence0312 >Feature sequence0313 <1 528 gene locus_tag LOCUS_05100 <1 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011090881.1:molybdate ABC transporter substrate-binding protein 539 1228 gene locus_tag LOCUS_05110 gene modB 539 1228 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073622.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence0314 <1857 837 gene locus_tag LOCUS_05120 <1857 837 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013533209.1:GNAT family N-acetyltransferase >Feature sequence0315 1704 649 gene locus_tag LOCUS_05130 1704 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 >Feature sequence0316 650 450 gene locus_tag LOCUS_05140 650 450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 903 643 gene locus_tag LOCUS_05150 903 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 695 704 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1857 1153 gene locus_tag LOCUS_05160 <1857 1153 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870705.1:Ni/Fe hydrogenase subunit alpha 1178 1187 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0317 471 1580 gene locus_tag LOCUS_05170 471 1580 CDS product DUF444 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_044233828.1 protein_id gnl|my_center|LOCUS_05170 >Feature sequence0318 544 71 gene locus_tag LOCUS_05180 gene ribE 544 71 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003358088.1 protein_id gnl|my_center|LOCUS_05180 1836 601 gene locus_tag LOCUS_05190 1836 601 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546813.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence0319 850 1635 gene locus_tag LOCUS_05200 850 1635 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048149073.1 protein_id gnl|my_center|LOCUS_05200 1855 1709 gene locus_tag LOCUS_05210 1855 1709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 >Feature sequence0320 >Feature sequence0321 81 608 gene locus_tag LOCUS_05220 gene rplJ 81 608 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943495.1 protein_id gnl|my_center|LOCUS_05220 649 1035 gene locus_tag LOCUS_05230 gene rplL 649 1035 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943494.1 protein_id gnl|my_center|LOCUS_05230 >Feature sequence0322 >Feature sequence0323 <1842 59 gene locus_tag LOCUS_05240 <1842 59 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924872.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence0324 <1 728 gene locus_tag LOCUS_05250 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546259.1:galactose-1-phosphate uridylyltransferase >Feature sequence0325 <1837 790 gene locus_tag LOCUS_05260 <1837 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403512.1:oxygen-independent coproporphyrinogen III oxidase >Feature sequence0326 >Feature sequence0327 1195 161 gene locus_tag LOCUS_05270 1195 161 CDS product FemAB family PEP-CTERM system-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011787328.1 protein_id gnl|my_center|LOCUS_05270 <1836 1219 gene locus_tag LOCUS_05280 <1836 1219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003228249.1:protein tyrosine kinase EpsB >Feature sequence0328 447 1046 gene locus_tag LOCUS_05290 gene hisIE 447 1046 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762399.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence0329 <1829 581 gene locus_tag LOCUS_05300 <1829 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064964.1:DUF5050 domain-containing protein >Feature sequence0330 2 145 gene locus_tag LOCUS_05310 2 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 940 164 gene locus_tag LOCUS_05320 940 164 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228854.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence0331 <1827 35 gene locus_tag LOCUS_05330 <1827 35 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583490.1:PBP1A family penicillin-binding protein >Feature sequence0332 1761 562 gene locus_tag LOCUS_05340 1761 562 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839261.1 protein_id gnl|my_center|LOCUS_05340 >Feature sequence0333 <1 1178 gene locus_tag LOCUS_05350 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000372295.1:TAT-variant-translocated molybdopterin oxidoreductase >Feature sequence0334 151 1152 gene locus_tag LOCUS_05360 gene gap 151 1152 CDS product type I glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391806.1 protein_id gnl|my_center|LOCUS_05360 >Feature sequence0335 <1 1150 gene locus_tag LOCUS_05370 <1 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703698.1:gamma-glutamyltransferase 1164 1442 gene locus_tag LOCUS_05380 1164 1442 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 >Feature sequence0336 250 1425 gene locus_tag LOCUS_05390 250 1425 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058190.1 protein_id gnl|my_center|LOCUS_05390 >Feature sequence0337 1636 314 gene locus_tag LOCUS_05400 gene glnA 1636 314 CDS product type I glutamate--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173386.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence0338 202 654 gene locus_tag LOCUS_05410 202 654 CDS product Fur family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002357560.1 protein_id gnl|my_center|LOCUS_05410 668 677 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1812 854 gene locus_tag LOCUS_05420 <1812 854 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421613.1:S9 family peptidase >Feature sequence0339 <1809 681 gene locus_tag LOCUS_05430 <1809 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938700.1:radical SAM protein >Feature sequence0340 976 353 gene locus_tag LOCUS_05440 976 353 CDS product succinate dehydrogenase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257751.1 protein_id gnl|my_center|LOCUS_05440 1794 1282 gene locus_tag LOCUS_05450 1794 1282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 >Feature sequence0341 931 2 gene locus_tag LOCUS_05460 931 2 CDS product aspartate carbamoyltransferase catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583924.1 protein_id gnl|my_center|LOCUS_05460 1494 943 gene locus_tag LOCUS_05470 gene pyrR 1494 943 CDS product bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_196768320.1 protein_id gnl|my_center|LOCUS_05470 1681 1607 gene locus_tag LOCUS_t00150 1681 1607 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0342 1012 539 gene locus_tag LOCUS_05480 1012 539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 696 705 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1472 1020 gene locus_tag LOCUS_05490 gene ribH 1472 1020 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008634050.1 protein_id gnl|my_center|LOCUS_05490 >Feature sequence0343 1484 465 gene locus_tag LOCUS_05500 1484 465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 >Feature sequence0344 356 1291 gene locus_tag LOCUS_05510 gene thyX 356 1291 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004597389.1 protein_id gnl|my_center|LOCUS_05510 >Feature sequence0345 >Feature sequence0346 <1 1050 gene locus_tag LOCUS_05520 <1 1050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202604.1:bifunctional metallophosphatase/5'-nucleotidase 1120 1437 gene locus_tag LOCUS_05530 1120 1437 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986832.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence0347 420 49 gene locus_tag LOCUS_05540 420 49 CDS product PTS sugar transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942528.1 protein_id gnl|my_center|LOCUS_05540 767 420 gene locus_tag LOCUS_05550 767 420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05550 1414 773 gene locus_tag LOCUS_05560 1414 773 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05560 780 789 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1794 1552 gene locus_tag LOCUS_05570 1794 1552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05570 >Feature sequence0348 1346 303 gene locus_tag LOCUS_05580 gene trpD 1346 303 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966438.1 protein_id gnl|my_center|LOCUS_05580 >Feature sequence0349 <1 1376 gene locus_tag LOCUS_05590 <1 1376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421620.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence0350 >Feature sequence0351 1476 490 gene locus_tag LOCUS_05600 gene pstS 1476 490 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096673.1 protein_id gnl|my_center|LOCUS_05600 >Feature sequence0352 627 1088 gene locus_tag LOCUS_05610 627 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 1123 1359 gene locus_tag LOCUS_05620 1123 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 1356 1556 gene locus_tag LOCUS_05630 1356 1556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 >Feature sequence0353 >Feature sequence0354 3 248 gene locus_tag LOCUS_05640 3 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 280 714 gene locus_tag LOCUS_05650 gene fliJ 280 714 CDS product flagellar export protein FliJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021361275.1 protein_id gnl|my_center|LOCUS_05650 735 1262 gene locus_tag LOCUS_05660 735 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 >Feature sequence0355 >Feature sequence0356 >Feature sequence0357 <1 994 gene locus_tag LOCUS_05670 <1 994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037269.1:endonuclease 1161 1316 gene locus_tag LOCUS_05680 1161 1316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 >Feature sequence0358 1721 477 gene locus_tag LOCUS_05690 gene nrfD 1721 477 CDS product polysulfide reductase NrfD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011462220.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence0359 288 297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 596 1762 gene locus_tag LOCUS_05700 596 1762 CDS product IS256-like element ISEfm2 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002287941.1 protein_id gnl|my_center|LOCUS_05700 >Feature sequence0360 <1 630 gene locus_tag LOCUS_05710 <1 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766232.1:histidinol dehydrogenase >Feature sequence0361 348 728 gene locus_tag LOCUS_05720 348 728 CDS product DsrE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877699.1 protein_id gnl|my_center|LOCUS_05720 784 1242 gene locus_tag LOCUS_05730 784 1242 CDS product glycine cleavage system protein H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881076.1 protein_id gnl|my_center|LOCUS_05730 >Feature sequence0362 388 1314 gene locus_tag LOCUS_05740 388 1314 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081431.1 protein_id gnl|my_center|LOCUS_05740 >Feature sequence0363 1 525 gene locus_tag LOCUS_05750 1 525 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 592 1542 gene locus_tag LOCUS_05760 gene arcC 592 1542 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393446.1 protein_id gnl|my_center|LOCUS_05760 >Feature sequence0364 1335 256 gene locus_tag LOCUS_05770 gene nadA 1335 256 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404647.1 protein_id gnl|my_center|LOCUS_05770 >Feature sequence0365 579 205 gene locus_tag LOCUS_05780 579 205 CDS product STAS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942075.1 protein_id gnl|my_center|LOCUS_05780 1243 716 gene locus_tag LOCUS_05790 1243 716 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964313.1 protein_id gnl|my_center|LOCUS_05790 >Feature sequence0366 <1 722 gene locus_tag LOCUS_05800 <1 722 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259581.1:GHMP kinase >Feature sequence0367 >Feature sequence0368 1113 1122 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0369 505 1512 gene locus_tag LOCUS_05810 505 1512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05810 >Feature sequence0370 <1753 8 gene locus_tag LOCUS_05820 <1753 8 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118840167.1:T9SS type A sorting domain-containing protein >Feature sequence0371 688 1452 gene locus_tag LOCUS_05830 688 1452 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403290.1 protein_id gnl|my_center|LOCUS_05830 >Feature sequence0372 >Feature sequence0373 <1 634 gene locus_tag LOCUS_05840 <1 634 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545758.1:radical SAM protein 847 1245 gene locus_tag LOCUS_05850 847 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 1261 1644 gene locus_tag LOCUS_05860 1261 1644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence0374 217 1038 gene locus_tag LOCUS_05870 217 1038 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404801.1 protein_id gnl|my_center|LOCUS_05870 1031 1642 gene locus_tag LOCUS_05880 gene nadD 1031 1642 CDS product nicotinate-nucleotide adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392101.1 protein_id gnl|my_center|LOCUS_05880 >Feature sequence0375 >Feature sequence0376 <1743 914 gene locus_tag LOCUS_05890 <1743 914 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007325399.1:ATP-binding protein >Feature sequence0377 >Feature sequence0378 <1 616 gene locus_tag LOCUS_05900 <1 616 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479947.1:S49 family peptidase 1421 708 gene locus_tag LOCUS_05910 1421 708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 >Feature sequence0379 697 311 gene locus_tag LOCUS_05920 697 311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 1178 726 gene locus_tag LOCUS_05930 1178 726 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083188.1 protein_id gnl|my_center|LOCUS_05930 >Feature sequence0380 824 165 gene locus_tag LOCUS_05940 824 165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 1488 925 gene locus_tag LOCUS_05950 1488 925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 >Feature sequence0381 >Feature sequence0382 >Feature sequence0383 >Feature sequence0384 <1 1548 gene locus_tag LOCUS_05960 <1 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000727474.1:peptidylprolyl isomerase >Feature sequence0385 >Feature sequence0386 1202 324 gene locus_tag LOCUS_05970 1202 324 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_05970 >Feature sequence0387 1644 355 gene locus_tag LOCUS_05980 gene hemA 1644 355 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933093.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence0388 >Feature sequence0389 1721 273 gene locus_tag LOCUS_05990 1721 273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 >Feature sequence0390 >Feature sequence0391 <1 1077 gene locus_tag LOCUS_06000 <1 1077 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943778.1:alpha/beta fold hydrolase >Feature sequence0392 <1 1138 gene locus_tag LOCUS_06010 <1 1138 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001218596.1:glycerol-3-phosphate dehydrogenase/oxidase >Feature sequence0393 872 498 gene locus_tag LOCUS_06020 gene gcvH 872 498 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_06020 <1718 886 gene locus_tag LOCUS_06030 <1718 886 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942662.1:acetyl-CoA carboxylase biotin carboxylase subunit >Feature sequence0394 <1 1145 gene locus_tag LOCUS_06040 <1 1145 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920774.1:response regulator >Feature sequence0395 1671 208 gene locus_tag LOCUS_06050 gene cysS 1671 208 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933811.