>Feature sequence001 <1 1091 gene locus_tag LOCUS_00010 <1 1091 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108682.1:helix-hairpin-helix domain-containing protein 1341 2204 gene locus_tag LOCUS_00020 1341 2204 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964148.1 protein_id gnl|my_center|LOCUS_00020 3060 2419 gene locus_tag LOCUS_00030 3060 2419 CDS product O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964180.1 protein_id gnl|my_center|LOCUS_00030 4877 3057 gene locus_tag LOCUS_00040 4877 3057 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962244.1 protein_id gnl|my_center|LOCUS_00040 6064 4895 gene locus_tag LOCUS_00050 6064 4895 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768487.1 protein_id gnl|my_center|LOCUS_00050 6777 6082 gene locus_tag LOCUS_00060 6777 6082 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962551.1 protein_id gnl|my_center|LOCUS_00060 7853 6879 gene locus_tag LOCUS_00070 gene aroC 7853 6879 CDS product chorismate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964214.1 protein_id gnl|my_center|LOCUS_00070 9102 7888 gene locus_tag LOCUS_00080 gene aroA 9102 7888 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964213.1 protein_id gnl|my_center|LOCUS_00080 9761 9099 gene locus_tag LOCUS_00090 9761 9099 CDS product 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249221.1 protein_id gnl|my_center|LOCUS_00090 10408 10097 gene locus_tag LOCUS_00100 10408 10097 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962418.1 protein_id gnl|my_center|LOCUS_00100 10632 10405 gene locus_tag LOCUS_00110 10632 10405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00110 11653 10625 gene locus_tag LOCUS_00120 gene aroB 11653 10625 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545319.1 protein_id gnl|my_center|LOCUS_00120 11926 13014 gene locus_tag LOCUS_00130 gene gcvT 11926 13014 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795559.1 protein_id gnl|my_center|LOCUS_00130 13019 13828 gene locus_tag LOCUS_00140 gene murI 13019 13828 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964198.1 protein_id gnl|my_center|LOCUS_00140 13830 14255 gene locus_tag LOCUS_00150 13830 14255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00150 15841 14372 gene locus_tag LOCUS_00160 15841 14372 CDS product GH3 auxin-responsive promoter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962572.1 protein_id gnl|my_center|LOCUS_00160 16063 17817 gene locus_tag LOCUS_00170 16063 17817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00170 19115 18060 gene locus_tag LOCUS_00180 19115 18060 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_072879556.1 protein_id gnl|my_center|LOCUS_00180 20331 19636 gene locus_tag LOCUS_00190 20331 19636 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962529.1 protein_id gnl|my_center|LOCUS_00190 20749 20333 gene locus_tag LOCUS_00200 20749 20333 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761508.1 protein_id gnl|my_center|LOCUS_00200 28306 20834 gene locus_tag LOCUS_00210 gene sprA 28306 20834 CDS product cell surface protein SprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062175791.1 protein_id gnl|my_center|LOCUS_00210 28893 28312 gene locus_tag LOCUS_00220 gene ruvA 28893 28312 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964221.1 protein_id gnl|my_center|LOCUS_00220 29044 30030 gene locus_tag LOCUS_00230 29044 30030 CDS product glucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107847.1 protein_id gnl|my_center|LOCUS_00230 >Feature sequence002 4671 1156 gene locus_tag LOCUS_00240 4671 1156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00240 6068 4968 gene locus_tag LOCUS_00250 gene dprA 6068 4968 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_172795629.1 protein_id gnl|my_center|LOCUS_00250 6219 6845 gene locus_tag LOCUS_00260 6219 6845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00260 7632 6937 gene locus_tag LOCUS_00270 7632 6937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00270 8505 7645 gene locus_tag LOCUS_00280 8505 7645 CDS product ChaN family lipoprotein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000604121.1 protein_id gnl|my_center|LOCUS_00280 8710 10092 gene locus_tag LOCUS_00290 8710 10092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00290 11384 10449 gene locus_tag LOCUS_00300 gene queG 11384 10449 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964223.1 protein_id gnl|my_center|LOCUS_00300 12433 11381 gene locus_tag LOCUS_00310 gene meaB 12433 11381 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784891.1 protein_id gnl|my_center|LOCUS_00310 12590 14899 gene locus_tag LOCUS_00320 12590 14899 CDS product BamA/TamA family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202810.1 protein_id gnl|my_center|LOCUS_00320 14954 16198 gene locus_tag LOCUS_00330 14954 16198 CDS product divalent metal cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263870.1 protein_id gnl|my_center|LOCUS_00330 17091 16384 gene locus_tag LOCUS_00340 gene pyrH 17091 16384 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759596.1 