>Feature sequence001 218 997 gene locus_tag LOCUS_00010 218 997 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002836742.1 protein_id gnl|my_center|LOCUS_00010 1174 992 gene locus_tag LOCUS_00020 1174 992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00020 2295 1171 gene locus_tag LOCUS_00030 gene carA 2295 1171 CDS product glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000254171.1 protein_id gnl|my_center|LOCUS_00030 2862 2305 gene locus_tag LOCUS_00040 2862 2305 CDS product DUF507 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001237418.1 protein_id gnl|my_center|LOCUS_00040 3637 2930 gene locus_tag LOCUS_00050 3637 2930 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00050 4148 3615 gene locus_tag LOCUS_00060 4148 3615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00060 4940 4152 gene locus_tag LOCUS_00070 4940 4152 CDS product phosphatidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000226149.1 protein_id gnl|my_center|LOCUS_00070 5923 4937 gene locus_tag LOCUS_00080 gene purM 5923 4937 CDS product phosphoribosylformylglycinamidine cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851320.1 protein_id gnl|my_center|LOCUS_00080 6161 5907 gene locus_tag LOCUS_00090 6161 5907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00090 7142 6171 gene locus_tag LOCUS_00100 gene trpS 7142 6171 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583821.1 protein_id gnl|my_center|LOCUS_00100 7972 7139 gene locus_tag LOCUS_00110 7972 7139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 9341 7959 gene locus_tag LOCUS_00120 gene der 9341 7959 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858744.1 protein_id gnl|my_center|LOCUS_00120 10910 9357 gene locus_tag LOCUS_00130 10910 9357 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546793.1 protein_id gnl|my_center|LOCUS_00130 11690 10977 gene locus_tag LOCUS_00140 gene pssA 11690 10977 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853992.1 protein_id gnl|my_center|LOCUS_00140 12327 11677 gene locus_tag LOCUS_00150 12327 11677 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942553.1 protein_id gnl|my_center|LOCUS_00150 14275 12299 gene locus_tag LOCUS_00160 gene ftsH 14275 12299 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852796.1 protein_id gnl|my_center|LOCUS_00160 15098 14262 gene locus_tag LOCUS_00170 15098 14262 CDS product 50S ribosomal protein L11 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852657.1 protein_id gnl|my_center|LOCUS_00170 15546 15166 gene locus_tag LOCUS_00180 15546 15166 CDS product chemotaxis response regulator CheY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002866134.1 protein_id gnl|my_center|LOCUS_00180 16281 15580 gene locus_tag LOCUS_00190 gene hisA 16281 15580 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943717.1 protein_id gnl|my_center|LOCUS_00190 16896 16291 gene locus_tag LOCUS_00200 gene hisH 16896 16291 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545834.1 protein_id gnl|my_center|LOCUS_00200 17789 16893 gene locus_tag LOCUS_00210 17789 16893 CDS product PDC sensor domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852871.1 protein_id gnl|my_center|LOCUS_00210 18339 17776 gene locus_tag LOCUS_00220 gene maf 18339 17776 CDS product septum formation inhibitor Maf inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000420308.1 protein_id gnl|my_center|LOCUS_00220 20240 18366 gene locus_tag LOCUS_00230 20240 18366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 20871 20230 gene locus_tag LOCUS_00240 gene dccR 20871 20230 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_00240 23413 20873 gene locus_tag LOCUS_00250 gene alaS 23413 20873 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858583.1 protein_id gnl|my_center|LOCUS_00250 23477 24538 gene locus_tag LOCUS_00260 23477 24538 CDS product pyridoxal phosphate-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000491853.1 protein_id gnl|my_center|LOCUS_00260 24535 26472 gene locus_tag LOCUS_00270 24535 26472 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858576.1 protein_id gnl|my_center|LOCUS_00270 27747 26653 gene locus_tag LOCUS_00280 27747 26653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00280 28562 27744 gene locus_tag LOCUS_00290 28562 27744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 >Feature sequence002 487 1368 gene locus_tag LOCUS_00300 gene exoX 487 1368 CDS product exodeoxyribonuclease X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816504.1 protein_id gnl|my_center|LOCUS_00300 2066 1365 gene locus_tag LOCUS_00310 2066 1365 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852965.1 protein_id gnl|my_center|LOCUS_00310 2820 2053 gene locus_tag LOCUS_00320 2820 2053 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852992.1 protein_id gnl|my_center|LOCUS_00320 3874 2807 gene locus_tag LOCUS_00330 3874 2807 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00330 4343 3861 gene locus_tag LOCUS_00340 4343 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00340 4883 4485 gene locus_tag LOCUS_00350 gene rpsI 4883 4485 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001227269.1 protein_id gnl|my_center|LOCUS_00350 5305 4883 gene locus_tag LOCUS_00360 gene rplM 5305 4883 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779321.1 protein_id gnl|my_center|LOCUS_00360 5857 5390 gene locus_tag LOCUS_00370 5857 5390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00370 6356 5850 gene locus_tag LOCUS_00380 6356 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 7192 6353 gene locus_tag LOCUS_00390 gene mqnP 7192 6353 CDS product menaquinone biosynthesis prenyltransferase MqnP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000913938.1 protein_id gnl|my_center|LOCUS_00390 7241 8092 gene locus_tag LOCUS_00400 gene miaA 7241 8092 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080343057.1 protein_id gnl|my_center|LOCUS_00400 10314 8089 gene locus_tag LOCUS_00410 10314 8089 CDS product paralyzed flagella protein PflA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851328.1 protein_id gnl|my_center|LOCUS_00410 11693 10362 gene locus_tag LOCUS_00420 11693 10362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00420 13123 11693 gene locus_tag LOCUS_00430 13123 11693 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545185.1 protein_id gnl|my_center|LOCUS_00430 14975 13125 gene locus_tag LOCUS_00440 gene nuoL 14975 13125 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460436.1 protein_id gnl|my_center|LOCUS_00440 15276 14968 gene locus_tag LOCUS_00450 15276 14968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 15747 15280 gene locus_tag LOCUS_00460 15747 15280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00460 16351 15749 gene locus_tag LOCUS_00470 16351 15749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 17324 16353 gene locus_tag LOCUS_00480 gene nuoH 17324 16353 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392496.1 protein_id gnl|my_center|LOCUS_00480 19007 17334 gene locus_tag LOCUS_00490 19007 17334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00490 19490 19017 gene locus_tag LOCUS_00500 19490 19017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00500 19812 19474 gene locus_tag LOCUS_00510 19812 19474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00510 21663 19957 gene locus_tag LOCUS_00520 21663 19957 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858720.1 protein_id gnl|my_center|LOCUS_00520 21712 22371 gene locus_tag LOCUS_00530 21712 22371 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213204.1 protein_id gnl|my_center|LOCUS_00530 22947 22363 gene locus_tag LOCUS_00540 gene rdgB 22947 22363 CDS product RdgB/HAM1 family non-canonical purine NTP pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853680.1 protein_id gnl|my_center|LOCUS_00540 <25158 23259 gene locus_tag LOCUS_00550 <25158 23259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010933702.1:efflux RND transporter permease subunit >Feature sequence003 471 4 gene locus_tag LOCUS_00560 471 4 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00560 1336 461 gene locus_tag LOCUS_00570 1336 461 CDS product menaquinone biosynthesis family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857964.1 protein_id gnl|my_center|LOCUS_00570 1861 1346 gene locus_tag LOCUS_00580 1861 1346 CDS product Uma2 family endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011124030.1 protein_id gnl|my_center|LOCUS_00580 1939 2976 gene locus_tag LOCUS_00590 gene recA 1939 2976 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851424.1 protein_id gnl|my_center|LOCUS_00590 2979 4250 gene locus_tag LOCUS_00600 gene eno 2979 4250 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000955673.1 protein_id gnl|my_center|LOCUS_00600 4264 4506 gene locus_tag LOCUS_00610 4264 4506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 4503 5072 gene locus_tag LOCUS_00620 4503 5072 CDS product AMIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000260967.1 protein_id gnl|my_center|LOCUS_00620 5059 5559 gene locus_tag LOCUS_00630 5059 5559 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002904001.1 protein_id gnl|my_center|LOCUS_00630 5549 5731 gene locus_tag LOCUS_00640 5549 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00640 5734 6315 gene locus_tag LOCUS_00650 5734 6315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00650 6361 7416 gene locus_tag LOCUS_00660 gene flhB 6361 7416 CDS product flagellar biosynthesis protein FlhB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858726.1 protein_id gnl|my_center|LOCUS_00660 7465 8427 gene locus_tag LOCUS_00670 7465 8427 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881055.1 protein_id gnl|my_center|LOCUS_00670 8424 9764 gene locus_tag LOCUS_00680 8424 9764 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858680.1 protein_id gnl|my_center|LOCUS_00680 9761 10288 gene locus_tag LOCUS_00690 9761 10288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 10285 11160 gene locus_tag LOCUS_00700 gene lpxC 10285 11160 CDS product UDP-3-O-acyl-N-acetylglucosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000815275.1 protein_id gnl|my_center|LOCUS_00700 11153 11596 gene locus_tag LOCUS_00710 11153 11596 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851789.1 protein_id gnl|my_center|LOCUS_00710 11607 12488 gene locus_tag LOCUS_00720 gene thrB 11607 12488 CDS product homoserine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002888538.1 protein_id gnl|my_center|LOCUS_00720 12759 15239 gene locus_tag LOCUS_00730 12759 15239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 15308 15655 gene locus_tag LOCUS_00740 gene rbfA 15308 15655 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002778650.1 protein_id gnl|my_center|LOCUS_00740 15652 16455 gene locus_tag LOCUS_00750 15652 16455 CDS product Cof-type HAD-IIB family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002379058.1 protein_id gnl|my_center|LOCUS_00750 16452 16898 gene locus_tag LOCUS_00760 gene rimP 16452 16898 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800873.1 protein_id gnl|my_center|LOCUS_00760 16888 17856 gene locus_tag LOCUS_00770 gene ribD 16888 17856 CDS product bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891948.1 protein_id gnl|my_center|LOCUS_00770 17858 18607 gene locus_tag LOCUS_00780 17858 18607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 18573 19376 gene locus_tag LOCUS_00790 18573 19376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 19379 20275 gene locus_tag LOCUS_00800 19379 20275 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852904.1 protein_id gnl|my_center|LOCUS_00800 20227 20589 gene locus_tag LOCUS_00810 20227 20589 CDS product polymer-forming cytoskeletal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859143.1 protein_id gnl|my_center|LOCUS_00810 21868 20573 gene locus_tag LOCUS_00820 gene radA 21868 20573 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858434.1 protein_id gnl|my_center|LOCUS_00820 22127 21861 gene locus_tag LOCUS_00830 22127 21861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 22992 22120 gene locus_tag LOCUS_00840 gene ftsY 22992 22120 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864556.1 protein_id gnl|my_center|LOCUS_00840 23405 22992 gene locus_tag LOCUS_00850 23405 22992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 23445 24044 gene locus_tag LOCUS_00860 23445 24044 CDS product 5-formyltetrahydrofolate cyclo-ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002875342.1 protein_id gnl|my_center|LOCUS_00860 >Feature sequence004 1460 294 gene locus_tag LOCUS_00870 1460 294 CDS product tyrosine-type recombinase/integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098087.1 protein_id gnl|my_center|LOCUS_00870 2253 1750 gene locus_tag LOCUS_00880 2253 1750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 2518 2228 gene locus_tag LOCUS_00890 2518 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00890 3320 2559 gene locus_tag LOCUS_00900 3320 2559 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011402848.1 protein_id gnl|my_center|LOCUS_00900 4186 3407 gene locus_tag LOCUS_00910 4186 3407 CDS product thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881431.1 protein_id gnl|my_center|LOCUS_00910 5228 4179 gene locus_tag LOCUS_00920 5228 4179 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853049.1 protein_id gnl|my_center|LOCUS_00920 6179 5238 gene locus_tag LOCUS_00930 6179 5238 CDS product branched-chain amino acid ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852952.1 protein_id gnl|my_center|LOCUS_00930 7659 6181 gene locus_tag LOCUS_00940 7659 6181 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 8891 7752 gene locus_tag LOCUS_00950 8891 7752 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852953.1 protein_id gnl|my_center|LOCUS_00950 8957 10207 gene locus_tag LOCUS_00960 gene serS 8957 10207 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858681.1 protein_id gnl|my_center|LOCUS_00960 10216 12387 gene locus_tag LOCUS_00970 gene pflB 10216 12387 CDS product motility protein PflB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858651.1 protein_id gnl|my_center|LOCUS_00970 12438 13160 gene locus_tag LOCUS_00980 12438 13160 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851668.1 protein_id gnl|my_center|LOCUS_00980 13150 13539 gene locus_tag LOCUS_00990 13150 13539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 13550 15244 gene locus_tag LOCUS_01000 13550 15244 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261885.1 protein_id gnl|my_center|LOCUS_01000 16306 15230 gene locus_tag LOCUS_01010 16306 15230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 16460 18148 gene locus_tag LOCUS_01020 gene ilvD 16460 18148 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853088.1 protein_id gnl|my_center|LOCUS_01020 18192 19031 gene locus_tag LOCUS_01030 18192 19031 CDS product nucleoside recognition domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003243723.1 protein_id gnl|my_center|LOCUS_01030 19616 19044 gene locus_tag LOCUS_01040 19616 19044 CDS product TIGR00296 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876490.1 protein_id gnl|my_center|LOCUS_01040 <22144 19658 gene locus_tag LOCUS_01050 <22144 19658 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880933.1:EAL domain-containing protein >Feature sequence005 867 400 gene locus_tag LOCUS_01060 867 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 890 2053 gene locus_tag LOCUS_01070 890 2053 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011055868.1 protein_id gnl|my_center|LOCUS_01070 2050 3066 gene locus_tag LOCUS_01080 2050 3066 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 3592 3053 gene locus_tag LOCUS_01090 3592 3053 CDS product esterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073646.1 protein_id gnl|my_center|LOCUS_01090 3731 5764 gene locus_tag LOCUS_01100 gene ligA 3731 5764 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852062.1 protein_id gnl|my_center|LOCUS_01100 5754 6047 gene locus_tag LOCUS_01110 gene clpS 5754 6047 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545154.1 protein_id gnl|my_center|LOCUS_01110 6048 8237 gene locus_tag LOCUS_01120 gene clpA 6048 8237 CDS product ATP-dependent Clp protease ATP-binding subunit ClpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546336.1 protein_id gnl|my_center|LOCUS_01120 8221 8910 gene locus_tag LOCUS_01130 gene aat 8221 8910 CDS product leucyl/phenylalanyl-tRNA--protein transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938894.1 protein_id gnl|my_center|LOCUS_01130 8897 9208 gene locus_tag LOCUS_01140 8897 9208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146594.1 protein_id gnl|my_center|LOCUS_01140 9908 9201 gene locus_tag LOCUS_01150 gene cmoA 9908 9201 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859101.1 protein_id gnl|my_center|LOCUS_01150 9963 11225 gene locus_tag LOCUS_01160 9963 11225 CDS product O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853122.1 protein_id gnl|my_center|LOCUS_01160 11381 12499 gene locus_tag LOCUS_01170 11381 12499 CDS product homoserine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943101.1 protein_id gnl|my_center|LOCUS_01170 12486 12659 gene locus_tag LOCUS_01180 12486 12659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 12656 13432 gene locus_tag LOCUS_01190 12656 13432 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853489.1 protein_id gnl|my_center|LOCUS_01190 14471 13425 gene locus_tag LOCUS_01200 14471 13425 CDS product dehypoxanthine futalosine cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081430802.1 protein_id gnl|my_center|LOCUS_01200 14535 15416 gene locus_tag LOCUS_01210 14535 15416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 15428 15952 gene locus_tag LOCUS_01220 15428 15952 CDS product CvpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858643.1 protein_id gnl|my_center|LOCUS_01220 15971 17479 gene locus_tag LOCUS_01230 gene lysS 15971 17479 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000492582.1 protein_id gnl|my_center|LOCUS_01230 17492 18742 gene locus_tag LOCUS_01240 17492 18742 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858710.1 protein_id gnl|my_center|LOCUS_01240 18781 19332 gene locus_tag LOCUS_01250 18781 19332 CDS product DUF1882 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859481.1 protein_id gnl|my_center|LOCUS_01250 19342 20037 gene locus_tag LOCUS_01260 19342 20037 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 20037 21443 gene locus_tag LOCUS_01270 gene trpE 20037 21443 CDS product anthranilate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880347.1 protein_id gnl|my_center|LOCUS_01270 >Feature sequence006 1809 661 gene locus_tag LOCUS_01280 1809 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 2450 1806 gene locus_tag LOCUS_01290 2450 1806 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930750.1 protein_id gnl|my_center|LOCUS_01290 3906 2416 gene locus_tag LOCUS_01300 3906 2416 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852957.1 protein_id gnl|my_center|LOCUS_01300 4925 3903 gene locus_tag LOCUS_01310 gene aroB 4925 3903 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852978.1 protein_id gnl|my_center|LOCUS_01310 6321 4909 gene locus_tag LOCUS_01320 6321 4909 CDS product COG3400 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857878.1 protein_id gnl|my_center|LOCUS_01320 6388 7509 gene locus_tag LOCUS_01330 gene tgt 6388 7509 CDS product tRNA guanosine(34) transglycosylase Tgt inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347385.1 protein_id gnl|my_center|LOCUS_01330 8599 7493 gene locus_tag LOCUS_01340 8599 7493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01340 9423 8599 gene locus_tag LOCUS_01350 9423 8599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01350 10022 9432 gene locus_tag LOCUS_01360 10022 9432 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851338.1 protein_id gnl|my_center|LOCUS_01360 10294 10019 gene locus_tag LOCUS_01370 10294 10019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01370 10382 10747 gene locus_tag LOCUS_01380 10382 10747 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01380 10750 12450 gene locus_tag LOCUS_01390 10750 12450 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 12460 12831 gene locus_tag LOCUS_01400 gene fliS 12460 12831 CDS product flagellar export chaperone FliS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002776169.1 protein_id gnl|my_center|LOCUS_01400 12831 13085 gene locus_tag LOCUS_01410 12831 13085 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01410 13812 13075 gene locus_tag LOCUS_01420 13812 13075 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859130.1 protein_id gnl|my_center|LOCUS_01420 14035 13802 gene locus_tag LOCUS_01430 14035 13802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 14847 14029 gene locus_tag LOCUS_01440 gene truB 14847 14029 CDS product tRNA pseudouridine(55) synthase TruB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891909.1 protein_id gnl|my_center|LOCUS_01440 16837 14849 gene locus_tag LOCUS_01450 16837 14849 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891908.1 protein_id gnl|my_center|LOCUS_01450 16927 17796 gene locus_tag LOCUS_01460 16927 17796 CDS product LysR substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880380.1 protein_id gnl|my_center|LOCUS_01460 18208 17783 gene locus_tag LOCUS_01470 18208 17783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 19928 18183 gene locus_tag LOCUS_01480 19928 18183 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891907.1 protein_id gnl|my_center|LOCUS_01480 20525 19941 gene locus_tag LOCUS_01490 20525 19941 CDS product aminotransferase class IV family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794135.1 protein_id gnl|my_center|LOCUS_01490 >Feature sequence007 <1 645 gene locus_tag LOCUS_01500 <1 645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000010001.1:flagellin B 2591 663 gene locus_tag LOCUS_01510 2591 663 CDS product motility associated factor glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611900.1 protein_id gnl|my_center|LOCUS_01510 2680 3054 gene locus_tag LOCUS_01520 2680 3054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 3051 3392 gene locus_tag LOCUS_01530 3051 3392 CDS product arsenate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207938.1 protein_id gnl|my_center|LOCUS_01530 3389 4102 gene locus_tag LOCUS_01540 3389 4102 CDS product DUF445 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003439009.1 protein_id gnl|my_center|LOCUS_01540 4115 4609 gene locus_tag LOCUS_01550 4115 4609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 7225 4631 gene locus_tag LOCUS_01560 gene acnB 7225 4631 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932230.1 protein_id gnl|my_center|LOCUS_01560 7373 8317 gene locus_tag LOCUS_01570 7373 8317 