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence0396 >Feature sequence0397 25 939 gene locus_tag LOCUS_06060 25 939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06060 884 1603 gene locus_tag LOCUS_06070 884 1603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06070 892 901 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0398 1310 39 gene locus_tag LOCUS_06080 1310 39 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037710.1 protein_id gnl|my_center|LOCUS_06080 >Feature sequence0399 1024 392 gene locus_tag LOCUS_06090 1024 392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 >Feature sequence0400 >Feature sequence0401 477 875 gene locus_tag LOCUS_06100 477 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 >Feature sequence0402 <1705 789 gene locus_tag LOCUS_06110 <1705 789 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924874.1:ATP-binding protein >Feature sequence0403 >Feature sequence0404 >Feature sequence0405 >Feature sequence0406 1374 793 gene locus_tag LOCUS_06120 gene gmhA 1374 793 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390355.1 protein_id gnl|my_center|LOCUS_06120 >Feature sequence0407 >Feature sequence0408 113 1576 gene locus_tag LOCUS_06130 113 1576 CDS product IS1182 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009129703.1 protein_id gnl|my_center|LOCUS_06130 >Feature sequence0409 504 1592 gene locus_tag LOCUS_06140 504 1592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 >Feature sequence0410 332 1132 gene locus_tag LOCUS_06150 332 1132 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 >Feature sequence0411 538 547 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1416 718 gene locus_tag LOCUS_06160 1416 718 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038966631.1 protein_id gnl|my_center|LOCUS_06160 >Feature sequence0412 1341 73 gene locus_tag LOCUS_06170 1341 73 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946753.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence0413 >Feature sequence0414 1286 1522 gene locus_tag LOCUS_06180 1286 1522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 >Feature sequence0415 <1 1097 gene locus_tag LOCUS_06190 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_177221404.1:preprotein translocase subunit SecA 542 551 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1197 1364 gene locus_tag LOCUS_06200 1197 1364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 >Feature sequence0416 <1 836 gene locus_tag LOCUS_06210 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941478.1:ATP-binding protein >Feature sequence0417 3 122 gene locus_tag LOCUS_06220 3 122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 125 1045 gene locus_tag LOCUS_06230 125 1045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 >Feature sequence0418 >Feature sequence0419 <1 1326 gene locus_tag LOCUS_06240 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005169575.1:ABC transporter substrate-binding protein 1375 1384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0420 <1 538 gene locus_tag LOCUS_06250 <1 538 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943453.1:ABC transporter permease 1098 673 gene locus_tag LOCUS_06260 1098 673 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_06260 >Feature sequence0421 <1 799 gene locus_tag LOCUS_06270 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403313.1:M1 family metallopeptidase >Feature sequence0422 687 696 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1112 906 gene locus_tag LOCUS_06280 1112 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 >Feature sequence0423 <1681 58 gene locus_tag LOCUS_06290 <1681 58 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001003185.1:heavy metal translocating P-type ATPase >Feature sequence0424 142 333 gene locus_tag LOCUS_06300 142 333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 330 1271 gene locus_tag LOCUS_06310 330 1271 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004521934.1 protein_id gnl|my_center|LOCUS_06310 >Feature sequence0425 988 209 gene locus_tag LOCUS_06320 988 209 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390659.1 protein_id gnl|my_center|LOCUS_06320 <1676 997 gene locus_tag LOCUS_06330 <1676 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_223294607.1:MlaE family lipid ABC transporter permease subunit >Feature sequence0426 >Feature sequence0427 <1673 850 gene locus_tag LOCUS_06340 <1673 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123790.1:TlpA disulfide reductase family protein >Feature sequence0428 <1 919 gene locus_tag LOCUS_06350 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_201372230.1:phosphoenolpyruvate synthase >Feature sequence0429 <1 816 gene locus_tag LOCUS_06360 <1 816 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000091291.1:ferredoxin-type protein NapG >Feature sequence0430 >Feature sequence0431 223 1113 gene locus_tag LOCUS_06370 gene era 223 1113 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001080241.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence0432 976 248 gene locus_tag LOCUS_06380 976 248 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125241.1 protein_id gnl|my_center|LOCUS_06380 1531 995 gene locus_tag LOCUS_06390 1531 995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 >Feature sequence0433 >Feature sequence0434 127 1665 gene locus_tag LOCUS_06400 127 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06400 >Feature sequence0435 444 1499 gene locus_tag LOCUS_06410 444 1499 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143639.1 protein_id gnl|my_center|LOCUS_06410 >Feature sequence0436 646 1044 gene locus_tag LOCUS_06420 646 1044 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082423.1 protein_id gnl|my_center|LOCUS_06420 <1665 1067 gene locus_tag LOCUS_06430 <1665 1067 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005808357.1:diacylglycerol kinase family lipid kinase >Feature sequence0437 >Feature sequence0438 1292 159 gene locus_tag LOCUS_06440 gene ald 1292 159 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011118338.1 protein_id gnl|my_center|LOCUS_06440 >Feature sequence0439 >Feature sequence0440 <1661 402 gene locus_tag LOCUS_06450 <1661 402 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048538435.1:S9 family peptidase >Feature sequence0441 >Feature sequence0442 <1 832 gene locus_tag LOCUS_06460 <1 832 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123093.1:C40 family peptidase <1658 1137 gene locus_tag LOCUS_06470 <1658 1137 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0443 <1 1076 gene locus_tag LOCUS_06480 <1 1076 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235045002.1:PAS domain S-box protein >Feature sequence0444 <1656 127 gene locus_tag LOCUS_06490 <1656 127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123515.1:type I polyketide synthase 198 207 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0445 1457 1466 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0446 >Feature sequence0447 <1 945 gene locus_tag LOCUS_06500 <1 945 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839930.1:N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase <1653 997 gene locus_tag LOCUS_06510 <1653 997 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257877.1:CUAEP/CCAEP-tail radical SAM protein >Feature sequence0448 >Feature sequence0449 584 593 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0450 >Feature sequence0451 <1 681 gene locus_tag LOCUS_06520 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962462.1:DNA polymerase I 1365 853 gene locus_tag LOCUS_06530 1365 853 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence0452 <1 1345 gene locus_tag LOCUS_06540 <1 1345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228149.1:aconitate hydratase AcnA >Feature sequence0453 <1643 302 gene locus_tag LOCUS_06550 <1643 302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001142683.1:aldehyde dehydrogenase family protein >Feature sequence0454 >Feature sequence0455 >Feature sequence0456 >Feature sequence0457 3 1058 gene locus_tag LOCUS_06560 3 1058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 1055 1465 gene locus_tag LOCUS_06570 1055 1465 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 >Feature sequence0458 >Feature sequence0459 >Feature sequence0460 372 791 gene locus_tag LOCUS_06580 372 791 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_06580 975 793 gene locus_tag LOCUS_06590 975 793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 1179 991 gene locus_tag LOCUS_06600 1179 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 >Feature sequence0461 <1 1310 gene locus_tag LOCUS_06610 <1 1310 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227631.1:pyruvate kinase >Feature sequence0462 371 1546 gene locus_tag LOCUS_06620 371 1546 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037402650.1 protein_id gnl|my_center|LOCUS_06620 >Feature sequence0463 >Feature sequence0464 >Feature sequence0465 895 428 gene locus_tag LOCUS_06630 gene rpsG 895 428 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545233.1 protein_id gnl|my_center|LOCUS_06630 1286 915 gene locus_tag LOCUS_06640 gene rpsL 1286 915 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938593.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence0466 <1613 36 gene locus_tag LOCUS_06650 <1613 36 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011142469.1:M14 family metallopeptidase >Feature sequence0467 809 291 gene locus_tag LOCUS_06660 809 291 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256182.1 protein_id gnl|my_center|LOCUS_06660 1106 828 gene locus_tag LOCUS_06670 1106 828 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868779.1 protein_id gnl|my_center|LOCUS_06670 1582 1106 gene locus_tag LOCUS_06680 1582 1106 CDS product TIGR00725 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022480.1 protein_id gnl|my_center|LOCUS_06680 >Feature sequence0468 1549 998 gene locus_tag LOCUS_06690 1549 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 >Feature sequence0469 3 1259 gene locus_tag LOCUS_06700 3 1259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06700 >Feature sequence0470 1117 47 gene locus_tag LOCUS_06710 1117 47 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942298.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence0471 <1605 17 gene locus_tag LOCUS_06720 <1605 17 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037073.1:prolyl oligopeptidase family serine peptidase 697 706 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0472 1230 463 gene locus_tag LOCUS_06730 1230 463 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 >Feature sequence0473 765 394 gene locus_tag LOCUS_06740 765 394 CDS product hotdog domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173828.1 protein_id gnl|my_center|LOCUS_06740 1479 775 gene locus_tag LOCUS_06750 1479 775 CDS product Clp1/GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227746.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence0474 >Feature sequence0475 >Feature sequence0476 230 1369 gene locus_tag LOCUS_06760 230 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 >Feature sequence0477 3 689 gene locus_tag LOCUS_06770 3 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 734 1045 gene locus_tag LOCUS_06780 734 1045 CDS product ribulose bisphosphate carboxylase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057344.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence0478 1107 385 gene locus_tag LOCUS_06790 1107 385 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838510.1 protein_id gnl|my_center|LOCUS_06790 >Feature sequence0479 922 931 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0480 <1 767 gene locus_tag LOCUS_06800 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933591.1:trigger factor 774 1367 gene locus_tag LOCUS_06810 gene clpP 774 1367 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942436.1 protein_id gnl|my_center|LOCUS_06810 >Feature sequence0481 >Feature sequence0482 >Feature sequence0483 1365 250 gene locus_tag LOCUS_06820 1365 250 CDS product sorbosone dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940868.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence0484 <1 1093 gene locus_tag LOCUS_06830 <1 1093 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016467.1:glycosyltransferase family 9 protein >Feature sequence0485 >Feature sequence0486 >Feature sequence0487 358 367 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0488 192 1076 gene locus_tag LOCUS_06840 gene purU 192 1076 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762395.1 protein_id gnl|my_center|LOCUS_06840 1588 1175 gene locus_tag LOCUS_06850 1588 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 >Feature sequence0489 <1 1057 gene locus_tag LOCUS_06860 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206690.1:TonB-dependent siderophore receptor >Feature sequence0490 1017 394 gene locus_tag LOCUS_06870 1017 394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence0491 44 117 gene locus_tag LOCUS_t00160 44 117 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0492 686 357 gene locus_tag LOCUS_06880 686 357 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 1507 710 gene locus_tag LOCUS_06890 1507 710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 >Feature sequence0493 1515 229 gene locus_tag LOCUS_06900 1515 229 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_06900 >Feature sequence0494 >Feature sequence0495 453 1259 gene locus_tag LOCUS_06910 453 1259 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932019.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence0496 <1574 466 gene locus_tag LOCUS_06920 <1574 466 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881287.1:GspE/PulE family protein >Feature sequence0497 >Feature sequence0498 <1572 986 gene locus_tag LOCUS_06930 <1572 986 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943985.1:ribulose-phosphate 3-epimerase >Feature sequence0499 >Feature sequence0500 858 496 gene locus_tag LOCUS_06940 858 496 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384683.1 protein_id gnl|my_center|LOCUS_06940 <1569 909 gene locus_tag LOCUS_06950 <1569 909 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192663.1:methyltransferase >Feature sequence0501 >Feature sequence0502 >Feature sequence0503 18 >1567 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccctcataggtatgctgaaaac >Feature sequence0504 459 629 gene locus_tag LOCUS_06960 459 629 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 1521 736 gene locus_tag LOCUS_06970 1521 736 CDS product enoyl-CoA hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004201757.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence0505 <1562 474 gene locus_tag LOCUS_06980 <1562 474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880684.1:glycosyltransferase family 1 protein >Feature sequence0506 >Feature sequence0507 >Feature sequence0508 3 821 gene locus_tag LOCUS_06990 3 821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 >Feature sequence0509 >Feature sequence0510 <1556 146 gene locus_tag LOCUS_07000 <1556 146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000595158.1:gamma-glutamyltransferase >Feature sequence0511 1032 10 gene locus_tag LOCUS_07010 1032 10 CDS product zinc-binding dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000644533.1 protein_id gnl|my_center|LOCUS_07010 1466 1035 gene locus_tag LOCUS_07020 1466 1035 CDS product BrxA/BrxB family bacilliredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000063712.1 protein_id gnl|my_center|LOCUS_07020 >Feature sequence0512 >Feature sequence0513 >Feature sequence0514 330 731 gene locus_tag LOCUS_07030 330 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 753 1172 gene locus_tag LOCUS_07040 753 1172 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404423.1 protein_id gnl|my_center|LOCUS_07040 >Feature sequence0515 480 965 gene locus_tag LOCUS_07050 480 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence0516 1179 904 gene locus_tag LOCUS_07060 1179 904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 >Feature sequence0517 1278 682 gene locus_tag LOCUS_07070 1278 682 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861311.1 protein_id gnl|my_center|LOCUS_07070 >Feature sequence0518 <1 1252 gene locus_tag LOCUS_07080 <1 1252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010926030.1:pyridoxal phosphate-dependent aminotransferase >Feature sequence0519 11 202 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtctcaatcccctctgaaaaacggggcgtctgcaag <1548 483 gene locus_tag LOCUS_07090 <1548 483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250080.1:2-oxoacid:ferredoxin oxidoreductase subunit beta >Feature sequence0520 >Feature sequence0521 1 153 gene locus_tag LOCUS_07100 1 153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 157 1485 gene locus_tag LOCUS_07110 157 1485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence0522 262 546 gene locus_tag LOCUS_07120 262 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 550 846 gene locus_tag LOCUS_07130 550 846 CDS product cell division protein ZapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393250.1 protein_id gnl|my_center|LOCUS_07130 >Feature sequence0523 966 619 gene locus_tag LOCUS_07140 gene rplT 966 619 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264177.1 protein_id gnl|my_center|LOCUS_07140 1185 991 gene locus_tag LOCUS_07150 gene rpmI 1185 991 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770936.