protein_id gnl|my_center|LOCUS_00340 17439 17876 gene locus_tag LOCUS_00350 17439 17876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 17927 19267 gene locus_tag LOCUS_00360 gene tilS 17927 19267 CDS product tRNA lysidine(34) synthetase TilS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963738.1 protein_id gnl|my_center|LOCUS_00360 19285 19941 gene locus_tag LOCUS_00370 gene nth 19285 19941 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767855.1 protein_id gnl|my_center|LOCUS_00370 20081 20006 gene locus_tag LOCUS_t00010 20081 20006 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 21172 20273 gene locus_tag LOCUS_00380 21172 20273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_018344201.1 protein_id gnl|my_center|LOCUS_00380 21739 21191 gene locus_tag LOCUS_00390 21739 21191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 22430 21825 gene locus_tag LOCUS_00400 gene rsmG 22430 21825 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962583.1 protein_id gnl|my_center|LOCUS_00400 23039 22437 gene locus_tag LOCUS_00410 gene sigW 23039 22437 CDS product RNA polymerase sigma factor SigW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003234958.1 protein_id gnl|my_center|LOCUS_00410 24166 23030 gene locus_tag LOCUS_00420 24166 23030 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963583.1 protein_id gnl|my_center|LOCUS_00420 24902 24228 gene locus_tag LOCUS_00430 24902 24228 CDS product NAD-dependent deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963913.1 protein_id gnl|my_center|LOCUS_00430 >Feature sequence003 3246 100 gene locus_tag LOCUS_00440 3246 100 CDS product CRISPR-associated protein Csx11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010875965.1 protein_id gnl|my_center|LOCUS_00440 4177 3239 gene locus_tag LOCUS_00450 4177 3239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00450 5175 4174 gene locus_tag LOCUS_00460 gene cmr1 5175 4174 CDS product type III-B CRISPR module RAMP protein Cmr1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048060794.1 protein_id gnl|my_center|LOCUS_00460 5758 5573 gene locus_tag LOCUS_00470 5758 5573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 5871 6113 gene locus_tag LOCUS_00480 5871 6113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00480 6120 8009 gene locus_tag LOCUS_00490 6120 8009 CDS product TIGR02556 family CRISPR-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582997.1 protein_id gnl|my_center|LOCUS_00490 8002 8976 gene locus_tag LOCUS_00500 gene cas7b 8002 8976 CDS product type I-B CRISPR-associated protein Cas7/Csh2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582996.1 protein_id gnl|my_center|LOCUS_00500 8991 9746 gene locus_tag LOCUS_00510 gene cas5b 8991 9746 CDS product type I-B CRISPR-associated protein Cas5b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582995.1 protein_id gnl|my_center|LOCUS_00510 9775 12183 gene locus_tag LOCUS_00520 9775 12183 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582994.1 protein_id gnl|my_center|LOCUS_00520 12245 12679 gene locus_tag LOCUS_00530 gene cas4 12245 12679 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582993.1 protein_id gnl|my_center|LOCUS_00530 12969 13673 gene locus_tag LOCUS_00540 12969 13673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 13677 13946 gene locus_tag LOCUS_00550 gene cas2 13677 13946 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_021013193.1 protein_id gnl|my_center|LOCUS_00550 14112 15322 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttttagagtacctaagaggaattgaaac 16374 15475 gene locus_tag LOCUS_00560 gene pfkB 16374 15475 CDS product 6-phosphofructokinase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097008.1 protein_id gnl|my_center|LOCUS_00560 16978 16358 gene locus_tag LOCUS_00570 16978 16358 CDS product polyhydroxyalkanoate synthesis regulator DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909395.1 protein_id gnl|my_center|LOCUS_00570 18127 16991 gene locus_tag LOCUS_00580 18127 16991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00580 <19875 18897 gene locus_tag LOCUS_00590 <19875 18897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010956752.1:MMPL family transporter >Feature sequence004 <1 941 gene locus_tag LOCUS_00600 <1 941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012582795.1:nitronate monooxygenase 2084 924 gene locus_tag LOCUS_00610 2084 924 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964438.1 protein_id gnl|my_center|LOCUS_00610 4696 2177 gene locus_tag LOCUS_00620 4696 2177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 6452 4899 gene locus_tag LOCUS_00630 6452 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 7510 6449 gene locus_tag LOCUS_00640 7510 6449 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107718.1 protein_id gnl|my_center|LOCUS_00640 8193 7615 gene locus_tag LOCUS_00650 8193 7615 CDS product flavin reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005803433.1 protein_id gnl|my_center|LOCUS_00650 14945 8202 gene locus_tag LOCUS_00660 14945 8202 