>Feature sequence001 34 390 gene locus_tag LOCUS_00010 34 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 662 1390 gene locus_tag LOCUS_00020 662 1390 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867812.1 protein_id gnl|my_center|LOCUS_00020 1600 2838 gene locus_tag LOCUS_00030 1600 2838 CDS product ORC1-type DNA replication protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146489.1 protein_id gnl|my_center|LOCUS_00030 2861 4387 gene locus_tag LOCUS_00040 2861 4387 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877017.1 protein_id gnl|my_center|LOCUS_00040 4622 4401 gene locus_tag LOCUS_00050 4622 4401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 5826 5113 gene locus_tag LOCUS_00060 5826 5113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 5825 9280 gene locus_tag LOCUS_00070 gene polC 5825 9280 CDS product DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061308.1 protein_id gnl|my_center|LOCUS_00070 9581 9333 gene locus_tag LOCUS_00080 9581 9333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 10699 9485 gene locus_tag LOCUS_00090 10699 9485 CDS product tripartite tricarboxylate transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115892580.1 protein_id gnl|my_center|LOCUS_00090 10735 11073 gene locus_tag LOCUS_00100 10735 11073 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869778.1 protein_id gnl|my_center|LOCUS_00100 11070 11990 gene locus_tag LOCUS_00110 11070 11990 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_00110 12023 13522 gene locus_tag LOCUS_00120 12023 13522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00120 13522 14220 gene locus_tag LOCUS_00130 13522 14220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00130 14217 15404 gene locus_tag LOCUS_00140 14217 15404 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583291.1 protein_id gnl|my_center|LOCUS_00140 15675 17303 gene locus_tag LOCUS_00150 15675 17303 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_00150 18354 17332 gene locus_tag LOCUS_00160 18354 17332 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966350.1 protein_id gnl|my_center|LOCUS_00160 18629 19828 gene locus_tag LOCUS_00170 18629 19828 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875974.1 protein_id gnl|my_center|LOCUS_00170 19825 21054 gene locus_tag LOCUS_00180 19825 21054 CDS product GDP-mannose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763221.1 protein_id gnl|my_center|LOCUS_00180 21320 22279 gene locus_tag LOCUS_00190 21320 22279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00190 22298 22765 gene locus_tag LOCUS_00200 22298 22765 CDS product FdtA/QdtA family cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057183.1 protein_id gnl|my_center|LOCUS_00200 22722 23378 gene locus_tag LOCUS_00210 22722 23378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 23375 24475 gene locus_tag LOCUS_00220 23375 24475 CDS product DegT/DnrJ/EryC1/StrS family aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583708.1 protein_id gnl|my_center|LOCUS_00220 24481 25383 gene locus_tag LOCUS_00230 24481 25383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 >Feature sequence002 5471 5737 gene locus_tag LOCUS_00240 5471 5737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 5781 6212 gene locus_tag LOCUS_00250 5781 6212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 8742 6409 gene locus_tag LOCUS_00260 8742 6409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 9893 8925 gene locus_tag LOCUS_00270 9893 8925 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941783.1 protein_id gnl|my_center|LOCUS_00270 10090 10494 gene locus_tag LOCUS_00280 10090 10494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 10579 11304 gene locus_tag LOCUS_00290 gene rnhB 10579 11304 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869628.1 protein_id gnl|my_center|LOCUS_00290 13151 11466 gene locus_tag LOCUS_00300 gene pyrG 13151 11466 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320045.1 protein_id gnl|my_center|LOCUS_00300 13278 13631 gene locus_tag LOCUS_00310 13278 13631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 13779 14531 gene locus_tag LOCUS_00320 13779 14531 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869745.1 protein_id gnl|my_center|LOCUS_00320 16007 14634 gene locus_tag LOCUS_00330 16007 14634 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 17995 16049 gene locus_tag LOCUS_00340 gene rqcH 17995 16049 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871150.1 protein_id gnl|my_center|LOCUS_00340 18196 18987 gene locus_tag LOCUS_00350 18196 18987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 19562 18978 gene locus_tag LOCUS_00360 gene scpB 19562 18978 CDS product SMC-Scp complex subunit ScpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867410.1 protein_id gnl|my_center|LOCUS_00360 20294 19569 gene locus_tag LOCUS_00370 20294 19569 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867480.1 protein_id gnl|my_center|LOCUS_00370 20516 20313 gene locus_tag LOCUS_00380 20516 20313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 20831 22329 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcccaccatgatctgattctaac >Feature sequence003 1663 479 gene locus_tag LOCUS_00390 gene thiI 1663 479 CDS product tRNA 4-thiouridine(8) synthase ThiI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878380.1 protein_id gnl|my_center|LOCUS_00390 2325 1744 gene locus_tag LOCUS_00400 2325 1744 CDS product 50S ribosomal protein L15e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867981.1 protein_id gnl|my_center|LOCUS_00400 3998 2544 gene locus_tag LOCUS_00410 gene gatA 3998 2544 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880108.1 protein_id gnl|my_center|LOCUS_00410 4360 4064 gene locus_tag LOCUS_00420 gene gatC 4360 4064 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879817.1 protein_id gnl|my_center|LOCUS_00420 4747 4439 gene locus_tag LOCUS_00430 4747 4439 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249488.1 protein_id gnl|my_center|LOCUS_00430 5305 4826 gene locus_tag LOCUS_00440 5305 4826 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868568.1 protein_id gnl|my_center|LOCUS_00440 5699 5418 gene locus_tag LOCUS_00450 5699 5418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 6760 5735 gene locus_tag LOCUS_00460 gene dph2 6760 5735 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 protein_id gnl|my_center|LOCUS_00460 7805 7197 gene locus_tag LOCUS_00470 gene thrH 7805 7197 CDS product bifunctional phosphoserine phosphatase/homoserine phosphotransferase ThrH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003098078.1 protein_id gnl|my_center|LOCUS_00470 9477 8467 gene locus_tag LOCUS_00480 gene orc1 9477 8467 CDS product DNA replication protein Orc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010904037.1 protein_id gnl|my_center|LOCUS_00480 10184 11287 gene locus_tag LOCUS_00490 gene ftsZ 10184 11287 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496560.1 protein_id gnl|my_center|LOCUS_00490 11507 12073 gene locus_tag LOCUS_00500 11507 12073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 12075 12905 gene locus_tag LOCUS_00510 12075 12905 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066246.1 protein_id gnl|my_center|LOCUS_00510 12966 14417 gene locus_tag LOCUS_00520 12966 14417 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_00520 14419 15243 gene locus_tag LOCUS_00530 14419 15243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 15240 16217 gene locus_tag LOCUS_00540 15240 16217 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080192.1 protein_id gnl|my_center|LOCUS_00540 16297 16665 gene locus_tag LOCUS_00550 16297 16665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00550 17464 18318 gene locus_tag LOCUS_00560 17464 18318 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867773.1 protein_id gnl|my_center|LOCUS_00560 18365 20371 gene locus_tag LOCUS_00570 18365 20371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00570 20584 21414 gene locus_tag LOCUS_00580 gene trmBL2 20584 21414 CDS product HTH-type transcriptional regulator TrmBL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146940.1 protein_id gnl|my_center|LOCUS_00580 >Feature sequence004 <1 774 gene locus_tag LOCUS_00590 <1 774 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878796.1:transcription initiation factor IIB 1937 780 gene locus_tag LOCUS_00600 1937 780 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876814.1 protein_id gnl|my_center|LOCUS_00600 2015 2407 gene locus_tag LOCUS_00610 2015 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 4175 2388 gene locus_tag LOCUS_00620 4175 2388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 6861 4240 gene locus_tag LOCUS_00630 6861 4240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 6923 7534 gene locus_tag LOCUS_00640 6923 7534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 8113 7580 gene locus_tag LOCUS_00650 8113 7580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 8621 8106 gene locus_tag LOCUS_00660 8621 8106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 8676 9062 gene locus_tag LOCUS_00670 8676 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 9567 9130 gene locus_tag LOCUS_00680 9567 9130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00680 11327 10011 gene locus_tag LOCUS_00690 11327 10011 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010903741.1 protein_id gnl|my_center|LOCUS_00690 12102 11464 gene locus_tag LOCUS_00700 12102 11464 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011173403.1 protein_id gnl|my_center|LOCUS_00700 12161 12421 gene locus_tag LOCUS_00710 12161 12421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00710 12895 12428 gene locus_tag LOCUS_00720 12895 12428 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583745.1 protein_id gnl|my_center|LOCUS_00720 13993 13088 gene locus_tag LOCUS_00730 13993 13088 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584019.1 protein_id gnl|my_center|LOCUS_00730 14805 13990 gene locus_tag LOCUS_00740 14805 13990 CDS product tRNA (adenine-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546052.1 protein_id gnl|my_center|LOCUS_00740 15249 14815 gene locus_tag LOCUS_00750 15249 14815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00750 15942 17306 gene locus_tag LOCUS_00760 15942 17306 CDS product tRNA pseudouridine(54/55) synthase Pus10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021461.1 protein_id gnl|my_center|LOCUS_00760 17379 17681 gene locus_tag LOCUS_00770 17379 17681 CDS product 50S ribosomal protein L21e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869531.1 protein_id gnl|my_center|LOCUS_00770 17691 18137 gene locus_tag LOCUS_00780 17691 18137 CDS product DNA-directed RNA polymerase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061025.1 protein_id gnl|my_center|LOCUS_00780 18209 18784 gene locus_tag LOCUS_00790 18209 18784 CDS product DUF655 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876938.1 protein_id gnl|my_center|LOCUS_00790 18856 19704 gene locus_tag LOCUS_00800 gene rsmA 18856 19704 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249850.1 protein_id gnl|my_center|LOCUS_00800 19701 20363 gene locus_tag LOCUS_00810 19701 20363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 20360 20713 gene locus_tag LOCUS_00820 20360 20713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 20713 21285 gene locus_tag LOCUS_00830 20713 21285 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061267.1 protein_id gnl|my_center|LOCUS_00830 21342 21635 gene locus_tag LOCUS_00840 21342 21635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 >Feature sequence005 <1 1572 gene locus_tag LOCUS_00850 <1 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870512.1:thermosome subunit beta 2997 1675 gene locus_tag LOCUS_00860 2997 1675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 4301 3435 gene locus_tag LOCUS_00870 4301 3435 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146505.1 protein_id gnl|my_center|LOCUS_00870 4354 5007 gene locus_tag LOCUS_00880 4354 5007 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526170.1 protein_id gnl|my_center|LOCUS_00880 6018 4993 gene locus_tag LOCUS_00890 gene fen 6018 4993 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_00890 6576 6118 gene locus_tag LOCUS_00900 gene lepB 6576 6118 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001831955.1 protein_id gnl|my_center|LOCUS_00900 7434 6913 gene locus_tag LOCUS_00910 7434 6913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 7735 7944 gene locus_tag LOCUS_00920 7735 7944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00920 9511 7949 gene locus_tag LOCUS_00930 9511 7949 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879805.1 protein_id gnl|my_center|LOCUS_00930 9831 9571 gene locus_tag LOCUS_00940 9831 9571 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878078.1 protein_id gnl|my_center|LOCUS_00940 10037 9858 gene locus_tag LOCUS_00950 10037 9858 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762439.1 protein_id gnl|my_center|LOCUS_00950 10368 11168 gene locus_tag LOCUS_00960 10368 11168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 12096 11215 gene locus_tag LOCUS_00970 12096 11215 CDS product branched-chain amino acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545688.1 protein_id gnl|my_center|LOCUS_00970 12135 13919 gene locus_tag LOCUS_00980 gene pheA 12135 13919 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013683139.1 protein_id gnl|my_center|LOCUS_00980 14409 13993 gene locus_tag LOCUS_00990 14409 13993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 14535 15311 gene locus_tag LOCUS_01000 14535 15311 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01000 15563 16192 gene locus_tag LOCUS_01010 15563 16192 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 16189 16788 gene locus_tag LOCUS_01020 16189 16788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01020 17154 16825 gene locus_tag LOCUS_01030 17154 16825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 17214 17576 gene locus_tag LOCUS_01040 17214 17576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 17554 18000 gene locus_tag LOCUS_01050 gene hycI 17554 18000 CDS product hydrogenase maturation peptidase HycI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867982.1 protein_id gnl|my_center|LOCUS_01050 18342 18025 gene locus_tag LOCUS_01060 18342 18025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 18722 18339 gene locus_tag LOCUS_01070 18722 18339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 19596 18709 gene locus_tag LOCUS_01080 19596 18709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 <20753 19593 gene locus_tag LOCUS_01090 <20753 19593 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545774.1:NADH-quinone oxidoreductase subunit C >Feature sequence006 296 27 gene locus_tag LOCUS_01100 296 27 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 476 1234 gene locus_tag LOCUS_01110 476 1234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 1536 1246 gene locus_tag LOCUS_01120 1536 1246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01120 1922 1635 gene locus_tag LOCUS_01130 1922 1635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 2149 2018 gene locus_tag LOCUS_01140 2149 2018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01140 2258 2185 gene locus_tag LOCUS_t00010 2258 2185 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 2297 3142 gene locus_tag LOCUS_01150 2297 3142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01150 3148 3687 gene locus_tag LOCUS_01160 3148 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01160 4102 3770 gene locus_tag LOCUS_01170 4102 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 4963 4109 gene locus_tag LOCUS_01180 4963 4109 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250367.1 protein_id gnl|my_center|LOCUS_01180 5608 4976 gene locus_tag LOCUS_01190 5608 4976 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250368.1 protein_id gnl|my_center|LOCUS_01190 6096 5614 gene locus_tag LOCUS_01200 6096 5614 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867125.1 protein_id gnl|my_center|LOCUS_01200 6542 6102 gene locus_tag LOCUS_01210 6542 6102 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878044.1 protein_id gnl|my_center|LOCUS_01210 6758 6561 gene locus_tag LOCUS_01220 6758 6561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 7415 8074 gene locus_tag LOCUS_01230 7415 8074 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01230 8071 8403 gene locus_tag LOCUS_01240 8071 8403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01240 9508 8396 gene locus_tag LOCUS_01250 gene ftsZ 9508 8396 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250372.1 protein_id gnl|my_center|LOCUS_01250 10340 9564 gene locus_tag LOCUS_01260 10340 9564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 10407 10652 gene locus_tag LOCUS_01270 10407 10652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 11450 10617 gene locus_tag LOCUS_01280 11450 10617 CDS product glucose-6-phosphate isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020865.1 protein_id gnl|my_center|LOCUS_01280 14298 11452 gene locus_tag LOCUS_01290 gene leuS 14298 11452 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879908.1 protein_id gnl|my_center|LOCUS_01290 14715 14344 gene locus_tag LOCUS_01300 14715 14344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01300 15044 15919 gene locus_tag LOCUS_01310 15044 15919 CDS product lysylphosphatidylglycerol synthase transmembrane domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267575.1 protein_id gnl|my_center|LOCUS_01310 16362 17135 gene locus_tag LOCUS_01320 gene minD 16362 17135 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249304.1 protein_id gnl|my_center|LOCUS_01320 17221 18285 gene locus_tag LOCUS_01330 17221 18285 CDS product glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880717.1 protein_id gnl|my_center|LOCUS_01330 18374 18586 gene locus_tag LOCUS_01340 18374 18586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 20271 18595 gene locus_tag LOCUS_01350 gene pheT 20271 18595 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868500.1 protein_id gnl|my_center|LOCUS_01350 >Feature sequence007 1217 654 gene locus_tag LOCUS_01360 1217 654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01360 1978 1238 gene locus_tag LOCUS_01370 1978 1238 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020938.1 protein_id gnl|my_center|LOCUS_01370 5984 1989 gene locus_tag LOCUS_01380 5984 1989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 7503 5977 gene locus_tag LOCUS_01390 7503 5977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 8050 7700 gene locus_tag LOCUS_01400 gene eif1A 8050 7700 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146587.1 protein_id gnl|my_center|LOCUS_01400 8756 8019 gene locus_tag LOCUS_01410 8756 8019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 9089 8775 gene locus_tag LOCUS_01420 9089 8775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 9522 9100 gene locus_tag LOCUS_01430 9522 9100 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877371.1 protein_id gnl|my_center|LOCUS_01430 10283 9534 gene locus_tag LOCUS_01440 10283 9534 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 12312 10297 gene locus_tag LOCUS_01450 12312 10297 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877372.1 