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence0524 <1546 585 gene locus_tag LOCUS_07160 <1546 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941790.1:sigma-54 dependent transcriptional regulator >Feature sequence0525 <1544 428 gene locus_tag LOCUS_07170 <1544 428 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011762026.1:acetate--CoA ligase >Feature sequence0526 1059 229 gene locus_tag LOCUS_07180 gene menH 1059 229 CDS product 2-succinyl-6-hydroxy-2,4-cyclohexadiene-1-carboxylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933504.1 protein_id gnl|my_center|LOCUS_07180 >Feature sequence0527 <1 1012 gene locus_tag LOCUS_07190 <1 1012 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256451.1:DUF3179 domain-containing protein 1370 1122 gene locus_tag LOCUS_07200 1370 1122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence0528 270 1532 gene locus_tag LOCUS_07210 gene mexH 270 1532 CDS product multidrug efflux RND transporter periplasmic adaptor MexH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104731.1 protein_id gnl|my_center|LOCUS_07210 >Feature sequence0529 93 1172 gene locus_tag LOCUS_07220 93 1172 CDS product PA0069 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011974655.1 protein_id gnl|my_center|LOCUS_07220 >Feature sequence0530 <1 553 gene locus_tag LOCUS_07230 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027997314.1:CusA/CzcA family heavy metal efflux RND transporter 550 1326 gene locus_tag LOCUS_07240 gene lgt 550 1326 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583316.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence0531 360 369 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 375 1112 gene locus_tag LOCUS_07250 375 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1077 1086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1531 1196 gene locus_tag LOCUS_07260 1531 1196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 >Feature sequence0532 >Feature sequence0533 >Feature sequence0534 <1537 570 gene locus_tag LOCUS_07270 <1537 570 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403763.1:sulfotransferase >Feature sequence0535 1094 1103 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0536 <1535 943 gene locus_tag LOCUS_07280 <1535 943 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839758.1:basic secretory protein-like protein note possible pseudo, frameshifted 1028 1037 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0537 555 707 gene locus_tag LOCUS_07290 555 707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 >Feature sequence0538 1339 767 gene locus_tag LOCUS_07300 gene pth 1339 767 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257532.1 protein_id gnl|my_center|LOCUS_07300 >Feature sequence0539 >Feature sequence0540 >Feature sequence0541 1440 601 gene locus_tag LOCUS_07310 1440 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 >Feature sequence0542 >Feature sequence0543 970 200 gene locus_tag LOCUS_07320 970 200 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770966.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence0544 874 245 gene locus_tag LOCUS_07330 874 245 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103021216.1 protein_id gnl|my_center|LOCUS_07330 1302 1003 gene locus_tag LOCUS_07340 1302 1003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 1101 1110 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0545 265 1005 gene locus_tag LOCUS_07350 265 1005 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943067.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence0546 <1 1120 gene locus_tag LOCUS_07360 <1 1120 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973240.1:thioester reductase domain-containing protein note possible pseudo, frameshifted 1077 1086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0547 2 415 gene locus_tag LOCUS_07370 2 415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 412 984 gene locus_tag LOCUS_07380 412 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence0548 <1 898 gene locus_tag LOCUS_07390 <1 898 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545008.1:glycoside hydrolase family 57 protein >Feature sequence0549 29 730 gene locus_tag LOCUS_07400 29 730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 >Feature sequence0550 >Feature sequence0551 835 338 gene locus_tag LOCUS_07410 835 338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 >Feature sequence0552 1045 494 gene locus_tag LOCUS_07420 gene hpt 1045 494 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404455.1 protein_id gnl|my_center|LOCUS_07420 >Feature sequence0553 463 996 gene locus_tag LOCUS_07430 463 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 >Feature sequence0554 <1518 968 gene locus_tag LOCUS_07440 <1518 968 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924817.1:bi-domain-containing oxidoreductase >Feature sequence0555 1516 617 gene locus_tag LOCUS_07450 1516 617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 >Feature sequence0556 2 487 gene locus_tag LOCUS_07460 2 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07460 492 701 gene locus_tag LOCUS_07470 492 701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 713 1096 gene locus_tag LOCUS_07480 713 1096 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404917.1 protein_id gnl|my_center|LOCUS_07480 >Feature sequence0557 >Feature sequence0558 <1515 850 gene locus_tag LOCUS_07490 <1515 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546781.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA >Feature sequence0559 >Feature sequence0560 814 146 gene locus_tag LOCUS_07500 814 146 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_07500 1323 820 gene locus_tag LOCUS_07510 1323 820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 >Feature sequence0561 >Feature sequence0562 217 843 gene locus_tag LOCUS_07520 217 843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07520 >Feature sequence0563 920 639 gene locus_tag LOCUS_07530 920 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 >Feature sequence0564 <1 919 gene locus_tag LOCUS_07540 <1 919 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762240.1:inositol-3-phosphate synthase >Feature sequence0565 <1 769 gene locus_tag LOCUS_07550 <1 769 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000783220.1:NAD(P)-dependent oxidoreductase >Feature sequence0566 >Feature sequence0567 >Feature sequence0568 <1 1328 gene locus_tag LOCUS_07560 <1 1328 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_190973259.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence0569 89 853 gene locus_tag LOCUS_07570 89 853 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957443.1 protein_id gnl|my_center|LOCUS_07570 >Feature sequence0570 <1501 552 gene locus_tag LOCUS_07580 <1501 552 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141951.1:fatty acyl-AMP ligase note possible pseudo, frameshifted 582 591 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0571 <1 1058 gene locus_tag LOCUS_07590 <1 1058 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003244371.1:MOP flippase family protein >Feature sequence0572 >Feature sequence0573 <1498 453 gene locus_tag LOCUS_07600 <1498 453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545939.1:F420-non-reducing hydrogenase subunit G >Feature sequence0574 324 872 gene locus_tag LOCUS_07610 324 872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 <1497 881 gene locus_tag LOCUS_07620 <1497 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203082.1:SpoIIE family protein phosphatase >Feature sequence0575 1226 399 gene locus_tag LOCUS_07630 1226 399 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_139456841.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence0576 >Feature sequence0577 >Feature sequence0578 1406 99 gene locus_tag LOCUS_07640 1406 99 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 >Feature sequence0579 >Feature sequence0580 267 506 gene locus_tag LOCUS_07650 267 506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 >Feature sequence0581 >Feature sequence0582 69 1223 gene locus_tag LOCUS_07660 69 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence0583 1326 1335 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0584 1491 613 gene locus_tag LOCUS_07670 1491 613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence0585 1378 1043 gene locus_tag LOCUS_07680 1378 1043 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405249.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence0586 18 1455 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttcagcatacctatgagggattgaaac >Feature sequence0587 642 133 gene locus_tag LOCUS_07690 642 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 >Feature sequence0588 >Feature sequence0589 >Feature sequence0590 1198 887 gene locus_tag LOCUS_07700 1198 887 CDS product non-heme iron oxygenase ferredoxin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259323.1 protein_id gnl|my_center|LOCUS_07700 >Feature sequence0591 >Feature sequence0592 1 642 gene locus_tag LOCUS_07710 1 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 >Feature sequence0593 658 41 gene locus_tag LOCUS_07720 658 41 CDS product YeeE/YedE thiosulfate transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942948.1 protein_id gnl|my_center|LOCUS_07720 <1481 655 gene locus_tag LOCUS_07730 <1481 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011086306.1:YeeE/YedE thiosulfate transporter family protein >Feature sequence0594 188 1303 gene locus_tag LOCUS_07740 188 1303 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013533192.1 protein_id gnl|my_center|LOCUS_07740 >Feature sequence0595 856 614 gene locus_tag LOCUS_07750 856 614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 <1480 819 gene locus_tag LOCUS_07760 <1480 819 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249925.1:MATE family efflux transporter 828 837 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0596 29 922 gene locus_tag LOCUS_07770 29 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 >Feature sequence0597 1085 21 gene locus_tag LOCUS_07780 1085 21 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257837.1 protein_id gnl|my_center|LOCUS_07780 >Feature sequence0598 207 1163 gene locus_tag LOCUS_07790 207 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 >Feature sequence0599 >Feature sequence0600 >Feature sequence0601 87 1142 gene locus_tag LOCUS_07800 87 1142 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_07800 >Feature sequence0602 <1 607 gene locus_tag LOCUS_07810 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_236616218.1:cytochrome c peroxidase >Feature sequence0603 >Feature sequence0604 <1 797 gene locus_tag LOCUS_07820 <1 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766132.1:sodium:solute symporter >Feature sequence0605 1458 520 gene locus_tag LOCUS_07830 1458 520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence0606 <1469 934 gene locus_tag LOCUS_07840 <1469 934 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010966321.1:CpsD/CapB family tyrosine-protein kinase >Feature sequence0607 >Feature sequence0608 1278 484 gene locus_tag LOCUS_07850 1278 484 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391812.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence0609 685 344 gene locus_tag LOCUS_07860 gene trxA 685 344 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009871903.1 protein_id gnl|my_center|LOCUS_07860 869 878 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0610 >Feature sequence0611 1128 202 gene locus_tag LOCUS_07870 1128 202 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102801083.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence0612 570 139 gene locus_tag LOCUS_07880 570 139 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_07880 <1460 718 gene locus_tag LOCUS_07890 <1460 718 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0613 >Feature sequence0614 805 26 gene locus_tag LOCUS_07900 805 26 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence0615 <1460 271 gene locus_tag LOCUS_07910 <1460 271 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545466.1:endopeptidase La >Feature sequence0616 <1459 446 gene locus_tag LOCUS_07920 <1459 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004291480.1:ATP-binding protein >Feature sequence0617 >Feature sequence0618 814 80 gene locus_tag LOCUS_07930 814 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07930 <1458 834 gene locus_tag LOCUS_07940 <1458 834 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013061621.1:DNA-directed RNA polymerase subunit alpha >Feature sequence0619 1148 327 gene locus_tag LOCUS_07950 1148 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 >Feature sequence0620 >Feature sequence0621 <1455 369 gene locus_tag LOCUS_07960 <1455 369 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004530640.1:NAD(P)-binding domain-containing protein >Feature sequence0622 >Feature sequence0623 >Feature sequence0624 >Feature sequence0625 865 377 gene locus_tag LOCUS_07970 865 377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence0626 1306 320 gene locus_tag LOCUS_07980 1306 320 CDS product NAD(P)H-quinone oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404056.1 protein_id gnl|my_center|LOCUS_07980 >Feature sequence0627 552 971 gene locus_tag LOCUS_07990 gene ndk 552 971 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403833.1 protein_id gnl|my_center|LOCUS_07990 >Feature sequence0628 <1451 24 gene locus_tag LOCUS_08000 <1451 24 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932655.1:Na+:solute symporter >Feature sequence0629 545 219 gene locus_tag LOCUS_08010 gene trxA 545 219 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056655.1 protein_id gnl|my_center|LOCUS_08010 >Feature sequence0630 713 1429 gene locus_tag LOCUS_08020 713 1429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 >Feature sequence0631 289 1113 gene locus_tag LOCUS_08030 gene rplB 289 1113 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081830.1 protein_id gnl|my_center|LOCUS_08030 1128 1412 gene locus_tag LOCUS_08040 gene rpsS 1128 1412 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081828.1 protein_id gnl|my_center|LOCUS_08040 >Feature sequence0632 >Feature sequence0633 2 643 gene locus_tag LOCUS_08050 2 643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 657 1136 gene locus_tag LOCUS_08060 657 1136 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 >Feature sequence0634 1 1086 gene locus_tag LOCUS_08070 1 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1341 1096 gene locus_tag LOCUS_08080 1341 1096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence0635 >Feature sequence0636 927 55 gene locus_tag LOCUS_08090 927 55 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 <1447 924 gene locus_tag LOCUS_08100 <1447 924 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000433117.1:ABC transporter ATP-binding protein >Feature sequence0637 1329 16 gene locus_tag LOCUS_08110 1329 16 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002675346.1 protein_id gnl|my_center|LOCUS_08110 1150 1159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0638 >Feature sequence0639 <1 745 gene locus_tag LOCUS_08120 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012544969.1:phosphomannomutase/phosphoglucomutase >Feature sequence0640 320 329 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1398 571 gene locus_tag LOCUS_08130 1398 571 CDS product proline dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228782.1 protein_id gnl|my_center|LOCUS_08130 >Feature sequence0641 >Feature sequence0642 <1 543 gene locus_tag LOCUS_08140 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256831.1:heme ABC exporter ATP-binding protein CcmA 521 1192 gene locus_tag LOCUS_08150 521 1192 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256830.