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 17645 15324 gene locus_tag LOCUS_00670 17645 15324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00670 <19593 17813 gene locus_tag LOCUS_00680 <19593 17813 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011205034.1:YadA-like family protein >Feature sequence005 3457 188 gene locus_tag LOCUS_00690 3457 188 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00690 5159 3546 gene locus_tag LOCUS_00700 5159 3546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00700 5718 5149 gene locus_tag LOCUS_00710 5718 5149 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786067.1 protein_id gnl|my_center|LOCUS_00710 5824 6465 gene locus_tag LOCUS_00720 5824 6465 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964290.1 protein_id gnl|my_center|LOCUS_00720 6469 8409 gene locus_tag LOCUS_00730 6469 8409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00730 9268 8414 gene locus_tag LOCUS_00740 9268 8414 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933671.1 protein_id gnl|my_center|LOCUS_00740 10666 9656 gene locus_tag LOCUS_00750 gene fbp 10666 9656 CDS product class 1 fructose-bisphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705872.1 protein_id gnl|my_center|LOCUS_00750 10745 11995 gene locus_tag LOCUS_00760 10745 11995 CDS product aspartate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962473.1 protein_id gnl|my_center|LOCUS_00760 13126 12314 gene locus_tag LOCUS_00770 13126 12314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 14729 13263 gene locus_tag LOCUS_00780 14729 13263 CDS product putative DNA binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016217.1 protein_id gnl|my_center|LOCUS_00780 15740 14739 gene locus_tag LOCUS_00790 15740 14739 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00790 <17178 16010 gene locus_tag LOCUS_00800 <17178 16010 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_224134611.1:cell division protein FtsZ >Feature sequence006 6699 5485 gene locus_tag LOCUS_00810 6699 5485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00810 7283 6702 gene locus_tag LOCUS_00820 7283 6702 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_00820 8682 7330 gene locus_tag LOCUS_00830 gene cpsG 8682 7330 CDS product colanic acid biosynthesis phosphomannomutase CpsG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012602262.1 protein_id gnl|my_center|LOCUS_00830 9779 8766 gene locus_tag LOCUS_00840 gene mltG 9779 8766 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202520.1 protein_id gnl|my_center|LOCUS_00840 11670 10618 gene locus_tag LOCUS_00850 11670 10618 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868996.1 protein_id gnl|my_center|LOCUS_00850 12491 11670 gene locus_tag LOCUS_00860 12491 11670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00860 13528 12539 gene locus_tag LOCUS_00870 13528 12539 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963732.1 protein_id gnl|my_center|LOCUS_00870 13736 13809 gene locus_tag LOCUS_t00020 13736 13809 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 13936 14010 gene locus_tag LOCUS_t00030 13936 14010 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 14023 14304 gene locus_tag LOCUS_00880 14023 14304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00880 14558 16513 gene locus_tag LOCUS_00890 gene gyrB 14558 16513 CDS product DNA topoisomerase (ATP-hydrolyzing) subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763685.1 protein_id gnl|my_center|LOCUS_00890 >Feature sequence007 1364 228 gene locus_tag LOCUS_00900 gene hemW 1364 228 CDS product radical SAM family heme chaperone HemW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763952.1 protein_id gnl|my_center|LOCUS_00900 3352 1421 gene locus_tag LOCUS_00910 3352 1421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00910 3537 3902 gene locus_tag LOCUS_00920 3537 3902 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016361979.1 protein_id gnl|my_center|LOCUS_00920 4411 3899 gene locus_tag LOCUS_00930 gene rimM 4411 3899 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962516.1 protein_id gnl|my_center|LOCUS_00930 5070 4408 gene locus_tag LOCUS_00940 5070 4408 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 5405 5332 gene locus_tag LOCUS_t00040 5405 5332 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5884 6435 gene locus_tag LOCUS_00950 5884 6435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 6631 6939 gene locus_tag LOCUS_00960 6631 6939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00960 7665 7222 gene locus_tag LOCUS_00970 gene gcvH 7665 7222 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964219.1 protein_id gnl|my_center|LOCUS_00970 7730 8506 gene locus_tag LOCUS_00980 7730 8506 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816946.1 protein_id gnl|my_center|LOCUS_00980 10095 8722 gene locus_tag LOCUS_00990 10095 8722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 10287 11387 gene locus_tag LOCUS_01000 10287 11387 CDS product DUF1573 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760932.1 