protein_id gnl|my_center|LOCUS_01450 12959 12414 gene locus_tag LOCUS_01460 12959 12414 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_01460 13739 13068 gene locus_tag LOCUS_01470 13739 13068 CDS product diphthine--ammonia ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980120.1 protein_id gnl|my_center|LOCUS_01470 15061 13736 gene locus_tag LOCUS_01480 15061 13736 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878057.1 protein_id gnl|my_center|LOCUS_01480 15127 15687 gene locus_tag LOCUS_01490 15127 15687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 15711 16910 gene locus_tag LOCUS_01500 15711 16910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 16901 17530 gene locus_tag LOCUS_01510 16901 17530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 17527 18111 gene locus_tag LOCUS_01520 17527 18111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 18234 18458 gene locus_tag LOCUS_01530 18234 18458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01530 18585 19295 gene locus_tag LOCUS_01540 18585 19295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 >Feature sequence008 377 712 gene locus_tag LOCUS_01550 377 712 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146744.1 protein_id gnl|my_center|LOCUS_01550 727 906 gene locus_tag LOCUS_01560 727 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01560 920 1396 gene locus_tag LOCUS_01570 920 1396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01570 1417 2088 gene locus_tag LOCUS_01580 1417 2088 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496375.1 protein_id gnl|my_center|LOCUS_01580 3438 2134 gene locus_tag LOCUS_01590 gene aspS 3438 2134 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868079.1 protein_id gnl|my_center|LOCUS_01590 3823 3500 gene locus_tag LOCUS_01600 3823 3500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01600 5062 3857 gene locus_tag LOCUS_01610 5062 3857 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387517.1 protein_id gnl|my_center|LOCUS_01610 5042 5308 gene locus_tag LOCUS_01620 5042 5308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 5305 5562 gene locus_tag LOCUS_01630 5305 5562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 5565 5843 gene locus_tag LOCUS_01640 5565 5843 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249719.1 protein_id gnl|my_center|LOCUS_01640 5926 7158 gene locus_tag LOCUS_01650 5926 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 7867 7244 gene locus_tag LOCUS_01660 7867 7244 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 7982 8091 gene locus_tag LOCUS_r00010 7982 8091 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 8469 8185 gene locus_tag LOCUS_01670 8469 8185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01670 8562 9788 gene locus_tag LOCUS_01680 8562 9788 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869194.1 protein_id gnl|my_center|LOCUS_01680 9830 10492 gene locus_tag LOCUS_01690 9830 10492 CDS product DJ-1/PfpI/YhbO family deglycase/protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870481.1 protein_id gnl|my_center|LOCUS_01690 11323 10868 gene locus_tag LOCUS_01700 11323 10868 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 11844 11326 gene locus_tag LOCUS_01710 11844 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 11825 11989 gene locus_tag LOCUS_01720 11825 11989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01720 12051 12488 gene locus_tag LOCUS_01730 12051 12488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01730 12482 12976 gene locus_tag LOCUS_01740 12482 12976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 12992 13678 gene locus_tag LOCUS_01750 12992 13678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 13683 15902 gene locus_tag LOCUS_01760 13683 15902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 16272 15853 gene locus_tag LOCUS_01770 16272 15853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 16292 16603 gene locus_tag LOCUS_01780 16292 16603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 18053 16668 gene locus_tag LOCUS_01790 18053 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 18982 18068 gene locus_tag LOCUS_01800 18982 18068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 19688 19317 gene locus_tag LOCUS_01810 19688 19317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 >Feature sequence009 801 385 gene locus_tag LOCUS_01820 gene rplM 801 385 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_01820 1172 807 gene locus_tag LOCUS_01830 1172 807 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867655.1 protein_id gnl|my_center|LOCUS_01830 2176 1358 gene locus_tag LOCUS_01840 2176 1358 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875678.1 protein_id gnl|my_center|LOCUS_01840 2586 2182 gene locus_tag LOCUS_01850 2586 2182 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867653.1 protein_id gnl|my_center|LOCUS_01850 3187 2606 gene locus_tag LOCUS_01860 gene rpsD 3187 2606 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879773.1 protein_id gnl|my_center|LOCUS_01860 3620 3162 gene locus_tag LOCUS_01870 3620 3162 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250457.1 protein_id gnl|my_center|LOCUS_01870 3882 3796 gene locus_tag LOCUS_t00020 3882 3796 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4149 3907 gene locus_tag LOCUS_01880 4149 3907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 4387 4181 gene locus_tag LOCUS_01890 4387 4181 CDS product Trm112 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545155.1 protein_id gnl|my_center|LOCUS_01890 5401 4427 gene locus_tag LOCUS_01900 5401 4427 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869643.1 protein_id gnl|my_center|LOCUS_01900 5719 5444 gene locus_tag LOCUS_01910 5719 5444 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978366.1 protein_id gnl|my_center|LOCUS_01910 6004 5738 gene locus_tag LOCUS_01920 6004 5738 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250466.1 protein_id gnl|my_center|LOCUS_01920 6462 6016 gene locus_tag LOCUS_01930 6462 6016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 7878 6481 gene locus_tag LOCUS_01940 gene secY 7878 6481 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869979.1 protein_id gnl|my_center|LOCUS_01940 8405 7899 gene locus_tag LOCUS_01950 8405 7899 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052270492.1 protein_id gnl|my_center|LOCUS_01950 8852 8421 gene locus_tag LOCUS_01960 gene rpmD 8852 8421 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869977.1 protein_id gnl|my_center|LOCUS_01960 9553 8852 gene locus_tag LOCUS_01970 gene rpsE 9553 8852 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250472.1 protein_id gnl|my_center|LOCUS_01970 10117 9560 gene locus_tag LOCUS_01980 10117 9560 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319359.1 protein_id gnl|my_center|LOCUS_01980 10599 10117 gene locus_tag LOCUS_01990 10599 10117 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875663.1 protein_id gnl|my_center|LOCUS_01990 10781 10599 gene locus_tag LOCUS_02000 10781 10599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 11494 10778 gene locus_tag LOCUS_02010 11494 10778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 12060 11485 gene locus_tag LOCUS_02020 12060 11485 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250476.1 protein_id gnl|my_center|LOCUS_02020 12521 12138 gene locus_tag LOCUS_02030 12521 12138 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064747.1 protein_id gnl|my_center|LOCUS_02030 12763 12533 gene locus_tag LOCUS_02040 12763 12533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02040 13363 12770 gene locus_tag LOCUS_02050 13363 12770 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156013673.1 protein_id gnl|my_center|LOCUS_02050 14085 13363 gene locus_tag LOCUS_02060 14085 13363 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869968.1 protein_id gnl|my_center|LOCUS_02060 14501 14085 gene locus_tag LOCUS_02070 gene rplX 14501 14085 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_02070 14910 14512 gene locus_tag LOCUS_02080 gene rpl14p 14910 14512 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879408.1 protein_id gnl|my_center|LOCUS_02080 15347 14925 gene locus_tag LOCUS_02090 15347 14925 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867454.1 protein_id gnl|my_center|LOCUS_02090 15645 15340 gene locus_tag LOCUS_02100 15645 15340 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869964.1 protein_id gnl|my_center|LOCUS_02100 15956 15651 gene locus_tag LOCUS_02110 gene yciH 15956 15651 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496503.1 protein_id gnl|my_center|LOCUS_02110 16165 15953 gene locus_tag LOCUS_02120 gene rpmC 16165 15953 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869962.1 protein_id gnl|my_center|LOCUS_02120 16941 16168 gene locus_tag LOCUS_02130 16941 16168 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869961.1 protein_id gnl|my_center|LOCUS_02130 17378 16938 gene locus_tag LOCUS_02140 gene rplV 17378 16938 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250488.1 protein_id gnl|my_center|LOCUS_02140 17792 17391 gene locus_tag LOCUS_02150 gene rpsS 17792 17391 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867460.1 protein_id gnl|my_center|LOCUS_02150 18502 17789 gene locus_tag LOCUS_02160 18502 17789 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875647.1 protein_id gnl|my_center|LOCUS_02160 18792 18523 gene locus_tag LOCUS_02170 18792 18523 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 protein_id gnl|my_center|LOCUS_02170 >Feature sequence010 142 939 gene locus_tag LOCUS_02180 142 939 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_070105199.1 protein_id gnl|my_center|LOCUS_02180 933 1181 gene locus_tag LOCUS_02190 933 1181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 1184 1921 gene locus_tag LOCUS_02200 1184 1921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 2019 2921 gene locus_tag LOCUS_02210 2019 2921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02210 2928 3095 gene locus_tag LOCUS_02220 2928 3095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 3206 3559 gene locus_tag LOCUS_02230 3206 3559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3708 3983 gene locus_tag LOCUS_02240 3708 3983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3986 4450 gene locus_tag LOCUS_02250 3986 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 4447 5322 gene locus_tag LOCUS_02260 4447 5322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 5322 7025 gene locus_tag LOCUS_02270 5322 7025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 7030 7305 gene locus_tag LOCUS_02280 7030 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 7317 7640 gene locus_tag LOCUS_02290 7317 7640 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 7597 9336 gene locus_tag LOCUS_02300 7597 9336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 9336 9704 gene locus_tag LOCUS_02310 9336 9704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 9701 12016 gene locus_tag LOCUS_02320 9701 12016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02320 12016 12405 gene locus_tag LOCUS_02330 12016 12405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 12460 12765 gene locus_tag LOCUS_02340 12460 12765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02340 12808 13392 gene locus_tag LOCUS_02350 12808 13392 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 14389 13520 gene locus_tag LOCUS_02360 14389 13520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 14855 14559 gene locus_tag LOCUS_02370 14855 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 15054 15491 gene locus_tag LOCUS_02380 15054 15491 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249364.1 protein_id gnl|my_center|LOCUS_02380 15828 16001 gene locus_tag LOCUS_02390 15828 16001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 16011 16988 gene locus_tag LOCUS_02400 16011 16988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158298048.1 protein_id gnl|my_center|LOCUS_02400 16981 17115 gene locus_tag LOCUS_02410 16981 17115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 17119 17349 gene locus_tag LOCUS_02420 17119 17349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 17339 17536 gene locus_tag LOCUS_02430 17339 17536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 17533 17820 gene locus_tag LOCUS_02440 17533 17820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 17817 18098 gene locus_tag LOCUS_02450 17817 18098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 18116 18289 gene locus_tag LOCUS_02460 18116 18289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 >Feature sequence011 2405 3133 gene locus_tag LOCUS_02470 2405 3133 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_02470 4017 3160 gene locus_tag LOCUS_02480 4017 3160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 5323 4325 gene locus_tag LOCUS_02490 5323 4325 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250419.1 protein_id gnl|my_center|LOCUS_02490 5460 7112 gene locus_tag LOCUS_02500 5460 7112 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878162.1 protein_id gnl|my_center|LOCUS_02500 7264 8022 gene locus_tag LOCUS_02510 7264 8022 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146498.1 protein_id gnl|my_center|LOCUS_02510 8029 9090 gene locus_tag LOCUS_02520 8029 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 9092 10036 gene locus_tag LOCUS_02530 9092 10036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 12072 10732 gene locus_tag LOCUS_02540 12072 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 13171 15615 gene locus_tag LOCUS_02550 13171 15615 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496762.1 protein_id gnl|my_center|LOCUS_02550 15995 16495 gene locus_tag LOCUS_02560 15995 16495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 16492 16947 gene locus_tag LOCUS_02570 16492 16947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 >Feature sequence012 102 1157 gene locus_tag LOCUS_02580 102 1157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867185.1 protein_id gnl|my_center|LOCUS_02580 1154 1804 gene locus_tag LOCUS_02590 1154 1804 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870202.1 protein_id gnl|my_center|LOCUS_02590 1879 2985 gene locus_tag LOCUS_02600 1879 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02600 3021 3464 gene locus_tag LOCUS_02610 3021 3464 CDS product putative metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846924.1 protein_id gnl|my_center|LOCUS_02610 5415 3433 gene locus_tag LOCUS_02620 gene gor 5415 3433 CDS product glyceraldehyde-3-phosphate:ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868698.1 protein_id gnl|my_center|LOCUS_02620 5519 6004 gene locus_tag LOCUS_02630 gene rpiB 5519 6004 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874952.1 protein_id gnl|my_center|LOCUS_02630 5997 6521 gene locus_tag LOCUS_02640 5997 6521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 7176 6559 gene locus_tag LOCUS_02650 gene rpsG 7176 6559 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867744.1 protein_id gnl|my_center|LOCUS_02650 7612 7184 gene locus_tag LOCUS_02660 7612 7184 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867743.1 protein_id gnl|my_center|LOCUS_02660 8098 7673 gene locus_tag LOCUS_02670 8098 7673 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867742.1 protein_id gnl|my_center|LOCUS_02670 8392 8108 gene locus_tag LOCUS_02680 8392 8108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02680 9568 8399 gene locus_tag LOCUS_02690 gene rpoA2 9568 8399 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867740.1 protein_id gnl|my_center|LOCUS_02690 12066 9568 gene locus_tag LOCUS_02700 gene rpoA1 12066 9568 CDS product DNA-directed RNA polymerase subunit A' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876677.1 protein_id gnl|my_center|LOCUS_02700 15385 12092 gene locus_tag LOCUS_02710 15385 12092 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867738.1 protein_id gnl|my_center|LOCUS_02710 15633 15382 gene locus_tag LOCUS_02720 15633 15382 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158296894.1 protein_id gnl|my_center|LOCUS_02720 15678 15827 gene locus_tag LOCUS_02730 15678 15827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 16408 16094 gene locus_tag LOCUS_02740 16408 16094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 16842 16417 gene locus_tag LOCUS_02750 16842 16417 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869702.