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence0643 >Feature sequence0644 297 306 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0645 1105 320 gene locus_tag LOCUS_08160 1105 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence0646 720 349 gene locus_tag LOCUS_08170 720 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08170 <1435 723 gene locus_tag LOCUS_08180 <1435 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943991.1:Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB >Feature sequence0647 >Feature sequence0648 828 79 gene locus_tag LOCUS_08190 828 79 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 <1428 828 gene locus_tag LOCUS_08200 <1428 828 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393401.1:ABC transporter ATP-binding protein >Feature sequence0649 >Feature sequence0650 <1 563 gene locus_tag LOCUS_08210 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403234.1:isoleucine--tRNA ligase 580 957 gene locus_tag LOCUS_08220 580 957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence0651 123 770 gene locus_tag LOCUS_08230 123 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 <1425 814 gene locus_tag LOCUS_08240 <1425 814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011057374.1:class II fumarate hydratase >Feature sequence0652 <1 565 gene locus_tag LOCUS_08250 <1 565 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393426.1:nickel-dependent lactate racemase 531 1247 gene locus_tag LOCUS_08260 531 1247 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933301.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence0653 <1 913 gene locus_tag LOCUS_08270 <1 913 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261142.1:alanine--glyoxylate aminotransferase family protein >Feature sequence0654 <1423 513 gene locus_tag LOCUS_08280 <1423 513 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_051000272.1:response regulator >Feature sequence0655 20 430 gene locus_tag LOCUS_08290 20 430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 608 1048 gene locus_tag LOCUS_08300 608 1048 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence0656 82 840 gene locus_tag LOCUS_08310 gene fliP 82 840 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941092.1 protein_id gnl|my_center|LOCUS_08310 850 1119 gene locus_tag LOCUS_08320 gene fliQ 850 1119 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002666830.1 protein_id gnl|my_center|LOCUS_08320 >Feature sequence0657 >Feature sequence0658 <1 729 gene locus_tag LOCUS_08330 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011058098.1:aminopeptidase P N-terminal domain-containing protein 816 1226 gene locus_tag LOCUS_08340 816 1226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 1085 1094 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0659 1 396 gene locus_tag LOCUS_08350 1 396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 >Feature sequence0660 524 1213 gene locus_tag LOCUS_08360 524 1213 CDS product SatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002262282.1 protein_id gnl|my_center|LOCUS_08360 >Feature sequence0661 945 954 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0662 54 737 gene locus_tag LOCUS_08370 gene coaE 54 737 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583248.1 protein_id gnl|my_center|LOCUS_08370 >Feature sequence0663 3 335 gene locus_tag LOCUS_08380 gene rpsK 3 335 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393910.1 protein_id gnl|my_center|LOCUS_08380 359 988 gene locus_tag LOCUS_08390 gene rpsD 359 988 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545818.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence0664 41 736 gene locus_tag LOCUS_08400 41 736 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392377.1 protein_id gnl|my_center|LOCUS_08400 >Feature sequence0665 >Feature sequence0666 >Feature sequence0667 <1411 651 gene locus_tag LOCUS_08410 <1411 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256451.1:DUF3179 domain-containing protein >Feature sequence0668 >Feature sequence0669 2 832 gene locus_tag LOCUS_08420 2 832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 >Feature sequence0670 >Feature sequence0671 <1 1227 gene locus_tag LOCUS_08430 <1 1227 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962878.1:alpha-ketoacid dehydrogenase subunit alpha/beta >Feature sequence0672 >Feature sequence0673 >Feature sequence0674 >Feature sequence0675 >Feature sequence0676 >Feature sequence0677 334 564 gene locus_tag LOCUS_08440 334 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence0678 363 82 gene locus_tag LOCUS_08450 363 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 <1401 287 gene locus_tag LOCUS_08460 <1401 287 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011015826.1:tetratricopeptide repeat protein note possible pseudo, frameshifted 350 359 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0679 >Feature sequence0680 <1401 290 gene locus_tag LOCUS_08470 <1401 290 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010963926.1:cation diffusion facilitator family transporter >Feature sequence0681 343 1137 gene locus_tag LOCUS_08480 gene trpA 343 1137 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943006.1 protein_id gnl|my_center|LOCUS_08480 >Feature sequence0682 744 753 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0683 587 1036 gene locus_tag LOCUS_08490 gene queF 587 1036 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001832596.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence0684 <1 1267 gene locus_tag LOCUS_08500 <1 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003234976.1:DUF1343 domain-containing protein >Feature sequence0685 212 646 gene locus_tag LOCUS_08510 gene cas4 212 646 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460582.1 protein_id gnl|my_center|LOCUS_08510 >Feature sequence0686 <1397 206 gene locus_tag LOCUS_08520 <1397 206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767105.1:NPCBM/NEW2 domain-containing protein >Feature sequence0687 >Feature sequence0688 1009 512 gene locus_tag LOCUS_08530 1009 512 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003419111.1 protein_id gnl|my_center|LOCUS_08530 >Feature sequence0689 200 358 gene locus_tag LOCUS_08540 200 358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1089 370 gene locus_tag LOCUS_08550 1089 370 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039550.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence0690 590 219 gene locus_tag LOCUS_08560 gene rpsM 590 219 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583368.1 protein_id gnl|my_center|LOCUS_08560 960 742 gene locus_tag LOCUS_08570 gene infA 960 742 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689399.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence0691 383 219 gene locus_tag LOCUS_08580 383 219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08580 >Feature sequence0692 >Feature sequence0693 >Feature sequence0694 646 179 gene locus_tag LOCUS_08590 646 179 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08590 1052 600 gene locus_tag LOCUS_08600 1052 600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08600 686 695 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0695 409 336 gene locus_tag LOCUS_t00170 409 336 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 643 464 gene locus_tag LOCUS_08610 643 464 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 678 687 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0696 >Feature sequence0697 >Feature sequence0698 >Feature sequence0699 >Feature sequence0700 3 299 gene locus_tag LOCUS_08620 3 299 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08620 1220 378 gene locus_tag LOCUS_08630 1220 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 >Feature sequence0701 <1385 106 gene locus_tag LOCUS_08640 <1385 106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169153932.1:aldehyde dehydrogenase family protein >Feature sequence0702 1252 743 gene locus_tag LOCUS_08650 1252 743 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_08650 >Feature sequence0703 >Feature sequence0704 >Feature sequence0705 1310 264 gene locus_tag LOCUS_08660 gene argC 1310 264 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256242.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence0706 >Feature sequence0707 >Feature sequence0708 <1 861 gene locus_tag LOCUS_08670 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002684564.1:glycine--tRNA ligase >Feature sequence0709 120 575 gene locus_tag LOCUS_08680 120 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 572 1195 gene locus_tag LOCUS_08690 572 1195 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393180.1 protein_id gnl|my_center|LOCUS_08690 >Feature sequence0710 >Feature sequence0711 >Feature sequence0712 <1 876 gene locus_tag LOCUS_08700 <1 876 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946745.1:cation-translocating P-type ATPase >Feature sequence0713 >Feature sequence0714 >Feature sequence0715 >Feature sequence0716 >Feature sequence0717 >Feature sequence0718 <1 763 gene locus_tag LOCUS_08710 <1 763 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963105.1:bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB 760 945 gene locus_tag LOCUS_08720 760 945 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 876 885 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 909 1337 gene locus_tag LOCUS_08730 909 1337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08730 >Feature sequence0719 >Feature sequence0720 1284 1371 gene locus_tag LOCUS_t00180 1284 1371 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0721 <1 562 gene locus_tag LOCUS_08740 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931821.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence0722 <1372 258 gene locus_tag LOCUS_08750 <1372 258 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404149.1:M20 family metallopeptidase >Feature sequence0723 238 828 gene locus_tag LOCUS_08760 238 828 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931701.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence0724 >Feature sequence0725 1348 116 gene locus_tag LOCUS_08770 gene ftsA 1348 116 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943689.1 protein_id gnl|my_center|LOCUS_08770 >Feature sequence0726 >Feature sequence0727 >Feature sequence0728 >Feature sequence0729 >Feature sequence0730 >Feature sequence0731 >Feature sequence0732 651 127 gene locus_tag LOCUS_08780 651 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 >Feature sequence0733 >Feature sequence0734 >Feature sequence0735 3 1076 gene locus_tag LOCUS_08790 3 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1036 1045 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0736 >Feature sequence0737 >Feature sequence0738 5 1096 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttcagcatacctatgagggattgaaac 1304 1185 gene locus_tag LOCUS_08800 1304 1185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 >Feature sequence0739 >Feature sequence0740 638 647 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1362 883 gene locus_tag LOCUS_08810 1362 883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence0741 <1 957 gene locus_tag LOCUS_08820 <1 957 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704392.1:two-component system response regulator >Feature sequence0742 >Feature sequence0743 <1360 717 gene locus_tag LOCUS_08830 <1360 717 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007324152.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence0744 >Feature sequence0745 >Feature sequence0746 754 248 gene locus_tag LOCUS_08840 754 248 CDS product TlpA disulfide reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943891.1 protein_id gnl|my_center|LOCUS_08840 <1357 767 gene locus_tag LOCUS_08850 <1357 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583126.1:thioredoxin family protein >Feature sequence0747 <1357 434 gene locus_tag LOCUS_08860 <1357 434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023091.1:ATP-binding protein >Feature sequence0748 >Feature sequence0749 368 871 gene locus_tag LOCUS_08870 368 871 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942914.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence0750 >Feature sequence0751 <1353 734 gene locus_tag LOCUS_08880 <1353 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005809761.1:type III pantothenate kinase >Feature sequence0752 628 215 gene locus_tag LOCUS_08890 gene zntR 628 215 CDS product Zn(2+)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309469.1 protein_id gnl|my_center|LOCUS_08890 >Feature sequence0753 >Feature sequence0754 >Feature sequence0755 >Feature sequence0756 <1350 539 gene locus_tag LOCUS_08900 <1350 539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228982.1:DUF1028 domain-containing protein >Feature sequence0757 >Feature sequence0758 >Feature sequence0759 <1 682 gene locus_tag LOCUS_08910 <1 682 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012296700.1:FAD-binding oxidoreductase >Feature sequence0760 >Feature sequence0761 >Feature sequence0762 652 661 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0763 >Feature sequence0764 >Feature sequence0765 >Feature sequence0766 39 1085 gene locus_tag LOCUS_08920 39 1085 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761244.1 protein_id gnl|my_center|LOCUS_08920 >Feature sequence0767 <1 529 gene locus_tag LOCUS_08930 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877685.1:molecular chaperone TorD family protein >Feature sequence0768 1244 483 gene locus_tag LOCUS_08940 1244 483 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014551636.1 protein_id gnl|my_center|LOCUS_08940 >Feature sequence0769 473 141 gene locus_tag LOCUS_08950 473 141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 >Feature sequence0770 >Feature sequence0771 >Feature sequence0772 537 920 gene locus_tag LOCUS_08960 537 920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence0773 1231 749 gene locus_tag LOCUS_08970 1231 749 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060883.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence0774 <1 575 gene locus_tag LOCUS_08980 <1 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880523.1:peroxiredoxin 950 636 gene locus_tag LOCUS_08990 950 636 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878370.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence0775 462 785 gene locus_tag LOCUS_09000 462 785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 >Feature sequence0776 840 343 gene locus_tag LOCUS_09010 840 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09010 349 358 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0777 >Feature sequence0778 <1340 259 gene locus_tag LOCUS_09020 <1340 259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164928917.1:TolC family protein >Feature sequence0779 >Feature sequence0780 >Feature sequence0781 >Feature sequence0782 <1337 386 gene locus_tag LOCUS_09030 <1337 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812942.1:ribonuclease Y >Feature sequence0783 <1 683 gene locus_tag LOCUS_09040 <1 683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010967584.1:divalent metal cation transporter 1071 745 gene locus_tag LOCUS_09050 1071 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence0784 >Feature sequence0785 3 1289 gene locus_tag LOCUS_09060 3 1289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 >Feature sequence0786 1208 624 gene locus_tag LOCUS_09070 1208 624 CDS product GTPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940776.1 protein_id gnl|my_center|LOCUS_09070 >Feature sequence0787 >Feature sequence0788 >Feature sequence0789 995 1004 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0790 >Feature sequence0791 >Feature sequence0792 >Feature sequence0793 597 181 gene locus_tag LOCUS_09080 597 181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1244 618 gene locus_tag LOCUS_09090 gene lexA 1244 618 CDS product transcriptional repressor LexA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804684.1 protein_id gnl|my_center|LOCUS_09090 >Feature sequence0794 >Feature sequence0795 <1 890 gene locus_tag LOCUS_09100 <1 890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943554.1:glutamate racemase >Feature sequence0796 >Feature sequence0797 1190 498 gene locus_tag LOCUS_09110 1190 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 >Feature sequence0798 >Feature sequence0799 >Feature sequence0800 >Feature sequence0801 <1 1179 gene locus_tag LOCUS_09120 <1 1179 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0802 >Feature sequence0803 >Feature sequence0804 >Feature sequence0805 553 38 gene locus_tag LOCUS_09130 553 38 CDS product NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256064.1 protein_id gnl|my_center|LOCUS_09130 >Feature sequence0806 <1317 610 gene locus_tag LOCUS_09140 <1317 610 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001084504.1:potassium transporter TrkG >Feature sequence0807 16 1248 gene locus_tag LOCUS_09150 16 1248 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108740.