protein_id gnl|my_center|LOCUS_01000 11505 12089 gene locus_tag LOCUS_01010 11505 12089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01010 12089 12391 gene locus_tag LOCUS_01020 gene groES 12089 12391 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024103730.1 protein_id gnl|my_center|LOCUS_01020 13593 13090 gene locus_tag LOCUS_01030 13593 13090 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 14395 13655 gene locus_tag LOCUS_01040 14395 13655 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01040 15726 14806 gene locus_tag LOCUS_01050 15726 14806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01050 16072 15719 gene locus_tag LOCUS_01060 16072 15719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01060 >Feature sequence008 4481 90 gene locus_tag LOCUS_01070 4481 90 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01070 4565 5590 gene locus_tag LOCUS_01080 4565 5590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01080 5601 7802 gene locus_tag LOCUS_01090 5601 7802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01090 8116 9006 gene locus_tag LOCUS_01100 8116 9006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01100 9142 13350 gene locus_tag LOCUS_01110 9142 13350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01110 16156 13988 gene locus_tag LOCUS_01120 16156 13988 CDS product S46 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766212.1 protein_id gnl|my_center|LOCUS_01120 >Feature sequence009 86 1042 gene locus_tag LOCUS_01130 86 1042 CDS product KpsF/GutQ family sugar-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099197.1 protein_id gnl|my_center|LOCUS_01130 1292 2014 gene locus_tag LOCUS_01140 gene lptB 1292 2014 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963369.1 protein_id gnl|my_center|LOCUS_01140 2018 4552 gene locus_tag LOCUS_01150 2018 4552 CDS product DUF5686 and carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107841.1 protein_id gnl|my_center|LOCUS_01150 6238 4586 gene locus_tag LOCUS_01160 6238 4586 CDS product Na/Pi cotransporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003430205.1 protein_id gnl|my_center|LOCUS_01160 6446 11326 gene locus_tag LOCUS_01170 6446 11326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01170 12564 11563 gene locus_tag LOCUS_01180 gene argF 12564 11563 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707753.1 protein_id gnl|my_center|LOCUS_01180 13539 12586 gene locus_tag LOCUS_01190 gene arcC 13539 12586 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868005.1 protein_id gnl|my_center|LOCUS_01190 15223 13787 gene locus_tag LOCUS_01200 15223 13787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 16004 15546 gene locus_tag LOCUS_01210 gene coaD 16004 15546 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962815.1 protein_id gnl|my_center|LOCUS_01210 >Feature sequence010 1852 746 gene locus_tag LOCUS_01220 1852 746 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080082.1 protein_id gnl|my_center|LOCUS_01220 2424 1855 gene locus_tag LOCUS_01230 2424 1855 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080084.1 protein_id gnl|my_center|LOCUS_01230 2973 2428 gene locus_tag LOCUS_01240 2973 2428 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080086.1 protein_id gnl|my_center|LOCUS_01240 3893 2985 gene locus_tag LOCUS_01250 3893 2985 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250169.1 protein_id gnl|my_center|LOCUS_01250 5759 3906 gene locus_tag LOCUS_01260 5759 3906 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867831.1 protein_id gnl|my_center|LOCUS_01260 7263 5767 gene locus_tag LOCUS_01270 7263 5767 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250171.1 protein_id gnl|my_center|LOCUS_01270 7631 7257 gene locus_tag LOCUS_01280 7631 7257 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_01280 8344 7634 gene locus_tag LOCUS_01290 8344 7634 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053840.1 protein_id gnl|my_center|LOCUS_01290 8625 8341 gene locus_tag LOCUS_01300 8625 8341 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867827.1 protein_id gnl|my_center|LOCUS_01300 9014 8622 gene locus_tag LOCUS_01310 gene mnhG 9014 8622 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867826.1 protein_id gnl|my_center|LOCUS_01310 9280 9011 gene locus_tag LOCUS_01320 9280 9011 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867825.1 protein_id gnl|my_center|LOCUS_01320 9798 9283 gene locus_tag LOCUS_01330 9798 9283 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867824.1 protein_id gnl|my_center|LOCUS_01330 10891 9890 gene locus_tag LOCUS_01340 10891 9890 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107714.1 protein_id gnl|my_center|LOCUS_01340 12445 10958 gene locus_tag LOCUS_01350 12445 10958 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01350 13282 12455 gene locus_tag LOCUS_01360 13282 12455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01360 15946 13460 gene locus_tag LOCUS_01370 15946 13460 CDS product putative LPS assembly protein LptD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203455.1 