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence013 347 1639 gene locus_tag LOCUS_02760 347 1639 CDS product lactate utilization protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875779.1 protein_id gnl|my_center|LOCUS_02760 1654 2421 gene locus_tag LOCUS_02770 1654 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_02770 2418 3284 gene locus_tag LOCUS_02780 2418 3284 CDS product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250160.1 protein_id gnl|my_center|LOCUS_02780 3290 4231 gene locus_tag LOCUS_02790 3290 4231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02790 5506 4304 gene locus_tag LOCUS_02800 5506 4304 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249500.1 protein_id gnl|my_center|LOCUS_02800 5819 6253 gene locus_tag LOCUS_02810 5819 6253 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162839581.1 protein_id gnl|my_center|LOCUS_02810 7457 6267 gene locus_tag LOCUS_02820 7457 6267 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061074.1 protein_id gnl|my_center|LOCUS_02820 7783 8334 gene locus_tag LOCUS_02830 7783 8334 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065298.1 protein_id gnl|my_center|LOCUS_02830 8490 9920 gene locus_tag LOCUS_02840 8490 9920 CDS product RtcB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356999.1 protein_id gnl|my_center|LOCUS_02840 9925 11112 gene locus_tag LOCUS_02850 9925 11112 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869956.1 protein_id gnl|my_center|LOCUS_02850 11109 12365 gene locus_tag LOCUS_02860 11109 12365 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065409.1 protein_id gnl|my_center|LOCUS_02860 12368 13063 gene locus_tag LOCUS_02870 12368 13063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 13060 14433 gene locus_tag LOCUS_02880 13060 14433 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867220.1 protein_id gnl|my_center|LOCUS_02880 >Feature sequence014 2618 507 gene locus_tag LOCUS_02890 2618 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 2740 3705 gene locus_tag LOCUS_02900 2740 3705 CDS product replication factor C small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879552.1 protein_id gnl|my_center|LOCUS_02900 4301 3828 gene locus_tag LOCUS_02910 4301 3828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4758 4450 gene locus_tag LOCUS_02920 4758 4450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 4955 6781 gene locus_tag LOCUS_02930 4955 6781 CDS product helicase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868460.1 protein_id gnl|my_center|LOCUS_02930 6951 7385 gene locus_tag LOCUS_02940 6951 7385 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393157.1 protein_id gnl|my_center|LOCUS_02940 7391 7624 gene locus_tag LOCUS_02950 7391 7624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_02950 7640 8044 gene locus_tag LOCUS_02960 7640 8044 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876799.1 protein_id gnl|my_center|LOCUS_02960 8035 9291 gene locus_tag LOCUS_02970 8035 9291 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990823.1 protein_id gnl|my_center|LOCUS_02970 9304 9642 gene locus_tag LOCUS_02980 9304 9642 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082362.1 protein_id gnl|my_center|LOCUS_02980 9683 10537 gene locus_tag LOCUS_02990 9683 10537 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876798.1 protein_id gnl|my_center|LOCUS_02990 10551 11432 gene locus_tag LOCUS_03000 10551 11432 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876797.1 protein_id gnl|my_center|LOCUS_03000 11870 11424 gene locus_tag LOCUS_03010 11870 11424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 12118 12894 gene locus_tag LOCUS_03020 12118 12894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03020 14684 12915 gene locus_tag LOCUS_03030 14684 12915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence015 103 1398 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcccaccatgatctgattctaac 2129 1737 gene locus_tag LOCUS_03040 2129 1737 CDS product ribonuclease P protein component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250718.1 protein_id gnl|my_center|LOCUS_03040 2895 2116 gene locus_tag LOCUS_03050 2895 2116 CDS product ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876327.1 protein_id gnl|my_center|LOCUS_03050 2985 3329 gene locus_tag LOCUS_03060 gene sepF 2985 3329 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878285.1 protein_id gnl|my_center|LOCUS_03060 3584 3916 gene locus_tag LOCUS_03070 3584 3916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 3970 4365 gene locus_tag LOCUS_03080 3970 4365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 4414 4914 gene locus_tag LOCUS_03090 4414 4914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 6863 4932 gene locus_tag LOCUS_03100 6863 4932 CDS product beta-CASP ribonuclease aCPSF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146646.1 protein_id gnl|my_center|LOCUS_03100 7567 6929 gene locus_tag LOCUS_03110 gene psmB 7567 6929 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870749.1 protein_id gnl|my_center|LOCUS_03110 7697 8260 gene locus_tag LOCUS_03120 7697 8260 CDS product HDIG domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202320297.1 protein_id gnl|my_center|LOCUS_03120 9532 8267 gene locus_tag LOCUS_03130 gene eno 9532 8267 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979231.1 protein_id gnl|my_center|LOCUS_03130 10506 9550 gene locus_tag LOCUS_03140 10506 9550 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869583.1 protein_id gnl|my_center|LOCUS_03140 11048 10611 gene locus_tag LOCUS_03150 11048 10611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 12174 11128 gene locus_tag LOCUS_03160 12174 11128 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868714.1 protein_id gnl|my_center|LOCUS_03160 12234 13091 gene locus_tag LOCUS_03170 12234 13091 CDS product eight-cysteine-cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878816.1 protein_id gnl|my_center|LOCUS_03170 14214 13102 gene locus_tag LOCUS_03180 14214 13102 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867201.1 protein_id gnl|my_center|LOCUS_03180 >Feature sequence016 1261 2214 gene locus_tag LOCUS_03190 1261 2214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 3277 2318 gene locus_tag LOCUS_03200 3277 2318 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 3898 3737 gene locus_tag LOCUS_03210 3898 3737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 4518 5222 gene locus_tag LOCUS_03220 gene psmA 4518 5222 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877997.1 protein_id gnl|my_center|LOCUS_03220 5219 5908 gene locus_tag LOCUS_03230 5219 5908 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496552.1 protein_id gnl|my_center|LOCUS_03230 5956 6669 gene locus_tag LOCUS_03240 gene rrp4 5956 6669 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867733.1 protein_id gnl|my_center|LOCUS_03240 6650 7411 gene locus_tag LOCUS_03250 gene rrp41 6650 7411 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867734.1 protein_id gnl|my_center|LOCUS_03250 7398 8207 gene locus_tag LOCUS_03260 gene rrp42 7398 8207 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867735.1 protein_id gnl|my_center|LOCUS_03260 8262 8603 gene locus_tag LOCUS_03270 8262 8603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03270 8770 9015 gene locus_tag LOCUS_03280 8770 9015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 9037 9381 gene locus_tag LOCUS_03290 9037 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03290 9466 10761 gene locus_tag LOCUS_03300 9466 10761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03300 10836 11093 gene locus_tag LOCUS_03310 10836 11093 CDS product UPF0147 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978435.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence017 2471 723 gene locus_tag LOCUS_03320 2471 723 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878662.1 protein_id gnl|my_center|LOCUS_03320 2821 2501 gene locus_tag LOCUS_03330 2821 2501 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024045.1 protein_id gnl|my_center|LOCUS_03330 3885 2818 gene locus_tag LOCUS_03340 3885 2818 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024044.1 protein_id gnl|my_center|LOCUS_03340 4445 3891 gene locus_tag LOCUS_03350 4445 3891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03350 4713 4489 gene locus_tag LOCUS_03360 4713 4489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03360 6587 4725 gene locus_tag LOCUS_03370 6587 4725 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193589509.1 protein_id gnl|my_center|LOCUS_03370 6911 6594 gene locus_tag LOCUS_03380 6911 6594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03380 7045 8031 gene locus_tag LOCUS_03390 7045 8031 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878852.1 protein_id gnl|my_center|LOCUS_03390 11956 8024 gene locus_tag LOCUS_03400 11956 8024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 <13183 12396 gene locus_tag LOCUS_03410 <13183 12396 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869517.1:RNA 3'-terminal phosphate cyclase >Feature sequence018 346 522 gene locus_tag LOCUS_03420 346 522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 576 1490 gene locus_tag LOCUS_03430 576 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03430 1558 1632 gene locus_tag LOCUS_t00030 1558 1632 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 1969 3276 gene locus_tag LOCUS_03440 1969 3276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 4318 3896 gene locus_tag LOCUS_03450 4318 3896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 4771 4538 gene locus_tag LOCUS_03460 4771 4538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 5153 5281 gene locus_tag LOCUS_03470 5153 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03470 5342 5791 gene locus_tag LOCUS_03480 5342 5791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 5903 7429 gene locus_tag LOCUS_03490 5903 7429 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878530.1 protein_id gnl|my_center|LOCUS_03490 7488 8663 gene locus_tag LOCUS_03500 gene nifS 7488 8663 CDS product cysteine desulfurase NifS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583089.1 protein_id gnl|my_center|LOCUS_03500 8689 9090 gene locus_tag LOCUS_03510 8689 9090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 9682 9128 gene locus_tag LOCUS_03520 9682 9128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 9747 10424 gene locus_tag LOCUS_03530 9747 10424 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870955.1 protein_id gnl|my_center|LOCUS_03530 10880 10437 gene locus_tag LOCUS_03540 10880 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 11569 10916 gene locus_tag LOCUS_03550 11569 10916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 12093 11587 gene locus_tag LOCUS_03560 12093 11587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 12669 12151 gene locus_tag LOCUS_03570 12669 12151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03570 >Feature sequence019 <1 1415 gene locus_tag LOCUS_03580 <1 1415 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878155.1:DNA topoisomerase VI subunit B 1412 2512 gene locus_tag LOCUS_03590 1412 2512 CDS product DNA topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867719.1 protein_id gnl|my_center|LOCUS_03590 2528 3355 gene locus_tag LOCUS_03600 2528 3355 CDS product UbiA prenyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250275.1 protein_id gnl|my_center|LOCUS_03600 3322 4218 gene locus_tag LOCUS_03610 3322 4218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4215 5408 gene locus_tag LOCUS_03620 4215 5408 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250274.1 protein_id gnl|my_center|LOCUS_03620 5451 5526 gene locus_tag LOCUS_t00040 5451 5526 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 5655 6338 gene locus_tag LOCUS_03630 5655 6338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03630 6676 6752 gene locus_tag LOCUS_t00050 6676 6752 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 6789 7376 gene locus_tag LOCUS_03640 gene endA 6789 7376 CDS product tRNA-intron lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496827.1 protein_id gnl|my_center|LOCUS_03640 7652 7410 gene locus_tag LOCUS_03650 7652 7410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9483 7930 gene locus_tag LOCUS_03660 9483 7930 CDS product glycine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002684564.1 protein_id gnl|my_center|LOCUS_03660 9588 10307 gene locus_tag LOCUS_03670 9588 10307 CDS product TIGR00266 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249137.1 protein_id gnl|my_center|LOCUS_03670 10372 11469 gene locus_tag LOCUS_03680 10372 11469 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875890.1 protein_id gnl|my_center|LOCUS_03680 >Feature sequence020 485 952 gene locus_tag LOCUS_03690 485 952 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867261.1 protein_id gnl|my_center|LOCUS_03690 1102 1329 gene locus_tag LOCUS_03700 1102 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 3540 1630 gene locus_tag LOCUS_03710 3540 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03710 7274 3516 gene locus_tag LOCUS_03720 gene cobN 7274 3516 CDS product cobaltochelatase subunit CobN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870959.1 protein_id gnl|my_center|LOCUS_03720 8221 7271 gene locus_tag LOCUS_03730 8221 7271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871080.1 protein_id gnl|my_center|LOCUS_03730 8991 8221 gene locus_tag LOCUS_03740 8991 8221 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761990.1 protein_id gnl|my_center|LOCUS_03740 10033 8984 gene locus_tag LOCUS_03750 10033 8984 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761989.1 protein_id gnl|my_center|LOCUS_03750 12146 10035 gene locus_tag LOCUS_03760 12146 10035 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761988.1 protein_id gnl|my_center|LOCUS_03760 >Feature sequence021 211 1362 gene locus_tag LOCUS_03770 211 1362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 1418 3475 gene locus_tag LOCUS_03780 1418 3475 CDS product IGHMBP2 family helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865024.1 protein_id gnl|my_center|LOCUS_03780 4073 3444 gene locus_tag LOCUS_03790 4073 3444 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496635.1 protein_id gnl|my_center|LOCUS_03790 4126 4198 gene locus_tag LOCUS_t00060 4126 4198 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4259 4807 gene locus_tag LOCUS_03800 4259 4807 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147117.1 protein_id gnl|my_center|LOCUS_03800 4794 5288 gene locus_tag LOCUS_03810 4794 5288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 5946 5278 gene locus_tag LOCUS_03820 5946 5278 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289241.1 protein_id gnl|my_center|LOCUS_03820 6078 6992 gene locus_tag LOCUS_03830 6078 6992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 7002 7325 gene locus_tag LOCUS_03840 7002 7325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 8583 7366 gene locus_tag LOCUS_03850 gene truD 8583 7366 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870092.1 protein_id gnl|my_center|LOCUS_03850 9707 8670 gene locus_tag LOCUS_03860 9707 8670 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867947.1 protein_id gnl|my_center|LOCUS_03860 9681 10043 gene locus_tag LOCUS_03870 9681 10043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03870 11148 10045 gene locus_tag LOCUS_03880 11148 10045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 11785 11123 gene locus_tag LOCUS_03890 11785 11123 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868175.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence022 480 1328 gene locus_tag LOCUS_03900 480 1328 CDS product decaprenyl-phosphate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000898866.1 protein_id gnl|my_center|LOCUS_03900 1355 3874 gene locus_tag LOCUS_03910 1355 3874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868311.1 protein_id gnl|my_center|LOCUS_03910 3898 4893 gene locus_tag LOCUS_03920 3898 4893 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980131.1 protein_id gnl|my_center|LOCUS_03920 4916 6451 gene locus_tag LOCUS_03930 4916 6451 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_148882924.1 protein_id gnl|my_center|LOCUS_03930 6879 7112 gene locus_tag LOCUS_03940 6879 7112 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_03940 7140 8294 gene locus_tag LOCUS_03950 gene sat 7140 8294 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_03950 8291 9697 gene locus_tag LOCUS_03960 8291 9697 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868288.1 protein_id gnl|my_center|LOCUS_03960 9679 10203 gene locus_tag LOCUS_03970 gene cysC 9679 10203 CDS product adenylyl-sulfate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868289.1 protein_id gnl|my_center|LOCUS_03970 10837 11892 gene locus_tag LOCUS_03980 10837 11892 CDS product glucose-1-phosphate thymidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868292.1 protein_id gnl|my_center|LOCUS_03980 >Feature sequence023 365 1114 gene locus_tag LOCUS_03990 365 1114 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_03990 1132 3567 gene locus_tag LOCUS_04000 1132 3567 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 4573 3578 gene locus_tag LOCUS_04010 4573 3578 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787927.1 protein_id gnl|my_center|LOCUS_04010 4671 6467 gene locus_tag LOCUS_04020 4671 6467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04020 6475 7161 gene locus_tag LOCUS_04030 6475 7161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04030 10598 7158 gene locus_tag LOCUS_04040 10598 7158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04040 >Feature sequence024 584 123 gene locus_tag LOCUS_04050 584 123 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04050 883 665 gene locus_tag LOCUS_04060 883 665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04060 2106 886 gene locus_tag LOCUS_04070 2106 886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 3426 2389 gene locus_tag LOCUS_04080 3426 2389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 3539 4447 gene locus_tag LOCUS_04090 3539 4447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 5567 4455 gene locus_tag LOCUS_04100 5567 4455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04100 6009 5836 gene locus_tag LOCUS_04110 6009 5836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 6221 7381 gene locus_tag LOCUS_04120 6221 7381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 8758 7391 gene locus_tag LOCUS_04130 8758 7391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04130 9974 8877 gene locus_tag LOCUS_04140 gene fbp 9974 8877 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877293.1 protein_id gnl|my_center|LOCUS_04140 >Feature sequence025 986 651 gene locus_tag LOCUS_04150 gene trxA 986 651 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392444.1 protein_id gnl|my_center|LOCUS_04150 1075 1473 gene locus_tag LOCUS_04160 1075 1473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 1610 2992 gene locus_tag LOCUS_04170 1610 2992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 3363 4268 gene locus_tag LOCUS_04180 3363 4268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 5472 4333 gene locus_tag LOCUS_04190 5472 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 7460 5469 gene locus_tag LOCUS_04200 7460 5469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04200 8070 7513 gene locus_tag LOCUS_04210 8070 7513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 8449 8054 gene locus_tag LOCUS_04220 8449 8054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04220 8909 8457 gene locus_tag LOCUS_04230 8909 8457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04230 8957 9709 gene locus_tag LOCUS_04240 8957 9709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04240 9844 10050 gene locus_tag LOCUS_04250 9844 10050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 >Feature sequence026 206 850 gene locus_tag LOCUS_04260 206 850 CDS product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868435.1 protein_id gnl|my_center|LOCUS_04260 961 1620 gene locus_tag LOCUS_04270 961 1620 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064852.1 protein_id gnl|my_center|LOCUS_04270 2281 1688 gene locus_tag LOCUS_04280 2281 1688 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_04280 2573 2346 gene locus_tag LOCUS_04290 2573 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 3536 2610 gene locus_tag LOCUS_04300 3536 2610 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870135.1 protein_id gnl|my_center|LOCUS_04300 4200 3550 gene locus_tag LOCUS_04310 4200 3550 CDS product DUF47 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240288.1 protein_id gnl|my_center|LOCUS_04310 4363 4440 gene locus_tag LOCUS_t00070 4363 4440 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 4571 6487 gene locus_tag LOCUS_04320 gene gyrB 4571 6487 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080806.1 protein_id gnl|my_center|LOCUS_04320 6517 8940 gene locus_tag LOCUS_04330 gene gyrA 6517 8940 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947899.1 protein_id gnl|my_center|LOCUS_04330 9002 9076 gene locus_tag LOCUS_t00080 9002 9076 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 9468 9556 gene locus_tag LOCUS_t00090 9468 9556 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence027 1664 162 gene locus_tag LOCUS_04340 1664 162 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023176.1 protein_id gnl|my_center|LOCUS_04340 3044 1680 gene locus_tag LOCUS_04350 3044 1680 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_04350 3710 3048 gene locus_tag LOCUS_04360 3710 3048 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061014.1 protein_id gnl|my_center|LOCUS_04360 3794 4714 gene locus_tag LOCUS_04370 3794 4714 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880080.1 protein_id gnl|my_center|LOCUS_04370 4708 5337 gene locus_tag LOCUS_04380 4708 5337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881344.1 protein_id gnl|my_center|LOCUS_04380 7293 5359 gene locus_tag LOCUS_04390 gene feoB 7293 5359 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249908.1 