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence0808 >Feature sequence0809 >Feature sequence0810 772 146 gene locus_tag LOCUS_09160 772 146 CDS product KaiC associated regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064643.1 protein_id gnl|my_center|LOCUS_09160 >Feature sequence0811 >Feature sequence0812 >Feature sequence0813 >Feature sequence0814 946 425 gene locus_tag LOCUS_09170 946 425 CDS product flagellar basal body-associated FliL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965451.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence0815 20 808 gene locus_tag LOCUS_09180 gene fadA 20 808 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704164.1 protein_id gnl|my_center|LOCUS_09180 399 408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0816 457 119 gene locus_tag LOCUS_09190 gene gldC 457 119 CDS product gliding motility protein GldC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964167.1 protein_id gnl|my_center|LOCUS_09190 593 907 gene locus_tag LOCUS_09200 593 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence0817 >Feature sequence0818 >Feature sequence0819 <1 697 gene locus_tag LOCUS_09210 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943723.1:UDP-N-acetylglucosamine 1-carboxyvinyltransferase >Feature sequence0820 >Feature sequence0821 >Feature sequence0822 >Feature sequence0823 872 195 gene locus_tag LOCUS_09220 872 195 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_09220 >Feature sequence0824 >Feature sequence0825 <1 778 gene locus_tag LOCUS_09230 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259049.1:polysulfide reductase NrfD >Feature sequence0826 >Feature sequence0827 >Feature sequence0828 >Feature sequence0829 <1 644 gene locus_tag LOCUS_09240 <1 644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880520.1:tetratricopeptide repeat protein >Feature sequence0830 652 71 gene locus_tag LOCUS_09250 gene pyrE 652 71 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926797.1 protein_id gnl|my_center|LOCUS_09250 <1304 665 gene locus_tag LOCUS_09260 <1304 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931823.1:orotidine-5'-phosphate decarboxylase >Feature sequence0831 <1304 195 gene locus_tag LOCUS_09270 <1304 195 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009879610.1:spore photoproduct lyase >Feature sequence0832 >Feature sequence0833 11 865 gene locus_tag LOCUS_09280 11 865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 >Feature sequence0834 >Feature sequence0835 >Feature sequence0836 >Feature sequence0837 770 381 gene locus_tag LOCUS_09290 770 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 <1299 784 gene locus_tag LOCUS_09300 <1299 784 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582678.1:TrkA family potassium uptake protein >Feature sequence0838 >Feature sequence0839 >Feature sequence0840 <1 1016 gene locus_tag LOCUS_09310 <1 1016 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005454699.1:class 1 fructose-bisphosphatase >Feature sequence0841 >Feature sequence0842 613 622 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0843 474 154 gene locus_tag LOCUS_09320 474 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 >Feature sequence0844 >Feature sequence0845 <1 551 gene locus_tag LOCUS_09330 <1 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973307.1:5'-nucleotidase C-terminal domain-containing protein >Feature sequence0846 84 902 gene locus_tag LOCUS_09340 gene pstB 84 902 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870525.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence0847 <1 511 gene locus_tag LOCUS_09350 <1 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003358679.1:HDOD domain-containing protein >Feature sequence0848 <1 817 gene locus_tag LOCUS_09360 <1 817 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583043.1:ABC transporter ATP-binding protein >Feature sequence0849 >Feature sequence0850 <1 728 gene locus_tag LOCUS_09370 <1 728 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392848.1:3-deoxy-7-phosphoheptulonate synthase >Feature sequence0851 1126 230 gene locus_tag LOCUS_09380 1126 230 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088649.1 protein_id gnl|my_center|LOCUS_09380 >Feature sequence0852 <1291 80 gene locus_tag LOCUS_09390 <1291 80 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838626.1:amidohydrolase >Feature sequence0853 >Feature sequence0854 <1 1039 gene locus_tag LOCUS_09400 <1 1039 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791600.1:TolC family protein >Feature sequence0855 >Feature sequence0856 373 300 gene locus_tag LOCUS_t00190 373 300 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 486 411 gene locus_tag LOCUS_t00200 486 411 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 646 563 gene locus_tag LOCUS_t00210 646 563 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 732 659 gene locus_tag LOCUS_t00220 732 659 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1287 886 gene locus_tag LOCUS_09410 1287 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 >Feature sequence0857 <1289 433 gene locus_tag LOCUS_09420 <1289 433 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767086.1:SpoIID/LytB domain-containing protein >Feature sequence0858 992 1001 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0859 >Feature sequence0860 >Feature sequence0861 >Feature sequence0862 >Feature sequence0863 >Feature sequence0864 30 530 gene locus_tag LOCUS_09430 gene nuoE 30 530 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000540773.1 protein_id gnl|my_center|LOCUS_09430 >Feature sequence0865 <1 611 gene locus_tag LOCUS_09440 <1 611 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926922.1:replication-associated recombination protein A 604 1092 gene locus_tag LOCUS_09450 604 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence0866 154 603 gene locus_tag LOCUS_09460 gene gcvH 154 603 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391976.1 protein_id gnl|my_center|LOCUS_09460 >Feature sequence0867 >Feature sequence0868 >Feature sequence0869 1185 544 gene locus_tag LOCUS_09470 1185 544 CDS product aldehyde dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012061663.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence0870 >Feature sequence0871 81 476 gene locus_tag LOCUS_09480 gene mscL 81 476 CDS product large-conductance mechanosensitive channel protein MscL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104883.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence0872 >Feature sequence0873 394 403 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0874 <1281 706 gene locus_tag LOCUS_09490 <1281 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941017.1:NADH-quinone oxidoreductase subunit L >Feature sequence0875 >Feature sequence0876 220 579 gene locus_tag LOCUS_09500 220 579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence0877 >Feature sequence0878 1161 508 gene locus_tag LOCUS_09510 1161 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence0879 508 245 gene locus_tag LOCUS_09520 508 245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 <1279 603 gene locus_tag LOCUS_09530 <1279 603 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393545.1:phosphoribosylformylglycinamidine synthase subunit PurQ >Feature sequence0880 <1278 511 gene locus_tag LOCUS_09540 <1278 511 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146505.1:ribose 1,5-bisphosphate isomerase >Feature sequence0881 581 496 gene locus_tag LOCUS_t00230 581 496 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <1276 734 gene locus_tag LOCUS_09550 <1276 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0882 55 837 gene locus_tag LOCUS_09560 55 837 CDS product alpha/beta hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760470.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence0883 >Feature sequence0884 >Feature sequence0885 209 282 gene locus_tag LOCUS_t00240 209 282 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 325 412 gene locus_tag LOCUS_t00250 325 412 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1272 487 gene locus_tag LOCUS_09570 1272 487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence0886 1012 542 gene locus_tag LOCUS_09580 1012 542 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422657.1 protein_id gnl|my_center|LOCUS_09580 >Feature sequence0887 <1 1070 gene locus_tag LOCUS_09590 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880656.1:nicotinate phosphoribosyltransferase >Feature sequence0888 >Feature sequence0889 >Feature sequence0890 <1271 561 gene locus_tag LOCUS_09600 <1271 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence0891 >Feature sequence0892 >Feature sequence0893 <1 801 gene locus_tag LOCUS_09610 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546183.1:phosphatase PAP2 family protein >Feature sequence0894 1241 99 gene locus_tag LOCUS_09620 1241 99 CDS product S-layer homology domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545470.1 protein_id gnl|my_center|LOCUS_09620 >Feature sequence0895 669 992 gene locus_tag LOCUS_09630 669 992 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008632829.1 protein_id gnl|my_center|LOCUS_09630 >Feature sequence0896 <1270 451 gene locus_tag LOCUS_09640 <1270 451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008292761.1:PEGA domain-containing protein >Feature sequence0897 3 506 gene locus_tag LOCUS_09650 3 506 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032889952.1 protein_id gnl|my_center|LOCUS_09650 <1268 638 gene locus_tag LOCUS_09660 <1268 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963010.1:phosphoglucosamine mutase >Feature sequence0898 <1 1094 gene locus_tag LOCUS_09670 <1 1094 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011458974.1:Sec-dependent nitrous-oxide reductase >Feature sequence0899 <1267 535 gene locus_tag LOCUS_09680 <1267 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880347.1:anthranilate synthase component I >Feature sequence0900 >Feature sequence0901 >Feature sequence0902 >Feature sequence0903 921 586 gene locus_tag LOCUS_09690 921 586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence0904 526 146 gene locus_tag LOCUS_09700 526 146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 <1264 536 gene locus_tag LOCUS_09710 <1264 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545471.1:protein-glutamate O-methyltransferase CheR >Feature sequence0905 >Feature sequence0906 >Feature sequence0907 >Feature sequence0908 507 581 gene locus_tag LOCUS_t00260 507 581 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 645 719 gene locus_tag LOCUS_t00270 645 719 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0909 1149 40 gene locus_tag LOCUS_09720 1149 40 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582745.1 protein_id gnl|my_center|LOCUS_09720 >Feature sequence0910 <1262 162 gene locus_tag LOCUS_09730 <1262 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932301.1:3-isopropylmalate dehydratase large subunit >Feature sequence0911 3 251 gene locus_tag LOCUS_09740 3 251 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 248 1213 gene locus_tag LOCUS_09750 gene murB 248 1213 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009894000.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence0912 >Feature sequence0913 402 411 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0914 791 27 gene locus_tag LOCUS_09760 791 27 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003226756.1 protein_id gnl|my_center|LOCUS_09760 >Feature sequence0915 <1 698 gene locus_tag LOCUS_09770 <1 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942876.1:bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase 726 1205 gene locus_tag LOCUS_09780 gene greA 726 1205 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765198.1 protein_id gnl|my_center|LOCUS_09780 >Feature sequence0916 <1 836 gene locus_tag LOCUS_09790 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222478.1:nucleotide sugar dehydrogenase >Feature sequence0917 >Feature sequence0918 543 184 gene locus_tag LOCUS_09800 543 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09800 901 446 gene locus_tag LOCUS_09810 901 446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09810 555 564 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0919 1 714 gene locus_tag LOCUS_09820 1 714 CDS product cyclodeaminase/cyclohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869660.1 protein_id gnl|my_center|LOCUS_09820 >Feature sequence0920 218 227 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1256 360 gene locus_tag LOCUS_09830 <1256 360 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072378.1:lipopolysaccharide assembly protein LapB >Feature sequence0921 >Feature sequence0922 >Feature sequence0923 1 369 gene locus_tag LOCUS_09840 1 369 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257742.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence0924 <1 881 gene locus_tag LOCUS_09850 <1 881 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082211.1:tetratricopeptide repeat protein >Feature sequence0925 >Feature sequence0926 1006 296 gene locus_tag LOCUS_09860 1006 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09860 1250 1086 gene locus_tag LOCUS_09870 1250 1086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 >Feature sequence0927 <1 535 gene locus_tag LOCUS_09880 <1 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030515.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme note possible pseudo, internal stop codon, frameshifted 494 503 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 541 1092 gene locus_tag LOCUS_09890 541 1092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09890 >Feature sequence0928 >Feature sequence0929 >Feature sequence0930 1163 18 gene locus_tag LOCUS_09900 1163 18 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192663.1 protein_id gnl|my_center|LOCUS_09900 >Feature sequence0931 >Feature sequence0932 <1 613 gene locus_tag LOCUS_09910 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118839787.1:ArsA family ATPase 1096 668 gene locus_tag LOCUS_09920 1096 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 >Feature sequence0933 >Feature sequence0934 >Feature sequence0935 <1 622 gene locus_tag LOCUS_09930 <1 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010876019.1:SDR family oxidoreductase >Feature sequence0936 558 133 gene locus_tag LOCUS_09940 558 133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence0937 >Feature sequence0938 700 1206 gene locus_tag LOCUS_09950 700 1206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence0939 >Feature sequence0940 852 166 gene locus_tag LOCUS_09960 852 166 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888988.