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544949.1 protein_id gnl|my_center|LOCUS_01570 8328 9092 gene locus_tag LOCUS_01580 8328 9092 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853086.1 protein_id gnl|my_center|LOCUS_01580 9073 9459 gene locus_tag LOCUS_01590 9073 9459 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545896.1 protein_id gnl|my_center|LOCUS_01590 9452 11059 gene locus_tag LOCUS_01600 9452 11059 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853239.1 protein_id gnl|my_center|LOCUS_01600 11078 11896 gene locus_tag LOCUS_01610 gene galU 11078 11896 CDS product UTP--glucose-1-phosphate uridylyltransferase GalU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088639.1 protein_id gnl|my_center|LOCUS_01610 11896 13662 gene locus_tag LOCUS_01620 gene glmS 11896 13662 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858421.1 protein_id gnl|my_center|LOCUS_01620 13692 14855 gene locus_tag LOCUS_01630 13692 14855 CDS product 2,3,4,5-tetrahydropyridine-2,6-carboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851311.1 protein_id gnl|my_center|LOCUS_01630 14941 15129 gene locus_tag LOCUS_01640 gene rpmB 14941 15129 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003973430.1 protein_id gnl|my_center|LOCUS_01640 15155 16291 gene locus_tag LOCUS_01650 15155 16291 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461981.1 protein_id gnl|my_center|LOCUS_01650 16300 17475 gene locus_tag LOCUS_01660 gene argJ 16300 17475 CDS product bifunctional ornithine acetyltransferase/N-acetylglutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193330363.1 protein_id gnl|my_center|LOCUS_01660 17528 17603 gene locus_tag LOCUS_t00010 17528 17603 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 17755 17831 gene locus_tag LOCUS_t00020 17755 17831 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 18660 17842 gene locus_tag LOCUS_01670 gene cysK 18660 17842 CDS product cysteine synthase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865179.1 protein_id gnl|my_center|LOCUS_01670 >Feature sequence008 499 170 gene locus_tag LOCUS_01680 499 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 1490 1101 gene locus_tag LOCUS_01690 gene queF 1490 1101 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002834281.1 protein_id gnl|my_center|LOCUS_01690 3777 1501 gene locus_tag LOCUS_01700 gene gyrB 3777 1501 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858833.1 protein_id gnl|my_center|LOCUS_01700 4864 3809 gene locus_tag LOCUS_01710 gene dnaN 4864 3809 CDS product DNA polymerase III subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858808.1 protein_id gnl|my_center|LOCUS_01710 6298 4991 gene locus_tag LOCUS_01720 gene dnaA 6298 4991 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858822.1 protein_id gnl|my_center|LOCUS_01720 6460 6924 gene locus_tag LOCUS_01730 gene ruvC 6460 6924 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891952.1 protein_id gnl|my_center|LOCUS_01730 7102 7575 gene locus_tag LOCUS_01740 7102 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 7994 7581 gene locus_tag LOCUS_01750 gene nusB 7994 7581 CDS product transcription antitermination factor NusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002824771.1 protein_id gnl|my_center|LOCUS_01750 8188 7994 gene locus_tag LOCUS_01760 8188 7994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 8652 8188 gene locus_tag LOCUS_01770 gene ribE 8652 8188 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854278.1 protein_id gnl|my_center|LOCUS_01770 9482 8691 gene locus_tag LOCUS_01780 gene kdsA 9482 8691 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858652.1 protein_id gnl|my_center|LOCUS_01780 9788 11077 gene locus_tag LOCUS_01790 9788 11077 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009897221.1 protein_id gnl|my_center|LOCUS_01790 11156 11902 gene locus_tag LOCUS_01800 gene dapF 11156 11902 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851173.1 protein_id gnl|my_center|LOCUS_01800 12013 12531 gene locus_tag LOCUS_01810 gene tpx 12013 12531 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880278.1 protein_id gnl|my_center|LOCUS_01810 12589 13005 gene locus_tag LOCUS_01820 12589 13005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 13015 13830 gene locus_tag LOCUS_01830 gene salC 13015 13830 CDS product peptidylprolyl isomerase SalC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864102.1 protein_id gnl|my_center|LOCUS_01830 14149 13814 gene locus_tag LOCUS_01840 14149 13814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01840 15240 14149 gene locus_tag LOCUS_01850 gene rlmN 15240 14149 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864795.1 protein_id gnl|my_center|LOCUS_01850 15766 15233 gene locus_tag LOCUS_01860 15766 15233 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853142.1 protein_id gnl|my_center|LOCUS_01860 16219 15791 gene locus_tag LOCUS_01870 16219 15791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 16983 16222 gene locus_tag LOCUS_01880 gene hisF 16983 16222 CDS product imidazoleglycerol phosphate synthase cyclase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000880108.1 protein_id gnl|my_center|LOCUS_01880 17118 17816 gene locus_tag LOCUS_01890 gene rsmA 17118 17816 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853083.1 protein_id gnl|my_center|LOCUS_01890 >Feature sequence009 85 585 gene locus_tag LOCUS_01900 85 585 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 1020 619 gene locus_tag LOCUS_01910 1020 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 1584 1060 gene locus_tag LOCUS_01920 1584 1060 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963151.1 protein_id gnl|my_center|LOCUS_01920 1667 3640 gene locus_tag LOCUS_01930 gene glyS 1667 3640 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858294.1 protein_id gnl|my_center|LOCUS_01930 3649 3849 gene locus_tag LOCUS_01940 3649 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 4193 3846 gene locus_tag LOCUS_01950 4193 3846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 4742 4242 gene locus_tag LOCUS_01960 4742 4242 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001179304.1 protein_id gnl|my_center|LOCUS_01960 5674 4784 gene locus_tag LOCUS_01970 5674 4784 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851738.1 protein_id gnl|my_center|LOCUS_01970 6335 5706 gene locus_tag LOCUS_01980 6335 5706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 7504 6356 gene locus_tag LOCUS_01990 gene tolB 7504 6356 CDS product Tol-Pal system protein TolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858647.1 protein_id gnl|my_center|LOCUS_01990 8187 7501 gene locus_tag LOCUS_02000 8187 7501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 8561 8184 gene locus_tag LOCUS_02010 8561 8184 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858790.1 protein_id gnl|my_center|LOCUS_02010 9112 8558 gene locus_tag LOCUS_02020 9112 8558 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854361.1 protein_id gnl|my_center|LOCUS_02020 9467 9087 gene locus_tag LOCUS_02030 gene atpC 9467 9087 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001863093.1 protein_id gnl|my_center|LOCUS_02030 10879 9470 gene locus_tag LOCUS_02040 gene atpD 10879 9470 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852005.1 protein_id gnl|my_center|LOCUS_02040 11770 10889 gene locus_tag LOCUS_02050 gene atpG 11770 10889 CDS product ATP synthase F1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851834.1 protein_id gnl|my_center|LOCUS_02050 13279 11774 gene locus_tag LOCUS_02060 gene atpA 13279 11774 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851836.1 protein_id gnl|my_center|LOCUS_02060 13810 13295 gene locus_tag LOCUS_02070 13810 13295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02070 14307 13810 gene locus_tag LOCUS_02080 14307 13810 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851681.1 protein_id gnl|my_center|LOCUS_02080 14729 14304 gene locus_tag LOCUS_02090 14729 14304 CDS product FoF1 ATP synthase subunit B' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851812.1 protein_id gnl|my_center|LOCUS_02090 15581 14763 gene locus_tag LOCUS_02100 15581 14763 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851919.1 protein_id gnl|my_center|LOCUS_02100 16360 15578 gene locus_tag LOCUS_02110 16360 15578 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851697.1 protein_id gnl|my_center|LOCUS_02110 16974 16357 gene locus_tag LOCUS_02120 16974 16357 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858812.1 protein_id gnl|my_center|LOCUS_02120 17852 16971 gene locus_tag LOCUS_02130 gene fmt 17852 16971 CDS product methionyl-tRNA formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851657.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence010 674 504 gene locus_tag LOCUS_02140 674 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 645 1070 gene locus_tag LOCUS_02150 645 1070 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 1067 2872 gene locus_tag LOCUS_02160 gene uvrC 1067 2872 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000774319.1 protein_id gnl|my_center|LOCUS_02160 2869 3630 gene locus_tag LOCUS_02170 2869 3630 CDS product bifunctional riboflavin kinase/FAD synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852206.1 protein_id gnl|my_center|LOCUS_02170 5905 3599 gene locus_tag LOCUS_02180 5905 3599 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 6380 5892 gene locus_tag LOCUS_02190 6380 5892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 8440 6374 gene locus_tag LOCUS_02200 8440 6374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 8491 10425 gene locus_tag LOCUS_02210 8491 10425 CDS product ABC-F family ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852425.1 protein_id gnl|my_center|LOCUS_02210 10418 11212 gene locus_tag LOCUS_02220 10418 11212 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852725.1 protein_id gnl|my_center|LOCUS_02220 11253 11624 gene locus_tag LOCUS_02230 11253 11624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 11634 11831 gene locus_tag LOCUS_02240 11634 11831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 11869 12537 gene locus_tag LOCUS_02250 11869 12537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 14055 12520 gene locus_tag LOCUS_02260 14055 12520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 14189 14707 gene locus_tag LOCUS_02270 gene ppa 14189 14707 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858521.1 protein_id gnl|my_center|LOCUS_02270 15507 14758 gene locus_tag LOCUS_02280 15507 14758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 16640 15504 gene locus_tag LOCUS_02290 16640 15504 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853125.1 protein_id gnl|my_center|LOCUS_02290 16727 16975 gene locus_tag LOCUS_02300 16727 16975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 16968 17240 gene locus_tag LOCUS_02310 16968 17240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02310 >Feature sequence011 1820 960 gene locus_tag LOCUS_02320 1820 960 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864856.1 protein_id gnl|my_center|LOCUS_02320 2316 1831 gene locus_tag LOCUS_02330 gene mobB 2316 1831 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852644.1 protein_id gnl|my_center|LOCUS_02330 2373 3647 gene locus_tag LOCUS_02340 2373 3647 CDS product MgtC/SapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482405.1 protein_id gnl|my_center|LOCUS_02340 5630 3609 gene locus_tag LOCUS_02350 gene flhA 5630 3609 CDS product flagellar biosynthesis protein FlhA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001262893.1 protein_id gnl|my_center|LOCUS_02350 5512 5820 gene locus_tag LOCUS_02360 5512 5820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 6201 5785 gene locus_tag LOCUS_02370 6201 5785 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583626.1 protein_id gnl|my_center|LOCUS_02370 6474 6259 gene locus_tag LOCUS_02380 6474 6259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02380 6726 7001 gene locus_tag LOCUS_02390 gene rpsO 6726 7001 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392569.1 protein_id gnl|my_center|LOCUS_02390 7444 7040 gene locus_tag LOCUS_02400 7444 7040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02400 8736 7441 gene locus_tag LOCUS_02410 gene hisD 8736 7441 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880475.1 protein_id gnl|my_center|LOCUS_02410 8780 9496 gene locus_tag LOCUS_02420 gene fetB 8780 9496 CDS product iron export ABC transporter permease subunit FetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880765.1 protein_id gnl|my_center|LOCUS_02420 10194 9505 gene locus_tag LOCUS_02430 gene gpmA 10194 9505 CDS product 2,3-diphosphoglycerate-dependent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870165.1 protein_id gnl|my_center|LOCUS_02430 10703 10209 gene locus_tag LOCUS_02440 10703 10209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 10742 11509 gene locus_tag LOCUS_02450 gene surE 10742 11509 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854555.1 protein_id gnl|my_center|LOCUS_02450 11502 12719 gene locus_tag LOCUS_02460 11502 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02460 12709 13335 gene locus_tag LOCUS_02470 12709 13335 CDS product tRNA threonylcarbamoyladenosine dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612425.1 protein_id gnl|my_center|LOCUS_02470 14981 13332 gene locus_tag LOCUS_02480 14981 13332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02480 16078 14984 gene locus_tag LOCUS_02490 16078 14984 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227769.1 protein_id gnl|my_center|LOCUS_02490 16138 17178 gene locus_tag LOCUS_02500 16138 17178 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02500 <18019 17165 gene locus_tag LOCUS_02510 <18019 17165 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010972133.1:calcium:proton antiporter >Feature sequence012 2467 1325 gene locus_tag LOCUS_02520 2467 1325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 3128 2460 gene locus_tag LOCUS_02530 3128 2460 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083233.1 protein_id gnl|my_center|LOCUS_02530 3212 4198 gene locus_tag LOCUS_02540 gene tsaD 3212 4198 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864246.1 protein_id gnl|my_center|LOCUS_02540 4459 4247 gene locus_tag LOCUS_02550 gene rpsU 4459 4247 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780697.1 protein_id gnl|my_center|LOCUS_02550 4543 5256 gene locus_tag LOCUS_02560 4543 5256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 5283 6911 gene locus_tag LOCUS_02570 5283 6911 CDS product CTP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853102.1 protein_id gnl|my_center|LOCUS_02570 6911 8425 gene locus_tag LOCUS_02580 gene recJ 6911 8425 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853146.1 protein_id gnl|my_center|LOCUS_02580 8422 9144 gene locus_tag LOCUS_02590 8422 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 9173 10075 gene locus_tag LOCUS_02600 9173 10075 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_099334852.1 protein_id gnl|my_center|LOCUS_02600 10059 12077 gene locus_tag LOCUS_02610 10059 12077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02610 12498 12172 gene locus_tag LOCUS_02620 12498 12172 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001211699.1 protein_id gnl|my_center|LOCUS_02620 12850 12482 gene locus_tag LOCUS_02630 12850 12482 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853400.1 protein_id gnl|my_center|LOCUS_02630 12887 13993 gene locus_tag LOCUS_02640 12887 13993 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260957.1 protein_id gnl|my_center|LOCUS_02640 14526 13942 gene locus_tag LOCUS_02650 14526 13942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02650 15037 14513 gene locus_tag LOCUS_02660 15037 14513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 15899 15024 gene locus_tag LOCUS_02670 15899 15024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 16699 15890 gene locus_tag LOCUS_02680 gene xerD 16699 15890 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546237.1 protein_id gnl|my_center|LOCUS_02680 16991 16668 gene locus_tag LOCUS_02690 16991 16668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 <17722 17123 gene locus_tag LOCUS_02700 <17722 17123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858634.1:tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB >Feature sequence013 1571 1020 gene locus_tag LOCUS_02710 1571 1020 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 1636 2658 gene locus_tag LOCUS_02720 gene ilvC 1636 2658 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858483.1 protein_id gnl|my_center|LOCUS_02720 2700 3860 gene locus_tag LOCUS_02730 2700 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02730 3826 5262 gene locus_tag LOCUS_02740 3826 5262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 5288 6097 gene locus_tag LOCUS_02750 gene minD 5288 6097 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001019069.1 protein_id gnl|my_center|LOCUS_02750 6094 6327 gene locus_tag LOCUS_02760 gene minE 6094 6327 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000051415.1 protein_id gnl|my_center|LOCUS_02760 6324 7310 gene locus_tag LOCUS_02770 6324 7310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 7288 7989 gene locus_tag LOCUS_02780 7288 7989 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002874287.1 protein_id gnl|my_center|LOCUS_02780 7967 8458 gene locus_tag LOCUS_02790 7967 8458 CDS product DNA-deoxyinosine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185796.1 protein_id gnl|my_center|LOCUS_02790 8437 8823 gene locus_tag LOCUS_02800 gene ruvX 8437 8823 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852281.1 protein_id gnl|my_center|LOCUS_02800 9629 8802 gene locus_tag LOCUS_02810 9629 8802 CDS product ketopantoate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245639.1 protein_id gnl|my_center|LOCUS_02810 10815 9727 gene locus_tag LOCUS_02820 gene trmA 10815 9727 CDS product tRNA (uridine(54)-C5)-methyltransferase TrmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206575.1 protein_id gnl|my_center|LOCUS_02820 11553 10825 gene locus_tag LOCUS_02830 gene fliP 11553 10825 CDS product flagellar type III secretion system pore protein FliP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852529.1 protein_id gnl|my_center|LOCUS_02830 12311 11550 gene locus_tag LOCUS_02840 12311 11550 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545014.1 protein_id gnl|my_center|LOCUS_02840 13087 12320 gene locus_tag LOCUS_02850 gene pomA 13087 12320 CDS product flagellar motor protein PomA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482965.1 protein_id gnl|my_center|LOCUS_02850 13133 14416 gene locus_tag LOCUS_02860 gene glmU 13133 14416 CDS product bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852530.1 protein_id gnl|my_center|LOCUS_02860 14413 15555 gene locus_tag LOCUS_02870 gene coaBC 14413 15555 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852470.1 protein_id gnl|my_center|LOCUS_02870 15536 15871 gene locus_tag LOCUS_02880 15536 15871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 15798 16211 gene locus_tag LOCUS_02890 15798 16211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02890 16214 16876 gene locus_tag LOCUS_02900 16214 16876 CDS product di-trans,poly-cis-decaprenylcistransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000370674.1 protein_id gnl|my_center|LOCUS_02900 >Feature sequence014 310 4515 gene locus_tag LOCUS_02910 310 4515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4478 5419 gene locus_tag LOCUS_02920 4478 5419 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001174316.1 protein_id gnl|my_center|LOCUS_02920 5355 6554 gene locus_tag LOCUS_02930 5355 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02930 6555 7670 gene locus_tag LOCUS_02940 gene trmB 6555 7670 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858203.1 protein_id gnl|my_center|LOCUS_02940 7648 8307 gene locus_tag LOCUS_02950 7648 8307 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853534.1 protein_id gnl|my_center|LOCUS_02950 8294 9076 gene locus_tag LOCUS_02960 8294 9076 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853622.1 protein_id gnl|my_center|LOCUS_02960 9073 10146 gene locus_tag LOCUS_02970 9073 10146 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000277334.1 protein_id gnl|my_center|LOCUS_02970 10180 10905 gene locus_tag LOCUS_02980 gene pyrH 10180 10905 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001148056.1 protein_id gnl|my_center|LOCUS_02980 10905 11108 gene locus_tag LOCUS_02990 10905 11108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02990 11105 13231 gene locus_tag LOCUS_03000 11105 13231 CDS product bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858057.1 protein_id gnl|my_center|LOCUS_03000 13224 14444 gene locus_tag LOCUS_03010 gene tyrS 13224 14444 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858315.1 protein_id gnl|my_center|LOCUS_03010 14454 15539 gene locus_tag LOCUS_03020 gene fabX 14454 15539 CDS product decanoate oxidase/trans-2-decenoyl-[acyl-carrier protein] isomerase FabX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000255244.1 protein_id gnl|my_center|LOCUS_03020 15539 16798 gene locus_tag LOCUS_03030 15539 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 >Feature sequence015 814 23 gene locus_tag LOCUS_03040 814 23 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004399351.1 protein_id gnl|my_center|LOCUS_03040 2615 798 gene locus_tag LOCUS_03050 gene dxs 2615 798 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_180373797.1 protein_id gnl|my_center|LOCUS_03050 3361 2612 gene locus_tag LOCUS_03060 3361 2612 CDS product FliH/SctL family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082901.1 protein_id gnl|my_center|LOCUS_03060 4379 3354 gene locus_tag LOCUS_03070 gene fliG 4379 3354 CDS product flagellar motor switch protein FliG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854670.1 protein_id gnl|my_center|LOCUS_03070 6066 4390 gene locus_tag LOCUS_03080 gene fliF 6066 4390 CDS product flagellar basal-body MS-ring/collar protein FliF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364750.1 protein_id gnl|my_center|LOCUS_03080 7133 6063 gene locus_tag LOCUS_03090 gene hisC 7133 6063 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858650.1 protein_id gnl|my_center|LOCUS_03090 8203 7142 gene locus_tag LOCUS_03100 gene pheA 8203 7142 CDS product prephenate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858741.1 protein_id gnl|my_center|LOCUS_03100 8946 8200 gene locus_tag LOCUS_03110 8946 8200 CDS product HAD-IIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858702.1 protein_id gnl|my_center|LOCUS_03110 10157 8949 gene locus_tag LOCUS_03120 gene lysA 10157 8949 CDS product diaminopimelate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858733.1 protein_id