protein_id gnl|my_center|LOCUS_04390 7684 7469 gene locus_tag LOCUS_04400 7684 7469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 8047 8265 gene locus_tag LOCUS_04410 8047 8265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 8897 8271 gene locus_tag LOCUS_04420 8897 8271 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024048.1 protein_id gnl|my_center|LOCUS_04420 <9761 8933 gene locus_tag LOCUS_04430 <9761 8933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064680.1:ATP synthase subunit B >Feature sequence028 3083 996 gene locus_tag LOCUS_04440 3083 996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 4496 3099 gene locus_tag LOCUS_04450 4496 3099 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870892.1 protein_id gnl|my_center|LOCUS_04450 4852 4493 gene locus_tag LOCUS_04460 4852 4493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 5031 5585 gene locus_tag LOCUS_04470 5031 5585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 5570 6043 gene locus_tag LOCUS_04480 5570 6043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 7629 6244 gene locus_tag LOCUS_04490 7629 6244 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226990577.1 protein_id gnl|my_center|LOCUS_04490 9565 8264 gene locus_tag LOCUS_04500 9565 8264 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053195.1 protein_id gnl|my_center|LOCUS_04500 >Feature sequence029 393 575 gene locus_tag LOCUS_04510 393 575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 677 4837 gene locus_tag LOCUS_04520 gene drmA 677 4837 CDS product DISARM system helicase DrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258771.1 protein_id gnl|my_center|LOCUS_04520 4834 6765 gene locus_tag LOCUS_04530 4834 6765 CDS product DUF1998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258770.1 protein_id gnl|my_center|LOCUS_04530 6758 7225 gene locus_tag LOCUS_04540 6758 7225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 7264 8601 gene locus_tag LOCUS_04550 7264 8601 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000760485.1 protein_id gnl|my_center|LOCUS_04550 8571 9248 gene locus_tag LOCUS_04560 8571 9248 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012258772.1 protein_id gnl|my_center|LOCUS_04560 9666 9591 gene locus_tag LOCUS_t00100 9666 9591 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence030 3439 785 gene locus_tag LOCUS_04570 3439 785 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146858.1 protein_id gnl|my_center|LOCUS_04570 3644 4291 gene locus_tag LOCUS_04580 3644 4291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 4636 5160 gene locus_tag LOCUS_04590 4636 5160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04590 5885 7045 gene locus_tag LOCUS_04600 5885 7045 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020842.1 protein_id gnl|my_center|LOCUS_04600 7128 7757 gene locus_tag LOCUS_04610 7128 7757 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064968.1 protein_id gnl|my_center|LOCUS_04610 7997 8968 gene locus_tag LOCUS_04620 gene pyrF 7997 8968 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013389894.1 protein_id gnl|my_center|LOCUS_04620 9212 8931 gene locus_tag LOCUS_04630 9212 8931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04630 >Feature sequence031 1537 926 gene locus_tag LOCUS_04640 1537 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868040.1 protein_id gnl|my_center|LOCUS_04640 2194 1550 gene locus_tag LOCUS_04650 2194 1550 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867423.1 protein_id gnl|my_center|LOCUS_04650 2450 2226 gene locus_tag LOCUS_04660 2450 2226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 2913 2497 gene locus_tag LOCUS_04670 2913 2497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 2966 3187 gene locus_tag LOCUS_04680 2966 3187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 3272 4153 gene locus_tag LOCUS_04690 gene trxB 3272 4153 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846363.1 protein_id gnl|my_center|LOCUS_04690 4161 4895 gene locus_tag LOCUS_04700 4161 4895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 4901 6082 gene locus_tag LOCUS_04710 4901 6082 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948041.1 protein_id gnl|my_center|LOCUS_04710 6379 6086 gene locus_tag LOCUS_04720 6379 6086 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902697.1 protein_id gnl|my_center|LOCUS_04720 6488 6570 gene locus_tag LOCUS_t00110 6488 6570 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 6938 8077 gene locus_tag LOCUS_04730 6938 8077 CDS product FIST C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963163.1 protein_id gnl|my_center|LOCUS_04730 8090 8353 gene locus_tag LOCUS_04740 8090 8353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 <9111 8386 gene locus_tag LOCUS_04750 <9111 8386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249915.1:mRNA surveillance protein pelota >Feature sequence032 108 2402 gene locus_tag LOCUS_04760 108 2402 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061106.1 protein_id gnl|my_center|LOCUS_04760 2488 3522 gene locus_tag LOCUS_04770 2488 3522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 3533 4477 gene locus_tag LOCUS_04780 gene radA 3533 4477 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878493.1 protein_id gnl|my_center|LOCUS_04780 4764 4498 gene locus_tag LOCUS_04790 4764 4498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 5497 4817 gene locus_tag LOCUS_04800 5497 4817 CDS product TIGR00297 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209320022.1 protein_id gnl|my_center|LOCUS_04800 6569 5508 gene locus_tag LOCUS_04810 6569 5508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04810 6672 7247 gene locus_tag LOCUS_04820 gene thpR 6672 7247 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867226.1 protein_id gnl|my_center|LOCUS_04820 <9011 7583 gene locus_tag LOCUS_04830 <9011 7583 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249711.1:tRNA guanosine(15) transglycosylase TgtA >Feature sequence033 77 499 gene locus_tag LOCUS_04840 77 499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 519 1079 gene locus_tag LOCUS_04850 519 1079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 1125 2444 gene locus_tag LOCUS_04860 1125 2444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 2449 2628 gene locus_tag LOCUS_04870 2449 2628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04870 2625 3947 gene locus_tag LOCUS_04880 2625 3947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 3959 4294 gene locus_tag LOCUS_04890 3959 4294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 4333 5403 gene locus_tag LOCUS_04900 4333 5403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 5400 5966 gene locus_tag LOCUS_04910 5400 5966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 6181 6366 gene locus_tag LOCUS_04920 6181 6366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 6372 6599 gene locus_tag LOCUS_04930 6372 6599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04930 6611 6961 gene locus_tag LOCUS_04940 6611 6961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 6967 7128 gene locus_tag LOCUS_04950 6967 7128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 7118 8683 gene locus_tag LOCUS_04960 7118 8683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 8688 8894 gene locus_tag LOCUS_04970 8688 8894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04970 >Feature sequence034 <1 891 gene locus_tag LOCUS_04980 <1 891 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867349.1:glutamine--fructose-6-phosphate transaminase (isomerizing) 981 1163 gene locus_tag LOCUS_04990 981 1163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 1436 1507 gene locus_tag LOCUS_t00120 1436 1507 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2078 1515 gene locus_tag LOCUS_05000 2078 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 3173 2151 gene locus_tag LOCUS_05010 3173 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05010 3669 3124 gene locus_tag LOCUS_05020 3669 3124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05020 4178 3741 gene locus_tag LOCUS_05030 4178 3741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 4291 5607 gene locus_tag LOCUS_05040 4291 5607 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867603.1 protein_id gnl|my_center|LOCUS_05040 5957 5649 gene locus_tag LOCUS_05050 5957 5649 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583748.1 protein_id gnl|my_center|LOCUS_05050 6125 7537 gene locus_tag LOCUS_05060 gene rbcL 6125 7537 CDS product type III ribulose-bisphosphate carboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870747.1 protein_id gnl|my_center|LOCUS_05060 8152 7811 gene locus_tag LOCUS_05070 8152 7811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05070 8523 8341 gene locus_tag LOCUS_05080 8523 8341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence035 429 935 gene locus_tag LOCUS_05090 gene porC 429 935 CDS product pyruvate synthase subunit PorC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869766.1 protein_id gnl|my_center|LOCUS_05090 925 1197 gene locus_tag LOCUS_05100 925 1197 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762971.1 protein_id gnl|my_center|LOCUS_05100 1350 2516 gene locus_tag LOCUS_05110 gene porA 1350 2516 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_05110 2905 7494 gene locus_tag LOCUS_05120 2905 7494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05120 7666 7517 gene locus_tag LOCUS_05130 7666 7517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 7641 8399 gene locus_tag LOCUS_05140 gene spo0J 7641 8399 CDS product stage 0 sporulation protein Spo0J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001051832.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence036 424 182 gene locus_tag LOCUS_05150 424 182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05150 694 458 gene locus_tag LOCUS_05160 694 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05160 785 858 gene locus_tag LOCUS_t00130 785 858 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 911 1060 gene locus_tag LOCUS_05170 911 1060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05170 1152 1595 gene locus_tag LOCUS_05180 1152 1595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 1678 3669 gene locus_tag LOCUS_05190 1678 3669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 3672 4610 gene locus_tag LOCUS_05200 3672 4610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4627 5604 gene locus_tag LOCUS_05210 4627 5604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 5610 6344 gene locus_tag LOCUS_05220 5610 6344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 6332 8107 gene locus_tag LOCUS_05230 6332 8107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05230 8119 8508 gene locus_tag LOCUS_05240 8119 8508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence037 1141 149 gene locus_tag LOCUS_05250 1141 149 CDS product daunorubicin resistance protein DrrA family ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250976.1 protein_id gnl|my_center|LOCUS_05250 1417 1142 gene locus_tag LOCUS_05260 1417 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 2231 1428 gene locus_tag LOCUS_05270 2231 1428 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083333.1 protein_id gnl|my_center|LOCUS_05270 2669 4087 gene locus_tag LOCUS_05280 gene ctpM 2669 4087 CDS product radical SAM/SPASM domain Clo7bot peptide maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948312.1 protein_id gnl|my_center|LOCUS_05280 4104 5606 gene locus_tag LOCUS_05290 4104 5606 CDS product DUF4932 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146715.1 protein_id gnl|my_center|LOCUS_05290 5761 6114 gene locus_tag LOCUS_05300 5761 6114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 6111 6899 gene locus_tag LOCUS_05310 6111 6899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 6910 7845 gene locus_tag LOCUS_05320 6910 7845 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878632.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence038 1003 62 gene locus_tag LOCUS_05330 1003 62 CDS product carbohydrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439483.1 protein_id gnl|my_center|LOCUS_05330 1997 1047 gene locus_tag LOCUS_05340 1997 1047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 3106 2216 gene locus_tag LOCUS_05350 3106 2216 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880971.1 protein_id gnl|my_center|LOCUS_05350 3282 4484 gene locus_tag LOCUS_05360 3282 4484 CDS product DUF763 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546236.1 protein_id gnl|my_center|LOCUS_05360 4549 5481 gene locus_tag LOCUS_05370 gene rfaD 4549 5481 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880173.1 protein_id gnl|my_center|LOCUS_05370 5557 6615 gene locus_tag LOCUS_05380 5557 6615 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870691.1 protein_id gnl|my_center|LOCUS_05380 6747 7805 gene locus_tag LOCUS_05390 6747 7805 CDS product UPF0104 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876885.1 protein_id gnl|my_center|LOCUS_05390 <8335 7802 gene locus_tag LOCUS_05400 <8335 7802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877892.1:type II toxin-antitoxin system toxin endoribonuclease Nob1 >Feature sequence039 598 335 gene locus_tag LOCUS_05410 598 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 3381 751 gene locus_tag LOCUS_05420 3381 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05420 3608 3438 gene locus_tag LOCUS_05430 3608 3438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3897 3655 gene locus_tag LOCUS_05440 3897 3655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 4343 3897 gene locus_tag LOCUS_05450 4343 3897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 4551 4309 gene locus_tag LOCUS_05460 4551 4309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 4985 4548 gene locus_tag LOCUS_05470 4985 4548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05470 5744 5097 gene locus_tag LOCUS_05480 5744 5097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 6114 5776 gene locus_tag LOCUS_05490 6114 5776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 6495 6139 gene locus_tag LOCUS_05500 6495 6139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 7006 6542 gene locus_tag LOCUS_05510 7006 6542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05510 7349 7017 gene locus_tag LOCUS_05520 7349 7017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05520 8172 7363 gene locus_tag LOCUS_05530 8172 7363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 >Feature sequence040 <1 534 gene locus_tag LOCUS_05540 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012966033.1:hydroxymethylglutaryl-CoA reductase, degradative 547 1599 gene locus_tag LOCUS_05550 547 1599 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060900.1 protein_id gnl|my_center|LOCUS_05550 1615 2778 gene locus_tag LOCUS_05560 1615 2778 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023935.1 protein_id gnl|my_center|LOCUS_05560 2799 3200 gene locus_tag LOCUS_05570 2799 3200 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023936.1 protein_id gnl|my_center|LOCUS_05570 3404 3958 gene locus_tag LOCUS_05580 3404 3958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 4588 3926 gene locus_tag LOCUS_05590 4588 3926 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010902573.1 protein_id gnl|my_center|LOCUS_05590 4643 5134 gene locus_tag LOCUS_05600 4643 5134 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065943.1 protein_id gnl|my_center|LOCUS_05600 5697 5404 gene locus_tag LOCUS_05610 5697 5404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05610 5750 6217 gene locus_tag LOCUS_05620 5750 6217 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762427.1 protein_id gnl|my_center|LOCUS_05620 6192 7853 gene locus_tag LOCUS_05630 gene lysS 6192 7853 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048061081.1 protein_id gnl|my_center|LOCUS_05630 >Feature sequence041 1438 476 gene locus_tag LOCUS_05640 1438 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 1850 1431 gene locus_tag LOCUS_05650 gene lysM 1850 1431 CDS product HTH-type transcriptional regulator LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978132.1 protein_id gnl|my_center|LOCUS_05650 2042 2335 gene locus_tag LOCUS_05660 2042 2335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 3664 2369 gene locus_tag LOCUS_05670 3664 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 3822 5069 gene locus_tag LOCUS_05680 3822 5069 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979394.1 protein_id gnl|my_center|LOCUS_05680 5069 5401 gene locus_tag LOCUS_05690 5069 5401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05690 5736 5443 gene locus_tag LOCUS_05700 5736 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 6065 6190 gene locus_tag LOCUS_05710 6065 6190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05710 6295 6498 gene locus_tag LOCUS_05720 6295 6498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 6398 6793 gene locus_tag LOCUS_05730 gene speD 6398 6793 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880113.1 protein_id gnl|my_center|LOCUS_05730 6914 7603 gene locus_tag LOCUS_05740 6914 7603 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 >Feature sequence042 1090 407 gene locus_tag LOCUS_05750 gene pyrH 1090 407 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762285.1 protein_id gnl|my_center|LOCUS_05750 1593 1111 gene locus_tag LOCUS_05760 1593 1111 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937739.1 protein_id gnl|my_center|LOCUS_05760 1913 1569 gene locus_tag LOCUS_05770 1913 1569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 3337 1910 gene locus_tag LOCUS_05780 3337 1910 CDS product monovalent cation/H+ antiporter subunit D family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007328227.1 protein_id gnl|my_center|LOCUS_05780 3654 3334 gene locus_tag LOCUS_05790 3654 3334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 4043 3651 gene locus_tag LOCUS_05800 4043 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05800 4353 4036 gene locus_tag LOCUS_05810 4353 4036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_05810 4585 4346 gene locus_tag LOCUS_05820 4585 4346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 5140 4901 gene locus_tag LOCUS_05830 5140 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05830 5607 5137 gene locus_tag LOCUS_05840 5607 5137 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080108.1 protein_id gnl|my_center|LOCUS_05840 5678 6025 gene locus_tag LOCUS_05850 5678 6025 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05850 6036 6692 gene locus_tag LOCUS_05860 6036 6692 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065619.1 protein_id gnl|my_center|LOCUS_05860 7184 6633 gene locus_tag LOCUS_05870 7184 6633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 <7887 7277 gene locus_tag LOCUS_05880 <7887 7277 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877204.1:S-methyl-5'-thioadenosine phosphorylase >Feature sequence043 3577 3242 gene locus_tag LOCUS_05890 3577 3242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 3732 3574 gene locus_tag LOCUS_05900 3732 3574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 4015 4566 gene locus_tag LOCUS_05910 4015 4566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 4568 6676 gene locus_tag LOCUS_05920 4568 6676 