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence0941 <1 725 gene locus_tag LOCUS_09970 <1 725 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202952.1:ABC transporter permease >Feature sequence0942 >Feature sequence0943 >Feature sequence0944 <1 656 gene locus_tag LOCUS_09980 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013230697.1:tRNA dihydrouridine synthase DusB >Feature sequence0945 >Feature sequence0946 1243 725 gene locus_tag LOCUS_09990 1243 725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence0947 569 183 gene locus_tag LOCUS_10000 569 183 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965183.1 protein_id gnl|my_center|LOCUS_10000 1227 553 gene locus_tag LOCUS_10010 1227 553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 >Feature sequence0948 <1 821 gene locus_tag LOCUS_10020 <1 821 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942630.1:TIGR03013 family PEP-CTERM/XrtA system glycosyltransferase >Feature sequence0949 >Feature sequence0950 1149 673 gene locus_tag LOCUS_10030 1149 673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 >Feature sequence0951 >Feature sequence0952 >Feature sequence0953 >Feature sequence0954 203 212 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0955 >Feature sequence0956 1 309 gene locus_tag LOCUS_10040 1 309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10040 >Feature sequence0957 <1 556 gene locus_tag LOCUS_10050 <1 556 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003640795.1:ribosome biogenesis GTP-binding protein YihA/YsxC >Feature sequence0958 897 906 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0959 >Feature sequence0960 <1237 544 gene locus_tag LOCUS_10060 <1237 544 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932009.1:glycosyltransferase family 2 protein >Feature sequence0961 >Feature sequence0962 <1 1095 gene locus_tag LOCUS_10070 <1 1095 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880145.1:serine--tRNA ligase >Feature sequence0963 <1 608 gene locus_tag LOCUS_10080 <1 608 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878966.1:ABC transporter ATP-binding protein 288 297 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0964 477 698 gene locus_tag LOCUS_10090 477 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence0965 <1 629 gene locus_tag LOCUS_10100 <1 629 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003400106.1:methionine gamma-lyase 865 626 gene locus_tag LOCUS_10110 865 626 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867550.1 protein_id gnl|my_center|LOCUS_10110 >Feature sequence0966 732 1034 gene locus_tag LOCUS_10120 732 1034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 >Feature sequence0967 416 970 gene locus_tag LOCUS_10130 416 970 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 >Feature sequence0968 1234 677 gene locus_tag LOCUS_10140 1234 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 >Feature sequence0969 <1 593 gene locus_tag LOCUS_10150 <1 593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003230650.1:bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor 893 902 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence0970 >Feature sequence0971 >Feature sequence0972 >Feature sequence0973 >Feature sequence0974 >Feature sequence0975 >Feature sequence0976 601 362 gene locus_tag LOCUS_10160 601 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 <1228 659 gene locus_tag LOCUS_10170 <1228 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250729.1:MBL fold metallo-hydrolase >Feature sequence0977 >Feature sequence0978 <1 799 gene locus_tag LOCUS_10180 <1 799 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030467.1:vitamin B12-dependent ribonucleotide reductase >Feature sequence0979 >Feature sequence0980 <1226 336 gene locus_tag LOCUS_10190 <1226 336 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008768493.1:lipopolysaccharide biosynthesis protein >Feature sequence0981 >Feature sequence0982 344 748 gene locus_tag LOCUS_10200 gene mce 344 748 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_10200 >Feature sequence0983 >Feature sequence0984 >Feature sequence0985 <1 818 gene locus_tag LOCUS_10210 <1 818 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940478.1:sigma-54 dependent transcriptional regulator >Feature sequence0986 1125 343 gene locus_tag LOCUS_10220 1125 343 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence0987 <1224 302 gene locus_tag LOCUS_10230 <1224 302 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545010.1:site-2 protease family protein >Feature sequence0988 470 135 gene locus_tag LOCUS_10240 470 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987057.1 protein_id gnl|my_center|LOCUS_10240 943 467 gene locus_tag LOCUS_10250 943 467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence0989 >Feature sequence0990 <1 720 gene locus_tag LOCUS_10260 <1 720 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003546298.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence0991 >Feature sequence0992 >Feature sequence0993 <1221 245 gene locus_tag LOCUS_10270 <1221 245 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_147443659.1:non-ribosomal peptide synthetase >Feature sequence0994 <1221 342 gene locus_tag LOCUS_10280 <1221 342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546729.1:D-glycero-beta-D-manno-heptose-7-phosphate kinase >Feature sequence0995 <1221 673 gene locus_tag LOCUS_10290 <1221 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868579.1:glycosyltransferase family 4 protein >Feature sequence0996 >Feature sequence0997 >Feature sequence0998 365 441 gene locus_tag LOCUS_t00280 365 441 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence0999 <1 1205 gene locus_tag LOCUS_10300 <1 1205 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003435581.1:glutamate--tRNA ligase >Feature sequence1000 >Feature sequence1001 <1216 363 gene locus_tag LOCUS_10310 <1216 363 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011109361.1:ROK family protein >Feature sequence1002 355 2 gene locus_tag LOCUS_10320 355 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 <1216 283 gene locus_tag LOCUS_10330 <1216 283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880649.1:formate dehydrogenase subunit gamma 366 375 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1003 1208 936 gene locus_tag LOCUS_10340 1208 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 >Feature sequence1004 >Feature sequence1005 >Feature sequence1006 964 161 gene locus_tag LOCUS_10350 964 161 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013385673.1 protein_id gnl|my_center|LOCUS_10350 1214 1020 gene locus_tag LOCUS_10360 1214 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence1007 >Feature sequence1008 857 165 gene locus_tag LOCUS_10370 857 165 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946775.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence1009 >Feature sequence1010 <1212 79 gene locus_tag LOCUS_10380 <1212 79 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073273.1:bifunctional aspartate kinase/homoserine dehydrogenase I >Feature sequence1011 >Feature sequence1012 >Feature sequence1013 1211 675 gene locus_tag LOCUS_10390 1211 675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence1014 <1 605 gene locus_tag LOCUS_10400 <1 605 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263815.1:SIS domain-containing protein >Feature sequence1015 >Feature sequence1016 <1 598 gene locus_tag LOCUS_10410 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482649.1:outer membrane lipoprotein-sorting protein >Feature sequence1017 1209 427 gene locus_tag LOCUS_10420 1209 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10420 >Feature sequence1018 1 150 gene locus_tag LOCUS_10430 1 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 147 890 gene locus_tag LOCUS_10440 gene fabG 147 890 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460500.1 protein_id gnl|my_center|LOCUS_10440 935 1177 gene locus_tag LOCUS_10450 gene acpP 935 1177 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881114.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence1019 >Feature sequence1020 112 912 gene locus_tag LOCUS_10460 112 912 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence1021 <1 1193 gene locus_tag LOCUS_10470 <1 1193 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence1022 >Feature sequence1023 >Feature sequence1024 193 202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 203 649 gene locus_tag LOCUS_10480 203 649 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932212.1 protein_id gnl|my_center|LOCUS_10480 671 973 gene locus_tag LOCUS_10490 671 973 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011213210.1 protein_id gnl|my_center|LOCUS_10490 >Feature sequence1025 >Feature sequence1026 452 123 gene locus_tag LOCUS_10500 452 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence1027 >Feature sequence1028 >Feature sequence1029 >Feature sequence1030 1070 654 gene locus_tag LOCUS_10510 1070 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 >Feature sequence1031 1204 908 gene locus_tag LOCUS_10520 1204 908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence1032 463 975 gene locus_tag LOCUS_10530 463 975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence1033 >Feature sequence1034 <1 804 gene locus_tag LOCUS_10540 <1 804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259719.1:isocitrate lyase >Feature sequence1035 >Feature sequence1036 27 707 gene locus_tag LOCUS_10550 27 707 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000868943.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence1037 >Feature sequence1038 >Feature sequence1039 <1201 327 gene locus_tag LOCUS_10560 <1201 327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_098062761.1:ectonucleotide pyrophosphatase/phosphodiesterase >Feature sequence1040 >Feature sequence1041 >Feature sequence1042 >Feature sequence1043 >Feature sequence1044 >Feature sequence1045 <1199 446 gene locus_tag LOCUS_10570 <1199 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005817240.1:adenylosuccinate lyase >Feature sequence1046 >Feature sequence1047 30 932 gene locus_tag LOCUS_10580 30 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence1048 >Feature sequence1049 <1 1011 gene locus_tag LOCUS_10590 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_118838467.1:sodium-dependent transporter >Feature sequence1050 <1197 202 gene locus_tag LOCUS_10600 <1197 202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011030494.1:alpha-galactosidase >Feature sequence1051 >Feature sequence1052 >Feature sequence1053 <1 553 gene locus_tag LOCUS_10610 <1 553 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070774.1:A24 family peptidase >Feature sequence1054 >Feature sequence1055 <1 729 gene locus_tag LOCUS_10620 <1 729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990698.1:ABC transporter permease 1191 982 gene locus_tag LOCUS_10630 1191 982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 >Feature sequence1056 211 220 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 226 432 gene locus_tag LOCUS_10640 226 432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10640 1111 443 gene locus_tag LOCUS_10650 1111 443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 >Feature sequence1057 >Feature sequence1058 >Feature sequence1059 786 163 gene locus_tag LOCUS_10660 786 163 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948446.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence1060 >Feature sequence1061 >Feature sequence1062 <1 694 gene locus_tag LOCUS_10670 <1 694 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546063.1:potassium channel protein >Feature sequence1063 >Feature sequence1064 <1 1162 gene locus_tag LOCUS_10680 <1 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011021764.1:PKD domain-containing protein >Feature sequence1065 >Feature sequence1066 >Feature sequence1067 >Feature sequence1068 <1 1133 gene locus_tag LOCUS_10690 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_205421524.1:amidase 239 248 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1069 >Feature sequence1070 >Feature sequence1071 >Feature sequence1072 >Feature sequence1073 1153 581 gene locus_tag LOCUS_10700 1153 581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 >Feature sequence1074 >Feature sequence1075 <1 623 gene locus_tag LOCUS_10710 <1 623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933292.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase 552 561 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1076 1125 214 gene locus_tag LOCUS_10720 1125 214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 >Feature sequence1077 <1181 342 gene locus_tag LOCUS_10730 <1181 342 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941160.1:tyrosine recombinase XerC >Feature sequence1078 401 1168 gene locus_tag LOCUS_10740 401 1168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 >Feature sequence1079 >Feature sequence1080 >Feature sequence1081 1013 378 gene locus_tag LOCUS_10750 1013 378 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392433.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence1082 >Feature sequence1083 871 425 gene locus_tag LOCUS_10760 871 425 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025773532.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence1084 >Feature sequence1085 30 776 gene locus_tag LOCUS_10770 gene cas6 30 776 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545251.1 protein_id gnl|my_center|LOCUS_10770 >Feature sequence1086 >Feature sequence1087 >Feature sequence1088 >Feature sequence1089 <1178 204 gene locus_tag LOCUS_10780 <1178 204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404107.1:o-succinylbenzoate--CoA ligase >Feature sequence1090 >Feature sequence1091 >Feature sequence1092 <1 915 gene locus_tag LOCUS_10790 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004079960.1:sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC >Feature sequence1093 586 595 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1094 >Feature sequence1095 <1175 522 gene locus_tag LOCUS_10800 <1175 522 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879949.1:GGDEF domain-containing protein >Feature sequence1096 595 604 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1097 282 291 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 322 1128 gene locus_tag LOCUS_10810 322 1128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10810 >Feature sequence1098 >Feature sequence1099 528 537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1100 >Feature sequence1101 <1169 630 gene locus_tag LOCUS_10820 <1169 630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941799.1:TIGR00282 family metallophosphoesterase >Feature sequence1102 >Feature sequence1103 <1 572 gene locus_tag LOCUS_10830 <1 572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082209.1:lysophospholipid acyltransferase family protein 1169 627 gene locus_tag LOCUS_10840 1169 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence1104 570 298 gene locus_tag LOCUS_10850 570 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1169 657 gene locus_tag LOCUS_10860 1169 657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence1105 >Feature sequence1106 >Feature sequence1107 <1167 566 gene locus_tag LOCUS_10870 <1167 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011228949.1:Fe-S cluster assembly ATPase SufC >Feature sequence1108 >Feature sequence1109 <1166 110 gene locus_tag LOCUS_10880 <1166 110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583893.1:nickel pincer cofactor biosynthesis protein LarC >Feature sequence1110 <1 1062 gene locus_tag LOCUS_10890 <1 1062 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931838.1:elongation factor G >Feature sequence1111 >Feature sequence1112 <1164 175 gene locus_tag LOCUS_10900 <1164 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064900.1:beta-propeller fold lactonase family protein >Feature sequence1113 758 510 gene locus_tag LOCUS_10910 758 510 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867827.1 protein_id gnl|my_center|LOCUS_10910 1117 755 gene locus_tag LOCUS_10920 1117 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 >Feature sequence1114 415 780 gene locus_tag LOCUS_10930 415 780 CDS product NADH-quinone oxidoreductase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224824.1 protein_id gnl|my_center|LOCUS_10930 >Feature sequence1115 >Feature sequence1116 >Feature sequence1117 <1 543 gene locus_tag LOCUS_10940 <1 543 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001220497.1:MBL fold metallo-hydrolase <1158 526 gene locus_tag LOCUS_10950 <1158 526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257870.1:response regulator transcription factor >Feature sequence1118 >Feature sequence1119 <1158 487 gene locus_tag LOCUS_10960 <1158 487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011123092.1:dipeptide epimerase >Feature sequence1120 <1158 379 gene locus_tag LOCUS_10970 <1158 379 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707062.1:sensor histidine kinase >Feature sequence1121 >Feature sequence1122 843 852 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1123 >Feature sequence1124 >Feature sequence1125 <1156 461 gene locus_tag LOCUS_10980 <1156 461 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256326.1:magnesium chelatase ATPase subunit D >Feature sequence1126 >Feature sequence1127 >Feature sequence1128 >Feature sequence1129 <1154 473 gene locus_tag LOCUS_10990 <1154 473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404248.