protein_id gnl|my_center|LOCUS_01370 >Feature sequence011 1933 383 gene locus_tag LOCUS_01380 1933 383 CDS product acyl-CoA carboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_205421548.1 protein_id gnl|my_center|LOCUS_01380 3389 2280 gene locus_tag LOCUS_01390 3389 2280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01390 7907 3489 gene locus_tag LOCUS_01400 7907 3489 CDS product translocation/assembly module TamB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_161799605.1 protein_id gnl|my_center|LOCUS_01400 8535 8110 gene locus_tag LOCUS_01410 8535 8110 CDS product YhbP family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015369539.1 protein_id gnl|my_center|LOCUS_01410 9808 8522 gene locus_tag LOCUS_01420 gene purD 9808 8522 CDS product phosphoribosylamine--glycine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964560.1 protein_id gnl|my_center|LOCUS_01420 9897 10466 gene locus_tag LOCUS_01430 9897 10466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 11950 10700 gene locus_tag LOCUS_01440 11950 10700 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_129254226.1 protein_id gnl|my_center|LOCUS_01440 12830 11955 gene locus_tag LOCUS_01450 12830 11955 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01450 14514 12823 gene locus_tag LOCUS_01460 14514 12823 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108843.1 protein_id gnl|my_center|LOCUS_01460 >Feature sequence012 249 1154 gene locus_tag LOCUS_01470 gene cysD 249 1154 CDS product sulfate adenylyltransferase subunit CysD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_103016337.1 protein_id gnl|my_center|LOCUS_01470 1199 2482 gene locus_tag LOCUS_01480 1199 2482 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000365065.1 protein_id gnl|my_center|LOCUS_01480 3383 2640 gene locus_tag LOCUS_01490 gene rlmB 3383 2640 CDS product 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762416.1 protein_id gnl|my_center|LOCUS_01490 3752 4048 gene locus_tag LOCUS_01500 3752 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01500 4052 4816 gene locus_tag LOCUS_01510 gene surE 4052 4816 CDS product 5'/3'-nucleotidase SurE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764237.1 protein_id gnl|my_center|LOCUS_01510 4820 5152 gene locus_tag LOCUS_01520 4820 5152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5309 6409 gene locus_tag LOCUS_01530 gene lpxB 5309 6409 CDS product lipid-A-disaccharide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964419.1 protein_id gnl|my_center|LOCUS_01530 6409 7581 gene locus_tag LOCUS_01540 6409 7581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 8680 7826 gene locus_tag LOCUS_01550 8680 7826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 9220 8768 gene locus_tag LOCUS_01560 gene dtd 9220 8768 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962422.1 protein_id gnl|my_center|LOCUS_01560 10787 9375 gene locus_tag LOCUS_01570 gene xseA 10787 9375 CDS product exodeoxyribonuclease VII large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203547.1 protein_id gnl|my_center|LOCUS_01570 12415 10787 gene locus_tag LOCUS_01580 12415 10787 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799138.1 protein_id gnl|my_center|LOCUS_01580 12867 12430 gene locus_tag LOCUS_01590 12867 12430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01590 13852 12968 gene locus_tag LOCUS_01600 13852 12968 CDS product nitroreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966216.1 protein_id gnl|my_center|LOCUS_01600 14522 13857 gene locus_tag LOCUS_01610 14522 13857 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 15131 14559 gene locus_tag LOCUS_01620 15131 14559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 >Feature sequence013 259 2769 gene locus_tag LOCUS_01630 259 2769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01630 3987 3076 gene locus_tag LOCUS_01640 gene xerD 3987 3076 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791940.1 protein_id gnl|my_center|LOCUS_01640 4904 3984 gene locus_tag LOCUS_01650 4904 3984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01650 6211 4901 gene locus_tag LOCUS_01660 6211 4901 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 7039 6428 gene locus_tag LOCUS_01670 7039 6428 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_01670 7696 7040 gene locus_tag LOCUS_01680 gene fsa 7696 7040 CDS product fructose-6-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107927.1 protein_id gnl|my_center|LOCUS_01680 9062 7860 gene locus_tag LOCUS_01690 9062 7860 CDS product C1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107980.1 protein_id gnl|my_center|LOCUS_01690 10175 9144 gene locus_tag LOCUS_01700 10175 9144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01700 10288 11079 gene locus_tag LOCUS_01710 10288 11079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 11146 11238 gene locus_tag LOCUS_t00050 11146 11238 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 11296 11386 gene locus_tag LOCUS_t00060 11296 11386 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 