gnl|my_center|LOCUS_03120 11169 10147 gene locus_tag LOCUS_03130 11169 10147 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858697.1 protein_id gnl|my_center|LOCUS_03130 11709 11170 gene locus_tag LOCUS_03140 gene pth 11709 11170 CDS product aminoacyl-tRNA hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858659.1 protein_id gnl|my_center|LOCUS_03140 12282 11746 gene locus_tag LOCUS_03150 12282 11746 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889331.1 protein_id gnl|my_center|LOCUS_03150 13450 12329 gene locus_tag LOCUS_03160 13450 12329 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003386380.1 protein_id gnl|my_center|LOCUS_03160 14408 13452 gene locus_tag LOCUS_03170 14408 13452 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851728.1 protein_id gnl|my_center|LOCUS_03170 15045 14419 gene locus_tag LOCUS_03180 gene serB 15045 14419 CDS product phosphoserine phosphatase SerB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851598.1 protein_id gnl|my_center|LOCUS_03180 15129 15356 gene locus_tag LOCUS_03190 15129 15356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 15349 16092 gene locus_tag LOCUS_03200 gene tatC 15349 16092 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000461250.1 protein_id gnl|my_center|LOCUS_03200 >Feature sequence016 1243 998 gene locus_tag LOCUS_03210 1243 998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 1482 1243 gene locus_tag LOCUS_03220 1482 1243 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03220 2533 1469 gene locus_tag LOCUS_03230 gene leuB 2533 1469 CDS product 3-isopropylmalate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880105.1 protein_id gnl|my_center|LOCUS_03230 3029 2520 gene locus_tag LOCUS_03240 gene leuD 3029 2520 CDS product 3-isopropylmalate dehydratase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544917.1 protein_id gnl|my_center|LOCUS_03240 3092 4015 gene locus_tag LOCUS_03250 3092 4015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03250 4810 4022 gene locus_tag LOCUS_03260 gene flgG 4810 4022 CDS product flagellar basal-body rod protein FlgG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852142.1 protein_id gnl|my_center|LOCUS_03260 5635 4850 gene locus_tag LOCUS_03270 5635 4850 CDS product flagellar hook-basal body protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858501.1 protein_id gnl|my_center|LOCUS_03270 5761 7575 gene locus_tag LOCUS_03280 gene rpoD 5761 7575 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852997.1 protein_id gnl|my_center|LOCUS_03280 7578 8369 gene locus_tag LOCUS_03290 7578 8369 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941313.1 protein_id gnl|my_center|LOCUS_03290 8366 9256 gene locus_tag LOCUS_03300 8366 9256 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852582.1 protein_id gnl|my_center|LOCUS_03300 9260 9811 gene locus_tag LOCUS_03310 9260 9811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03310 9808 10812 gene locus_tag LOCUS_03320 9808 10812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03320 10829 11632 gene locus_tag LOCUS_03330 gene xerD 10829 11632 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000390080.1 protein_id gnl|my_center|LOCUS_03330 11629 11928 gene locus_tag LOCUS_03340 11629 11928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 11919 12521 gene locus_tag LOCUS_03350 11919 12521 CDS product type III pantothenate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864777.1 protein_id gnl|my_center|LOCUS_03350 12518 13129 gene locus_tag LOCUS_03360 gene hisG 12518 13129 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003436683.1 protein_id gnl|my_center|LOCUS_03360 13119 13796 gene locus_tag LOCUS_03370 13119 13796 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965668.1 protein_id gnl|my_center|LOCUS_03370 14440 13793 gene locus_tag LOCUS_03380 gene nth 14440 13793 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612264.1 protein_id gnl|my_center|LOCUS_03380 14501 15217 gene locus_tag LOCUS_03390 14501 15217 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081500.1 protein_id gnl|my_center|LOCUS_03390 15227 16102 gene locus_tag LOCUS_03400 gene peb4 15227 16102 CDS product peptidylprolyl isomerase PEB4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852119.1 protein_id gnl|my_center|LOCUS_03400 >Feature sequence017 1902 520 gene locus_tag LOCUS_03410 gene thiC 1902 520 CDS product phosphomethylpyrimidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921089.1 protein_id gnl|my_center|LOCUS_03410 2068 3189 gene locus_tag LOCUS_03420 2068 3189 CDS product bifunctional 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase/2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851397.1 protein_id gnl|my_center|LOCUS_03420 3164 4021 gene locus_tag LOCUS_03430 3164 4021 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851295.1 protein_id gnl|my_center|LOCUS_03430 3999 5174 gene locus_tag LOCUS_03440 gene sat 3999 5174 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108789.1 protein_id gnl|my_center|LOCUS_03440 5187 5840 gene locus_tag LOCUS_03450 5187 5840 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_071542407.1 protein_id gnl|my_center|LOCUS_03450 5833 6327 gene locus_tag LOCUS_03460 5833 6327 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851418.1 protein_id gnl|my_center|LOCUS_03460 6328 7632 gene locus_tag LOCUS_03470 6328 7632 CDS product APC family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870113.1 protein_id gnl|my_center|LOCUS_03470 8366 7719 gene locus_tag LOCUS_03480 8366 7719 CDS product ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011976248.1 protein_id gnl|my_center|LOCUS_03480 8917 8363 gene locus_tag LOCUS_03490 8917 8363 CDS product IMPACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858665.1 protein_id gnl|my_center|LOCUS_03490 9843 8917 gene locus_tag LOCUS_03500 9843 8917 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000647423.1 protein_id gnl|my_center|LOCUS_03500 10141 9833 gene locus_tag LOCUS_03510 10141 9833 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 11205 10186 gene locus_tag LOCUS_03520 gene mnmA 11205 10186 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851977.1 protein_id gnl|my_center|LOCUS_03520 11512 11228 gene locus_tag LOCUS_03530 11512 11228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 12303 11509 gene locus_tag LOCUS_03540 12303 11509 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851719.1 protein_id gnl|my_center|LOCUS_03540 13468 12281 gene locus_tag LOCUS_03550 13468 12281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03550 14150 13458 gene locus_tag LOCUS_03560 gene mtnN 14150 13458 CDS product aminodeoxyfutalosine nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000250146.1 protein_id gnl|my_center|LOCUS_03560 14893 14147 gene locus_tag LOCUS_03570 14893 14147 CDS product carbon-nitrogen hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941312.1 protein_id gnl|my_center|LOCUS_03570 15795 14890 gene locus_tag LOCUS_03580 gene fabD 15795 14890 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851630.1 protein_id gnl|my_center|LOCUS_03580 >Feature sequence018 2702 378 gene locus_tag LOCUS_03590 2702 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03590 5317 2723 gene locus_tag LOCUS_03600 gene flgL 5317 2723 CDS product flagellar hook-associated protein FlgL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001266636.1 protein_id gnl|my_center|LOCUS_03600 6152 5361 gene locus_tag LOCUS_03610 6152 5361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 7489 6152 gene locus_tag LOCUS_03620 gene xseA 7489 6152 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000382848.1 protein_id gnl|my_center|LOCUS_03620 8453 7461 gene locus_tag LOCUS_03630 8453 7461 CDS product alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852617.1 protein_id gnl|my_center|LOCUS_03630 8742 8461 gene locus_tag LOCUS_03640 gene rpsR 8742 8461 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853032.1 protein_id gnl|my_center|LOCUS_03640 9214 8753 gene locus_tag LOCUS_03650 9214 8753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 9539 9207 gene locus_tag LOCUS_03660 gene rpsF 9539 9207 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865739.1 protein_id gnl|my_center|LOCUS_03660 9695 10708 gene locus_tag LOCUS_03670 9695 10708 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003229459.1 protein_id gnl|my_center|LOCUS_03670 11467 10724 gene locus_tag LOCUS_03680 11467 10724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 12006 11566 gene locus_tag LOCUS_03690 12006 11566 CDS product glycine zipper 2TM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072571.1 protein_id gnl|my_center|LOCUS_03690 12458 12003 gene locus_tag LOCUS_03700 12458 12003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03700 14007 12460 gene locus_tag LOCUS_03710 gene pqiB 14007 12460 CDS product intermembrane transport protein PqiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003693803.1 protein_id gnl|my_center|LOCUS_03710 14470 13979 gene locus_tag LOCUS_03720 14470 13979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 15152 14553 gene locus_tag LOCUS_03730 15152 14553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03730 15368 15292 gene locus_tag LOCUS_t00030 15368 15292 tRNA product tRNA-Asp inference COORDINATES:profile:Aragorn:1.2.38 15461 15386 gene locus_tag LOCUS_t00040 15461 15386 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 15540 15465 gene locus_tag LOCUS_t00050 15540 15465 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence019 1453 983 gene locus_tag LOCUS_03740 gene lptE 1453 983 CDS product LPS assembly lipoprotein LptE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001202125.1 protein_id gnl|my_center|LOCUS_03740 3943 1484 gene locus_tag LOCUS_03750 gene leuS 3943 1484 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852890.1 protein_id gnl|my_center|LOCUS_03750 4848 3943 gene locus_tag LOCUS_03760 4848 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 5857 4850 gene locus_tag LOCUS_03770 5857 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 6948 5854 gene locus_tag LOCUS_03780 6948 5854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03780 7772 6948 gene locus_tag LOCUS_03790 7772 6948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03790 8117 7776 gene locus_tag LOCUS_03800 8117 7776 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383778.1 protein_id gnl|my_center|LOCUS_03800 9109 8138 gene locus_tag LOCUS_03810 gene secF 9109 8138 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858025.1 protein_id gnl|my_center|LOCUS_03810 10667 9111 gene locus_tag LOCUS_03820 gene secD 10667 9111 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857963.1 protein_id gnl|my_center|LOCUS_03820 10965 10654 gene locus_tag LOCUS_03830 gene yajC 10965 10654 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002786346.1 protein_id gnl|my_center|LOCUS_03830 10905 12182 gene locus_tag LOCUS_03840 10905 12182 CDS product apolipoprotein N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852744.1 protein_id gnl|my_center|LOCUS_03840 12197 12820 gene locus_tag LOCUS_03850 gene bioD 12197 12820 CDS product dethiobiotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000897490.1 protein_id gnl|my_center|LOCUS_03850 12808 13215 gene locus_tag LOCUS_03860 12808 13215 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250603.1 protein_id gnl|my_center|LOCUS_03860 14594 13212 gene locus_tag LOCUS_03870 14594 13212 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_108558166.1 protein_id gnl|my_center|LOCUS_03870 15159 14605 gene locus_tag LOCUS_03880 15159 14605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03880 >Feature sequence020 797 348 gene locus_tag LOCUS_03890 797 348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03890 1266 871 gene locus_tag LOCUS_03900 1266 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927161.1 protein_id gnl|my_center|LOCUS_03900 1373 2413 gene locus_tag LOCUS_03910 1373 2413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2414 2722 gene locus_tag LOCUS_03920 2414 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 2748 2987 gene locus_tag LOCUS_03930 2748 2987 CDS product YdcH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855201.1 protein_id gnl|my_center|LOCUS_03930 3580 2999 gene locus_tag LOCUS_03940 3580 2999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 4697 3846 gene locus_tag LOCUS_03950 gene nadC 4697 3846 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000405980.1 protein_id gnl|my_center|LOCUS_03950 5665 4694 gene locus_tag LOCUS_03960 gene nadA 5665 4694 CDS product quinolinate synthase NadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001141770.1 protein_id gnl|my_center|LOCUS_03960 5727 6335 gene locus_tag LOCUS_03970 gene plsY 5727 6335 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854681.1 protein_id gnl|my_center|LOCUS_03970 6335 6661 gene locus_tag LOCUS_03980 6335 6661 CDS product dihydroneopterin aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000850887.1 protein_id gnl|my_center|LOCUS_03980 6713 7378 gene locus_tag LOCUS_03990 gene hsrA 6713 7378 CDS product homeostatic response regulator transcription factor HsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857553.1 protein_id gnl|my_center|LOCUS_03990 7380 7634 gene locus_tag LOCUS_04000 7380 7634 CDS product YfhL family 4Fe-4S dicluster ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000055463.1 protein_id gnl|my_center|LOCUS_04000 7634 9091 gene locus_tag LOCUS_04010 7634 9091 CDS product Ppx/GppA phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001074267.1 protein_id gnl|my_center|LOCUS_04010 9084 9485 gene locus_tag LOCUS_04020 9084 9485 CDS product arsenate reductase ArsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582904.1 protein_id gnl|my_center|LOCUS_04020 10225 9503 gene locus_tag LOCUS_04030 10225 9503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04030 10813 10268 gene locus_tag LOCUS_04040 10813 10268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_04040 13003 10823 gene locus_tag LOCUS_04050 gene bamA 13003 10823 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851708.1 protein_id gnl|my_center|LOCUS_04050 13076 13903 gene locus_tag LOCUS_04060 13076 13903 CDS product prephenate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611641.1 protein_id gnl|my_center|LOCUS_04060 14158 13910 gene locus_tag LOCUS_04070 14158 13910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04070 14251 14520 gene locus_tag LOCUS_04080 14251 14520 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 14498 14911 gene locus_tag LOCUS_04090 14498 14911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04090 >Feature sequence021 959 207 gene locus_tag LOCUS_04100 959 207 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880277.1 protein_id gnl|my_center|LOCUS_04100 1430 1059 gene locus_tag LOCUS_04110 1430 1059 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04110 2344 1403 gene locus_tag LOCUS_04120 gene argF 2344 1403 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858026.1 protein_id gnl|my_center|LOCUS_04120 2392 2949 gene locus_tag LOCUS_04130 gene ribA 2392 2949 CDS product GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853056.1 protein_id gnl|my_center|LOCUS_04130 2933 3622 gene locus_tag LOCUS_04140 2933 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04140 3619 4146 gene locus_tag LOCUS_04150 gene rsmG 3619 4146 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001068828.1 protein_id gnl|my_center|LOCUS_04150 4148 4348 gene locus_tag LOCUS_04160 4148 4348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04160 4335 4712 gene locus_tag LOCUS_04170 4335 4712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 4709 5242 gene locus_tag LOCUS_04180 gene cetB 4709 5242 CDS product bipartate energy taxis response protein CetB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002777340.1 protein_id gnl|my_center|LOCUS_04180 5232 6653 gene locus_tag LOCUS_04190 gene cetA 5232 6653 CDS product bipartate energy taxis response protein CetA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002790076.1 protein_id gnl|my_center|LOCUS_04190 6644 7720 gene locus_tag LOCUS_04200 6644 7720 CDS product FtsW/RodA/SpoVE family cell cycle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864601.1 protein_id gnl|my_center|LOCUS_04200 8612 7728 gene locus_tag LOCUS_04210 8612 7728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04210 10810 8774 gene locus_tag LOCUS_04220 gene fdhF 10810 8774 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774551.1 protein_id gnl|my_center|LOCUS_04220 11548 10838 gene locus_tag LOCUS_04230 11548 10838 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388186.1 protein_id gnl|my_center|LOCUS_04230 11560 12285 gene locus_tag LOCUS_04240 11560 12285 CDS product YdcF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881298.1 protein_id gnl|my_center|LOCUS_04240 13312 12554 gene locus_tag LOCUS_04250 13312 12554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04250 14213 13344 gene locus_tag LOCUS_04260 14213 13344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04260 >Feature sequence022 <1 642 gene locus_tag LOCUS_04270 <1 642 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002890476.1:ferritin-like domain-containing protein 1205 639 gene locus_tag LOCUS_04280 1205 639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 1439 1912 gene locus_tag LOCUS_04290 gene moaC 1439 1912 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001131513.1 protein_id gnl|my_center|LOCUS_04290 1902 2402 gene locus_tag LOCUS_04300 1902 2402 CDS product molybdenum cofactor guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002867312.1 protein_id gnl|my_center|LOCUS_04300 4457 2349 gene locus_tag LOCUS_04310 4457 2349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04310 4506 7109 gene locus_tag LOCUS_04320 gene polA 4506 7109 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858644.1 protein_id gnl|my_center|LOCUS_04320 7542 7102 gene locus_tag LOCUS_04330 7542 7102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 10349 7752 gene locus_tag LOCUS_04340 gene sbcC 10349 7752 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880625.1 protein_id gnl|my_center|LOCUS_04340 11385 10339 gene locus_tag LOCUS_04350 11385 10339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04350 11732 11385 gene locus_tag LOCUS_04360 11732 11385 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_04360 12000 11743 gene locus_tag LOCUS_04370 12000 11743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 12246 12001 gene locus_tag LOCUS_04380 12246 12001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 12986 12237 gene locus_tag LOCUS_04390 12986 12237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 13807 12980 gene locus_tag LOCUS_04400 13807 12980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 13919 13785 gene locus_tag LOCUS_04410 13919 13785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 14167 14345 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq ggtttaactgatgacccgatttaaggggattgcgac >Feature sequence023 1730 1260 gene locus_tag LOCUS_04420 1730 1260 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04420 2089 1727 gene locus_tag LOCUS_04430 2089 1727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04430 2520 2086 gene locus_tag LOCUS_04440 2520 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04440 2927 2508 gene locus_tag LOCUS_04450 gene gspG 2927 2508 CDS product type II secretion system major pseudopilin GspG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000738789.1 protein_id gnl|my_center|LOCUS_04450 2969 3745 gene locus_tag LOCUS_04460 2969 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04460 3723 4568 gene locus_tag LOCUS_04470 3723 4568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 4565 4903 gene locus_tag LOCUS_04480 4565 4903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04480 4900 5370 gene locus_tag LOCUS_04490 4900 5370 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04490 5357 6088 gene locus_tag LOCUS_04500 5357 6088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6075 7847 gene locus_tag LOCUS_04510 6075 7847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 7834 9333 gene locus_tag LOCUS_04520 gene pilB 7834 9333 CDS product type IV-A pilus assembly ATPase PilB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546013.1 protein_id gnl|my_center|LOCUS_04520 9335 10522 gene locus_tag LOCUS_04530 gene lspF 9335 10522 CDS product GspF family T2SS innner membrane protein variant LspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947093.1 protein_id gnl|my_center|LOCUS_04530 <13324 11022 gene locus_tag LOCUS_04540 <13324 11022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_070065546.1:enhanced entry virulence factor RtxA >Feature sequence024 20 922 gene locus_tag LOCUS_04550 20 922 CDS product N-carbamoylputrescine amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853261.1 protein_id gnl|my_center|LOCUS_04550 901 2505 gene locus_tag LOCUS_04560 901 2505 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 2480 2701 gene locus_tag LOCUS_04570 2480 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04570 2698 3339 gene locus_tag LOCUS_04580 gene rpe 2698 3339 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858571.1 protein_id gnl|my_center|LOCUS_04580 3341 3943 gene locus_tag LOCUS_04590 3341 3943 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687611.1 protein_id gnl|my_center|LOCUS_04590 3963 5261 gene locus_tag LOCUS_04600 3963 5261 CDS product NFACT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864240.1 protein_id gnl|my_center|LOCUS_04600 5255 5491 gene locus_tag LOCUS_04610 5255 5491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 5493 6239 gene locus_tag LOCUS_04620 5493 6239 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869557.1 protein_id gnl|my_center|LOCUS_04620 6239 7318 gene locus_tag LOCUS_04630 gene dxr 6239 7318 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864243.1 protein_id gnl|my_center|LOCUS_04630 7299 7931 gene locus_tag LOCUS_04640 7299 7931 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851542.1 protein_id gnl|my_center|LOCUS_04640 8054 8611 gene locus_tag LOCUS_04650 8054 8611 CDS product pyruvate flavodoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486467.1 protein_id gnl|my_center|LOCUS_04650 8621 9019 gene locus_tag LOCUS_04660 8621 9019 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000656174.1 protein_id gnl|my_center|LOCUS_04660 9029 10246 gene locus_tag LOCUS_04670 9029 10246 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129867.1 protein_id gnl|my_center|LOCUS_04670 10257 11210 gene locus_tag LOCUS_04680 10257 11210 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000238135.1 protein_id gnl|my_center|LOCUS_04680 11268 11642 gene locus_tag LOCUS_04690 11268 