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA >Feature sequence1130 <1 829 gene locus_tag LOCUS_11000 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012639931.1:amidohydrolase family protein >Feature sequence1131 670 167 gene locus_tag LOCUS_11010 670 167 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939190.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence1132 >Feature sequence1133 >Feature sequence1134 >Feature sequence1135 >Feature sequence1136 >Feature sequence1137 2 847 gene locus_tag LOCUS_11020 2 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence1138 12 374 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgctcccttcacgggggcgtggattgaaac 708 833 gene locus_tag LOCUS_11030 708 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 799 1014 gene locus_tag LOCUS_11040 799 1014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11040 >Feature sequence1139 317 150 gene locus_tag LOCUS_11050 317 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 870 268 gene locus_tag LOCUS_11060 870 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 283 292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1140 <1 571 gene locus_tag LOCUS_11070 <1 571 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927203.1:serine hydrolase domain-containing protein >Feature sequence1141 <1151 557 gene locus_tag LOCUS_11080 <1151 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000072965.1:electron transfer flavoprotein subunit alpha/FixB family protein >Feature sequence1142 >Feature sequence1143 265 849 gene locus_tag LOCUS_11090 265 849 CDS product superoxide dismutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275138.1 protein_id gnl|my_center|LOCUS_11090 >Feature sequence1144 <1 655 gene locus_tag LOCUS_11100 <1 655 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008665997.1:M28 family peptidase >Feature sequence1145 865 2 gene locus_tag LOCUS_11110 865 2 CDS product xanthine dehydrogenase family protein subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259304.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence1146 <1149 341 gene locus_tag LOCUS_11120 <1149 341 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404833.1:polysulfide reductase NrfD >Feature sequence1147 >Feature sequence1148 >Feature sequence1149 >Feature sequence1150 297 1058 gene locus_tag LOCUS_11130 297 1058 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405200.1 protein_id gnl|my_center|LOCUS_11130 >Feature sequence1151 >Feature sequence1152 >Feature sequence1153 >Feature sequence1154 >Feature sequence1155 396 737 gene locus_tag LOCUS_11140 396 737 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948455.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence1156 13 102 gene locus_tag LOCUS_t00290 13 102 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 489 184 gene locus_tag LOCUS_11150 489 184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence1157 1141 962 gene locus_tag LOCUS_11160 1141 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence1158 <1 600 gene locus_tag LOCUS_11170 <1 600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038038884.1:prephenate dehydratase 706 633 gene locus_tag LOCUS_t00300 706 633 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1159 <1142 435 gene locus_tag LOCUS_11180 <1142 435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545429.1:ATP-dependent zinc metalloprotease FtsH >Feature sequence1160 >Feature sequence1161 >Feature sequence1162 <1 761 gene locus_tag LOCUS_11190 <1 761 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027480084.1:S8 family peptidase 913 985 gene locus_tag LOCUS_t00310 913 985 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1163 >Feature sequence1164 <1140 536 gene locus_tag LOCUS_11200 <1140 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250866.1:nitrilase >Feature sequence1165 >Feature sequence1166 <1 510 gene locus_tag LOCUS_11210 <1 510 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037269.1:endonuclease >Feature sequence1167 >Feature sequence1168 >Feature sequence1169 >Feature sequence1170 <1138 221 gene locus_tag LOCUS_11220 <1138 221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015064358.1:metallophosphoesterase >Feature sequence1171 >Feature sequence1172 >Feature sequence1173 744 343 gene locus_tag LOCUS_11230 744 343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence1174 >Feature sequence1175 >Feature sequence1176 >Feature sequence1177 >Feature sequence1178 568 296 gene locus_tag LOCUS_11240 568 296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 375 384 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1179 >Feature sequence1180 >Feature sequence1181 >Feature sequence1182 >Feature sequence1183 <1134 162 gene locus_tag LOCUS_11250 <1134 162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004543824.1:S41 family peptidase >Feature sequence1184 >Feature sequence1185 >Feature sequence1186 1083 208 gene locus_tag LOCUS_11260 1083 208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 >Feature sequence1187 265 696 gene locus_tag LOCUS_11270 265 696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 816 1076 gene locus_tag LOCUS_11280 816 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11280 >Feature sequence1188 >Feature sequence1189 >Feature sequence1190 >Feature sequence1191 <1129 410 gene locus_tag LOCUS_11290 <1129 410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011860915.1:sodium:solute symporter >Feature sequence1192 >Feature sequence1193 799 29 gene locus_tag LOCUS_11300 799 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 >Feature sequence1194 <1128 359 gene locus_tag LOCUS_11310 <1128 359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010990053.1:sugar phosphorylase >Feature sequence1195 >Feature sequence1196 >Feature sequence1197 <1 686 gene locus_tag LOCUS_11320 <1 686 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546043.1:ATP-dependent chaperone ClpB >Feature sequence1198 >Feature sequence1199 >Feature sequence1200 <1 1046 gene locus_tag LOCUS_11330 <1 1046 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103016249.1:GTPase HflX >Feature sequence1201 409 1116 gene locus_tag LOCUS_11340 409 1116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 503 512 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1202 >Feature sequence1203 >Feature sequence1204 <1121 282 gene locus_tag LOCUS_11350 <1121 282 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762696.1:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence1205 >Feature sequence1206 1121 234 gene locus_tag LOCUS_11360 gene panC 1121 234 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391688.1 protein_id gnl|my_center|LOCUS_11360 >Feature sequence1207 >Feature sequence1208 604 613 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1209 <1 740 gene locus_tag LOCUS_11370 <1 740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070433.1:amidohydrolase family protein 488 497 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 857 931 gene locus_tag LOCUS_t00320 857 931 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1210 628 62 gene locus_tag LOCUS_11380 628 62 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 1119 625 gene locus_tag LOCUS_11390 1119 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence1211 >Feature sequence1212 <1 573 gene locus_tag LOCUS_11400 <1 573 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880399.1:hydrogenase nickel incorporation protein HypB 586 858 gene locus_tag LOCUS_11410 586 858 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776342.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence1213 >Feature sequence1214 191 838 gene locus_tag LOCUS_11420 191 838 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761903.1 protein_id gnl|my_center|LOCUS_11420 >Feature sequence1215 <1 601 gene locus_tag LOCUS_11430 <1 601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003891452.1:TetR/AcrR family transcriptional regulator >Feature sequence1216 >Feature sequence1217 303 1112 gene locus_tag LOCUS_11440 gene trpC 303 1112 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765048.1 protein_id gnl|my_center|LOCUS_11440 >Feature sequence1218 <1 991 gene locus_tag LOCUS_11450 <1 991 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence1219 >Feature sequence1220 669 58 gene locus_tag LOCUS_11460 669 58 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682263.1 protein_id gnl|my_center|LOCUS_11460 >Feature sequence1221 >Feature sequence1222 >Feature sequence1223 >Feature sequence1224 <1111 358 gene locus_tag LOCUS_11470 <1111 358 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164927126.1:DUF4438 domain-containing protein >Feature sequence1225 <1 568 gene locus_tag LOCUS_11480 <1 568 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404453.1:tryptophanase >Feature sequence1226 <1 1026 gene locus_tag LOCUS_11490 <1 1026 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012259418.1:carboxylate-amine ligase >Feature sequence1227 >Feature sequence1228 >Feature sequence1229 <1109 506 gene locus_tag LOCUS_11500 <1109 506 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404499.1:dicarboxylate/amino acid:cation symporter >Feature sequence1230 >Feature sequence1231 <1 843 gene locus_tag LOCUS_11510 <1 843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004398493.1:sensory box histidine kinase PhoR >Feature sequence1232 >Feature sequence1233 >Feature sequence1234 <1 693 gene locus_tag LOCUS_11520 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943070.1:ATP-binding protein >Feature sequence1235 <1 944 gene locus_tag LOCUS_11530 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037269.1:endonuclease >Feature sequence1236 <1103 254 gene locus_tag LOCUS_11540 <1103 254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958038.1:transcription-repair coupling factor 376 385 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1237 >Feature sequence1238 >Feature sequence1239 >Feature sequence1240 45 521 gene locus_tag LOCUS_11550 45 521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 657 585 gene locus_tag LOCUS_t00330 657 585 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1241 >Feature sequence1242 582 785 gene locus_tag LOCUS_11560 582 785 CDS product PspC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957794.1 protein_id gnl|my_center|LOCUS_11560 >Feature sequence1243 >Feature sequence1244 >Feature sequence1245 >Feature sequence1246 1097 498 gene locus_tag LOCUS_11570 1097 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence1247 >Feature sequence1248 548 303 gene locus_tag LOCUS_11580 gene purS 548 303 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403723.1 protein_id gnl|my_center|LOCUS_11580 <1097 545 gene locus_tag LOCUS_11590 <1097 545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853992.1:CDP-diacylglycerol--serine O-phosphatidyltransferase >Feature sequence1249 >Feature sequence1250 54 983 gene locus_tag LOCUS_11600 gene ftsY 54 983 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787934.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence1251 >Feature sequence1252 <1 767 gene locus_tag LOCUS_11610 <1 767 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403093.1:b(o/a)3-type cytochrome-c oxidase subunit 1 >Feature sequence1253 <1 892 gene locus_tag LOCUS_11620 <1 892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004399303.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase >Feature sequence1254 189 509 gene locus_tag LOCUS_11630 189 509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence1255 <1 933 gene locus_tag LOCUS_11640 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393494.1:threonine synthase >Feature sequence1256 >Feature sequence1257 517 666 gene locus_tag LOCUS_11650 517 666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence1258 >Feature sequence1259 >Feature sequence1260 <1092 523 gene locus_tag LOCUS_11660 <1092 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933221.1:5'/3'-nucleotidase SurE >Feature sequence1261 >Feature sequence1262 2 583 gene locus_tag LOCUS_11670 2 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 663 1022 gene locus_tag LOCUS_11680 663 1022 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_145023062.1 protein_id gnl|my_center|LOCUS_11680 >Feature sequence1263 93 671 gene locus_tag LOCUS_11690 93 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence1264 >Feature sequence1265 <1 1071 gene locus_tag LOCUS_11700 <1 1071 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011173822.1:tRNA 4-thiouridine(8) synthase ThiI >Feature sequence1266 >Feature sequence1267 >Feature sequence1268 >Feature sequence1269 >Feature sequence1270 >Feature sequence1271 829 341 gene locus_tag LOCUS_11710 829 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 >Feature sequence1272 86 841 gene locus_tag LOCUS_11720 86 841 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942121.1 protein_id gnl|my_center|LOCUS_11720 >Feature sequence1273 >Feature sequence1274 >Feature sequence1275 >Feature sequence1276 510 301 gene locus_tag LOCUS_11730 510 301 CDS product MbtH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770699.1 protein_id gnl|my_center|LOCUS_11730 >Feature sequence1277 >Feature sequence1278 >Feature sequence1279 >Feature sequence1280 >Feature sequence1281 785 438 gene locus_tag LOCUS_11740 785 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 >Feature sequence1282 <1082 406 gene locus_tag LOCUS_11750 <1082 406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393061.1:type II secretion system F family protein >Feature sequence1283 >Feature sequence1284 <1 667 gene locus_tag LOCUS_11760 <1 667 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_009967010.1:oligoendopeptidase F >Feature sequence1285 >Feature sequence1286 >Feature sequence1287 >Feature sequence1288 >Feature sequence1289 463 714 gene locus_tag LOCUS_11770 463 714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 >Feature sequence1290 808 86 gene locus_tag LOCUS_11780 808 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 >Feature sequence1291 <1081 273 gene locus_tag LOCUS_11790 <1081 273 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545277.1:dihydropteroate synthase >Feature sequence1292 1080 127 gene locus_tag LOCUS_11800 1080 127 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence1293 >Feature sequence1294 783 792 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1295 >Feature sequence1296 411 818 gene locus_tag LOCUS_11810 411 818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence1297 >Feature sequence1298 >Feature sequence1299 770 480 gene locus_tag LOCUS_11820 770 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 791 800 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1300 >Feature sequence1301 >Feature sequence1302 >Feature sequence1303 >Feature sequence1304 >Feature sequence1305 >Feature sequence1306 >Feature sequence1307 >Feature sequence1308 <1 1065 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttcagcatacctatgagggattgaaac >Feature sequence1309 <1 639 gene locus_tag LOCUS_11830 <1 639 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583412.1:alanine dehydrogenase note possible pseudo, frameshifted 473 482 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 548 742 gene locus_tag LOCUS_11840 548 742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11840 >Feature sequence1310 >Feature sequence1311 >Feature sequence1312 >Feature sequence1313 1070 480 gene locus_tag LOCUS_11850 1070 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11850 >Feature sequence1314 2 652 gene locus_tag LOCUS_11860 2 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11860 >Feature sequence1315 810 145 gene locus_tag LOCUS_11870 810 145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 >Feature sequence1316 >Feature sequence1317 <1 779 gene locus_tag LOCUS_11880 <1 779 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_081461260.1:PAS domain S-box protein >Feature sequence1318 >Feature sequence1319 >Feature sequence1320 634 560 gene locus_tag LOCUS_t00340 634 560 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1321 >Feature sequence1322 >Feature sequence1323 >Feature sequence1324 256 265 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1325 >Feature sequence1326 >Feature sequence1327 575 225 gene locus_tag LOCUS_11890 575 225 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010918309.