12654 11797 gene locus_tag LOCUS_01720 12654 11797 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962491.1 protein_id gnl|my_center|LOCUS_01720 <15202 12776 gene locus_tag LOCUS_01730 <15202 12776 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_169313288.1:Calx-beta domain-containing protein >Feature sequence014 714 523 gene locus_tag LOCUS_01740 714 523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01740 1051 722 gene locus_tag LOCUS_01750 1051 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 1577 1065 gene locus_tag LOCUS_01760 1577 1065 CDS product peptidoglycan recognition family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000402954.1 protein_id gnl|my_center|LOCUS_01760 1827 1591 gene locus_tag LOCUS_01770 1827 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 2461 1829 gene locus_tag LOCUS_01780 2461 1829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01780 3824 3426 gene locus_tag LOCUS_01790 3824 3426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01790 4121 3867 gene locus_tag LOCUS_01800 4121 3867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 4437 4099 gene locus_tag LOCUS_01810 4437 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01810 4631 4434 gene locus_tag LOCUS_01820 4631 4434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01820 4947 4624 gene locus_tag LOCUS_01830 4947 4624 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 5660 4947 gene locus_tag LOCUS_01840 gene xerA 5660 4947 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867504.1 protein_id gnl|my_center|LOCUS_01840 5827 5639 gene locus_tag LOCUS_01850 5827 5639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01850 6634 5954 gene locus_tag LOCUS_01860 6634 5954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 7893 6631 gene locus_tag LOCUS_01870 gene dnaB 7893 6631 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001286244.1 protein_id gnl|my_center|LOCUS_01870 8260 7967 gene locus_tag LOCUS_01880 8260 7967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01880 9142 8405 gene locus_tag LOCUS_01890 9142 8405 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01890 9735 9139 gene locus_tag LOCUS_01900 9735 9139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01900 10705 9728 gene locus_tag LOCUS_01910 10705 9728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 11298 10702 gene locus_tag LOCUS_01920 11298 10702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01920 11845 11276 gene locus_tag LOCUS_01930 11845 11276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01930 12133 11951 gene locus_tag LOCUS_01940 12133 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 12686 12177 gene locus_tag LOCUS_01950 12686 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 13467 12793 gene locus_tag LOCUS_01960 13467 12793 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01960 13807 13526 gene locus_tag LOCUS_01970 13807 13526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01970 14112 13876 gene locus_tag LOCUS_01980 14112 13876 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01980 14353 14129 gene locus_tag LOCUS_01990 14353 14129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01990 14641 14369 gene locus_tag LOCUS_02000 14641 14369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02000 15012 14659 gene locus_tag LOCUS_02010 15012 14659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 >Feature sequence015 630 91 gene locus_tag LOCUS_02020 630 91 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1037 627 gene locus_tag LOCUS_02030 1037 627 CDS product thioesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963339.1 protein_id gnl|my_center|LOCUS_02030 1850 1041 gene locus_tag LOCUS_02040 1850 1041 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070794.1 protein_id gnl|my_center|LOCUS_02040 2908 2027 gene locus_tag LOCUS_02050 gene sucD 2908 2027 CDS product succinate--CoA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963119.1 protein_id gnl|my_center|LOCUS_02050 4518 2995 gene locus_tag LOCUS_02060 gene hutH 4518 2995 CDS product histidine ammonia-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016650.1 protein_id gnl|my_center|LOCUS_02060 4951 5142 gene locus_tag LOCUS_02070 4951 5142 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384317.1 protein_id gnl|my_center|LOCUS_02070 6329 5424 gene locus_tag LOCUS_02080 gene miaA 6329 5424 CDS product tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202192.1 protein_id gnl|my_center|LOCUS_02080 7355 6333 gene locus_tag LOCUS_02090 7355 6333 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762747.1 protein_id gnl|my_center|LOCUS_02090 8893 7370 gene locus_tag LOCUS_02100 gene purH 8893 7370 CDS product bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792044.1 protein_id gnl|my_center|LOCUS_02100 9805 8966 gene locus_tag LOCUS_02110 9805 8966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02110 10563 9871 gene locus_tag LOCUS_02120 10563 9871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02120 10660 11118 