11642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 12571 11639 gene locus_tag LOCUS_04700 gene corA 12571 11639 CDS product magnesium/cobalt transporter CorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081315.1 protein_id gnl|my_center|LOCUS_04700 13142 12672 gene locus_tag LOCUS_04710 13142 12672 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 >Feature sequence025 836 189 gene locus_tag LOCUS_04720 836 189 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000376795.1 protein_id gnl|my_center|LOCUS_04720 889 1203 gene locus_tag LOCUS_04730 889 1203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 1200 2126 gene locus_tag LOCUS_04740 1200 2126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 2136 2690 gene locus_tag LOCUS_04750 gene frr 2136 2690 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000938332.1 protein_id gnl|my_center|LOCUS_04750 2692 3303 gene locus_tag LOCUS_04760 gene pyrE 2692 3303 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851820.1 protein_id gnl|my_center|LOCUS_04760 3303 3701 gene locus_tag LOCUS_04770 3303 3701 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550872.1 protein_id gnl|my_center|LOCUS_04770 3829 4737 gene locus_tag LOCUS_04780 3829 4737 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072975.1 protein_id gnl|my_center|LOCUS_04780 4766 5731 gene locus_tag LOCUS_04790 4766 5731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 5713 6273 gene locus_tag LOCUS_04800 5713 6273 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853153.1 protein_id gnl|my_center|LOCUS_04800 6270 6968 gene locus_tag LOCUS_04810 6270 6968 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851407.1 protein_id gnl|my_center|LOCUS_04810 7863 6934 gene locus_tag LOCUS_04820 7863 6934 CDS product D-2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854730.1 protein_id gnl|my_center|LOCUS_04820 7900 8625 gene locus_tag LOCUS_04830 7900 8625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 9965 8622 gene locus_tag LOCUS_04840 9965 8622 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858001.1 protein_id gnl|my_center|LOCUS_04840 10414 9965 gene locus_tag LOCUS_04850 gene accB 10414 9965 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853623.1 protein_id gnl|my_center|LOCUS_04850 10492 11052 gene locus_tag LOCUS_04860 gene dcd 10492 11052 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003381535.1 protein_id gnl|my_center|LOCUS_04860 11049 11735 gene locus_tag LOCUS_04870 gene pyrF 11049 11735 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858700.1 protein_id gnl|my_center|LOCUS_04870 11732 12466 gene locus_tag LOCUS_04880 11732 12466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence026 396 1 gene locus_tag LOCUS_04890 396 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04890 505 945 gene locus_tag LOCUS_04900 gene rplI 505 945 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781628.1 protein_id gnl|my_center|LOCUS_04900 945 1496 gene locus_tag LOCUS_04910 gene hslV 945 1496 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002781630.1 protein_id gnl|my_center|LOCUS_04910 1498 2814 gene locus_tag LOCUS_04920 gene hslU 1498 2814 CDS product ATP-dependent protease ATPase subunit HslU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852226.1 protein_id gnl|my_center|LOCUS_04920 2823 3701 gene locus_tag LOCUS_04930 gene era 2823 3701 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862438.1 protein_id gnl|my_center|LOCUS_04930 3701 5284 gene locus_tag LOCUS_04940 3701 5284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 5281 5910 gene locus_tag LOCUS_04950 5281 5910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04950 5907 6332 gene locus_tag LOCUS_04960 5907 6332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 6329 7681 gene locus_tag LOCUS_04970 gene mshL 6329 7681 CDS product pilus (MSHA type) biogenesis protein MshL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851309.1 protein_id gnl|my_center|LOCUS_04970 7665 8396 gene locus_tag LOCUS_04980 7665 8396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 8396 9088 gene locus_tag LOCUS_04990 8396 9088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 9081 9869 gene locus_tag LOCUS_05000 9081 9869 CDS product HDOD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545798.1 protein_id gnl|my_center|LOCUS_05000 9874 11826 gene locus_tag LOCUS_05010 9874 11826 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891871.1 protein_id gnl|my_center|LOCUS_05010 >Feature sequence027 492 944 gene locus_tag LOCUS_05020 492 944 CDS product IS630 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_051041523.1 protein_id gnl|my_center|LOCUS_05020 941 1711 gene locus_tag LOCUS_05030 941 1711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1806 3383 gene locus_tag LOCUS_05040 1806 3383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3615 3800 gene locus_tag LOCUS_05050 3615 3800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05050 3797 4471 gene locus_tag LOCUS_05060 3797 4471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05060 4727 5665 gene locus_tag LOCUS_05070 4727 5665 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207210.1 protein_id gnl|my_center|LOCUS_05070 5691 5963 gene locus_tag LOCUS_05080 5691 5963 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 7570 6107 gene locus_tag LOCUS_05090 7570 6107 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891914.1 protein_id gnl|my_center|LOCUS_05090 7867 7589 gene locus_tag LOCUS_05100 7867 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 8052 7976 gene locus_tag LOCUS_t00060 8052 7976 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 8215 9204 gene locus_tag LOCUS_05110 8215 9204 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011089174.1 protein_id gnl|my_center|LOCUS_05110 9201 9758 gene locus_tag LOCUS_05120 9201 9758 CDS product TRAP transporter small permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724859.1 protein_id gnl|my_center|LOCUS_05120 9755 11038 gene locus_tag LOCUS_05130 gene dctM 9755 11038 CDS product C4-dicarboxylate TRAP transporter large permease protein DctM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085927.1 protein_id gnl|my_center|LOCUS_05130 11230 11505 gene locus_tag LOCUS_05140 gene groES 11230 11505 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825273.1 protein_id gnl|my_center|LOCUS_05140 >Feature sequence028 1271 60 gene locus_tag LOCUS_05150 1271 60 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851913.1 protein_id gnl|my_center|LOCUS_05150 1329 1811 gene locus_tag LOCUS_05160 gene aroQ 1329 1811 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852001.1 protein_id gnl|my_center|LOCUS_05160 1811 2821 gene locus_tag LOCUS_05170 1811 2821 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000677174.1 protein_id gnl|my_center|LOCUS_05170 2821 2985 gene locus_tag LOCUS_05180 2821 2985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05180 2982 3434 gene locus_tag LOCUS_05190 gene folK 2982 3434 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209612148.1 protein_id gnl|my_center|LOCUS_05190 3436 4635 gene locus_tag LOCUS_05200 3436 4635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 4632 5495 gene locus_tag LOCUS_05210 gene flhG 4632 5495 CDS product flagella biosynthesis ATPase FlhG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851985.1 protein_id gnl|my_center|LOCUS_05210 5508 5846 gene locus_tag LOCUS_05220 5508 5846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05220 5843 6526 gene locus_tag LOCUS_05230 5843 6526 CDS product RNA polymerase sigma factor FliA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859753.1 protein_id gnl|my_center|LOCUS_05230 6519 7595 gene locus_tag LOCUS_05240 gene fliM 6519 7595 CDS product flagellar motor switch protein FliM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000763575.1 protein_id gnl|my_center|LOCUS_05240 7588 8370 gene locus_tag LOCUS_05250 gene fliY 7588 8370 CDS product flagellar motor switch protein FliY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001150629.1 protein_id gnl|my_center|LOCUS_05250 8415 9677 gene locus_tag LOCUS_05260 8415 9677 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853398.1 protein_id gnl|my_center|LOCUS_05260 9670 10491 gene locus_tag LOCUS_05270 gene lgt 9670 10491 CDS product prolipoprotein diacylglyceryl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854600.1 protein_id gnl|my_center|LOCUS_05270 10479 11714 gene locus_tag LOCUS_05280 gene hemG 10479 11714 CDS product protoporphyrinogen oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545161.1 protein_id gnl|my_center|LOCUS_05280 11707 12399 gene locus_tag LOCUS_05290 11707 12399 CDS product cytochrome c biogenesis protein CcdA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001880582.1 protein_id gnl|my_center|LOCUS_05290 >Feature sequence029 838 284 gene locus_tag LOCUS_05300 838 284 CDS product DJ-1/PfpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964937.1 protein_id gnl|my_center|LOCUS_05300 1582 884 gene locus_tag LOCUS_05310 1582 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 2950 1592 gene locus_tag LOCUS_05320 gene hemN 2950 1592 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853363.1 protein_id gnl|my_center|LOCUS_05320 3834 2947 gene locus_tag LOCUS_05330 gene hemC 3834 2947 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856753.1 protein_id gnl|my_center|LOCUS_05330 4843 3866 gene locus_tag LOCUS_05340 gene hemB 4843 3866 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852925.1 protein_id gnl|my_center|LOCUS_05340 5880 4840 gene locus_tag LOCUS_05350 gene hemE 5880 4840 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853233.1 protein_id gnl|my_center|LOCUS_05350 7152 5893 gene locus_tag LOCUS_05360 gene hemA 7152 5893 CDS product glutamyl-tRNA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000418286.1 protein_id gnl|my_center|LOCUS_05360 7624 7154 gene locus_tag LOCUS_05370 7624 7154 CDS product PhnA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005422752.1 protein_id gnl|my_center|LOCUS_05370 10107 7621 gene locus_tag LOCUS_05380 10107 7621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 10523 10104 gene locus_tag LOCUS_05390 10523 10104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 11178 10615 gene locus_tag LOCUS_05400 11178 10615 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05400 <12141 11239 gene locus_tag LOCUS_05410 <12141 11239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851243.1:PAS domain-containing sensor histidine kinase >Feature sequence030 324 1112 gene locus_tag LOCUS_05420 gene fabI 324 1112 CDS product enoyl-ACP reductase FabI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780456.1 protein_id gnl|my_center|LOCUS_05420 1213 2382 gene locus_tag LOCUS_05430 1213 2382 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 3090 2452 gene locus_tag LOCUS_05440 3090 2452 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986243.1 protein_id gnl|my_center|LOCUS_05440 4340 3087 gene locus_tag LOCUS_05450 4340 3087 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000746824.1 protein_id gnl|my_center|LOCUS_05450 5133 4333 gene locus_tag LOCUS_05460 5133 4333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 6329 5130 gene locus_tag LOCUS_05470 6329 5130 CDS product LL-diaminopimelate aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932911.1 protein_id gnl|my_center|LOCUS_05470 7102 6326 gene locus_tag LOCUS_05480 7102 6326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851994.1 protein_id gnl|my_center|LOCUS_05480 7902 7099 gene locus_tag LOCUS_05490 7902 7099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 8557 7892 gene locus_tag LOCUS_05500 gene rlmB 8557 7892 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851944.1 protein_id gnl|my_center|LOCUS_05500 9367 8576 gene locus_tag LOCUS_05510 gene rsmI 9367 8576 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851893.1 protein_id gnl|my_center|LOCUS_05510 9568 9368 gene locus_tag LOCUS_05520 gene rpmE 9568 9368 CDS product 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851603.1 protein_id gnl|my_center|LOCUS_05520 9957 9706 gene locus_tag LOCUS_05530 9957 9706 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939490.1 protein_id gnl|my_center|LOCUS_05530 10061 10492 gene locus_tag LOCUS_05540 10061 10492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05540 11726 10482 gene locus_tag LOCUS_05550 11726 10482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 >Feature sequence031 818 579 gene locus_tag LOCUS_05560 818 579 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356779.1 protein_id gnl|my_center|LOCUS_05560 1300 815 gene locus_tag LOCUS_05570 1300 815 CDS product DUF3972 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852251.1 protein_id gnl|my_center|LOCUS_05570 1797 1300 gene locus_tag LOCUS_05580 gene purE 1797 1300 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852194.1 protein_id gnl|my_center|LOCUS_05580 3090 1807 gene locus_tag LOCUS_05590 3090 1807 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001077422.1 protein_id gnl|my_center|LOCUS_05590 3708 3094 gene locus_tag LOCUS_05600 3708 3094 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852254.1 protein_id gnl|my_center|LOCUS_05600 3762 4541 gene locus_tag LOCUS_05610 3762 4541 CDS product histidinol-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887115.1 protein_id gnl|my_center|LOCUS_05610 4563 5819 gene locus_tag LOCUS_05620 4563 5819 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857990.1 protein_id gnl|my_center|LOCUS_05620 5857 6807 gene locus_tag LOCUS_05630 5857 6807 CDS product flagellar basal body P-ring protein FlgI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000832067.1 protein_id gnl|my_center|LOCUS_05630 6817 7080 gene locus_tag LOCUS_05640 6817 7080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05640 7123 7305 gene locus_tag LOCUS_05650 7123 7305 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05650 7334 7744 gene locus_tag LOCUS_05660 7334 7744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05660 7746 9944 gene locus_tag LOCUS_05670 7746 9944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 10587 9934 gene locus_tag LOCUS_05680 10587 9934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05680 10642 11358 gene locus_tag LOCUS_05690 10642 11358 CDS product TIGR02757 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851318.1 protein_id gnl|my_center|LOCUS_05690 >Feature sequence032 1539 25 gene locus_tag LOCUS_05700 1539 25 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05700 2110 1526 gene locus_tag LOCUS_05710 2110 1526 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_05710 3318 2110 gene locus_tag LOCUS_05720 3318 2110 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256133.1 protein_id gnl|my_center|LOCUS_05720 5345 3330 gene locus_tag LOCUS_05730 5345 3330 CDS product ATP-dependent helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852419.1 protein_id gnl|my_center|LOCUS_05730 5735 5376 gene locus_tag LOCUS_05740 gene fliW 5735 5376 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862609.1 protein_id gnl|my_center|LOCUS_05740 6969 5767 gene locus_tag LOCUS_05750 6969 5767 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003549506.1 protein_id gnl|my_center|LOCUS_05750 7811 6969 gene locus_tag LOCUS_05760 gene argB 7811 6969 CDS product acetylglutamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082330.1 protein_id gnl|my_center|LOCUS_05760 8531 7857 gene locus_tag LOCUS_05770 gene queC 8531 7857 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779268.1 protein_id gnl|my_center|LOCUS_05770 8585 9001 gene locus_tag LOCUS_05780 gene ybeY 8585 9001 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000889553.1 protein_id gnl|my_center|LOCUS_05780 10532 9303 gene locus_tag LOCUS_05790 10532 9303 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000996418.1 protein_id gnl|my_center|LOCUS_05790 11248 10529 gene locus_tag LOCUS_05800 gene lptB 11248 10529 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855252.1 protein_id gnl|my_center|LOCUS_05800 >Feature sequence033 373 1092 gene locus_tag LOCUS_05810 373 1092 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852315.1 protein_id gnl|my_center|LOCUS_05810 1119 1841 gene locus_tag LOCUS_05820 1119 1841 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852139.1 protein_id gnl|my_center|LOCUS_05820 1841 2974 gene locus_tag LOCUS_05830 gene waaA 1841 2974 CDS product lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852277.1 protein_id gnl|my_center|LOCUS_05830 2964 3245 gene locus_tag LOCUS_05840 2964 3245 CDS product DUF167 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867625.1 protein_id gnl|my_center|LOCUS_05840 3281 4993 gene locus_tag LOCUS_05850 gene polX 3281 4993 CDS product DNA polymerase/3'-5' exonuclease PolX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957611.1 protein_id gnl|my_center|LOCUS_05850 6718 4949 gene locus_tag LOCUS_05860 6718 4949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 9397 6752 gene locus_tag LOCUS_05870 9397 6752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 <11286 9436 gene locus_tag LOCUS_05880 <11286 9436 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002805291.1:flagellar hook protein FlgE >Feature sequence034 972 445 gene locus_tag LOCUS_05890 972 445 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 1907 972 gene locus_tag LOCUS_05900 gene accA 1907 972 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858530.1 protein_id gnl|my_center|LOCUS_05900 3138 1918 gene locus_tag LOCUS_05910 3138 1918 CDS product beta-ketoacyl-ACP synthase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001252848.1 protein_id gnl|my_center|LOCUS_05910 3452 3216 gene locus_tag LOCUS_05920 gene acpP 3452 3216 CDS product acyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005544465.1 protein_id gnl|my_center|LOCUS_05920 4257 3514 gene locus_tag LOCUS_05930 gene fabG 4257 3514 CDS product 3-oxoacyl-ACP reductase FabG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858551.1 protein_id gnl|my_center|LOCUS_05930 4303 5355 gene locus_tag LOCUS_05940 gene mraY 4303 5355 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858494.1 protein_id gnl|my_center|LOCUS_05940 5365 6261 gene locus_tag LOCUS_05950 5365 6261 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 6258 7436 gene locus_tag LOCUS_05960 gene murD 6258 7436 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858617.1 protein_id gnl|my_center|LOCUS_05960 7464 7539 gene locus_tag LOCUS_t00070 7464 7539 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 9818 7575 gene locus_tag LOCUS_05970 9818 7575 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 10132 9845 gene locus_tag LOCUS_05980 10132 9845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 10158 10871 gene locus_tag LOCUS_05990 10158 10871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582849.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence035 1450 1082 gene locus_tag LOCUS_06000 1450 1082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 2037 1447 gene locus_tag LOCUS_06010 2037 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 3457 2027 gene locus_tag LOCUS_06020 3457 2027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06020 3922 3467 gene locus_tag LOCUS_06030 3922 3467 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 4363 3923 gene locus_tag LOCUS_06040 4363 3923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 5313 4360 gene locus_tag LOCUS_06050 5313 4360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06050 5924 5307 gene locus_tag LOCUS_06060 5924 5307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 7020 5926 gene locus_tag LOCUS_06070 gene prfB 7020 5926 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851475.1 protein_id gnl|my_center|LOCUS_06070 7079 7897 gene locus_tag LOCUS_06080 gene panC 7079 7897 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001264323.1 protein_id gnl|my_center|LOCUS_06080 7907 8866 gene locus_tag LOCUS_06090 7907 8866 CDS product murein L,D-transpeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852494.1 protein_id gnl|my_center|LOCUS_06090 >Feature sequence036 1 345 gene locus_tag LOCUS_06100 1 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 356 649 gene locus_tag LOCUS_06110 gene fliE 356 649 CDS product flagellar hook-basal body complex protein FliE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001147918.1 protein_id gnl|my_center|LOCUS_06110 649 2361 gene locus_tag LOCUS_06120 649 2361 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858598.1 protein_id gnl|my_center|LOCUS_06120 2351 3451 gene locus_tag LOCUS_06130 2351 3451 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880493.1 protein_id gnl|my_center|LOCUS_06130 3471 4748 gene locus_tag LOCUS_06140 3471 4748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 4824 5246 gene locus_tag LOCUS_06150 4824 5246 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933626.1 protein_id gnl|my_center|LOCUS_06150 5475 5633 gene locus_tag LOCUS_06160 5475 5633 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06160 5637 6008 gene locus_tag LOCUS_06170 gene rpsM 5637 6008 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002800121.1 protein_id gnl|my_center|LOCUS_06170 6019 6411 gene locus_tag LOCUS_06180 gene rpsK 6019 6411 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001129287.1 protein_id gnl|my_center|LOCUS_06180 6414 7040 gene locus_tag LOCUS_06190 gene rpsD 6414 7040 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851551.1 protein_id gnl|my_center|LOCUS_06190 7054 8055 gene locus_tag LOCUS_06200 7054 8055 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000864547.1 protein_id gnl|my_center|LOCUS_06200 8055 8426 gene locus_tag LOCUS_06210 gene rplQ 8055 8426 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851332.1 protein_id gnl|my_center|LOCUS_06210 8429 8725 gene locus_tag LOCUS_06220 8429 8725 CDS product NifU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858971.1 protein_id gnl|my_center|LOCUS_06220 8700 9062 gene locus_tag LOCUS_06230 8700 9062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 9034 10248 gene locus_tag LOCUS_06240 9034 10248 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865460.1 protein_id gnl|my_center|LOCUS_06240 >Feature sequence037 27 515 gene locus_tag LOCUS_06250 27 515 CDS product prepilin-type N-terminal cleavage/methylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261164.1 protein_id gnl|my_center|LOCUS_06250 1456 509 gene locus_tag LOCUS_06260 gene flgS 1456 509 CDS product acid survival sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000748581.1 protein_id gnl|my_center|LOCUS_06260 1854 3407 gene locus_tag LOCUS_06270 1854 3407 CDS product fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002244146.1 protein_id gnl|my_center|LOCUS_06270 5503 3404 gene locus_tag LOCUS_06280 5503 3404 