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 6772 7008 gene locus_tag LOCUS_05930 6772 7008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05930 7119 7043 gene locus_tag LOCUS_t00140 7119 7043 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 7209 7502 gene locus_tag LOCUS_05940 7209 7502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 >Feature sequence044 1698 352 gene locus_tag LOCUS_05950 1698 352 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023945.1 protein_id gnl|my_center|LOCUS_05950 3038 1770 gene locus_tag LOCUS_05960 3038 1770 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964371.1 protein_id gnl|my_center|LOCUS_05960 3736 3014 gene locus_tag LOCUS_05970 3736 3014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 5657 3810 gene locus_tag LOCUS_05980 5657 3810 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107693.1 protein_id gnl|my_center|LOCUS_05980 >Feature sequence045 4579 5742 gene locus_tag LOCUS_05990 4579 5742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 6485 5994 gene locus_tag LOCUS_06000 6485 5994 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879918.1 protein_id gnl|my_center|LOCUS_06000 <7480 6672 gene locus_tag LOCUS_06010 <7480 6672 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878259.1:manganese-dependent inorganic pyrophosphatase >Feature sequence046 2576 1641 gene locus_tag LOCUS_06020 2576 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3615 2551 gene locus_tag LOCUS_06030 3615 2551 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4198 6396 gene locus_tag LOCUS_06040 4198 6396 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870561.1 protein_id gnl|my_center|LOCUS_06040 6436 7338 gene locus_tag LOCUS_06050 6436 7338 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867793.1 protein_id gnl|my_center|LOCUS_06050 >Feature sequence047 626 438 gene locus_tag LOCUS_06060 626 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 1604 642 gene locus_tag LOCUS_06070 1604 642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 1889 1653 gene locus_tag LOCUS_06080 1889 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250306.1 protein_id gnl|my_center|LOCUS_06080 3403 1913 gene locus_tag LOCUS_06090 3403 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06090 3863 3480 gene locus_tag LOCUS_06100 3863 3480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 5625 3910 gene locus_tag LOCUS_06110 5625 3910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06110 5907 5644 gene locus_tag LOCUS_06120 5907 5644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06120 6109 5921 gene locus_tag LOCUS_06130 6109 5921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06130 6282 6106 gene locus_tag LOCUS_06140 6282 6106 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 6668 6279 gene locus_tag LOCUS_06150 6668 6279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 7195 6818 gene locus_tag LOCUS_06160 7195 6818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 >Feature sequence048 367 167 gene locus_tag LOCUS_06170 367 167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06170 1197 367 gene locus_tag LOCUS_06180 1197 367 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250523.1 protein_id gnl|my_center|LOCUS_06180 2328 1297 gene locus_tag LOCUS_06190 2328 1297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064248.1 protein_id gnl|my_center|LOCUS_06190 3405 2458 gene locus_tag LOCUS_06200 3405 2458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06200 3625 4398 gene locus_tag LOCUS_06210 3625 4398 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877442.1 protein_id gnl|my_center|LOCUS_06210 4825 4430 gene locus_tag LOCUS_06220 4825 4430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 5226 4822 gene locus_tag LOCUS_06230 5226 4822 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870178.1 protein_id gnl|my_center|LOCUS_06230 5315 5548 gene locus_tag LOCUS_06240 5315 5548 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878376.1 protein_id gnl|my_center|LOCUS_06240 5565 5780 gene locus_tag LOCUS_06250 5565 5780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 5899 5972 gene locus_tag LOCUS_t00150 5899 5972 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6009 6380 gene locus_tag LOCUS_06260 6009 6380 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877226.1 protein_id gnl|my_center|LOCUS_06260 7104 6532 gene locus_tag LOCUS_06270 7104 6532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06270 >Feature sequence049 >Feature sequence050 563 378 gene locus_tag LOCUS_06280 563 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 934 713 gene locus_tag LOCUS_06290 934 713 CDS product DUF2283 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249455.1 protein_id gnl|my_center|LOCUS_06290 1220 1041 gene locus_tag LOCUS_06300 1220 1041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 1828 2052 gene locus_tag LOCUS_06310 1828 2052 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 2339 2049 gene locus_tag LOCUS_06320 2339 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06320 3186 2353 gene locus_tag LOCUS_06330 3186 2353 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867513.1 protein_id gnl|my_center|LOCUS_06330 3854 3504 gene locus_tag LOCUS_06340 3854 3504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 4811 3870 gene locus_tag LOCUS_06350 4811 3870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 6955 4808 gene locus_tag LOCUS_06360 6955 4808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 >Feature sequence051 <1 1178 gene locus_tag LOCUS_06370 <1 1178 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867288.1:NAD(P)/FAD-dependent oxidoreductase 1217 1918 gene locus_tag LOCUS_06380 gene uppS 1217 1918 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867696.1 protein_id gnl|my_center|LOCUS_06380 2474 2040 gene locus_tag LOCUS_06390 2474 2040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2996 2745 gene locus_tag LOCUS_06400 2996 2745 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879278.1 protein_id gnl|my_center|LOCUS_06400 3693 2983 gene locus_tag LOCUS_06410 gene dph5 3693 2983 CDS product diphthine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249061.1 protein_id gnl|my_center|LOCUS_06410 3796 4689 gene locus_tag LOCUS_06420 3796 4689 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878207.1 protein_id gnl|my_center|LOCUS_06420 5336 4746 gene locus_tag LOCUS_06430 5336 4746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 <7228 5597 gene locus_tag LOCUS_06440 <7228 5597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878560.1:ATP-binding protein >Feature sequence052 535 1014 gene locus_tag LOCUS_06450 535 1014 CDS product DUF523 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000635494.1 protein_id gnl|my_center|LOCUS_06450 2442 1006 gene locus_tag LOCUS_06460 gene cysS 2442 1006 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877918.1 protein_id gnl|my_center|LOCUS_06460 2494 3000 gene locus_tag LOCUS_06470 2494 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06470 3373 3834 gene locus_tag LOCUS_06480 3373 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 4387 3908 gene locus_tag LOCUS_06490 4387 3908 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_084078882.1 protein_id gnl|my_center|LOCUS_06490 4499 4424 gene locus_tag LOCUS_t00160 4499 4424 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 6211 4589 gene locus_tag LOCUS_06500 gene metG 6211 4589 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021984.1 protein_id gnl|my_center|LOCUS_06500 <7186 6132 gene locus_tag LOCUS_06510 <7186 6132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001133565.1:flavohemoglobin expression-modulating QEGLA motif protein >Feature sequence053 400 1488 gene locus_tag LOCUS_06520 400 1488 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249523.1 protein_id gnl|my_center|LOCUS_06520 2400 1759 gene locus_tag LOCUS_06530 2400 1759 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 2449 3741 gene locus_tag LOCUS_06540 gene serS 2449 3741 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868451.1 protein_id gnl|my_center|LOCUS_06540 3747 5804 gene locus_tag LOCUS_06550 gene topA 3747 5804 CDS product DNA topoisomerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868544.1 protein_id gnl|my_center|LOCUS_06550 6368 5793 gene locus_tag LOCUS_06560 gene pyrE 6368 5793 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877462.1 protein_id gnl|my_center|LOCUS_06560 <7052 6405 gene locus_tag LOCUS_06570 <7052 6405 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251181.1:DNA repair and recombination protein RadB >Feature sequence054 620 1684 gene locus_tag LOCUS_06580 620 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 2170 2961 gene locus_tag LOCUS_06590 2170 2961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 5264 2985 gene locus_tag LOCUS_06600 gene rad50 5264 2985 CDS product DNA double-strand break repair ATPase Rad50 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251161.1 protein_id gnl|my_center|LOCUS_06600 5729 5406 gene locus_tag LOCUS_06610 5729 5406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 >Feature sequence055 1380 211 gene locus_tag LOCUS_06620 1380 211 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496868.1 protein_id gnl|my_center|LOCUS_06620 2204 1380 gene locus_tag LOCUS_06630 2204 1380 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022096.1 protein_id gnl|my_center|LOCUS_06630 3229 2213 gene locus_tag LOCUS_06640 3229 2213 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867784.1 protein_id gnl|my_center|LOCUS_06640 3840 3226 gene locus_tag LOCUS_06650 3840 3226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 5140 3884 gene locus_tag LOCUS_06660 5140 3884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 6215 5394 gene locus_tag LOCUS_06670 6215 5394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06670 >Feature sequence056 114 977 gene locus_tag LOCUS_06680 114 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06680 974 2020 gene locus_tag LOCUS_06690 974 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 2637 2083 gene locus_tag LOCUS_06700 gene trmY 2637 2083 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064324.1 protein_id gnl|my_center|LOCUS_06700 2823 4322 gene locus_tag LOCUS_06710 gene gatB 2823 4322 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024400.1 protein_id gnl|my_center|LOCUS_06710 4591 5043 gene locus_tag LOCUS_06720 gene nrdR 4591 5043 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004454958.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence057 2 391 gene locus_tag LOCUS_06730 2 391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 1454 423 gene locus_tag LOCUS_06740 gene amrS 1454 423 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249844.1 protein_id gnl|my_center|LOCUS_06740 1559 2884 gene locus_tag LOCUS_06750 1559 2884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06750 2963 4930 gene locus_tag LOCUS_06760 2963 4930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 6240 4948 gene locus_tag LOCUS_06770 6240 4948 CDS product endonuclease Q family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164931016.1 protein_id gnl|my_center|LOCUS_06770 >Feature sequence058 1929 2258 gene locus_tag LOCUS_06780 1929 2258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 2515 2315 gene locus_tag LOCUS_06790 2515 2315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 2648 3223 gene locus_tag LOCUS_06800 gene rpoE 2648 3223 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869896.1 protein_id gnl|my_center|LOCUS_06800 3275 3454 gene locus_tag LOCUS_06810 3275 3454 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868804.1 protein_id gnl|my_center|LOCUS_06810 3482 3784 gene locus_tag LOCUS_06820 3482 3784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06820 4261 5235 gene locus_tag LOCUS_06830 4261 5235 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_06830 >Feature sequence059 1209 247 gene locus_tag LOCUS_06840 1209 247 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2441 1428 gene locus_tag LOCUS_06850 2441 1428 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 2672 3286 gene locus_tag LOCUS_06860 2672 3286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 6128 3303 gene locus_tag LOCUS_06870 6128 3303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06870 >Feature sequence060 <1 2114 gene locus_tag LOCUS_06880 <1 2114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010870991.1:DUF2341 domain-containing protein 4802 2193 gene locus_tag LOCUS_06890 gene mngB 4802 2193 CDS product mannosylglycerate hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989450.1 protein_id gnl|my_center|LOCUS_06890 5819 4863 gene locus_tag LOCUS_06900 5819 4863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 >Feature sequence061 2253 5606 gene locus_tag LOCUS_06910 2253 5606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06910 >Feature sequence062 <1 883 gene locus_tag LOCUS_06920 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010889723.1:flagellar biosynthesis protein FlhA 903 1148 gene locus_tag LOCUS_06930 903 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06930 1108 1117 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1193 1903 gene locus_tag LOCUS_06940 1193 1903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06940 1840 1849 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1988 2851 gene locus_tag LOCUS_06950 1988 2851 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680723.1 protein_id gnl|my_center|LOCUS_06950 2916 3503 gene locus_tag LOCUS_06960 2916 3503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 3480 3489 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3493 4137 gene locus_tag LOCUS_06970 gene whiG 3493 4137 CDS product RNA polymerase sigma factor WhiG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000039671.1 protein_id gnl|my_center|LOCUS_06970 >Feature sequence063 1475 519 gene locus_tag LOCUS_06980 1475 519 CDS product phosphotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_120770150.1 protein_id gnl|my_center|LOCUS_06980 2805 1486 gene locus_tag LOCUS_06990 2805 1486 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719484.1 protein_id gnl|my_center|LOCUS_06990 3341 2802 gene locus_tag LOCUS_07000 3341 2802 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719485.1 protein_id gnl|my_center|LOCUS_07000 4523 3438 gene locus_tag LOCUS_07010 4523 3438 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002719483.1 protein_id gnl|my_center|LOCUS_07010 4769 5164 gene locus_tag LOCUS_07020 4769 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 >Feature sequence064 1028 81 gene locus_tag LOCUS_07030 1028 81 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948979.1 protein_id gnl|my_center|LOCUS_07030 1490 2266 gene locus_tag LOCUS_07040 1490 2266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07040 2677 2279 gene locus_tag LOCUS_07050 2677 2279 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986456.1 protein_id gnl|my_center|LOCUS_07050 3996 2674 gene locus_tag LOCUS_07060 3996 2674 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868848.1 protein_id gnl|my_center|LOCUS_07060 4271 5041 gene locus_tag LOCUS_07070 4271 5041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 >Feature sequence065 1781 615 gene locus_tag LOCUS_07080 gene porA 1781 615 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496445.1 protein_id gnl|my_center|LOCUS_07080 2095 1799 gene locus_tag LOCUS_07090 gene porD 2095 1799 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869765.1 protein_id gnl|my_center|LOCUS_07090 2668 2105 gene locus_tag LOCUS_07100 2668 2105 CDS product pyruvate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020093.1 protein_id gnl|my_center|LOCUS_07100 2892 2815 gene locus_tag LOCUS_t00170 2892 2815 tRNA product tRNA-Ile inference COORDINATES:profile:Aragorn:1.2.38 3576 4847 gene locus_tag LOCUS_07110 3576 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 >Feature sequence066 <1 1208 gene locus_tag LOCUS_07120 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146523.1:DEAD/DEAH box helicase 1277 3058 gene locus_tag LOCUS_07130 1277 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 3895 3065 gene locus_tag LOCUS_07140 3895 3065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 4476 3913 gene locus_tag LOCUS_07150 4476 3913 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250285.1 protein_id gnl|my_center|LOCUS_07150 4973 4473 gene locus_tag LOCUS_07160 4973 4473 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 >Feature sequence067 283 2889 gene locus_tag LOCUS_07170 283 2889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 2889 3128 gene locus_tag LOCUS_07180 2889 3128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 3125 4006 gene locus_tag LOCUS_07190 3125 4006 CDS product ERCC4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879905.1 protein_id gnl|my_center|LOCUS_07190 4453 4007 gene locus_tag LOCUS_07200 4453 4007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence068 1375 374 gene locus_tag LOCUS_07210 1375 374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 2173 1406 gene locus_tag LOCUS_07220 2173 1406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 2269 2343 gene locus_tag LOCUS_t00180 2269 2343 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 2671 2898 gene locus_tag LOCUS_07230 2671 2898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07230 3978 2950 gene locus_tag LOCUS_07240 gene hypE 3978 2950 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878862.1 protein_id gnl|my_center|LOCUS_07240 5318 3984 gene locus_tag LOCUS_07250 5318 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 >Feature sequence069 959 555 gene locus_tag LOCUS_07260 959 555 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064279.1 protein_id gnl|my_center|LOCUS_07260 1896 937 gene locus_tag LOCUS_07270 1896 937 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868818.1 protein_id gnl|my_center|LOCUS_07270 2648 1893 gene locus_tag LOCUS_07280 2648 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07280 2833 3693 gene locus_tag LOCUS_07290 2833 3693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 3801 4121 gene locus_tag LOCUS_07300 3801 4121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4881 4159 gene locus_tag LOCUS_07310 4881 4159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 <5429 4862 gene locus_tag LOCUS_07320 <5429 4862 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_052846717.1:radical SAM protein >Feature sequence070 1883 1275 gene locus_tag LOCUS_07330 1883 1275 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 2567 3850 gene locus_tag LOCUS_07340 gene hisS 2567 3850 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868795.1 protein_id gnl|my_center|LOCUS_07340 3847 4770 gene locus_tag LOCUS_07350 gene rnz 3847 4770 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022970.