gene locus_tag LOCUS_02130 gene msrA 10660 11118 CDS product peptide-methionine (S)-S-oxide reductase MsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021447.1 protein_id gnl|my_center|LOCUS_02130 11412 13316 gene locus_tag LOCUS_02140 11412 13316 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962373.1 protein_id gnl|my_center|LOCUS_02140 13585 13352 gene locus_tag LOCUS_02150 13585 13352 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02150 >Feature sequence016 32 1540 gene locus_tag LOCUS_02160 gene atpD 32 1540 CDS product F0F1 ATP synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962293.1 protein_id gnl|my_center|LOCUS_02160 1551 1799 gene locus_tag LOCUS_02170 gene atpC 1551 1799 CDS product ATP synthase F1 subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107410.1 protein_id gnl|my_center|LOCUS_02170 1806 2453 gene locus_tag LOCUS_02180 1806 2453 CDS product 4'-phosphopantetheinyl transferase superfamily protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291961.1 protein_id gnl|my_center|LOCUS_02180 3293 2472 gene locus_tag LOCUS_02190 3293 2472 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02190 3502 3430 gene locus_tag LOCUS_t00070 3502 3430 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5909 3600 gene locus_tag LOCUS_02200 5909 3600 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02200 7147 6455 gene locus_tag LOCUS_02210 7147 6455 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107286.1 protein_id gnl|my_center|LOCUS_02210 7715 7140 gene locus_tag LOCUS_02220 7715 7140 CDS product D-sedoheptulose 7-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966335.1 protein_id gnl|my_center|LOCUS_02220 8753 7728 gene locus_tag LOCUS_02230 8753 7728 CDS product dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766012.1 protein_id gnl|my_center|LOCUS_02230 9888 8743 gene locus_tag LOCUS_02240 9888 8743 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405119.1 protein_id gnl|my_center|LOCUS_02240 10086 12026 gene locus_tag LOCUS_02250 10086 12026 CDS product M1 family aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962262.1 protein_id gnl|my_center|LOCUS_02250 13044 12199 gene locus_tag LOCUS_02260 gene accD 13044 12199 CDS product acetyl-CoA carboxylase, carboxyltransferase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962493.1 protein_id gnl|my_center|LOCUS_02260 14152 13097 gene locus_tag LOCUS_02270 14152 13097 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295283.1 protein_id gnl|my_center|LOCUS_02270 >Feature sequence017 1403 51 gene locus_tag LOCUS_02280 1403 51 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02280 3423 1480 gene locus_tag LOCUS_02290 3423 1480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 1541 1640 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 3673 4083 gene locus_tag LOCUS_02300 3673 4083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02300 5331 4057 gene locus_tag LOCUS_02310 5331 4057 CDS product replication-associated recombination protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765915.1 protein_id gnl|my_center|LOCUS_02310 6134 5328 gene locus_tag LOCUS_02320 gene truA 6134 5328 CDS product tRNA pseudouridine(38-40) synthase TruA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785168.1 protein_id gnl|my_center|LOCUS_02320 7212 6160 gene locus_tag LOCUS_02330 7212 6160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02330 7308 8042 gene locus_tag LOCUS_02340 gene gldF 7308 8042 CDS product gliding motility-associated ABC transporter permease subunit GldF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963228.1 protein_id gnl|my_center|LOCUS_02340 8047 9771 gene locus_tag LOCUS_02350 gene gldG 8047 9771 CDS product gliding motility-associated ABC transporter substrate-binding protein GldG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963229.1 protein_id gnl|my_center|LOCUS_02350 9877 10911 gene locus_tag LOCUS_02360 9877 10911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 <13926 10998 gene locus_tag LOCUS_02370 <13926 10998 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011203753.1:leucine--tRNA ligase >Feature sequence018 <1 1311 gene locus_tag LOCUS_02380 <1 1311 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962187.1:T9SS type A sorting domain-containing protein 1332 2246 gene locus_tag LOCUS_02390 1332 2246 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_02390 2539 4794 gene locus_tag LOCUS_02400 2539 4794 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202910.1 protein_id gnl|my_center|LOCUS_02400 4858 5448 gene locus_tag LOCUS_02410 4858 5448 CDS product DUF4290 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790584.1 protein_id gnl|my_center|LOCUS_02410 5455 6765 gene locus_tag LOCUS_02420 gene murA 5455 6765 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790583.1 protein_id gnl|my_center|LOCUS_02420 6783 7238 gene locus_tag LOCUS_02430 6783 7238 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249473.1 protein_id gnl|my_center|LOCUS_02430 8118 7285 gene locus_tag LOCUS_02440 8118 