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence1328 >Feature sequence1329 <1 706 gene locus_tag LOCUS_11900 <1 706 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931782.1:3-deoxy-8-phosphooctulonate synthase >Feature sequence1330 >Feature sequence1331 <1 681 gene locus_tag LOCUS_11910 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005783875.1:acetylglutamate kinase >Feature sequence1332 >Feature sequence1333 <1063 228 gene locus_tag LOCUS_11920 <1063 228 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013098887.1:tagatose-bisphosphate aldolase subunit KbaZ 306 315 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1334 >Feature sequence1335 >Feature sequence1336 >Feature sequence1337 >Feature sequence1338 >Feature sequence1339 936 10 gene locus_tag LOCUS_11930 936 10 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_11930 >Feature sequence1340 >Feature sequence1341 270 839 gene locus_tag LOCUS_11940 270 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 >Feature sequence1342 33 926 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttcagcatacctatgagggattgaaac >Feature sequence1343 2 1043 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatccctcataggtatgctgaaaac >Feature sequence1344 >Feature sequence1345 2 976 gene locus_tag LOCUS_11950 2 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257446.1 protein_id gnl|my_center|LOCUS_11950 >Feature sequence1346 >Feature sequence1347 >Feature sequence1348 <1 514 gene locus_tag LOCUS_11960 <1 514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011404833.1:polysulfide reductase NrfD 511 954 gene locus_tag LOCUS_11970 511 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence1349 >Feature sequence1350 777 151 gene locus_tag LOCUS_11980 777 151 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421523.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence1351 <1059 470 gene locus_tag LOCUS_11990 <1059 470 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010931943.1:sugar phosphate nucleotidyltransferase >Feature sequence1352 >Feature sequence1353 >Feature sequence1354 >Feature sequence1355 >Feature sequence1356 <1 664 gene locus_tag LOCUS_12000 <1 664 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082064.1:F0F1 ATP synthase subunit alpha >Feature sequence1357 >Feature sequence1358 552 31 gene locus_tag LOCUS_12010 552 31 CDS product type 1 glutamine amidotransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868874.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence1359 >Feature sequence1360 526 77 gene locus_tag LOCUS_12020 526 77 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762241.1 protein_id gnl|my_center|LOCUS_12020 >Feature sequence1361 <1 582 gene locus_tag LOCUS_12030 <1 582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence1362 616 625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1363 >Feature sequence1364 >Feature sequence1365 697 29 gene locus_tag LOCUS_12040 697 29 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 >Feature sequence1366 >Feature sequence1367 >Feature sequence1368 >Feature sequence1369 >Feature sequence1370 <1 558 gene locus_tag LOCUS_12050 <1 558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403140.1:alpha-amylase family glycosyl hydrolase >Feature sequence1371 631 296 gene locus_tag LOCUS_12060 631 296 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391577.1 protein_id gnl|my_center|LOCUS_12060 >Feature sequence1372 3 491 gene locus_tag LOCUS_12070 3 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 656 665 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1373 <1 944 gene locus_tag LOCUS_12080 <1 944 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546508.1:diphosphate--fructose-6-phosphate 1-phosphotransferase >Feature sequence1374 310 319 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1375 20 1051 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gttttcagcatacctatgagggattgaaac >Feature sequence1376 >Feature sequence1377 >Feature sequence1378 767 273 gene locus_tag LOCUS_12090 767 273 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816335.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence1379 >Feature sequence1380 >Feature sequence1381 3 410 gene locus_tag LOCUS_12100 3 410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 504 863 gene locus_tag LOCUS_12110 504 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 883 967 gene locus_tag LOCUS_t00350 883 967 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1382 >Feature sequence1383 >Feature sequence1384 >Feature sequence1385 >Feature sequence1386 >Feature sequence1387 <1046 214 gene locus_tag LOCUS_12120 <1046 214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein >Feature sequence1388 >Feature sequence1389 >Feature sequence1390 >Feature sequence1391 >Feature sequence1392 >Feature sequence1393 >Feature sequence1394 >Feature sequence1395 965 291 gene locus_tag LOCUS_12130 965 291 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010883319.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence1396 <1043 206 gene locus_tag LOCUS_12140 <1043 206 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082004.1:peptide chain release factor 2 >Feature sequence1397 <1 798 gene locus_tag LOCUS_12150 <1 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531440.1:DegQ family serine endoprotease >Feature sequence1398 >Feature sequence1399 >Feature sequence1400 >Feature sequence1401 >Feature sequence1402 >Feature sequence1403 609 415 gene locus_tag LOCUS_12160 gene rpmB 609 415 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942874.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence1404 >Feature sequence1405 890 441 gene locus_tag LOCUS_12170 890 441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12170 458 467 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1406 >Feature sequence1407 474 483 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1408 >Feature sequence1409 <1 523 gene locus_tag LOCUS_12180 <1 523 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941031.1:ATP-dependent DNA helicase DinG 1019 627 gene locus_tag LOCUS_12190 1019 627 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 >Feature sequence1410 44 778 gene locus_tag LOCUS_12200 44 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 >Feature sequence1411 >Feature sequence1412 >Feature sequence1413 819 94 gene locus_tag LOCUS_12210 819 94 CDS product polyprenol monophosphomannose synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942433.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence1414 >Feature sequence1415 >Feature sequence1416 <1 778 gene locus_tag LOCUS_12220 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_103037073.1:prolyl oligopeptidase family serine peptidase >Feature sequence1417 >Feature sequence1418 >Feature sequence1419 <1036 181 gene locus_tag LOCUS_12230 <1036 181 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011202792.1:pitrilysin family protein >Feature sequence1420 746 755 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1421 796 805 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1422 <1035 139 gene locus_tag LOCUS_12240 <1035 139 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107360.1:electron transport complex subunit RsxC >Feature sequence1423 >Feature sequence1424 <1 638 gene locus_tag LOCUS_12250 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000125282.1:acetoacetate metabolism transcriptional regulator AtoC >Feature sequence1425 <1035 311 gene locus_tag LOCUS_12260 <1035 311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948103.1:ABC transporter ATP-binding protein >Feature sequence1426 >Feature sequence1427 1034 27 gene locus_tag LOCUS_12270 1034 27 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257499.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence1428 >Feature sequence1429 >Feature sequence1430 949 146 gene locus_tag LOCUS_12280 949 146 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679769.1 protein_id gnl|my_center|LOCUS_12280 221 230 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1431 >Feature sequence1432 21 572 gene locus_tag LOCUS_12290 21 572 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_12290 >Feature sequence1433 <1031 387 gene locus_tag LOCUS_12300 <1031 387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250181.1:UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) >Feature sequence1434 >Feature sequence1435 1029 70 gene locus_tag LOCUS_12310 1029 70 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence1436 >Feature sequence1437 1027 164 gene locus_tag LOCUS_12320 1027 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence1438 585 659 gene locus_tag LOCUS_t00360 585 659 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 708 896 gene locus_tag LOCUS_12330 gene secE 708 896 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931843.1 protein_id gnl|my_center|LOCUS_12330 >Feature sequence1439 >Feature sequence1440 1027 401 gene locus_tag LOCUS_12340 1027 401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence1441 >Feature sequence1442 >Feature sequence1443 51 125 gene locus_tag LOCUS_t00370 51 125 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence1444 <1 836 gene locus_tag LOCUS_12350 <1 836 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010902857.1:multicopper oxidase family protein >Feature sequence1445 >Feature sequence1446 >Feature sequence1447 392 401 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1448 <1 959 gene locus_tag LOCUS_12360 <1 959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005812939.1:recombinase RecA >Feature sequence1449 <1025 388 gene locus_tag LOCUS_12370 <1025 388 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546652.1:FAD/NAD(P)-binding protein >Feature sequence1450 >Feature sequence1451 >Feature sequence1452 >Feature sequence1453 701 710 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1454 >Feature sequence1455 >Feature sequence1456 999 559 gene locus_tag LOCUS_12380 999 559 CDS product SUF system NifU family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228878.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence1457 >Feature sequence1458 >Feature sequence1459 229 777 gene locus_tag LOCUS_12390 229 777 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 >Feature sequence1460 9 404 gene locus_tag LOCUS_12400 9 404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 >Feature sequence1461 >Feature sequence1462 <1019 219 gene locus_tag LOCUS_12410 <1019 219 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943668.1:flagellar hook-associated protein FlgL >Feature sequence1463 <1019 197 gene locus_tag LOCUS_12420 <1019 197 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948861.1:ABC transporter permease >Feature sequence1464 602 772 gene locus_tag LOCUS_12430 gene lysW 602 772 CDS product lysine biosynthesis protein LysW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229005.1 protein_id gnl|my_center|LOCUS_12430 >Feature sequence1465 >Feature sequence1466 <1 657 gene locus_tag LOCUS_12440 <1 657 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011227870.1:MogA/MoaB family molybdenum cofactor biosynthesis protein >Feature sequence1467 >Feature sequence1468 >Feature sequence1469 >Feature sequence1470 42 614 gene locus_tag LOCUS_12450 gene idi 42 614 CDS product isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963899.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence1471 749 378 gene locus_tag LOCUS_12460 749 378 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011172908.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence1472 >Feature sequence1473 >Feature sequence1474 >Feature sequence1475 >Feature sequence1476 38 991 gene locus_tag LOCUS_12470 38 991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 >Feature sequence1477 <1 948 gene locus_tag LOCUS_12480 <1 948 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010890572.1:Fic family protein >Feature sequence1478 >Feature sequence1479 >Feature sequence1480 812 546 gene locus_tag LOCUS_12490 812 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 826 835 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1481 >Feature sequence1482 >Feature sequence1483 >Feature sequence1484 <1012 429 gene locus_tag LOCUS_12500 <1012 429 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012258192.1:TRAP transporter large permease subunit >Feature sequence1485 118 546 gene locus_tag LOCUS_12510 118 546 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942284.1 protein_id gnl|my_center|LOCUS_12510 1010 474 gene locus_tag LOCUS_12520 1010 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 575 584 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1486 >Feature sequence1487 >Feature sequence1488 1011 265 gene locus_tag LOCUS_12530 1011 265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 >Feature sequence1489 993 172 gene locus_tag LOCUS_12540 993 172 CDS product 5'-nucleotidase, lipoprotein e(P4) family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000782748.1 protein_id gnl|my_center|LOCUS_12540 >Feature sequence1490 >Feature sequence1491 >Feature sequence1492 >Feature sequence1493 435 905 gene locus_tag LOCUS_12550 435 905 CDS product methylated-DNA--[protein]-cysteine S-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000017896.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence1494 >Feature sequence1495 >Feature sequence1496 <1008 176 gene locus_tag LOCUS_12560 <1008 176 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678884.1:FtsH protease activity modulator HflK >Feature sequence1497 >Feature sequence1498 >Feature sequence1499 >Feature sequence1500 >Feature sequence1501 >Feature sequence1502 >Feature sequence1503 >Feature sequence1504 >Feature sequence1505 <1 745 gene locus_tag LOCUS_12570 <1 745 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926799.1:Ppx/GppA phosphatase family protein >Feature sequence1506 805 497 gene locus_tag LOCUS_12580 gene rpsJ 805 497 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005810163.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence1507 >Feature sequence1508 >Feature sequence1509 >Feature sequence1510 461 129 gene locus_tag LOCUS_12590 461 129 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_12590 >Feature sequence1511 533 805 gene locus_tag LOCUS_12600 533 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence1512 >Feature sequence1513 >Feature sequence1514 >Feature sequence1515 >Feature sequence1516 381 737 gene locus_tag LOCUS_12610 381 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12610 722 731 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence1517 >Feature sequence1518