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence071 3770 1491 gene locus_tag LOCUS_07360 3770 1491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 3879 4295 gene locus_tag LOCUS_07370 3879 4295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07370 4279 5124 gene locus_tag LOCUS_07380 4279 5124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07380 >Feature sequence072 984 583 gene locus_tag LOCUS_07390 984 583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 1103 1567 gene locus_tag LOCUS_07400 1103 1567 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053707.1 protein_id gnl|my_center|LOCUS_07400 1695 3887 gene locus_tag LOCUS_07410 1695 3887 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870669.1 protein_id gnl|my_center|LOCUS_07410 3991 5172 gene locus_tag LOCUS_07420 3991 5172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence073 >Feature sequence074 <1 1070 gene locus_tag LOCUS_07430 <1 1070 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048060852.1:ATPase domain-containing protein 1146 1520 gene locus_tag LOCUS_07440 1146 1520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 2187 1510 gene locus_tag LOCUS_07450 2187 1510 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867382.1 protein_id gnl|my_center|LOCUS_07450 2336 3598 gene locus_tag LOCUS_07460 2336 3598 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021177.1 protein_id gnl|my_center|LOCUS_07460 <4922 3580 gene locus_tag LOCUS_07470 <4922 3580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010869511.1:Glu-tRNA(Gln) amidotransferase subunit GatE >Feature sequence075 1808 936 gene locus_tag LOCUS_07480 1808 936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 2681 1893 gene locus_tag LOCUS_07490 2681 1893 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867154.1 protein_id gnl|my_center|LOCUS_07490 2805 3647 gene locus_tag LOCUS_07500 2805 3647 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868801.1 protein_id gnl|my_center|LOCUS_07500 4402 3677 gene locus_tag LOCUS_07510 4402 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 4758 4432 gene locus_tag LOCUS_07520 4758 4432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249226.1 protein_id gnl|my_center|LOCUS_07520 >Feature sequence076 391 44 gene locus_tag LOCUS_07530 391 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07530 462 1733 gene locus_tag LOCUS_07540 462 1733 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020262.1 protein_id gnl|my_center|LOCUS_07540 2864 1737 gene locus_tag LOCUS_07550 2864 1737 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545596.1 protein_id gnl|my_center|LOCUS_07550 3253 2987 gene locus_tag LOCUS_07560 3253 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 3463 3287 gene locus_tag LOCUS_07570 3463 3287 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 4179 3613 gene locus_tag LOCUS_07580 4179 3613 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_07580 4263 4811 gene locus_tag LOCUS_07590 4263 4811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4901 4828 gene locus_tag LOCUS_t00190 4901 4828 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence077 590 1018 gene locus_tag LOCUS_07600 gene dut 590 1018 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000694145.1 protein_id gnl|my_center|LOCUS_07600 1278 1478 gene locus_tag LOCUS_07610 1278 1478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 1480 1701 gene locus_tag LOCUS_07620 1480 1701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 1714 1905 gene locus_tag LOCUS_07630 1714 1905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 1887 1896 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2724 2212 gene locus_tag LOCUS_07640 2724 2212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 3128 2757 gene locus_tag LOCUS_07650 3128 2757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3677 3141 gene locus_tag LOCUS_07660 3677 3141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 >Feature sequence078 223 17 gene locus_tag LOCUS_07670 223 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 890 276 gene locus_tag LOCUS_07680 890 276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07680 1608 1532 gene locus_tag LOCUS_t00200 1608 1532 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1980 1690 gene locus_tag LOCUS_07690 gene albA 1980 1690 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879448.1 protein_id gnl|my_center|LOCUS_07690 2636 2067 gene locus_tag LOCUS_07700 gene can 2636 2067 CDS product carbonate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000651585.1 protein_id gnl|my_center|LOCUS_07700 2937 3479 gene locus_tag LOCUS_07710 2937 3479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3690 3812 gene locus_tag LOCUS_07720 3690 3812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07720 4667 3858 gene locus_tag LOCUS_07730 4667 3858 CDS product site-specific integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964234.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence079 1106 2389 gene locus_tag LOCUS_07740 1106 2389 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249880.1 protein_id gnl|my_center|LOCUS_07740 2472 2852 gene locus_tag LOCUS_07750 2472 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2893 4095 gene locus_tag LOCUS_07760 2893 4095 CDS product aconitase X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870830.1 protein_id gnl|my_center|LOCUS_07760 4113 4532 gene locus_tag LOCUS_07770 4113 4532 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_07770 >Feature sequence080 1137 271 gene locus_tag LOCUS_07780 1137 271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 1697 1134 gene locus_tag LOCUS_07790 1697 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 2316 1687 gene locus_tag LOCUS_07800 2316 1687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07800 4337 2313 gene locus_tag LOCUS_07810 4337 2313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07810 >Feature sequence081 1649 294 gene locus_tag LOCUS_07820 gene nhaA 1649 294 CDS product Na+/H+ antiporter NhaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011119453.1 protein_id gnl|my_center|LOCUS_07820 1762 2664 gene locus_tag LOCUS_07830 gene nhaR 1762 2664 CDS product transcriptional activator NhaR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104144.1 protein_id gnl|my_center|LOCUS_07830 2854 2994 gene locus_tag LOCUS_07840 2854 2994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07840 >Feature sequence082 1202 2680 gene locus_tag LOCUS_07850 gene proS 1202 2680 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868093.1 protein_id gnl|my_center|LOCUS_07850 2704 3282 gene locus_tag LOCUS_07860 2704 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07860 3465 4310 gene locus_tag LOCUS_07870 gene htpX 3465 4310 CDS product zinc metalloprotease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193360263.1 protein_id gnl|my_center|LOCUS_07870 >Feature sequence083 444 833 gene locus_tag LOCUS_07880 444 833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07880 826 1008 gene locus_tag LOCUS_07890 826 1008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 1080 1274 gene locus_tag LOCUS_07900 1080 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 1360 1707 gene locus_tag LOCUS_07910 1360 1707 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 4182 1735 gene locus_tag LOCUS_07920 gene ppsA 4182 1735 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056610.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence084 <1 546 gene locus_tag LOCUS_07930 <1 546 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868855.1:triose-phosphate isomerase 753 1166 gene locus_tag LOCUS_07940 753 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07940 2058 1144 gene locus_tag LOCUS_07950 2058 1144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 2501 2055 gene locus_tag LOCUS_07960 2501 2055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 4200 2650 gene locus_tag LOCUS_07970 4200 2650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence085 >Feature sequence086 3142 3609 gene locus_tag LOCUS_07980 3142 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence087 508 164 gene locus_tag LOCUS_07990 508 164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 1281 508 gene locus_tag LOCUS_08000 1281 508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08000 1946 1278 gene locus_tag LOCUS_08010 1946 1278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 2224 1943 gene locus_tag LOCUS_08020 2224 1943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 2403 2221 gene locus_tag LOCUS_08030 2403 2221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 2864 2400 gene locus_tag LOCUS_08040 2864 2400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 3400 2936 gene locus_tag LOCUS_08050 3400 2936 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 3789 3460 gene locus_tag LOCUS_08060 3789 3460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08060 4055 3780 gene locus_tag LOCUS_08070 4055 3780 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 4245 4048 gene locus_tag LOCUS_08080 4245 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 >Feature sequence088 2983 1934 gene locus_tag LOCUS_08090 2983 1934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 3573 2986 gene locus_tag LOCUS_08100 3573 2986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 4178 3774 gene locus_tag LOCUS_08110 4178 3774 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 >Feature sequence089 1021 326 gene locus_tag LOCUS_08120 1021 326 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066013.1 protein_id gnl|my_center|LOCUS_08120 1187 1408 gene locus_tag LOCUS_08130 1187 1408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence090 <1 1019 gene locus_tag LOCUS_08140 <1 1019 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868838.1:DNA polymerase 2862 1006 gene locus_tag LOCUS_08150 2862 1006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08150 2897 3892 gene locus_tag LOCUS_08160 gene map 2897 3892 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868538.1 protein_id gnl|my_center|LOCUS_08160 >Feature sequence091 1500 892 gene locus_tag LOCUS_08170 gene tmk 1500 892 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_08170 2276 1650 gene locus_tag LOCUS_08180 2276 1650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 3448 2291 gene locus_tag LOCUS_08190 gene pan 3448 2291 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879468.1 protein_id gnl|my_center|LOCUS_08190 <4215 3539 gene locus_tag LOCUS_08200 <4215 3539 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000904312.1:TatD family hydrolase >Feature sequence092 469 1815 gene locus_tag LOCUS_08210 gene mgtE 469 1815 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228410.1 protein_id gnl|my_center|LOCUS_08210 3139 1817 gene locus_tag LOCUS_08220 3139 1817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08220 >Feature sequence093 623 504 gene locus_tag LOCUS_08230 623 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 1366 620 gene locus_tag LOCUS_08240 gene cas6 1366 620 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496476.1 protein_id gnl|my_center|LOCUS_08240 4070 1515 gene locus_tag LOCUS_08250 4070 1515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence094 2909 528 gene locus_tag LOCUS_08260 2909 528 CDS product tRNA(Met) cytidine acetyltransferase TmcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868389.1 protein_id gnl|my_center|LOCUS_08260 2949 3305 gene locus_tag LOCUS_08270 2949 3305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08270 >Feature sequence095 1303 1022 gene locus_tag LOCUS_08280 1303 1022 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 2209 1526 gene locus_tag LOCUS_08290 2209 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 3879 2308 gene locus_tag LOCUS_08300 3879 2308 CDS product tRNA uridine(34) 5-carboxymethylaminomethyl modification radical SAM/GNAT enzyme Elp3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496733.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence096 637 1482 gene locus_tag LOCUS_08310 637 1482 CDS product M55 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146582.1 protein_id gnl|my_center|LOCUS_08310 1488 2501 gene locus_tag LOCUS_08320 1488 2501 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868074.1 protein_id gnl|my_center|LOCUS_08320 2507 3940 gene locus_tag LOCUS_08330 2507 3940 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948160.1 protein_id gnl|my_center|LOCUS_08330 >Feature sequence097 804 403 gene locus_tag LOCUS_08340 804 403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08340 1019 723 gene locus_tag LOCUS_08350 1019 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08350 1197 1057 gene locus_tag LOCUS_08360 1197 1057 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08360 1371 1225 gene locus_tag LOCUS_08370 1371 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_08370 1819 2091 gene locus_tag LOCUS_08380 1819 2091 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2227 3819 gene locus_tag LOCUS_08390 2227 3819 CDS product CpaF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083750460.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence098 1091 2014 gene locus_tag LOCUS_08400 1091 2014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08400 2667 2104 gene locus_tag LOCUS_08410 2667 2104 CDS product recombinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074405.1 protein_id gnl|my_center|LOCUS_08410 3105 2815 gene locus_tag LOCUS_08420 3105 2815 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550171.1 protein_id gnl|my_center|LOCUS_08420 3367 3098 gene locus_tag LOCUS_08430 gene yacA 3367 3098 CDS product type II toxin-antitoxin system antitoxin YacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000079957.1 protein_id gnl|my_center|LOCUS_08430 3488 3772 gene locus_tag LOCUS_08440 3488 3772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 >Feature sequence099 507 289 gene locus_tag LOCUS_08450 507 289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 730 497 gene locus_tag LOCUS_08460 730 497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 1187 966 gene locus_tag LOCUS_08470 1187 966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 1435 1184 gene locus_tag LOCUS_08480 1435 1184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 1588 2856 gene locus_tag LOCUS_08490 1588 2856 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846674.1 protein_id gnl|my_center|LOCUS_08490 3611 2853 gene locus_tag LOCUS_08500 3611 2853 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249206.1 protein_id gnl|my_center|LOCUS_08500 >Feature sequence100 1897 86 gene locus_tag LOCUS_08510 1897 86 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2872 1898 gene locus_tag LOCUS_08520 2872 1898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 3353 2934 gene locus_tag LOCUS_08530 3353 2934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08530 >Feature sequence101 178 678 gene locus_tag LOCUS_08540 178 678 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 1718 690 gene locus_tag LOCUS_08550 1718 690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 1833 2591 gene locus_tag LOCUS_08560 1833 2591 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250740.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence102 <1 561 gene locus_tag LOCUS_08570 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877391.1:dTDP-glucose 4,6-dehydratase 551 1108 gene locus_tag LOCUS_08580 gene rfbC 551 1108 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868297.1 protein_id gnl|my_center|LOCUS_08580 1108 1980 gene locus_tag LOCUS_08590 gene rfbD 1108 1980 CDS product dTDP-4-dehydrorhamnose reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868299.1 protein_id gnl|my_center|LOCUS_08590 2295 2020 gene locus_tag LOCUS_08600 2295 2020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3196 2450 gene locus_tag LOCUS_08610 3196 2450 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001078432.1 protein_id gnl|my_center|LOCUS_08610 <3802 3210 gene locus_tag LOCUS_08620 <3802 3210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_068665507.1:sulfatase-like hydrolase/transferase >Feature sequence103 204 608 gene locus_tag LOCUS_08630 204 608 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583024.1 protein_id gnl|my_center|LOCUS_08630 1225 566 gene locus_tag LOCUS_08640 1225 566 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868828.1 protein_id gnl|my_center|LOCUS_08640 2168 1269 gene locus_tag LOCUS_08650 2168 1269 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868238.1 protein_id gnl|my_center|LOCUS_08650 2235 2660 gene locus_tag LOCUS_08660 2235 2660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 2664 3590 gene locus_tag LOCUS_08670 2664 3590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08670 >Feature sequence104 928 3462 gene locus_tag LOCUS_08680 928 3462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 >Feature sequence105 1145 402 gene locus_tag LOCUS_08690 1145 402 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250957.1 protein_id gnl|my_center|LOCUS_08690 1555 1142 gene locus_tag LOCUS_08700 gene hypA 1555 1142 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867705.1 protein_id gnl|my_center|LOCUS_08700 2251 2060 gene locus_tag LOCUS_08710 2251 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 >Feature sequence106 760 1167 gene locus_tag LOCUS_08720 760 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08720 1178 1507 gene locus_tag LOCUS_08730 1178 1507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1682 2227 gene locus_tag LOCUS_08740 1682 2227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08740 2313 2753 gene locus_tag LOCUS_08750 2313 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08750 3055 3369 gene locus_tag LOCUS_08760 3055 3369 CDS product EVE domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879842.