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06280 5901 5551 gene locus_tag LOCUS_06290 gene rplT 5901 5551 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851731.1 protein_id gnl|my_center|LOCUS_06290 6186 5992 gene locus_tag LOCUS_06300 gene rpmI 6186 5992 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001125542.1 protein_id gnl|my_center|LOCUS_06300 6259 7065 gene locus_tag LOCUS_06310 6259 7065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 8013 7048 gene locus_tag LOCUS_06320 8013 7048 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858639.1 protein_id gnl|my_center|LOCUS_06320 8999 8013 gene locus_tag LOCUS_06330 gene plsX 8999 8013 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858645.1 protein_id gnl|my_center|LOCUS_06330 9148 8999 gene locus_tag LOCUS_06340 gene rpmF 9148 8999 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001830121.1 protein_id gnl|my_center|LOCUS_06340 9487 9158 gene locus_tag LOCUS_06350 9487 9158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06350 9901 9488 gene locus_tag LOCUS_06360 gene ndk 9901 9488 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858685.1 protein_id gnl|my_center|LOCUS_06360 10246 9968 gene locus_tag LOCUS_06370 10246 9968 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858671.1 protein_id gnl|my_center|LOCUS_06370 <11048 10353 gene locus_tag LOCUS_06380 <11048 10353 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000655178.1:methionine adenosyltransferase >Feature sequence038 1140 373 gene locus_tag LOCUS_06390 1140 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 2828 1137 gene locus_tag LOCUS_06400 gene asnB 2828 1137 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009930749.1 protein_id gnl|my_center|LOCUS_06400 2869 3654 gene locus_tag LOCUS_06410 2869 3654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06410 4721 3651 gene locus_tag LOCUS_06420 4721 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06420 5299 4790 gene locus_tag LOCUS_06430 5299 4790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 6211 5309 gene locus_tag LOCUS_06440 6211 5309 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853222.1 protein_id gnl|my_center|LOCUS_06440 6755 6228 gene locus_tag LOCUS_06450 6755 6228 CDS product YqhA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852919.1 protein_id gnl|my_center|LOCUS_06450 7806 6748 gene locus_tag LOCUS_06460 7806 6748 CDS product aspartate-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852931.1 protein_id gnl|my_center|LOCUS_06460 8931 7816 gene locus_tag LOCUS_06470 gene flgR 8931 7816 CDS product fla regulon two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853038.1 protein_id gnl|my_center|LOCUS_06470 9708 9268 gene locus_tag LOCUS_06480 gene flgP 9708 9268 CDS product flagellar assembly lipoprotein FlgP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852972.1 protein_id gnl|my_center|LOCUS_06480 <10820 9752 gene locus_tag LOCUS_06490 <10820 9752 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001153763.1:DNA topoisomerase (ATP-hydrolyzing) subunit A >Feature sequence039 772 173 gene locus_tag LOCUS_06500 gene yihA 772 173 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852258.1 protein_id gnl|my_center|LOCUS_06500 1218 772 gene locus_tag LOCUS_06510 1218 772 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 1712 1218 gene locus_tag LOCUS_06520 1712 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 2197 1697 gene locus_tag LOCUS_06530 2197 1697 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858506.1 protein_id gnl|my_center|LOCUS_06530 2760 2194 gene locus_tag LOCUS_06540 gene hisB 2760 2194 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393530.1 protein_id gnl|my_center|LOCUS_06540 3439 2762 gene locus_tag LOCUS_06550 3439 2762 CDS product septal ring lytic transglycosylase RlpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852227.1 protein_id gnl|my_center|LOCUS_06550 4780 3443 gene locus_tag LOCUS_06560 4780 3443 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000044457.1 protein_id gnl|my_center|LOCUS_06560 5526 4777 gene locus_tag LOCUS_06570 5526 4777 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000469349.1 protein_id gnl|my_center|LOCUS_06570 5621 6937 gene locus_tag LOCUS_06580 5621 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06580 7071 7586 gene locus_tag LOCUS_06590 gene mog 7071 7586 CDS product molybdopterin adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879970.1 protein_id gnl|my_center|LOCUS_06590 7546 8367 gene locus_tag LOCUS_06600 7546 8367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 8696 8364 gene locus_tag LOCUS_06610 8696 8364 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853247.1 protein_id gnl|my_center|LOCUS_06610 9114 8686 gene locus_tag LOCUS_06620 gene rpiB 9114 8686 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546357.1 protein_id gnl|my_center|LOCUS_06620 9158 9934 gene locus_tag LOCUS_06630 9158 9934 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853163.1 protein_id gnl|my_center|LOCUS_06630 10062 >10358 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttcaatactccaaatgtatcggttaaat >Feature sequence040 640 1407 gene locus_tag LOCUS_06640 640 1407 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891854.1 protein_id gnl|my_center|LOCUS_06640 2667 1399 gene locus_tag LOCUS_06650 gene murA 2667 1399 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857102.1 protein_id gnl|my_center|LOCUS_06650 3533 2691 gene locus_tag LOCUS_06660 gene nfo 3533 2691 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015706116.1 protein_id gnl|my_center|LOCUS_06660 3900 3565 gene locus_tag LOCUS_06670 3900 3565 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001100349.1 protein_id gnl|my_center|LOCUS_06670 3953 4936 gene locus_tag LOCUS_06680 gene pheS 3953 4936 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852567.1 protein_id gnl|my_center|LOCUS_06680 4933 7179 gene locus_tag LOCUS_06690 gene pheT 4933 7179 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002915726.1 protein_id gnl|my_center|LOCUS_06690 7176 8474 gene locus_tag LOCUS_06700 gene aroA 7176 8474 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852577.1 protein_id gnl|my_center|LOCUS_06700 8464 9294 gene locus_tag LOCUS_06710 8464 9294 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852585.1 protein_id gnl|my_center|LOCUS_06710 >Feature sequence041 1086 490 gene locus_tag LOCUS_06720 1086 490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 1289 1089 gene locus_tag LOCUS_06730 1289 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2734 1340 gene locus_tag LOCUS_06740 2734 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06740 4732 2744 gene locus_tag LOCUS_06750 4732 2744 CDS product LPS-assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853186.1 protein_id gnl|my_center|LOCUS_06750 5162 4713 gene locus_tag LOCUS_06760 5162 4713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06760 6419 5163 gene locus_tag LOCUS_06770 gene purD 6419 5163 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853212.1 protein_id gnl|my_center|LOCUS_06770 6934 6446 gene locus_tag LOCUS_06780 6934 6446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06780 7107 6931 gene locus_tag LOCUS_06790 7107 6931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06790 7152 8138 gene locus_tag LOCUS_06800 7152 8138 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545202.1 protein_id gnl|my_center|LOCUS_06800 8227 9228 gene locus_tag LOCUS_06810 gene amrS 8227 9228 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881217.1 protein_id gnl|my_center|LOCUS_06810 9225 10016 gene locus_tag LOCUS_06820 gene amrB 9225 10016 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388207.1 protein_id gnl|my_center|LOCUS_06820 >Feature sequence042 27 1628 gene locus_tag LOCUS_06830 27 1628 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06830 1625 2320 gene locus_tag LOCUS_06840 1625 2320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 2313 3200 gene locus_tag LOCUS_06850 2313 3200 CDS product NAD(P)H-dependent glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859277.1 protein_id gnl|my_center|LOCUS_06850 3436 3197 gene locus_tag LOCUS_06860 3436 3197 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06860 3391 4098 gene locus_tag LOCUS_06870 3391 4098 CDS product TlyA family rRNA (cytidine-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001235220.1 protein_id gnl|my_center|LOCUS_06870 4091 5143 gene locus_tag LOCUS_06880 gene ispG 4091 5143 CDS product flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852250.1 protein_id gnl|my_center|LOCUS_06880 5249 5542 gene locus_tag LOCUS_06890 5249 5542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06890 5539 6939 gene locus_tag LOCUS_06900 5539 6939 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858532.1 protein_id gnl|my_center|LOCUS_06900 6936 8129 gene locus_tag LOCUS_06910 6936 8129 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209611625.1 protein_id gnl|my_center|LOCUS_06910 >Feature sequence043 <1 1114 gene locus_tag LOCUS_06920 <1 1114 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852639.1:methionine--tRNA ligase 1111 1992 gene locus_tag LOCUS_06930 1111 1992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852449.1 protein_id gnl|my_center|LOCUS_06930 1985 2545 gene locus_tag LOCUS_06940 1985 2545 CDS product NUDIX domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000119978.1 protein_id gnl|my_center|LOCUS_06940 2556 3920 gene locus_tag LOCUS_06950 gene pgmL 2556 3920 CDS product phosphoglucosamine mutase PgmL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891933.1 protein_id gnl|my_center|LOCUS_06950 4130 4978 gene locus_tag LOCUS_06960 4130 4978 CDS product DnaJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853234.1 protein_id gnl|my_center|LOCUS_06960 5021 5395 gene locus_tag LOCUS_06970 gene hspR 5021 5395 CDS product heat shock transcriptional regulator HspR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853230.1 protein_id gnl|my_center|LOCUS_06970 8299 5417 gene locus_tag LOCUS_06980 8299 5417 CDS product AsmA-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001042337.1 protein_id gnl|my_center|LOCUS_06980 8238 9170 gene locus_tag LOCUS_06990 gene mltG 8238 9170 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000208854.1 protein_id gnl|my_center|LOCUS_06990 >Feature sequence044 1970 1554 gene locus_tag LOCUS_07000 1970 1554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 2307 2092 gene locus_tag LOCUS_07010 2307 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 2843 2307 gene locus_tag LOCUS_07020 2843 2307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2884 3321 gene locus_tag LOCUS_07030 2884 3321 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 4808 3318 gene locus_tag LOCUS_07040 4808 3318 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864855.1 protein_id gnl|my_center|LOCUS_07040 5082 4801 gene locus_tag LOCUS_07050 5082 4801 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852501.1 protein_id gnl|my_center|LOCUS_07050 6415 5114 gene locus_tag LOCUS_07060 gene gltX 6415 5114 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002871824.1 protein_id gnl|my_center|LOCUS_07060 6983 6474 gene locus_tag LOCUS_07070 6983 6474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07070 7368 6994 gene locus_tag LOCUS_07080 7368 6994 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 9730 7523 gene locus_tag LOCUS_07090 9730 7523 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001048043.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence045 <1 1106 gene locus_tag LOCUS_07100 <1 1106 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164930713.1:cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB 1099 2034 gene locus_tag LOCUS_07110 1099 2034 CDS product glycosyl hydrolase family 8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880904.1 protein_id gnl|my_center|LOCUS_07110 2034 5480 gene locus_tag LOCUS_07120 2034 5480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 5474 6196 gene locus_tag LOCUS_07130 5474 6196 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880907.1 protein_id gnl|my_center|LOCUS_07130 6220 6510 gene locus_tag LOCUS_07140 6220 6510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 6507 8513 gene locus_tag LOCUS_07150 6507 8513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 <9627 8514 gene locus_tag LOCUS_07160 <9627 8514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880071.1:aldehyde dehydrogenase family protein >Feature sequence046 <1 904 gene locus_tag LOCUS_07170 <1 904 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010965932.1:carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit 914 2248 gene locus_tag LOCUS_07180 gene fslC 914 2248 CDS product rhizoferrin biosystnesis N-citrylornithine decarboxylase FslC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022882.1 protein_id gnl|my_center|LOCUS_07180 2253 4277 gene locus_tag LOCUS_07190 2253 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 4252 4869 gene locus_tag LOCUS_07200 4252 4869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 4866 5687 gene locus_tag LOCUS_07210 4866 5687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07210 6586 5684 gene locus_tag LOCUS_07220 6586 5684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 6639 7202 gene locus_tag LOCUS_07230 6639 7202 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880323.1 protein_id gnl|my_center|LOCUS_07230 7199 8341 gene locus_tag LOCUS_07240 7199 8341 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858667.1 protein_id gnl|my_center|LOCUS_07240 >Feature sequence047 456 64 gene locus_tag LOCUS_07250 456 64 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07250 1803 472 gene locus_tag LOCUS_07260 gene mnmE 1803 472 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853397.1 protein_id gnl|my_center|LOCUS_07260 2437 1772 gene locus_tag LOCUS_07270 2437 1772 CDS product Jag N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853389.1 protein_id gnl|my_center|LOCUS_07270 3954 2434 gene locus_tag LOCUS_07280 gene yidC 3954 2434 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853384.1 protein_id gnl|my_center|LOCUS_07280 4264 3947 gene locus_tag LOCUS_07290 gene yidD 4264 3947 CDS product membrane protein insertion efficiency factor YidD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853395.1 protein_id gnl|my_center|LOCUS_07290 4415 4221 gene locus_tag LOCUS_07300 4415 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 4651 4517 gene locus_tag LOCUS_07310 4651 4517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 5196 4696 gene locus_tag LOCUS_07320 gene raiA 5196 4696 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546709.1 protein_id gnl|my_center|LOCUS_07320 5644 5240 gene locus_tag LOCUS_07330 5644 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 6678 5641 gene locus_tag LOCUS_07340 6678 5641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 7367 6675 gene locus_tag LOCUS_07350 7367 6675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07350 8058 7345 gene locus_tag LOCUS_07360 8058 7345 CDS product pyrroline-5-carboxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858388.1 protein_id gnl|my_center|LOCUS_07360 8461 8078 gene locus_tag LOCUS_07370 gene fliW 8461 8078 CDS product flagellar assembly protein FliW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862609.1 protein_id gnl|my_center|LOCUS_07370 >Feature sequence048 <1 585 gene locus_tag LOCUS_07380 <1 585 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880567.1:SagB/ThcOx family dehydrogenase 1092 595 gene locus_tag LOCUS_07390 1092 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 1243 1503 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaatccccttagaatcgggtcatagttaaac 3511 1808 gene locus_tag LOCUS_07400 3511 1808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 4755 3511 gene locus_tag LOCUS_07410 4755 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 8649 4897 gene locus_tag LOCUS_07420 8649 4897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 9136 9046 gene locus_tag LOCUS_t00080 9136 9046 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence049 233 1249 gene locus_tag LOCUS_07430 gene yejK 233 1249 CDS product nucleoid-associated protein YejK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113787.1 protein_id gnl|my_center|LOCUS_07430 1242 2387 gene locus_tag LOCUS_07440 1242 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 3091 3384 gene locus_tag LOCUS_07450 3091 3384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07450 3952 3377 gene locus_tag LOCUS_07460 3952 3377 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864829.1 protein_id gnl|my_center|LOCUS_07460 4719 3961 gene locus_tag LOCUS_07470 gene xth 4719 3961 CDS product exodeoxyribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878084.1 protein_id gnl|my_center|LOCUS_07470 6098 4716 gene locus_tag LOCUS_07480 6098 4716 CDS product FAD-linked oxidase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852810.1 protein_id gnl|my_center|LOCUS_07480 6721 6095 gene locus_tag LOCUS_07490 6721 6095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 8763 6826 gene locus_tag LOCUS_07500 8763 6826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 >Feature sequence050 <1 665 gene locus_tag LOCUS_07510 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891851.1:response regulator 669 1181 gene locus_tag LOCUS_07520 669 1181 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002826355.1 protein_id gnl|my_center|LOCUS_07520 3007 1178 gene locus_tag LOCUS_07530 gene speA 3007 1178 CDS product biosynthetic arginine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891885.1 protein_id gnl|my_center|LOCUS_07530 4180 3017 gene locus_tag LOCUS_07540 gene hisS 4180 3017 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852541.1 protein_id gnl|my_center|LOCUS_07540 5016 4207 gene locus_tag LOCUS_07550 5016 4207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 5044 5829 gene locus_tag LOCUS_07560 5044 5829 CDS product TIGR00282 family metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583165.1 protein_id gnl|my_center|LOCUS_07560 5819 6445 gene locus_tag LOCUS_07570 5819 6445 CDS product 3-methyladenine DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000887243.1 protein_id gnl|my_center|LOCUS_07570 6442 7248 gene locus_tag LOCUS_07580 gene cas6 6442 7248 CDS product CRISPR system precrRNA processing endoribonuclease RAMP protein Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545643.1 protein_id gnl|my_center|LOCUS_07580 7238 8140 gene locus_tag LOCUS_07590 7238 8140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 >Feature sequence051 1305 610 gene locus_tag LOCUS_07600 1305 610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 2134 1280 gene locus_tag LOCUS_07610 2134 1280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 2276 3004 gene locus_tag LOCUS_07620 2276 3004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 2997 4721 gene locus_tag LOCUS_07630 2997 4721 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07630 4840 5238 gene locus_tag LOCUS_07640 4840 5238 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 5424 5753 gene locus_tag LOCUS_07650 5424 5753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 5795 6556 gene locus_tag LOCUS_07660 5795 6556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07660 6567 7337 gene locus_tag LOCUS_07670 6567 7337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 >Feature sequence052 1630 572 gene locus_tag LOCUS_07680 gene aroF 1630 572 CDS product 3-deoxy-7-phosphoheptulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964210.1 protein_id gnl|my_center|LOCUS_07680 1771 2517 gene locus_tag LOCUS_07690 1771 2517 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858535.1 protein_id gnl|my_center|LOCUS_07690 4139 2514 gene locus_tag LOCUS_07700 4139 2514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 6583 4136 gene locus_tag LOCUS_07710 gene glnD 6583 4136 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947447.1 protein_id gnl|my_center|LOCUS_07710 6631 7698 gene locus_tag LOCUS_07720 gene mqnE 6631 7698 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000346642.1 protein_id gnl|my_center|LOCUS_07720 8045 7689 gene locus_tag LOCUS_07730 8045 7689 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081498.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence053 452 1315 gene locus_tag LOCUS_07740 452 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07740 1404 1814 gene locus_tag LOCUS_07750 1404 1814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07750 2359 1826 gene locus_tag LOCUS_07760 gene infC 2359 1826 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851726.1 protein_id gnl|my_center|LOCUS_07760 4194 2356 gene locus_tag LOCUS_07770 gene thrS 4194 2356 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858701.1 protein_id gnl|my_center|LOCUS_07770 4422 4625 gene locus_tag LOCUS_07780 4422 4625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 4708 4633 gene locus_tag LOCUS_t00090 4708 4633 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 5148 4699 gene locus_tag LOCUS_07790 gene lspA 5148 4699 CDS product signal peptidase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000921378.1 protein_id gnl|my_center|LOCUS_07790 6467 5145 gene locus_tag LOCUS_07800 gene glmM 6467 5145 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002860288.1 protein_id gnl|my_center|LOCUS_07800 6557 6838 gene locus_tag LOCUS_07810 gene rpsT 6557 6838 CDS product 30S ribosomal protein S20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001273615.1 protein_id gnl|my_center|LOCUS_07810 6908 7975 gene locus_tag LOCUS_07820 gene prfA 6908 7975 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851189.1 protein_id gnl|my_center|LOCUS_07820 >Feature sequence054 720 421 gene locus_tag LOCUS_07830 720 421 CDS product AtpZ/AtpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852414.1 protein_id gnl|my_center|LOCUS_07830 1976 720 gene locus_tag LOCUS_07840 gene hemL 1976 720 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000421462.1 protein_id gnl|my_center|LOCUS_07840 2020 2301 gene locus_tag LOCUS_07850 gene gatC 2020 2301 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858734.1 protein_id gnl|my_center|LOCUS_07850 2311 3378 gene locus_tag LOCUS_07860 2311 3378 CDS product type IV pilus twitching motility protein PilT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942138.1 protein_id gnl|my_center|LOCUS_07860 3368 4378 gene locus_tag LOCUS_07870 gene queA 3368 4378 CDS product tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852279.1 protein_id gnl|my_center|LOCUS_07870 4837 4397 gene locus_tag LOCUS_07880 gene trxC 4837 4397 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480229.1 protein_id gnl|my_center|LOCUS_07880 7061 4893 gene locus_tag LOCUS_07890 7061 4893 CDS product endonuclease MutS2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891903.1 protein_id gnl|my_center|LOCUS_07890 7604 7065 gene locus_tag LOCUS_07900 7604 7065 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851622.1 protein_id gnl|my_center|LOCUS_07900 7882 7601 gene locus_tag LOCUS_07910 7882 7601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07910 >Feature sequence055 1712 486 gene locus_tag LOCUS_07920 1712 486 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852436.1 protein_id gnl|my_center|LOCUS_07920 2802 1702 gene locus_tag LOCUS_07930 2802 1702 CDS product quinone-dependent dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852597.1 protein_id gnl|my_center|LOCUS_07930 4181 2787 gene locus_tag LOCUS_07940 gene cysS 4181 2787 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000471359.1 protein_id gnl|my_center|LOCUS_07940 5071 4184 gene locus_tag LOCUS_07950 5071 4184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07950 5100 5474 gene locus_tag LOCUS_07960 5100 5474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 5604 7451 gene locus_tag LOCUS_07970 5604 7451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07970 >Feature sequence056 928 647 gene locus_tag LOCUS_07980 928 647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 2091 925 gene locus_tag LOCUS_07990 2091 925 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000967300.1 protein_id gnl|my_center|LOCUS_07990 2219 4414 gene locus_tag LOCUS_08000 2219 4414 CDS product EAL domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880722.1 protein_id gnl|my_center|LOCUS_08000 5116 4415 gene locus_tag LOCUS_08010 gene cysE 5116 4415 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056695.1 protein_id gnl|my_center|LOCUS_08010 5672 5100 gene locus_tag LOCUS_08020 gene tmk 5672 5100 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852526.1 protein_id gnl|my_center|LOCUS_08020 6136 5663 gene locus_tag LOCUS_08030 gene coaD 6136 5663 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169234.1 protein_id gnl|my_center|LOCUS_08030 6650 6129 gene locus_tag LOCUS_08040 6650 6129 CDS product UbiX family flavin prenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869594.1 protein_id gnl|my_center|LOCUS_08040 6771 6920 gene locus_tag LOCUS_08050 6771 6920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08050 >Feature sequence057 <1 719 gene locus_tag LOCUS_08060 <1 719 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002854067.1:succinyl-diaminopimelate desuccinylase 716 922 gene locus_tag LOCUS_08070 716 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08070 1639 914 gene locus_tag LOCUS_08080 1639 914 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08080 2373 1639 gene locus_tag LOCUS_08090 2373 1639 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546205.1 protein_id gnl|my_center|LOCUS_08090 2481 3107 gene locus_tag LOCUS_08100 2481 3107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 6165 3118 gene locus_tag LOCUS_08110 6165 3118 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804147.1 protein_id gnl|my_center|LOCUS_08110 7254 6169 gene locus_tag LOCUS_08120 7254 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08120 >Feature sequence058 104 709 gene locus_tag LOCUS_08130 104 709 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 protein_id gnl|my_center|LOCUS_08130 1099 695 gene locus_tag LOCUS_08140 1099 695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08140 1214 2599 gene locus_tag LOCUS_08150 gene htrA 1214 2599 CDS product serine protease HtrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853235.1 protein_id gnl|my_center|LOCUS_08150 3291 2728 gene locus_tag LOCUS_08160 3291 2728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 4050 3307 gene locus_tag LOCUS_08170 gene mreC 4050 3307 CDS product rod shape-determining protein MreC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001213296.1 protein_id gnl|my_center|LOCUS_08170 5068 4043 gene locus_tag LOCUS_08180 5068 4043 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891850.1 protein_id gnl|my_center|LOCUS_08180 6275 5058 gene locus_tag LOCUS_08190 gene clpX 6275 5058 CDS product ATP-dependent Clp protease ATP-binding subunit ClpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891849.1 protein_id gnl|my_center|LOCUS_08190 7020 6259 gene locus_tag LOCUS_08200 gene lpxA 7020 6259 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851756.1 protein_id gnl|my_center|LOCUS_08200 7594 7154 gene locus_tag LOCUS_08210 gene fabZ 7594 7154 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857452.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence059 1724 669 gene locus_tag LOCUS_08220 gene truD 1724 669 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001052415.1 protein_id gnl|my_center|LOCUS_08220 2407 1751 gene locus_tag LOCUS_08230 2407 1751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 3238 2417 gene locus_tag LOCUS_08240 3238 2417 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130232873.1 protein_id gnl|my_center|LOCUS_08240 3693 3235 gene locus_tag LOCUS_08250 3693 3235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 4240 3731 gene locus_tag LOCUS_08260 4240 3731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 4954 4250 gene locus_tag LOCUS_08270 4954 4250 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880390.1 protein_id gnl|my_center|LOCUS_08270 5492 4929 gene locus_tag LOCUS_08280 5492 4929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08280 6367 5540 gene locus_tag LOCUS_08290 6367 5540 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933695.1 protein_id gnl|my_center|LOCUS_08290 7326 6367 gene locus_tag LOCUS_08300 7326 6367 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933696.1 protein_id gnl|my_center|LOCUS_08300 >Feature sequence060 1676 366 gene locus_tag LOCUS_08310 1676 366 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 2357 1686 gene locus_tag LOCUS_08320 2357 1686 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879872.1 protein_id gnl|my_center|LOCUS_08320 5018 2361 gene locus_tag LOCUS_08330 5018 2361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08330 6156 5107 gene locus_tag LOCUS_08340 6156 5107 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08340 6499 6335 gene locus_tag LOCUS_08350 6499 6335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08350 6894 6550 gene locus_tag LOCUS_08360 6894 6550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08360 >Feature sequence061 1034 402 gene locus_tag LOCUS_08370 gene gmk 1034 402 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000551230.1 protein_id gnl|my_center|LOCUS_08370 2028 1036 gene locus_tag LOCUS_08380 2028 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 2076 2597 gene locus_tag LOCUS_08390 2076 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 3354 2590 gene locus_tag LOCUS_08400 gene fliR 3354 2590 CDS product flagellar biosynthetic protein FliR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852712.1 protein_id gnl|my_center|LOCUS_08400 3983 3345 gene locus_tag LOCUS_08410 3983 3345 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891917.1 protein_id gnl|my_center|LOCUS_08410 5512 3995 gene locus_tag LOCUS_08420 5512 3995 CDS product RNA-guided endonuclease TnpB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930721.1 protein_id gnl|my_center|LOCUS_08420 5759 5568 gene locus_tag LOCUS_08430 5759 5568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 6875 5949 gene locus_tag LOCUS_08440 gene tsf 6875 5949 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003384678.1 protein_id gnl|my_center|LOCUS_08440 >Feature sequence062 869 198 gene locus_tag LOCUS_08450 869 198 CDS product flagellar basal body rod modification protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002805290.1 protein_id gnl|my_center|LOCUS_08450 2279 909 gene locus_tag LOCUS_08460 2279 909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 2360 4171 gene locus_tag LOCUS_08470 gene typA 2360 4171 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002859745.1 protein_id gnl|my_center|LOCUS_08470 4265 5656 gene locus_tag LOCUS_08480 4265 5656 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789589.1 protein_id gnl|my_center|LOCUS_08480 5653 6699 gene locus_tag LOCUS_08490 gene czcB 5653 6699 CDS product CzcB/NccB family metal efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880415.1 protein_id gnl|my_center|LOCUS_08490 >Feature sequence063 <1 595 gene locus_tag LOCUS_08500 <1 595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002865443.1:ferrous iron transport protein B 652 1686 gene locus_tag LOCUS_08510 652 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 2046 4487 gene locus_tag LOCUS_08520 2046 4487 CDS product ribonucleoside-diphosphate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002865087.1 protein_id gnl|my_center|LOCUS_08520 4500 5540 gene locus_tag LOCUS_08530 4500 5540 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000453999.1 protein_id gnl|my_center|LOCUS_08530 5558 5716 gene locus_tag LOCUS_08540 5558 5716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08540 5685 6101 gene locus_tag LOCUS_08550 5685 6101 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921681.1 protein_id gnl|my_center|LOCUS_08550 6103 6657 gene locus_tag LOCUS_08560 6103 6657 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880571.1 protein_id gnl|my_center|LOCUS_08560 >Feature sequence064 1431 445 gene locus_tag LOCUS_08570 gene trpD 1431 445 CDS product anthranilate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546835.1 protein_id gnl|my_center|LOCUS_08570 2346 1441 gene locus_tag LOCUS_08580 gene ppk2 2346 1441 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_08580 3221 2358 gene locus_tag LOCUS_08590 3221 2358 CDS product hexaprenyl-diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864642.1 protein_id gnl|my_center|LOCUS_08590 3589 3218 gene locus_tag LOCUS_08600 3589 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 3848 3582 gene locus_tag LOCUS_08610 3848 3582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08610 4275 3904 gene locus_tag LOCUS_08620 gene msrB 4275 3904 CDS product peptide-methionine (R)-S-oxide reductase MsrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057056.1 protein_id gnl|my_center|LOCUS_08620 4325 4894 gene locus_tag LOCUS_08630 gene recR 4325 4894 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853214.1 protein_id gnl|my_center|LOCUS_08630 5375 4878 gene locus_tag LOCUS_08640 5375 4878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 5879 5427 gene locus_tag LOCUS_08650 5879 5427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 >Feature sequence065 2113 638 gene locus_tag LOCUS_08660 2113 638 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611139.1 protein_id gnl|my_center|LOCUS_08660 2601 2080 gene locus_tag LOCUS_08670 gene def 2601 2080 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001185845.1 protein_id gnl|my_center|LOCUS_08670 3593 2601 gene locus_tag LOCUS_08680 3593 2601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 4183 3593 gene locus_tag LOCUS_08690 gene clpP 4183 3593 CDS product ATP-dependent Clp endopeptidase proteolytic subunit ClpP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002806309.1 protein_id gnl|my_center|LOCUS_08690 5469 4183 gene locus_tag LOCUS_08700 gene tig 5469 4183 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001047731.1 protein_id gnl|my_center|LOCUS_08700 5532 6110 gene locus_tag LOCUS_08710 gene folE 5532 6110 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851990.1 protein_id gnl|my_center|LOCUS_08710 >Feature sequence066 <1 889 gene locus_tag LOCUS_08720 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858133.1:ribonuclease Y 899 1480 gene locus_tag LOCUS_08730 899 1480 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852433.1 protein_id gnl|my_center|LOCUS_08730 2036 1458 gene locus_tag LOCUS_08740 2036 1458 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966112.1 protein_id gnl|my_center|LOCUS_08740 2988 2038 gene locus_tag LOCUS_08750 2988 2038 CDS product TIGR01212 family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880377.1 protein_id gnl|my_center|LOCUS_08750 4377 3040 gene locus_tag LOCUS_08760 gene purF 4377 3040 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851896.1 protein_id gnl|my_center|LOCUS_08760 5149 4388 gene locus_tag LOCUS_08770 gene dapB 5149 4388 CDS product 4-hydroxy-tetrahydrodipicolinate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851754.1 protein_id gnl|my_center|LOCUS_08770 6054 5146 gene locus_tag LOCUS_08780 gene trxB 6054 5146 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851648.1 protein_id gnl|my_center|LOCUS_08780 6444 6064 gene locus_tag LOCUS_08790 6444 6064 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 6818 6495 gene locus_tag LOCUS_08800 gene trxA 6818 6495 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000020199.1 protein_id gnl|my_center|LOCUS_08800 >Feature sequence067 1159 200 gene locus_tag LOCUS_08810 1159 200 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_08810 2436 1159 gene locus_tag LOCUS_08820 2436 1159 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931920.1 protein_id gnl|my_center|LOCUS_08820 2693 2460 gene locus_tag LOCUS_08830 2693 2460 CDS product ComEA family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853093.1 protein_id gnl|my_center|LOCUS_08830 3872 2703 gene locus_tag LOCUS_08840 gene ugd 3872 2703 CDS product UDP-glucose 6-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000704874.1 protein_id gnl|my_center|LOCUS_08840 4299 3901 gene locus_tag LOCUS_08850 4299 3901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 4721 4281 gene locus_tag LOCUS_08860 4721 4281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851686.1 protein_id gnl|my_center|LOCUS_08860 5130 4711 gene locus_tag LOCUS_08870 5130 4711 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08870 6368 5127 gene locus_tag LOCUS_08880 6368 5127 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851458.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence068 364 1497 gene locus_tag LOCUS_08890 364 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08890 1508 2095 gene locus_tag LOCUS_08900 1508 2095 CDS product TRAP transporter small permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483276.1 protein_id gnl|my_center|LOCUS_08900 2095 3387 gene locus_tag LOCUS_08910 2095 3387 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_08910 3390 4118 gene locus_tag LOCUS_08920 3390 4118 CDS product DUF72 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880570.1 protein_id gnl|my_center|LOCUS_08920 4698 4156 gene locus_tag LOCUS_08930 4698 4156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08930 4888 4727 gene locus_tag LOCUS_08940 4888 4727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 5666 4899 gene locus_tag LOCUS_08950 5666 4899 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010938969.1 protein_id gnl|my_center|LOCUS_08950 6612 5728 gene locus_tag LOCUS_08960 gene htpX 6612 5728 CDS product protease HtpX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072672.1 protein_id gnl|my_center|LOCUS_08960 >Feature sequence069 861 226 gene locus_tag LOCUS_08970 861 226 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003433829.1 protein_id gnl|my_center|LOCUS_08970 934 1323 gene locus_tag LOCUS_08980 934 1323 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2572 1310 gene locus_tag LOCUS_08990 2572 1310 CDS product KamA family radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881057.1 protein_id gnl|my_center|LOCUS_08990 4308 2569 gene locus_tag LOCUS_09000 4308 2569 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09000 4936 4277 gene locus_tag LOCUS_09010 4936 4277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09010 5771 4995 gene locus_tag LOCUS_09020 5771 4995 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880102.1 protein_id gnl|my_center|LOCUS_09020 5870 6169 gene locus_tag LOCUS_09030 5870 6169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 <6750 6162 gene locus_tag LOCUS_09040 <6750 6162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001204347.1:menaquinone biosynthesis decarboxylase >Feature sequence070 2433 565 gene locus_tag LOCUS_09050 gene tkt 2433 565 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858130.1 protein_id gnl|my_center|LOCUS_09050 3281 2433 gene locus_tag LOCUS_09060 3281 2433 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851379.1 protein_id gnl|my_center|LOCUS_09060 4178 3282 gene locus_tag LOCUS_09070 4178 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 4462 4175 gene locus_tag LOCUS_09080 4462 4175 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851172.1 protein_id gnl|my_center|LOCUS_09080 4836 4462 gene locus_tag LOCUS_09090 4836 4462 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011948189.1 protein_id gnl|my_center|LOCUS_09090 5181 4846 gene locus_tag LOCUS_09100 5181 4846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 5698 5240 gene locus_tag LOCUS_09110 5698 5240 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09110 5946 5698 gene locus_tag LOCUS_09120 5946 5698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence071 1450 74 gene locus_tag LOCUS_09130 1450 74 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853317.1 protein_id gnl|my_center|LOCUS_09130 2089 1451 gene locus_tag LOCUS_09140 2089 1451 CDS product DedA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000393406.1 protein_id gnl|my_center|LOCUS_09140 3285 2086 gene locus_tag LOCUS_09150 gene trpB 3285 2086 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880421.1 protein_id gnl|my_center|LOCUS_09150 3333 3572 gene locus_tag LOCUS_09160 3333 3572 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 4111 3584 gene locus_tag LOCUS_09170 4111 3584 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010972163.1 protein_id gnl|my_center|LOCUS_09170 5100 4126 gene locus_tag LOCUS_09180 5100 4126 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256684.1 protein_id gnl|my_center|LOCUS_09180 5663 5100 gene locus_tag LOCUS_09190 gene efp 5663 5100 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000974265.1 protein_id gnl|my_center|LOCUS_09190 <6671 5675 gene locus_tag LOCUS_09200 <6671 5675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852643.1:phosphoglycerate dehydrogenase >Feature sequence072 726 1343 gene locus_tag LOCUS_09210 gene recO 726 1343 CDS product recombination protein RecO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851895.1 protein_id gnl|my_center|LOCUS_09210 1353 2492 gene locus_tag LOCUS_09220 gene lhgO 1353 2492 CDS product L-2-hydroxyglutarate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958479.1 protein_id gnl|my_center|LOCUS_09220 2489 2674 gene locus_tag LOCUS_09230 2489 2674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09230 2671 5073 gene locus_tag LOCUS_09240 2671 5073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 5077 5553 gene locus_tag LOCUS_09250 5077 5553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence073 499 17 gene locus_tag LOCUS_09260 499 17 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 707 1756 gene locus_tag LOCUS_09270 707 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09270 1744 2265 gene locus_tag LOCUS_09280 1744 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09280 2258 5812 gene locus_tag LOCUS_09290 2258 5812 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203140.1 protein_id gnl|my_center|LOCUS_09290 >Feature sequence074 1222 215 gene locus_tag LOCUS_09300 1222 215 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856867.1 protein_id gnl|my_center|LOCUS_09300 1532 5017 gene locus_tag LOCUS_09310 1532 5017 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389174.1 protein_id gnl|my_center|LOCUS_09310 5007 5966 gene locus_tag LOCUS_09320 5007 5966 CDS product hydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010939562.1 protein_id gnl|my_center|LOCUS_09320 5963 6391 gene locus_tag LOCUS_09330 gene nuoB 5963 6391 CDS product NADH-quinone oxidoreductase subunit NuoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389176.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence075 <1 885 gene locus_tag LOCUS_09340 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064496844.1:phosphoribosylglycinamide formyltransferase 2 1103 1441 gene locus_tag LOCUS_09350 gene glnB 1103 1441 CDS product nitrogen regulatory protein P-II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005308848.1 protein_id gnl|my_center|LOCUS_09350 1466 2638 gene locus_tag LOCUS_09360 1466 2638 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083240.1 protein_id gnl|my_center|LOCUS_09360 4626 2644 gene locus_tag LOCUS_09370 4626 2644 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_09370 4704 5171 gene locus_tag LOCUS_09380 4704 5171 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250006.1 protein_id gnl|my_center|LOCUS_09380 5604 5149 gene locus_tag LOCUS_09390 gene smpB 5604 5149 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852861.1 protein_id gnl|my_center|LOCUS_09390 <6201 5601 gene locus_tag LOCUS_09400 <6201 5601 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002851769.1:glutamate 5-kinase >Feature sequence076 2174 579 gene locus_tag LOCUS_09410 2174 579 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_09410 2406 2164 gene locus_tag LOCUS_09420 2406 2164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09420 2959 2576 gene locus_tag LOCUS_09430 2959 2576 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249480.1 protein_id gnl|my_center|LOCUS_09430 3066 3395 gene locus_tag LOCUS_09440 3066 3395 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09440 3483 4259 gene locus_tag LOCUS_09450 3483 4259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 4249 4932 gene locus_tag LOCUS_09460 gene rnc 4249 4932 CDS product ribonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851153.1 protein_id gnl|my_center|LOCUS_09460 4936 6009 gene locus_tag LOCUS_09470 gene aroC 4936 6009 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001094036.