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08760 >Feature sequence107 202 2 gene locus_tag LOCUS_08770 202 2 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 370 215 gene locus_tag LOCUS_08780 370 215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 876 370 gene locus_tag LOCUS_08790 876 370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 1077 877 gene locus_tag LOCUS_08800 1077 877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 1265 1077 gene locus_tag LOCUS_08810 1265 1077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 1444 1659 gene locus_tag LOCUS_08820 1444 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 <3544 1668 gene locus_tag LOCUS_08830 <3544 1668 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878137.1:isoleucine--tRNA ligase >Feature sequence108 640 870 gene locus_tag LOCUS_08840 640 870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 2252 936 gene locus_tag LOCUS_08850 2252 936 CDS product RNase J family beta-CASP ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146740.1 protein_id gnl|my_center|LOCUS_08850 3159 2314 gene locus_tag LOCUS_08860 3159 2314 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011020650.1 protein_id gnl|my_center|LOCUS_08860 3340 3170 gene locus_tag LOCUS_08870 3340 3170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 >Feature sequence109 499 1935 gene locus_tag LOCUS_08880 gene cca 499 1935 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870623.1 protein_id gnl|my_center|LOCUS_08880 3057 1930 gene locus_tag LOCUS_08890 3057 1930 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053677.1 protein_id gnl|my_center|LOCUS_08890 3140 3216 gene locus_tag LOCUS_t00210 3140 3216 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 3439 3221 gene locus_tag LOCUS_08900 3439 3221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08900 >Feature sequence110 124 540 gene locus_tag LOCUS_08910 124 540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1249 875 gene locus_tag LOCUS_08920 1249 875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08920 1305 1673 gene locus_tag LOCUS_08930 1305 1673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 1666 1800 gene locus_tag LOCUS_08940 1666 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1797 2102 gene locus_tag LOCUS_08950 1797 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 2642 2121 gene locus_tag LOCUS_08960 2642 2121 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08960 >Feature sequence111 534 199 gene locus_tag LOCUS_08970 534 199 CDS product nucleoside triphosphate pyrophosphohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125076.1 protein_id gnl|my_center|LOCUS_08970 2662 1178 gene locus_tag LOCUS_08980 2662 1178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 <3363 2685 gene locus_tag LOCUS_08990 <3363 2685 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965586.1:acyl-protein synthetase >Feature sequence112 794 282 gene locus_tag LOCUS_09000 794 282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 847 1941 gene locus_tag LOCUS_09010 847 1941 CDS product geranylgeranyl reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871044.1 protein_id gnl|my_center|LOCUS_09010 <3347 2124 gene locus_tag LOCUS_09020 <3347 2124 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941811.1:hopanoid biosynthesis associated radical SAM protein HpnJ >Feature sequence113 <1 1737 gene locus_tag LOCUS_09030 <1 1737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496860.1:PINc/VapC family ATPase 2298 1738 gene locus_tag LOCUS_09040 2298 1738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 2456 2689 gene locus_tag LOCUS_09050 2456 2689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09050 >Feature sequence114 <1 1652 gene locus_tag LOCUS_09060 <1 1652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011726962.1:RND family transporter 1732 2115 gene locus_tag LOCUS_09070 gene rpl7ae 1732 2115 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979469.1 protein_id gnl|my_center|LOCUS_09070 2139 2333 gene locus_tag LOCUS_09080 2139 2333 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875895.1 protein_id gnl|my_center|LOCUS_09080 2425 2646 gene locus_tag LOCUS_09090 2425 2646 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250260.1 protein_id gnl|my_center|LOCUS_09090 2679 3134 gene locus_tag LOCUS_09100 gene ndk 2679 3134 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878270.1 protein_id gnl|my_center|LOCUS_09100 >Feature sequence115 447 749 gene locus_tag LOCUS_09110 447 749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 877 953 gene locus_tag LOCUS_t00220 877 953 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1592 957 gene locus_tag LOCUS_09120 1592 957 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877878.1 protein_id gnl|my_center|LOCUS_09120 2020 1589 gene locus_tag LOCUS_09130 2020 1589 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879219.1 protein_id gnl|my_center|LOCUS_09130 2106 2690 gene locus_tag LOCUS_09140 2106 2690 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060893.1 protein_id gnl|my_center|LOCUS_09140 2814 2741 gene locus_tag LOCUS_t00230 2814 2741 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 3102 2866 gene locus_tag LOCUS_09150 3102 2866 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980138.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence116 1808 627 gene locus_tag LOCUS_09160 1808 627 CDS product DUF1512 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979465.1 protein_id gnl|my_center|LOCUS_09160 2110 2841 gene locus_tag LOCUS_09170 2110 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09170 >Feature sequence117 45 1307 gene locus_tag LOCUS_09180 45 1307 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867591.1 protein_id gnl|my_center|LOCUS_09180 1618 1424 gene locus_tag LOCUS_09190 1618 1424 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080635.1 protein_id gnl|my_center|LOCUS_09190 1889 1632 gene locus_tag LOCUS_09200 1889 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 2806 1916 gene locus_tag LOCUS_09210 2806 1916 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 >Feature sequence118 1855 2976 gene locus_tag LOCUS_09220 1855 2976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 >Feature sequence119 488 21 gene locus_tag LOCUS_09230 488 21 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 1430 495 gene locus_tag LOCUS_09240 1430 495 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_09240 2029 1427 gene locus_tag LOCUS_09250 2029 1427 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868780.1 protein_id gnl|my_center|LOCUS_09250 2667 2080 gene locus_tag LOCUS_09260 2667 2080 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877880.1 protein_id gnl|my_center|LOCUS_09260 2812 3117 gene locus_tag LOCUS_09270 2812 3117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 >Feature sequence120 1006 419 gene locus_tag LOCUS_09280 1006 419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 1205 1026 gene locus_tag LOCUS_09290 1205 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09290 1663 2613 gene locus_tag LOCUS_09300 gene rpl3p 1663 2613 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879418.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence121 32 865 gene locus_tag LOCUS_09310 32 865 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875687.1 protein_id gnl|my_center|LOCUS_09310 884 1426 gene locus_tag LOCUS_09320 884 1426 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868694.1 protein_id gnl|my_center|LOCUS_09320 2262 1471 gene locus_tag LOCUS_09330 2262 1471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2937 2359 gene locus_tag LOCUS_09340 2937 2359 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546732.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence122 1386 685 gene locus_tag LOCUS_09350 1386 685 CDS product YjjG family noncanonical pyrimidine nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108200.1 protein_id gnl|my_center|LOCUS_09350 2647 1373 gene locus_tag LOCUS_09360 gene spn 2647 1373 CDS product bifunctional sugar-1-phosphate nucleotidylyltransferase/acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978425.1 protein_id gnl|my_center|LOCUS_09360 3118 2705 gene locus_tag LOCUS_09370 3118 2705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09370 >Feature sequence123 734 81 gene locus_tag LOCUS_09380 734 81 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09380 1417 737 gene locus_tag LOCUS_09390 1417 737 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 2333 1428 gene locus_tag LOCUS_09400 gene cas7i 2333 1428 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_09400 >Feature sequence124 378 950 gene locus_tag LOCUS_09410 378 950 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 1007 2152 gene locus_tag LOCUS_09420 gene pseC 1007 2152 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870579.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence125 44 610 gene locus_tag LOCUS_09430 44 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 631 921 gene locus_tag LOCUS_09440 631 921 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09440 929 1606 gene locus_tag LOCUS_09450 929 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 1654 2523 gene locus_tag LOCUS_09460 1654 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 2528 3049 gene locus_tag LOCUS_09470 2528 3049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 >Feature sequence126 <1 1260 gene locus_tag LOCUS_09480 <1 1260 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679812.1:ATP-dependent Clp protease ATP-binding subunit 1263 2192 gene locus_tag LOCUS_09490 1263 2192 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002679668.1 protein_id gnl|my_center|LOCUS_09490 2195 2875 gene locus_tag LOCUS_09500 2195 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 >Feature sequence127 234 983 gene locus_tag LOCUS_09510 234 983 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080614.1 protein_id gnl|my_center|LOCUS_09510 1045 1695 gene locus_tag LOCUS_09520 1045 1695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 2798 1710 gene locus_tag LOCUS_09530 2798 1710 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870059.1 protein_id gnl|my_center|LOCUS_09530 >Feature sequence128 589 873 gene locus_tag LOCUS_09540 589 873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 900 1547 gene locus_tag LOCUS_09550 900 1547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09550 1986 1582 gene locus_tag LOCUS_09560 1986 1582 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878018.1 protein_id gnl|my_center|LOCUS_09560 2438 2821 gene locus_tag LOCUS_09570 2438 2821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence129 >Feature sequence130 746 225 gene locus_tag LOCUS_09580 746 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 1325 810 gene locus_tag LOCUS_09590 1325 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09590 2799 1807 gene locus_tag LOCUS_09600 2799 1807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 >Feature sequence131 649 452 gene locus_tag LOCUS_09610 649 452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09610 1014 646 gene locus_tag LOCUS_09620 1014 646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 1219 1055 gene locus_tag LOCUS_09630 1219 1055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 1379 1660 gene locus_tag LOCUS_09640 1379 1660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09640 1793 2221 gene locus_tag LOCUS_09650 1793 2221 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879168.1 protein_id gnl|my_center|LOCUS_09650 2218 2925 gene locus_tag LOCUS_09660 2218 2925 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877630.1 protein_id gnl|my_center|LOCUS_09660 >Feature sequence132 1525 689 gene locus_tag LOCUS_09670 1525 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 1599 1608 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1856 2374 gene locus_tag LOCUS_09680 1856 2374 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249699.1 protein_id gnl|my_center|LOCUS_09680 >Feature sequence133 353 547 gene locus_tag LOCUS_09690 353 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09690 609 977 gene locus_tag LOCUS_09700 609 977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_09700 1075 2343 gene locus_tag LOCUS_09710 1075 2343 CDS product DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546645.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence134 181 1005 gene locus_tag LOCUS_09720 181 1005 CDS product metal ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392447.1 protein_id gnl|my_center|LOCUS_09720 1002 1781 gene locus_tag LOCUS_09730 1002 1781 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002377973.1 protein_id gnl|my_center|LOCUS_09730 1782 2567 gene locus_tag LOCUS_09740 1782 2567 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392445.1 protein_id gnl|my_center|LOCUS_09740 >Feature sequence135 967 200 gene locus_tag LOCUS_09750 967 200 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879869.1 protein_id gnl|my_center|LOCUS_09750 1165 1800 gene locus_tag LOCUS_09760 1165 1800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 2093 1797 gene locus_tag LOCUS_09770 2093 1797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 >Feature sequence136 989 258 gene locus_tag LOCUS_09780 gene istB 989 258 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967560.1 protein_id gnl|my_center|LOCUS_09780 2575 1034 gene locus_tag LOCUS_09790 gene istA 2575 1034 CDS product IS21-like element ISPsy14 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004666649.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence137 1208 1387 gene locus_tag LOCUS_09800 1208 1387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 1377 2483 gene locus_tag LOCUS_09810 gene hypD 1377 2483 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048086080.1 protein_id gnl|my_center|LOCUS_09810 2572 2730 gene locus_tag LOCUS_09820 2572 2730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 >Feature sequence138 930 358 gene locus_tag LOCUS_09830 930 358 CDS product DUF116 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877715.1 protein_id gnl|my_center|LOCUS_09830 1471 983 gene locus_tag LOCUS_09840 1471 983 CDS product small multi-drug export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064945.1 protein_id gnl|my_center|LOCUS_09840 1995 1498 gene locus_tag LOCUS_09850 1995 1498 CDS product 8-oxo-dGTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980098.1 protein_id gnl|my_center|LOCUS_09850 2763 2116 gene locus_tag LOCUS_09860 gene rpsB 2763 2116 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870496.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence139 <1 1293 gene locus_tag LOCUS_09870 <1 1293 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868790.1:alanine--tRNA ligase 1375 1932 gene locus_tag LOCUS_09880 1375 1932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 >Feature sequence140 272 574 gene locus_tag LOCUS_09890 272 574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09890 1409 1113 gene locus_tag LOCUS_09900 1409 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1540 2043 gene locus_tag LOCUS_09910 1540 2043 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868454.1 protein_id gnl|my_center|LOCUS_09910 >Feature sequence141 118 387 gene locus_tag LOCUS_09920 118 387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09920 369 378 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 426 1073 gene locus_tag LOCUS_09930 426 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1088 2509 gene locus_tag LOCUS_09940 1088 2509 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 >Feature sequence142 <1 1434 gene locus_tag LOCUS_09950 <1 1434 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002674349.1:nucleoside kinase 2499 1435 gene locus_tag LOCUS_09960 2499 1435 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870115.1 protein_id gnl|my_center|LOCUS_09960 >Feature sequence143 3 1286 gene locus_tag LOCUS_09970 3 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 1871 2230 gene locus_tag LOCUS_09980 1871 2230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 >Feature sequence144 >Feature sequence145 487 1890 gene locus_tag LOCUS_09990 487 1890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 >Feature sequence146 1088 150 gene locus_tag LOCUS_10000 1088 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 1756 1115 gene locus_tag LOCUS_10010 1756 1115 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 2261 1782 gene locus_tag LOCUS_10020 2261 1782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10020 >Feature sequence147 572 354 gene locus_tag LOCUS_10030 572 354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146754.1 protein_id gnl|my_center|LOCUS_10030 2148 616 gene locus_tag LOCUS_10040 gene bgaS 2148 616 CDS product beta-galactosidase BgaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868057.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence148 292 65 gene locus_tag LOCUS_10050 292 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 703 317 gene locus_tag LOCUS_10060 703 317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10060 1791 1117 gene locus_tag LOCUS_10070 1791 1117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 >Feature sequence149 1256 684 gene locus_tag LOCUS_10080 1256 684 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_10080 >Feature sequence150 >Feature sequence151 83 973 gene locus_tag LOCUS_10090 83 973 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 1050 1379 gene locus_tag LOCUS_10100 1050 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 1764 2234 gene locus_tag LOCUS_10110 1764 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10110 >Feature sequence152 560 252 gene locus_tag LOCUS_10120 560 252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10120 810 1124 gene locus_tag LOCUS_10130 810 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10130 1109 1324 gene locus_tag LOCUS_10140 1109 1324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 1676 1371 gene locus_tag LOCUS_10150 1676 1371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2056 2196 gene locus_tag LOCUS_10160 2056 2196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence153 98 220 gene locus_tag LOCUS_10170 98 220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 367 993 gene locus_tag LOCUS_10180 367 993 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878677.1 protein_id gnl|my_center|LOCUS_10180 1021 1383 gene locus_tag LOCUS_10190 1021 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 1389 1778 gene locus_tag LOCUS_10200 1389 1778 CDS product Zn-ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048066022.1 protein_id gnl|my_center|LOCUS_10200 2560 1793 gene locus_tag LOCUS_10210 2560 1793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 >Feature sequence154 1812 961 gene locus_tag LOCUS_10220 1812 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10220 <2551 1813 gene locus_tag LOCUS_10230 <2551 1813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582996.1:type I-B CRISPR-associated protein Cas7/Csh2 >Feature sequence155 1864 149 gene locus_tag LOCUS_10240 1864 149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10240 2379 1864 gene locus_tag LOCUS_10250 2379 1864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10250 >Feature sequence156 1188 178 gene locus_tag LOCUS_10260 1188 178 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496932.1 protein_id gnl|my_center|LOCUS_10260 1865 1206 gene locus_tag LOCUS_10270 1865 1206 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496558.1 protein_id gnl|my_center|LOCUS_10270 2242 1883 gene locus_tag LOCUS_10280 2242 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 >Feature sequence157 386 1297 gene locus_tag LOCUS_10290 386 1297 CDS product pseudouridine-5'-phosphate glycosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948816.1 protein_id gnl|my_center|LOCUS_10290 1870 1334 gene locus_tag LOCUS_10300 1870 1334 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878317.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence158 1008 1367 gene locus_tag LOCUS_10310 1008 1367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 >Feature sequence159 <1 1473 gene locus_tag LOCUS_10320 <1 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878634.1:NEW3 domain-containing protein 1470 2213 gene locus_tag LOCUS_10330 1470 2213 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064337.