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence077 859 200 gene locus_tag LOCUS_09480 859 200 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852054.1 protein_id gnl|my_center|LOCUS_09480 1904 861 gene locus_tag LOCUS_09490 gene rseP 1904 861 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002934663.1 protein_id gnl|my_center|LOCUS_09490 2491 1901 gene locus_tag LOCUS_09500 gene pgsA 2491 1901 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002812871.1 protein_id gnl|my_center|LOCUS_09500 3271 2495 gene locus_tag LOCUS_09510 3271 2495 CDS product enoyl-ACP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001014495.1 protein_id gnl|my_center|LOCUS_09510 4147 3281 gene locus_tag LOCUS_09520 gene dapA 4147 3281 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852574.1 protein_id gnl|my_center|LOCUS_09520 5369 4179 gene locus_tag LOCUS_09530 5369 4179 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853329.1 protein_id gnl|my_center|LOCUS_09530 <6129 5372 gene locus_tag LOCUS_09540 <6129 5372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000588147.1:preprotein translocase subunit SecA >Feature sequence078 <1 677 gene locus_tag LOCUS_09550 <1 677 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858730.1:lipid-A-disaccharide synthase 699 1187 gene locus_tag LOCUS_09560 gene greA 699 1187 CDS product transcription elongation factor GreA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001031337.1 protein_id gnl|my_center|LOCUS_09560 1204 1632 gene locus_tag LOCUS_09570 gene dut 1204 1632 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002682351.1 protein_id gnl|my_center|LOCUS_09570 1641 2618 gene locus_tag LOCUS_09580 gene argC 1641 2618 CDS product N-acetyl-gamma-glutamyl-phosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881228.1 protein_id gnl|my_center|LOCUS_09580 2608 3303 gene locus_tag LOCUS_09590 2608 3303 CDS product UDP-2,3-diacylglucosamine diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000894935.1 protein_id gnl|my_center|LOCUS_09590 3293 4255 gene locus_tag LOCUS_09600 3293 4255 CDS product chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851778.1 protein_id gnl|my_center|LOCUS_09600 >Feature sequence079 281 2404 gene locus_tag LOCUS_09610 gene pglB 281 2404 CDS product undecaprenyl-diphosphooligosaccharide--protein glycotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852780.1 protein_id gnl|my_center|LOCUS_09610 2401 2991 gene locus_tag LOCUS_09620 2401 2991 CDS product sugar transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107355.1 protein_id gnl|my_center|LOCUS_09620 2993 4069 gene locus_tag LOCUS_09630 gene pglE 2993 4069 CDS product UDP-N-acetylbacillosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852877.1 protein_id gnl|my_center|LOCUS_09630 4047 5780 gene locus_tag LOCUS_09640 gene pglF 4047 5780 CDS product UDP-N-acetylglucosamine 4,6-dehydratase (configuration-retaining) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858054.1 protein_id gnl|my_center|LOCUS_09640 >Feature sequence080 1921 1382 gene locus_tag LOCUS_09650 gene grpE 1921 1382 CDS product nucleotide exchange factor GrpE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000650844.1 protein_id gnl|my_center|LOCUS_09650 3115 2114 gene locus_tag LOCUS_09660 3115 2114 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856044.1 protein_id gnl|my_center|LOCUS_09660 4116 3124 gene locus_tag LOCUS_09670 gene ruvB 4116 3124 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856258.1 protein_id gnl|my_center|LOCUS_09670 4893 4117 gene locus_tag LOCUS_09680 gene panB 4893 4117 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000062669.1 protein_id gnl|my_center|LOCUS_09680 4947 5666 gene locus_tag LOCUS_09690 gene trpA 4947 5666 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082732.1 protein_id gnl|my_center|LOCUS_09690 >Feature sequence081 1498 77 gene locus_tag LOCUS_09700 gene gatB 1498 77 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858123.1 protein_id gnl|my_center|LOCUS_09700 2722 1514 gene locus_tag LOCUS_09710 gene ilvA 2722 1514 CDS product threonine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858758.1 protein_id gnl|my_center|LOCUS_09710 3165 2719 gene locus_tag LOCUS_09720 3165 2719 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393898.1 protein_id gnl|my_center|LOCUS_09720 3269 3544 gene locus_tag LOCUS_09730 3269 3544 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003701976.1 protein_id gnl|my_center|LOCUS_09730 3584 3669 gene locus_tag LOCUS_t00100 3584 3669 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3728 4027 gene locus_tag LOCUS_09740 3728 4027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09740 5853 4024 gene locus_tag LOCUS_09750 5853 4024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09750 >Feature sequence082 290 511 gene locus_tag LOCUS_09760 290 511 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857949.1 protein_id gnl|my_center|LOCUS_09760 513 947 gene locus_tag LOCUS_09770 513 947 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000912676.1 protein_id gnl|my_center|LOCUS_09770 947 2143 gene locus_tag LOCUS_09780 947 2143 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858151.1 protein_id gnl|my_center|LOCUS_09780 3402 2140 gene locus_tag LOCUS_09790 3402 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 4045 3494 gene locus_tag LOCUS_09800 4045 3494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09800 4106 5221 gene locus_tag LOCUS_09810 gene nspC 4106 5221 CDS product carboxynorspermidine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011461405.1 protein_id gnl|my_center|LOCUS_09810 >Feature sequence083 390 118 gene locus_tag LOCUS_09820 390 118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 542 1501 gene locus_tag LOCUS_09830 542 1501 CDS product SLAC1 anion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_049788774.1 protein_id gnl|my_center|LOCUS_09830 1502 2005 gene locus_tag LOCUS_09840 1502 2005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 2015 3187 gene locus_tag LOCUS_09850 2015 3187 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932765.1 protein_id gnl|my_center|LOCUS_09850 3931 3188 gene locus_tag LOCUS_09860 gene cobB 3931 3188 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762545.1 protein_id gnl|my_center|LOCUS_09860 3984 4235 gene locus_tag LOCUS_09870 3984 4235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 4690 4232 gene locus_tag LOCUS_09880 4690 4232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 5308 4727 gene locus_tag LOCUS_09890 5308 4727 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858481.1 protein_id gnl|my_center|LOCUS_09890 5580 5320 gene locus_tag LOCUS_09900 5580 5320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 >Feature sequence084 940 53 gene locus_tag LOCUS_09910 940 53 CDS product CoA ester lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013222029.1 protein_id gnl|my_center|LOCUS_09910 1308 937 gene locus_tag LOCUS_09920 1308 937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852485.1 protein_id gnl|my_center|LOCUS_09920 1386 2240 gene locus_tag LOCUS_09930 gene folD 1386 2240 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864845.1 protein_id gnl|my_center|LOCUS_09930 2237 3202 gene locus_tag LOCUS_09940 gene lepB 2237 3202 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852457.1 protein_id gnl|my_center|LOCUS_09940 3202 3861 gene locus_tag LOCUS_09950 3202 3861 CDS product site-2 protease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001159394.1 protein_id gnl|my_center|LOCUS_09950 4948 3866 gene locus_tag LOCUS_09960 gene dnaJ 4948 3866 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000423848.1 protein_id gnl|my_center|LOCUS_09960 5681 5409 gene locus_tag LOCUS_09970 5681 5409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09970 >Feature sequence085 1704 1141 gene locus_tag LOCUS_09980 1704 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09980 1748 2659 gene locus_tag LOCUS_09990 gene rsmH 1748 2659 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891880.1 protein_id gnl|my_center|LOCUS_09990 2652 2927 gene locus_tag LOCUS_10000 2652 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence086 1086 775 gene locus_tag LOCUS_10010 1086 775 CDS product FlhB-like flagellar biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001044050.1 protein_id gnl|my_center|LOCUS_10010 1537 1064 gene locus_tag LOCUS_10020 gene thpR 1537 1064 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871092.1 protein_id gnl|my_center|LOCUS_10020 1743 1534 gene locus_tag LOCUS_10030 1743 1534 CDS product DUF2905 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545707.1 protein_id gnl|my_center|LOCUS_10030 1803 3080 gene locus_tag LOCUS_10040 gene leuC 1803 3080 CDS product 3-isopropylmalate dehydratase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583552.1 protein_id gnl|my_center|LOCUS_10040 3577 3116 gene locus_tag LOCUS_10050 3577 3116 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 3649 4617 gene locus_tag LOCUS_10060 3649 4617 CDS product agmatine/peptidylarginine deiminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000827275.1 protein_id gnl|my_center|LOCUS_10060 4592 5281 gene locus_tag LOCUS_10070 4592 5281 CDS product YaaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853346.1 protein_id gnl|my_center|LOCUS_10070 >Feature sequence087 1030 65 gene locus_tag LOCUS_10080 1030 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1965 1027 gene locus_tag LOCUS_10090 gene csd1 1965 1027 CDS product peptidoglycan DD-metalloendopeptidase Csd1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000231086.1 protein_id gnl|my_center|LOCUS_10090 2792 2124 gene locus_tag LOCUS_10100 gene purQ 2792 2124 CDS product phosphoribosylformylglycinamidine synthase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858528.1 protein_id gnl|my_center|LOCUS_10100 3031 2789 gene locus_tag LOCUS_10110 gene purS 3031 2789 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858611.1 protein_id gnl|my_center|LOCUS_10110 3735 3028 gene locus_tag LOCUS_10120 3735 3028 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858572.1 protein_id gnl|my_center|LOCUS_10120 5013 3745 gene locus_tag LOCUS_10130 5013 3745 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856815.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence088 <1 853 gene locus_tag LOCUS_10140 <1 853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853162.1:4-hydroxythreonine-4-phosphate dehydrogenase 913 1749 gene locus_tag LOCUS_10150 913 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10150 2451 1894 gene locus_tag LOCUS_10160 2451 1894 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864641.1 protein_id gnl|my_center|LOCUS_10160 3281 2448 gene locus_tag LOCUS_10170 3281 2448 CDS product 2-oxoglutarate ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000885323.1 protein_id gnl|my_center|LOCUS_10170 4440 3295 gene locus_tag LOCUS_10180 4440 3295 CDS product 2-oxoglutarate synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858560.1 protein_id gnl|my_center|LOCUS_10180 4733 4440 gene locus_tag LOCUS_10190 4733 4440 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851088.1 protein_id gnl|my_center|LOCUS_10190 >Feature sequence089 248 172 gene locus_tag LOCUS_t00110 248 172 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 614 273 gene locus_tag LOCUS_10200 gene acpS 614 273 CDS product holo-ACP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579175.1 protein_id gnl|my_center|LOCUS_10200 1123 611 gene locus_tag LOCUS_10210 gene fliL 1123 611 CDS product flagellar basal body-associated protein FliL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002780442.1 protein_id gnl|my_center|LOCUS_10210 1208 1951 gene locus_tag LOCUS_10220 1208 1951 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004596488.1 protein_id gnl|my_center|LOCUS_10220 3063 1948 gene locus_tag LOCUS_10230 gene ftsZ 3063 1948 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852071.1 protein_id gnl|my_center|LOCUS_10230 4397 3078 gene locus_tag LOCUS_10240 gene ftsA 4397 3078 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891881.1 protein_id gnl|my_center|LOCUS_10240 >Feature sequence090 293 1594 gene locus_tag LOCUS_10250 gene rimO 293 1594 CDS product 30S ribosomal protein S12 methylthiotransferase RimO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851299.1 protein_id gnl|my_center|LOCUS_10250 1587 2561 gene locus_tag LOCUS_10260 gene tilS 1587 2561 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851521.1 protein_id gnl|my_center|LOCUS_10260 2504 3199 gene locus_tag LOCUS_10270 2504 3199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10270 3237 3313 gene locus_tag LOCUS_t00120 3237 3313 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 3319 3394 gene locus_tag LOCUS_t00130 3319 3394 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 3517 4737 gene locus_tag LOCUS_10280 3517 4737 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856962.1 protein_id gnl|my_center|LOCUS_10280 5030 4734 gene locus_tag LOCUS_10290 5030 4734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 >Feature sequence091 65 937 gene locus_tag LOCUS_10300 gene moaA 65 937 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002868437.1 protein_id gnl|my_center|LOCUS_10300 939 1139 gene locus_tag LOCUS_10310 939 1139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 1132 1926 gene locus_tag LOCUS_10320 1132 1926 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943708.1 protein_id gnl|my_center|LOCUS_10320 1951 2343 gene locus_tag LOCUS_10330 1951 2343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 2340 2696 gene locus_tag LOCUS_10340 2340 2696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 2745 3389 gene locus_tag LOCUS_10350 gene dccR 2745 3389 CDS product two-component system response regulator DccR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853205.1 protein_id gnl|my_center|LOCUS_10350 3379 4458 gene locus_tag LOCUS_10360 gene dccS 3379 4458 CDS product two-component system sensor histidine kinase DccS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853219.1 protein_id gnl|my_center|LOCUS_10360 4500 4874 gene locus_tag LOCUS_10370 4500 4874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10370 >Feature sequence092 1767 940 gene locus_tag LOCUS_10380 1767 940 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858573.1 protein_id gnl|my_center|LOCUS_10380 1867 2109 gene locus_tag LOCUS_10390 1867 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2841 2263 gene locus_tag LOCUS_10400 2841 2263 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10400 3923 2832 gene locus_tag LOCUS_10410 3923 2832 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10410 >Feature sequence093 <1 841 gene locus_tag LOCUS_10420 <1 841 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852163.1:signal recognition particle protein 920 1171 gene locus_tag LOCUS_10430 gene rpsP 920 1171 CDS product 30S ribosomal protein S16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000216125.1 protein_id gnl|my_center|LOCUS_10430 1171 1413 gene locus_tag LOCUS_10440 1171 1413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10440 1403 1927 gene locus_tag LOCUS_10450 gene rimM 1403 1927 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001261987.1 protein_id gnl|my_center|LOCUS_10450 1924 2577 gene locus_tag LOCUS_10460 gene trmD 1924 2577 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000672977.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence094 50 1123 gene locus_tag LOCUS_10470 gene fbaA 50 1123 CDS product class II fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852272.1 protein_id gnl|my_center|LOCUS_10470 1123 1965 gene locus_tag LOCUS_10480 1123 1965 CDS product 1-aminocyclopropane-1-carboxylate deaminase/D-cysteine desulfhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021450949.1 protein_id gnl|my_center|LOCUS_10480 2081 3928 gene locus_tag LOCUS_10490 2081 3928 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 3925 4755 gene locus_tag LOCUS_10500 3925 4755 CDS product NADH-quinone oxidoreductase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937740.1 protein_id gnl|my_center|LOCUS_10500 >Feature sequence095 236 1267 gene locus_tag LOCUS_10510 236 1267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 1260 2180 gene locus_tag LOCUS_10520 1260 2180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 2182 3318 gene locus_tag LOCUS_10530 2182 3318 CDS product class I SAM-dependent rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881355.1 protein_id gnl|my_center|LOCUS_10530 3398 3529 gene locus_tag LOCUS_10540 3398 3529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10540 3532 4008 gene locus_tag LOCUS_10550 3532 4008 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence096 612 7 gene locus_tag LOCUS_10560 612 7 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852828.1 protein_id gnl|my_center|LOCUS_10560 1541 612 gene locus_tag LOCUS_10570 1541 612 CDS product tRNA-dihydrouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851926.1 protein_id gnl|my_center|LOCUS_10570 2439 1516 gene locus_tag LOCUS_10580 2439 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 2786 2436 gene locus_tag LOCUS_10590 gene dksA 2786 2436 CDS product molecular chaperone DnaK suppressor DksA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851949.1 protein_id gnl|my_center|LOCUS_10590 3229 2798 gene locus_tag LOCUS_10600 3229 2798 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002869860.1 protein_id gnl|my_center|LOCUS_10600 3831 3163 gene locus_tag LOCUS_10610 3831 3163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 4677 3832 gene locus_tag LOCUS_10620 gene accD 4677 3832 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851791.1 protein_id gnl|my_center|LOCUS_10620 >Feature sequence097 1485 316 gene locus_tag LOCUS_10630 1485 316 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10630 2648 1482 gene locus_tag LOCUS_10640 2648 1482 CDS product acetylornithine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082331.1 protein_id gnl|my_center|LOCUS_10640 3155 2658 gene locus_tag LOCUS_10650 3155 2658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10650 3214 4707 gene locus_tag LOCUS_10660 3214 4707 CDS product SulP family inorganic anion transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022095.1 protein_id gnl|my_center|LOCUS_10660 >Feature sequence098 1489 968 gene locus_tag LOCUS_10670 1489 968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10670 2526 1477 gene locus_tag LOCUS_10680 2526 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10680 3200 2535 gene locus_tag LOCUS_10690 3200 2535 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_10690 4390 3197 gene locus_tag LOCUS_10700 4390 3197 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858475.1 protein_id gnl|my_center|LOCUS_10700 >Feature sequence099 468 791 gene locus_tag LOCUS_10710 468 791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10710 776 2557 gene locus_tag LOCUS_10720 gene mrdA 776 2557 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852196.1 protein_id gnl|my_center|LOCUS_10720 2569 2778 gene locus_tag LOCUS_10730 2569 2778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3718 2759 gene locus_tag LOCUS_10740 3718 2759 CDS product MnmA/TRMU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851386.1 protein_id gnl|my_center|LOCUS_10740 >Feature sequence100 77 352 gene locus_tag LOCUS_10750 77 352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10750 371 1930 gene locus_tag LOCUS_10760 371 1930 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932055.1 protein_id gnl|my_center|LOCUS_10760 1927 2904 gene locus_tag LOCUS_10770 1927 2904 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546404.1 protein_id gnl|my_center|LOCUS_10770 3415 2888 gene locus_tag LOCUS_10780 3415 2888 CDS product dual specificity protein phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546664.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence101 456 752 gene locus_tag LOCUS_10790 456 752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 1483 836 gene locus_tag LOCUS_10800 1483 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2201 1572 gene locus_tag LOCUS_10810 2201 1572 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930584.1 protein_id gnl|my_center|LOCUS_10810 2755 2201 gene locus_tag LOCUS_10820 2755 2201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 2863 3858 gene locus_tag LOCUS_10830 gene pstS 2863 3858 CDS product phosphate ABC transporter substrate-binding protein PstS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010881320.1 protein_id gnl|my_center|LOCUS_10830 >Feature sequence102 <1 1557 gene locus_tag LOCUS_10840 <1 1557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000681408.1:type I DNA topoisomerase 1554 2084 gene locus_tag LOCUS_10850 1554 2084 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546148.1 protein_id gnl|my_center|LOCUS_10850 2081 2905 gene locus_tag LOCUS_10860 2081 2905 CDS product biotin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851400.1 protein_id gnl|my_center|LOCUS_10860 2895 4052 gene locus_tag LOCUS_10870 2895 4052 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002855678.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence103 2097 373 gene locus_tag LOCUS_10880 2097 373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 2678 2094 gene locus_tag LOCUS_10890 gene hydD 2678 2094 CDS product hydrogenase biosynthesis protein HydD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000078602.1 protein_id gnl|my_center|LOCUS_10890 3458 2760 gene locus_tag LOCUS_10900 gene cybH 3458 2760 CDS product Ni/Fe-hydrogenase, b-type cytochrome subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853164.1 protein_id gnl|my_center|LOCUS_10900 <4174 3469 gene locus_tag LOCUS_10910 <4174 3469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853190.1:nickel-dependent hydrogenase large subunit >Feature sequence104 211 1887 gene locus_tag LOCUS_10920 211 1887 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 1877 3094 gene locus_tag LOCUS_10930 1877 3094 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456304.1 protein_id gnl|my_center|LOCUS_10930 3305 3736 gene locus_tag LOCUS_10940 3305 3736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10940 >Feature sequence105 1 453 gene locus_tag LOCUS_10950 1 453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10950 463 1125 gene locus_tag LOCUS_10960 463 1125 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530319.1 protein_id gnl|my_center|LOCUS_10960 1261 1569 gene locus_tag LOCUS_10970 gene rpsJ 1261 1569 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002779353.1 protein_id gnl|my_center|LOCUS_10970 1580 2158 gene locus_tag LOCUS_10980 gene rplC 1580 2158 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864792.1 protein_id gnl|my_center|LOCUS_10980 2155 2739 gene locus_tag LOCUS_10990 gene rplD 2155 2739 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851146.1 protein_id gnl|my_center|LOCUS_10990 2743 3024 gene locus_tag LOCUS_11000 2743 3024 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851441.1 protein_id gnl|my_center|LOCUS_11000 3036 3860 gene locus_tag LOCUS_11010 gene rplB 3036 3860 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002825501.1 protein_id gnl|my_center|LOCUS_11010 >Feature sequence106 <1 772 gene locus_tag LOCUS_11020 <1 772 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002871805.1:DNA repair protein RecN 765 1664 gene locus_tag LOCUS_11030 765 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11030 1680 1766 gene locus_tag LOCUS_t00140 1680 1766 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2283 1792 gene locus_tag LOCUS_11040 2283 1792 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence107 214 1041 gene locus_tag LOCUS_11050 gene purU 214 1041 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693604.1 protein_id gnl|my_center|LOCUS_11050 1050 1172 gene locus_tag LOCUS_11060 1050 1172 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 1165 1623 gene locus_tag LOCUS_11070 1165 1623 CDS product tRNA (cytidine(34)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852450.1 protein_id gnl|my_center|LOCUS_11070 1620 2105 gene locus_tag LOCUS_11080 1620 2105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 2106 2459 gene locus_tag LOCUS_11090 2106 2459 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 3363 2446 gene locus_tag LOCUS_11100 3363 2446 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 3410 3622 gene locus_tag LOCUS_11110 3410 3622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 >Feature sequence108 <1 851 gene locus_tag LOCUS_11120 <1 851 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853490.1:CinA family protein 864 1877 gene locus_tag LOCUS_11130 864 1877 CDS product bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000601458.1 protein_id gnl|my_center|LOCUS_11130 1878 2774 gene locus_tag LOCUS_11140 gene hemH 1878 2774 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000364269.1 protein_id gnl|my_center|LOCUS_11140 2749 3174 gene locus_tag LOCUS_11150 gene dtd 2749 3174 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880240.1 protein_id gnl|my_center|LOCUS_11150 3176 3580 gene locus_tag LOCUS_11160 3176 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11160 >Feature sequence109 <1 173 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq cccttatcgggtcaagttgtatgagac 580 332 gene locus_tag LOCUS_11170 580 332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 872 570 gene locus_tag LOCUS_11180 872 570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1606 797 gene locus_tag LOCUS_11190 gene cas1b 1606 797 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861768.1 protein_id gnl|my_center|LOCUS_11190 1866 1603 gene locus_tag LOCUS_11200 gene cas2 1866 1603 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545199.1 protein_id gnl|my_center|LOCUS_11200 2798 1923 gene locus_tag LOCUS_11210 2798 1923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 3624 2815 gene locus_tag LOCUS_11220 3624 2815 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11220 >Feature sequence110 9 481 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtcgcaatcccgttttccggtcattttgtttaaac 729 863 gene locus_tag LOCUS_11230 729 863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1075 1668 gene locus_tag LOCUS_11240 1075 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 1662 2411 gene locus_tag LOCUS_11250 1662 2411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 2402 2647 gene locus_tag LOCUS_11260 2402 2647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 2648 2905 gene locus_tag LOCUS_11270 2648 2905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 >Feature sequence111 <1 1020 gene locus_tag LOCUS_11280 <1 1020 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002852262.1:radical SAM family heme chaperone HemW 1722 1021 gene locus_tag LOCUS_11290 gene flgH 1722 1021 CDS product flagellar basal body L-ring protein FlgH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864738.1 protein_id gnl|my_center|LOCUS_11290 2657 1881 gene locus_tag LOCUS_11300 gene trpC 2657 1881 CDS product indole-3-glycerol phosphate synthase TrpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002854779.1 protein_id gnl|my_center|LOCUS_11300 <3643 2587 gene locus_tag LOCUS_11310 <3643 2587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002855132.1:lipoprotein >Feature sequence112 <1 2050 gene locus_tag LOCUS_11320 <1 2050 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880400.1:carbamoyltransferase HypF 2075 2959 gene locus_tag LOCUS_11330 2075 2959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11330 2952 3086 gene locus_tag LOCUS_11340 2952 3086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 >Feature sequence113 63 1040 gene locus_tag LOCUS_11350 63 1040 CDS product FkbM family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_144351381.1 protein_id gnl|my_center|LOCUS_11350 1037 2059 gene locus_tag LOCUS_11360 1037 2059 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338817.1 protein_id gnl|my_center|LOCUS_11360 2053 2289 gene locus_tag LOCUS_11370 2053 2289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 2286 3488 gene locus_tag LOCUS_11380 2286 3488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence114 75 803 gene locus_tag LOCUS_11390 75 803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 804 1097 gene locus_tag LOCUS_11400 804 1097 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 1097 1414 gene locus_tag LOCUS_11410 1097 1414 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11410 1424 3184 gene locus_tag LOCUS_11420 gene ciaB 1424 3184 CDS product invasion protein CiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858322.1 protein_id gnl|my_center|LOCUS_11420 3187 3429 gene locus_tag LOCUS_11430 3187 3429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11430 >Feature sequence115 480 1097 gene locus_tag LOCUS_11440 480 1097 CDS product DUF6088 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011166986.1 protein_id gnl|my_center|LOCUS_11440 1090 2070 gene locus_tag LOCUS_11450 1090 2070 CDS product nucleotidyl transferase AbiEii/AbiGii toxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013448020.1 protein_id gnl|my_center|LOCUS_11450 3176 2067 gene locus_tag LOCUS_11460 3176 2067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11460 >Feature sequence116 2450 1488 gene locus_tag LOCUS_11470 2450 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851401.1 protein_id gnl|my_center|LOCUS_11470 >Feature sequence117 2315 438 gene locus_tag LOCUS_11480 2315 438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11480 3015 2377 gene locus_tag LOCUS_11490 gene crdR 3015 2377 CDS product copper response regulator transcription factor CrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001169789.1 protein_id gnl|my_center|LOCUS_11490 >Feature sequence118 1254 244 gene locus_tag LOCUS_11500 gene murG 1254 244 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002856115.1 protein_id gnl|my_center|LOCUS_11500 2390 1251 gene locus_tag LOCUS_11510 gene ftsW 2390 1251 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858324.1 protein_id gnl|my_center|LOCUS_11510 2489 2917 gene locus_tag LOCUS_11520 gene flgB 2489 2917 CDS product flagellar basal body rod protein FlgB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000347783.1 protein_id gnl|my_center|LOCUS_11520 >Feature sequence119 2417 2692 gene locus_tag LOCUS_11530 2417 2692 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 >Feature sequence120 2607 1993 gene locus_tag LOCUS_11540 2607 1993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 <3160 2600 gene locus_tag LOCUS_11550 <3160 2600 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002864150.1:valine--tRNA ligase >Feature sequence121 393 1076 gene locus_tag LOCUS_11560 393 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 1073 1717 gene locus_tag LOCUS_11570 1073 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 1764 2204 gene locus_tag LOCUS_11580 1764 2204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 >Feature sequence122 446 790 gene locus_tag LOCUS_11590 446 790 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 841 2310 gene locus_tag LOCUS_11600 841 2310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11600 >Feature sequence123 1272 148 gene locus_tag LOCUS_11610 1272 148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11610 2098 1262 gene locus_tag LOCUS_11620 2098 1262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11620 3033 2095 gene locus_tag LOCUS_11630 3033 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11630 >Feature sequence124 2062 1763 gene locus_tag LOCUS_11640 2062 1763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11640 2362 2078 gene locus_tag LOCUS_11650 2362 2078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11650 >Feature sequence125 649 1461 gene locus_tag LOCUS_11660 649 1461 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012972462.1 protein_id gnl|my_center|LOCUS_11660 1865 1527 gene locus_tag LOCUS_11670 1865 1527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 2247 2080 gene locus_tag LOCUS_11680 2247 2080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 2372 2250 gene locus_tag LOCUS_11690 2372 2250 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 2784 2374 gene locus_tag LOCUS_11700 2784 2374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11700 >Feature sequence126 <1 1291 gene locus_tag LOCUS_11710 <1 1291 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858588.1:ATP-dependent DNA helicase RecG 1530 1294 gene locus_tag LOCUS_11720 1530 1294 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11720 <2929 1630 gene locus_tag LOCUS_11730 <2929 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891904.1:UDP-N-acetylmuramate--L-alanine ligase >Feature sequence127 1257 2138 gene locus_tag LOCUS_11740 gene cmoB 1257 2138 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864121.1 protein_id gnl|my_center|LOCUS_11740 >Feature sequence128 <1 864 gene locus_tag LOCUS_11750 <1 864 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891831.1:flagellar hook-length control protein FliK 2641 836 gene locus_tag LOCUS_11760 2641 836 CDS product motility associated factor glycosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001116307.1 protein_id gnl|my_center|LOCUS_11760 >Feature sequence129 344 177 gene locus_tag LOCUS_11770 344 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11770 776 345 gene locus_tag LOCUS_11780 776 345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 1789 788 gene locus_tag LOCUS_11790 1789 788 CDS product AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460176.1 protein_id gnl|my_center|LOCUS_11790 1925 2497 gene locus_tag LOCUS_11800 1925 2497 CDS product bifunctional precorrin-2 dehydrogenase/sirohydrochlorin ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880784.1 protein_id gnl|my_center|LOCUS_11800 >Feature sequence130 <1 619 gene locus_tag LOCUS_11810 <1 619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000798928.1:molybdate ABC transporter substrate-binding protein 616 990 gene locus_tag LOCUS_11820 616 990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11820 983 1663 gene locus_tag LOCUS_11830 gene modB 983 1663 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857391.1 protein_id gnl|my_center|LOCUS_11830 1626 2504 gene locus_tag LOCUS_11840 1626 2504 CDS product sulfate/molybdate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002816233.1 protein_id gnl|my_center|LOCUS_11840 >Feature sequence131 389 1291 gene locus_tag LOCUS_11850 389 1291 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_11850 2456 1284 gene locus_tag LOCUS_11860 2456 1284 CDS product PleD family two-component system response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971367.1 protein_id gnl|my_center|LOCUS_11860 >Feature sequence132 64 2058 gene locus_tag LOCUS_11870 64 2058 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941696.1 protein_id gnl|my_center|LOCUS_11870 2068 2355 gene locus_tag LOCUS_11880 2068 2355 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence133 533 150 gene locus_tag LOCUS_11890 533 150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11890 897 556 gene locus_tag LOCUS_11900 897 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11900 1071 1379 gene locus_tag LOCUS_11910 1071 1379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 1809 2015 gene locus_tag LOCUS_11920 1809 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11920 2026 2223 gene locus_tag LOCUS_11930 2026 2223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11930 >Feature sequence134 590 198 gene locus_tag LOCUS_11940 590 198 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 861 592 gene locus_tag LOCUS_11950 861 592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 940 1209 gene locus_tag LOCUS_11960 940 1209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 2451 1384 gene locus_tag LOCUS_11970 2451 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11970 >Feature sequence135 1866 733 gene locus_tag LOCUS_11980 gene pglE 1866 733 CDS product UDP-N-acetylbacillosamine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852877.1 protein_id gnl|my_center|LOCUS_11980 2405 1866 gene locus_tag LOCUS_11990 2405 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence136 1088 744 gene locus_tag LOCUS_12000 1088 744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12000 2046 1099 gene locus_tag LOCUS_12010 2046 1099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12010 2436 2056 gene locus_tag LOCUS_12020 2436 2056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12020 >Feature sequence137 791 510 gene locus_tag LOCUS_12030 791 510 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 1005 775 gene locus_tag LOCUS_12040 1005 775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12040 1539 2060 gene locus_tag LOCUS_12050 1539 2060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 2050 2418 gene locus_tag LOCUS_12060 2050 2418 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 >Feature sequence138 <1 903 gene locus_tag LOCUS_12070 <1 903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000884428.1:M48 family metallopeptidase 900 1559 gene locus_tag LOCUS_12080 900 1559 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880787.1 protein_id gnl|my_center|LOCUS_12080 1807 1926 gene locus_tag LOCUS_12090 1807 1926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 1949 2200 gene locus_tag LOCUS_12100 1949 2200 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence139 1 159 gene locus_tag LOCUS_12110 1 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12110 149 415 gene locus_tag LOCUS_12120 gene fliQ 149 415 CDS product flagellar biosynthesis protein FliQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445741.1 protein_id gnl|my_center|LOCUS_12120 412 1173 gene locus_tag LOCUS_12130 412 1173 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858257.1 protein_id gnl|my_center|LOCUS_12130 2125 1163 gene locus_tag LOCUS_12140 2125 1163 CDS product DUF475 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023287.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence140 >Feature sequence141 1247 36 gene locus_tag LOCUS_12150 gene mltC 1247 36 CDS product membrane-bound lytic murein transglycosylase MltC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005490305.1 protein_id gnl|my_center|LOCUS_12150 1668 1258 gene locus_tag LOCUS_12160 1668 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12160 2255 1668 gene locus_tag LOCUS_12170 2255 1668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 >Feature sequence142 <2344 963 gene locus_tag LOCUS_12180 <2344 963 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012583238.1:type II secretion system ATPase GspE >Feature sequence143 393 43 gene locus_tag LOCUS_12190 gene hypA 393 43 CDS product hydrogenase maturation nickel metallochaperone HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880634.1 protein_id gnl|my_center|LOCUS_12190 445 1026 gene locus_tag LOCUS_12200 445 1026 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880156.1 protein_id gnl|my_center|LOCUS_12200 1010 1870 gene locus_tag LOCUS_12210 1010 1870 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880486.1 protein_id gnl|my_center|LOCUS_12210 >Feature sequence144 891 172 gene locus_tag LOCUS_12220 gene kdsB 891 172 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852502.1 protein_id gnl|my_center|LOCUS_12220 935 1153 gene locus_tag LOCUS_12230 935 1153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12230 1150 1833 gene locus_tag LOCUS_12240 1150 1833 CDS product tRNA1(Val) (adenine(37)-N6)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864161.1 protein_id gnl|my_center|LOCUS_12240 1835 2209 gene locus_tag LOCUS_12250 1835 2209 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002864630.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence145 <1 693 gene locus_tag LOCUS_12260 <1 693 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891865.1:aspartate kinase 693 1223 gene locus_tag LOCUS_12270 693 1223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 1220 1765 gene locus_tag LOCUS_12280 1220 1765 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852167.1 protein_id gnl|my_center|LOCUS_12280 >Feature sequence146 1751 1065 gene locus_tag LOCUS_12290 1751 1065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 2125 1748 gene locus_tag LOCUS_12300 2125 1748 CDS product ExbD/TolR family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858790.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence147 1190 2170 gene locus_tag LOCUS_12310 1190 2170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 >Feature sequence148 830 378 gene locus_tag LOCUS_12320 830 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1060 1788 gene locus_tag LOCUS_12330 1060 1788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 >Feature sequence149 134 1516 gene locus_tag LOCUS_12340 gene pyk 134 1516 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584142.1 protein_id gnl|my_center|LOCUS_12340 1788 1513 gene locus_tag LOCUS_12350 1788 1513 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 >Feature sequence150 674 225 gene locus_tag LOCUS_12360 gene pseH 674 225 CDS product UDP-4-amino-4,6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858467.1 protein_id gnl|my_center|LOCUS_12360 1452 640 gene locus_tag LOCUS_12370 gene pseG 1452 640 CDS product UDP-2,4-diacetamido-2,4,6-trideoxy-beta-L-altropyranose hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002830499.1 protein_id gnl|my_center|LOCUS_12370 2113 1433 gene locus_tag LOCUS_12380 gene pseF 2113 1433 CDS product pseudaminic acid cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_066867757.1 protein_id gnl|my_center|LOCUS_12380 >Feature sequence151 1476 157 gene locus_tag LOCUS_12390 1476 157 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12390 <2112 1473 gene locus_tag LOCUS_12400 <2112 1473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002858782.1:ABC transporter ATP-binding protein >Feature sequence152 548 126 gene locus_tag LOCUS_12410 548 126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 1076 591 gene locus_tag LOCUS_12420 1076 591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1621 1073 gene locus_tag LOCUS_12430 1621 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1973 1764 gene locus_tag LOCUS_12440 1973 1764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 >Feature sequence153 1743 67 gene locus_tag LOCUS_12450 1743 67 CDS product IS1634 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_170127867.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence154 304 1497 gene locus_tag LOCUS_12460 304 1497 CDS product M48 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000884428.1 protein_id gnl|my_center|LOCUS_12460 >Feature sequence155 >Feature sequence156 1446 478 gene locus_tag LOCUS_12470 1446 478 CDS product DNA adenine methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001106543.1 protein_id gnl|my_center|LOCUS_12470 1657 1427 gene locus_tag LOCUS_12480 1657 1427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12480 >Feature sequence157 158 1012 gene locus_tag LOCUS_12490 158 1012 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462366.1 protein_id gnl|my_center|LOCUS_12490 1045 1560 gene locus_tag LOCUS_12500 1045 1560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence158 1640 663 gene locus_tag LOCUS_12510 gene hypE 1640 663 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706338.1 protein_id gnl|my_center|LOCUS_12510 1914 1681 gene locus_tag LOCUS_12520 1914 1681 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12520 >Feature sequence159 471 1679 gene locus_tag LOCUS_12530 gene mtaB 471 1679 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858158.1 protein_id gnl|my_center|LOCUS_12530 >Feature sequence160 4 1368 gene locus_tag LOCUS_12540 4 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 1468 1812 gene locus_tag LOCUS_12550 1468 1812 CDS product YkvA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070685.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence161 1177 482 gene locus_tag LOCUS_12560 1177 482 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546862.1 protein_id gnl|my_center|LOCUS_12560 1837 1208 gene locus_tag LOCUS_12570 1837 1208 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079931.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence162 1492 845 gene locus_tag LOCUS_12580 1492 845 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930584.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence163 302 1180 gene locus_tag LOCUS_12590 302 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 >Feature sequence164 1354 44 gene locus_tag LOCUS_12600 1354 44 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 >Feature sequence165 <1 1080 gene locus_tag LOCUS_12610 <1 1080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001116307.1:motility associated factor glycosyltransferase family protein <1805 1052 gene locus_tag LOCUS_12620 <1805 1052 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891831.1:flagellar hook-length control protein FliK >Feature sequence166 >Feature sequence167 149 631 gene locus_tag LOCUS_12630 149 631 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001164436.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence168 <1 889 gene locus_tag LOCUS_12640 <1 889 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004082880.1:6-phosphofructokinase >Feature sequence169 345 40 gene locus_tag LOCUS_12650 345 40 CDS product F0F1 ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002853292.1 protein_id gnl|my_center|LOCUS_12650 1534 458 gene locus_tag LOCUS_12660 1534 458 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880235.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence170 >Feature sequence171 1367 720 gene locus_tag LOCUS_12670 1367 720 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930584.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence172 1095 427 gene locus_tag LOCUS_12680 1095 427 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 >Feature sequence173 632 204 gene locus_tag LOCUS_12690 632 204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12690 1180 623 gene locus_tag LOCUS_12700 1180 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12700 >Feature sequence174 209 652 gene locus_tag LOCUS_12710 209 652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710