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence160 >Feature sequence161 >Feature sequence162 >Feature sequence163 1663 242 gene locus_tag LOCUS_10340 1663 242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2192 1665 gene locus_tag LOCUS_10350 2192 1665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10350 1671 1680 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2082 2363 gene locus_tag LOCUS_10360 2082 2363 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence164 325 1653 gene locus_tag LOCUS_10370 325 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence165 1040 1639 gene locus_tag LOCUS_10380 1040 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10380 1666 2097 gene locus_tag LOCUS_10390 1666 2097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 >Feature sequence166 <1 737 gene locus_tag LOCUS_10400 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003972242.1:iron-containing alcohol dehydrogenase family protein >Feature sequence167 1 615 gene locus_tag LOCUS_10410 gene dapB 1 615 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_10410 682 2049 gene locus_tag LOCUS_10420 gene purF 682 2049 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence168 99 284 gene locus_tag LOCUS_10430 99 284 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 protein_id gnl|my_center|LOCUS_10430 373 951 gene locus_tag LOCUS_10440 373 951 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879280.1 protein_id gnl|my_center|LOCUS_10440 996 2120 gene locus_tag LOCUS_10450 996 2120 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496792.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence169 >Feature sequence170 <2260 128 gene locus_tag LOCUS_10460 <2260 128 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010878524.1:reverse gyrase >Feature sequence171 277 498 gene locus_tag LOCUS_10470 277 498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 1046 2026 gene locus_tag LOCUS_10480 1046 2026 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence172 <2243 1597 gene locus_tag LOCUS_10490 <2243 1597 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456304.1:type II secretion system F family protein >Feature sequence173 764 135 gene locus_tag LOCUS_10500 764 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 1513 761 gene locus_tag LOCUS_10510 1513 761 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10510 1884 1732 gene locus_tag LOCUS_10520 1884 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2169 1960 gene locus_tag LOCUS_10530 2169 1960 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence174 84 1982 gene locus_tag LOCUS_10540 84 1982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10540 >Feature sequence175 >Feature sequence176 632 1000 gene locus_tag LOCUS_10550 632 1000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 1003 1317 gene locus_tag LOCUS_10560 1003 1317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 1289 1690 gene locus_tag LOCUS_10570 1289 1690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 1723 2037 gene locus_tag LOCUS_10580 1723 2037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 >Feature sequence177 529 1068 gene locus_tag LOCUS_10590 529 1068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 1519 1528 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence178 2046 154 gene locus_tag LOCUS_10600 2046 154 CDS product sodium:solute symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012804055.1 protein_id gnl|my_center|LOCUS_10600 1077 1086 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence179 <1 607 gene locus_tag LOCUS_10610 <1 607 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868711.1:molybdopterin-binding protein 585 1061 gene locus_tag LOCUS_10620 585 1061 CDS product NUDIX hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980328.1 protein_id gnl|my_center|LOCUS_10620 967 976 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence180 524 1441 gene locus_tag LOCUS_10630 524 1441 CDS product AEC family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001829745.1 protein_id gnl|my_center|LOCUS_10630 <2155 1526 gene locus_tag LOCUS_10640 <2155 1526 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012869215.1:3-methyl-2-oxobutanoate hydroxymethyltransferase >Feature sequence181 <1 659 gene locus_tag LOCUS_10650 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048061020.1:translation initiation factor IF-2 subunit alpha 896 1750 gene locus_tag LOCUS_10660 896 1750 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250053.1 protein_id gnl|my_center|LOCUS_10660 1929 2129 gene locus_tag LOCUS_10670 1929 2129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 >Feature sequence182 322 816 gene locus_tag LOCUS_10680 322 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 914 1648 gene locus_tag LOCUS_10690 914 1648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10690 >Feature sequence183 248 1162 gene locus_tag LOCUS_10700 248 1162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10700 1152 2075 gene locus_tag LOCUS_10710 1152 2075 CDS product site-specific DNA-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008193633.1 protein_id gnl|my_center|LOCUS_10710 >Feature sequence184 62 138 gene locus_tag LOCUS_t00240 62 138 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 334 954 gene locus_tag LOCUS_10720 334 954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 948 1193 gene locus_tag LOCUS_10730 948 1193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 >Feature sequence185 1046 531 gene locus_tag LOCUS_10740 1046 531 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545049.1 protein_id gnl|my_center|LOCUS_10740 2009 1080 gene locus_tag LOCUS_10750 2009 1080 CDS product cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546059.1 protein_id gnl|my_center|LOCUS_10750 >Feature sequence186 >Feature sequence187 1448 1457 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence188 21 2009 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gataaaatcagaccaaaatgggattgaaag >Feature sequence189 795 1472 gene locus_tag LOCUS_10760 795 1472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence190 920 3 gene locus_tag LOCUS_10770 920 3 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10770 1315 902 gene locus_tag LOCUS_10780 1315 902 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 >Feature sequence191 1241 327 gene locus_tag LOCUS_10790 1241 327 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 >Feature sequence192 1800 841 gene locus_tag LOCUS_10800 1800 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 >Feature sequence193 <1 665 gene locus_tag LOCUS_10810 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942139.1:type II secretion system F family protein 910 1194 gene locus_tag LOCUS_10820 910 1194 CDS product integration host factor subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942168.1 protein_id gnl|my_center|LOCUS_10820 1462 1253 gene locus_tag LOCUS_10830 1462 1253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 >Feature sequence194 572 216 gene locus_tag LOCUS_10840 572 216 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 792 556 gene locus_tag LOCUS_10850 792 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 1508 789 gene locus_tag LOCUS_10860 1508 789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence195 1524 1243 gene locus_tag LOCUS_10870 1524 1243 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877574.1 protein_id gnl|my_center|LOCUS_10870 1627 1552 gene locus_tag LOCUS_t00250 1627 1552 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 1676 1685 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence196 216 845 gene locus_tag LOCUS_10880 216 845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867709.1 protein_id gnl|my_center|LOCUS_10880 842 1396 gene locus_tag LOCUS_10890 842 1396 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878317.1 protein_id gnl|my_center|LOCUS_10890 <2009 1365 gene locus_tag LOCUS_10900 <2009 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000392647.1:magnesium transporter >Feature sequence197 31 414 gene locus_tag LOCUS_10910 31 414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 423 1652 gene locus_tag LOCUS_10920 gene prf1 423 1652 CDS product peptide chain release factor aRF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146580.1 protein_id gnl|my_center|LOCUS_10920 >Feature sequence198 1304 1176 gene locus_tag LOCUS_10930 1304 1176 CDS product desulfoferrodoxin FeS4 iron-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023638.1 protein_id gnl|my_center|LOCUS_10930 <1989 1309 gene locus_tag LOCUS_10940 <1989 1309 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963428.1:nucleotide sugar dehydrogenase >Feature sequence199 1113 130 gene locus_tag LOCUS_10950 1113 130 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583306.1 protein_id gnl|my_center|LOCUS_10950 1581 1117 gene locus_tag LOCUS_10960 gene fabZ 1581 1117 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420731.1 protein_id gnl|my_center|LOCUS_10960 >Feature sequence200 125 1945 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gaccatagtgggattgaaagtggaacaat >Feature sequence201 1132 1728 gene locus_tag LOCUS_10970 1132 1728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence202 171 965 gene locus_tag LOCUS_10980 171 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10980 949 1344 gene locus_tag LOCUS_10990 949 1344 CDS product sigma-70 region 4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250870.1 protein_id gnl|my_center|LOCUS_10990 1379 1564 gene locus_tag LOCUS_11000 1379 1564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11000 >Feature sequence203 737 519 gene locus_tag LOCUS_11010 737 519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11010 1423 1100 gene locus_tag LOCUS_11020 1423 1100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 1647 1420 gene locus_tag LOCUS_11030 1647 1420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 >Feature sequence204 <1 807 gene locus_tag LOCUS_11040 <1 807 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072232.1:RimK family alpha-L-glutamate ligase 859 1581 gene locus_tag LOCUS_11050 859 1581 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202318933.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence205 361 47 gene locus_tag LOCUS_11060 361 47 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1918 458 gene locus_tag LOCUS_11070 1918 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11070 >Feature sequence206 467 709 gene locus_tag LOCUS_11080 467 709 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 706 1155 gene locus_tag LOCUS_11090 706 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 >Feature sequence207 >Feature sequence208 455 464 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence209 1163 372 gene locus_tag LOCUS_11100 gene speB 1163 372 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869807.1 protein_id gnl|my_center|LOCUS_11100 1347 1490 gene locus_tag LOCUS_11110 1347 1490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence210 272 673 gene locus_tag LOCUS_11120 272 673 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867889.1 protein_id gnl|my_center|LOCUS_11120 1084 1368 gene locus_tag LOCUS_11130 1084 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 >Feature sequence211 837 1139 gene locus_tag LOCUS_11140 837 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11140 >Feature sequence212 813 292 gene locus_tag LOCUS_11150 813 292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 1520 804 gene locus_tag LOCUS_11160 1520 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence213 1793 36 gene locus_tag LOCUS_11170 1793 36 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 >Feature sequence214 >Feature sequence215 >Feature sequence216 >Feature sequence217 24 >1809 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gataaaatcagaccatagtgggattgaaag >Feature sequence218 <1767 575 gene locus_tag LOCUS_11180 <1767 575 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858661.1:carbamoyl-phosphate synthase large subunit >Feature sequence219 199 477 gene locus_tag LOCUS_11190 199 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 657 881 gene locus_tag LOCUS_11200 657 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11200 915 1466 gene locus_tag LOCUS_11210 915 1466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 >Feature sequence220 215 913 gene locus_tag LOCUS_11220 215 913 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878402.1 protein_id gnl|my_center|LOCUS_11220 1258 968 gene locus_tag LOCUS_11230 1258 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 >Feature sequence221 <1746 860 gene locus_tag LOCUS_11240 <1746 860 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002882660.1:flagellar hook protein FlgE >Feature sequence222 >Feature sequence223 >Feature sequence224 <1 569 gene locus_tag LOCUS_11250 <1 569 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095092.1:D-lyxose/D-mannose family sugar isomerase >Feature sequence225 1393 113 gene locus_tag LOCUS_11260 1393 113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 1612 1400 gene locus_tag LOCUS_11270 1612 1400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence226 >Feature sequence227 67 1705 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ctttcaatcccattttggtctgattttatc >Feature sequence228 >Feature sequence229 >Feature sequence230 >Feature sequence231 245 324 gene locus_tag LOCUS_t00260 245 324 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 361 960 gene locus_tag LOCUS_11280 361 960 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878079.1 protein_id gnl|my_center|LOCUS_11280 1339 965 gene locus_tag LOCUS_11290 1339 965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 >Feature sequence232 827 1408 gene locus_tag LOCUS_11300 gene rplJ 827 1408 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878836.1 protein_id gnl|my_center|LOCUS_11300 >Feature sequence233 376 636 gene locus_tag LOCUS_11310 376 636 CDS product DUF433 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391714.1 protein_id gnl|my_center|LOCUS_11310 617 763 gene locus_tag LOCUS_11320 617 763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11320 769 894 gene locus_tag LOCUS_11330 769 894 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 >Feature sequence234 1510 467 gene locus_tag LOCUS_11340 1510 467 CDS product integrase core domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205617032.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence235 >Feature sequence236 1196 381 gene locus_tag LOCUS_11350 1196 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11350 >Feature sequence237 1035 661 gene locus_tag LOCUS_11360 1035 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 666 675 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1651 1135 gene locus_tag LOCUS_11370 <1651 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007329295.1:sulfite exporter TauE/SafE family protein >Feature sequence238 16 1029 gene locus_tag LOCUS_11380 16 1029 CDS product lipid II:glycine glycyltransferase FemX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002658082.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence239 844 200 gene locus_tag LOCUS_11390 844 200 CDS product polysaccharide export protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390865.1 protein_id gnl|my_center|LOCUS_11390 <1642 1127 gene locus_tag LOCUS_11400 <1642 1127 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038965931.1:molybdenum cofactor biosynthesis protein B >Feature sequence240 130 903 gene locus_tag LOCUS_11410 130 903 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005809761.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence241 <1636 435 gene locus_tag LOCUS_11420 <1636 435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146756.1:ABC transporter substrate-binding protein >Feature sequence242 <1632 661 gene locus_tag LOCUS_11430 <1632 661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938761.1:DegQ family serine endoprotease >Feature sequence243 >Feature sequence244 377 1264 gene locus_tag LOCUS_11440 377 1264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11440 1608 1261 gene locus_tag LOCUS_11450 1608 1261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 >Feature sequence245 281 571 gene locus_tag LOCUS_11460 281 571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 525 534 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 552 1331 gene locus_tag LOCUS_11470 552 1331 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022155.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11470 >Feature sequence246 >Feature sequence247 1382 579 gene locus_tag LOCUS_11480 gene speE 1382 579 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000424691.1 protein_id gnl|my_center|LOCUS_11480 >Feature sequence248 29 1547 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gataaaatcagaccaaaatgggattgaaag >Feature sequence249 874 671 gene locus_tag LOCUS_11490 874 671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 <1567 974 gene locus_tag LOCUS_11500 <1567 974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868004.1:ATP-dependent DNA helicase >Feature sequence250 531 1214 gene locus_tag LOCUS_11510 531 1214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 1512 1252 gene locus_tag LOCUS_11520 1512 1252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11520 >Feature sequence251 53 271 gene locus_tag LOCUS_11530 gene infA 53 271 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546095.1 protein_id gnl|my_center|LOCUS_11530 558 938 gene locus_tag LOCUS_11540 gene rpsM 558 938 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544955.1 protein_id gnl|my_center|LOCUS_11540 953 1345 gene locus_tag LOCUS_11550 gene rpsK 953 1345 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545788.1 protein_id gnl|my_center|LOCUS_11550 >Feature sequence252 566 201 gene locus_tag LOCUS_11560 566 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1159 569 gene locus_tag LOCUS_11570 1159 569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1256 1182 gene locus_tag LOCUS_t00270 1256 1182 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1336 1261 gene locus_tag LOCUS_t00280 1336 1261 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence253 209 84 gene locus_tag LOCUS_11580 209 84 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 1294 203 gene locus_tag LOCUS_11590 1294 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_11590 414 423 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence254 299 308 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1204 350 gene locus_tag LOCUS_11600 1204 350 CDS product M28 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000680714.1 protein_id gnl|my_center|LOCUS_11600 >Feature sequence255 >Feature sequence256 <1 1011 gene locus_tag LOCUS_11610 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000371130.1:peptide chain release factor 2 >Feature sequence257 2 160 gene locus_tag LOCUS_11620 2 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 253 915 gene locus_tag LOCUS_11630 253 915 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112472.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence258 634 1029 gene locus_tag LOCUS_11640 634 1029 CDS product sigma-70 region 4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250870.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence259 162 794 gene locus_tag LOCUS_11650 162 794 CDS product XRE family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876297.1 protein_id gnl|my_center|LOCUS_11650 <1524 935 gene locus_tag LOCUS_11660 <1524 935 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000971620.1:methyl-accepting chemotaxis protein TlpB >Feature sequence260 >Feature sequence261 478 669 gene locus_tag LOCUS_11670 478 669 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 980 813 gene locus_tag LOCUS_11680 980 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 1050 1235 gene locus_tag LOCUS_11690 1050 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence262 <1503 502 gene locus_tag LOCUS_11700 <1503 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010879160.1:vitamin B12-dependent ribonucleotide reductase