7285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784255.1 protein_id gnl|my_center|LOCUS_02440 9748 8126 gene locus_tag LOCUS_02450 9748 8126 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583496.1 protein_id gnl|my_center|LOCUS_02450 10211 13060 gene locus_tag LOCUS_02460 10211 13060 CDS product class I SAM-dependent DNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039744.1 protein_id gnl|my_center|LOCUS_02460 >Feature sequence019 1377 1919 gene locus_tag LOCUS_02470 gene gldD 1377 1919 CDS product gliding motility lipoprotein GldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963775.1 protein_id gnl|my_center|LOCUS_02470 1923 3008 gene locus_tag LOCUS_02480 1923 3008 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000947999.1 protein_id gnl|my_center|LOCUS_02480 3107 3871 gene locus_tag LOCUS_02490 gene tpiA 3107 3871 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760849.1 protein_id gnl|my_center|LOCUS_02490 5587 4559 gene locus_tag LOCUS_02500 5587 4559 CDS product FAD:protein FMN transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785727.1 protein_id gnl|my_center|LOCUS_02500 6545 5580 gene locus_tag LOCUS_02510 gene rfaD 6545 5580 CDS product ADP-glyceromanno-heptose 6-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011015772.1 protein_id gnl|my_center|LOCUS_02510 7375 6542 gene locus_tag LOCUS_02520 7375 6542 CDS product 1,4-dihydroxy-6-naphthoate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941121.1 protein_id gnl|my_center|LOCUS_02520 8658 7723 gene locus_tag LOCUS_02530 gene mdh 8658 7723 CDS product malate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404318.1 protein_id gnl|my_center|LOCUS_02530 8854 8781 gene locus_tag LOCUS_t00080 8854 8781 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9113 11122 gene locus_tag LOCUS_02540 9113 11122 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02540 <12979 11451 gene locus_tag LOCUS_02550 <12979 11451 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011108986.1:ABC-F family ATP-binding cassette domain-containing protein >Feature sequence020 1003 3027 gene locus_tag LOCUS_02560 1003 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3212 3589 gene locus_tag LOCUS_02570 3212 3589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02570 3650 4042 gene locus_tag LOCUS_02580 3650 4042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02580 4029 4469 gene locus_tag LOCUS_02590 4029 4469 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02590 4709 6616 gene locus_tag LOCUS_02600 4709 6616 CDS product RecQ family ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203526.1 protein_id gnl|my_center|LOCUS_02600 6951 7024 gene locus_tag LOCUS_t00090 6951 7024 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 7139 9367 gene locus_tag LOCUS_02610 gene purL 7139 9367 CDS product phosphoribosylformylglycinamidine synthase subunit PurL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932909.1 protein_id gnl|my_center|LOCUS_02610 9387 11846 gene locus_tag LOCUS_02620 9387 11846 CDS product bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038503907.1 protein_id gnl|my_center|LOCUS_02620 >Feature sequence021 829 383 gene locus_tag LOCUS_02630 829 383 CDS product DUF2147 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001043223.1 protein_id gnl|my_center|LOCUS_02630 1591 1001 gene locus_tag LOCUS_02640 1591 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02640 1884 4133 gene locus_tag LOCUS_02650 1884 4133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071268.1 protein_id gnl|my_center|LOCUS_02650 5405 4854 gene locus_tag LOCUS_02660 5405 4854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 6639 5539 gene locus_tag LOCUS_02670 6639 5539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 6834 8951 gene locus_tag LOCUS_02680 6834 8951 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555778.1 protein_id gnl|my_center|LOCUS_02680 8941 9717 gene locus_tag LOCUS_02690 8941 9717 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404226.1 protein_id gnl|my_center|LOCUS_02690 9942 10460 gene locus_tag LOCUS_02700 9942 10460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02700 10467 11129 gene locus_tag LOCUS_02710 10467 11129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 >Feature sequence022 247 942 gene locus_tag LOCUS_02720 247 942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 949 3348 gene locus_tag LOCUS_02730 949 3348 CDS product tyrosine-protein kinase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963430.1 protein_id gnl|my_center|LOCUS_02730 3357 4409 gene locus_tag LOCUS_02740 3357 4409 CDS product MraY family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391762.1 protein_id gnl|my_center|LOCUS_02740 4464 5420 gene locus_tag LOCUS_02750 4464 5420 CDS product lytic transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964115.1 protein_id gnl|my_center|LOCUS_02750 5432 8272 gene locus_tag LOCUS_02760 gene uvrA 5432 8272 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032813763.1 protein_id gnl|my_center|LOCUS_02760 8864 8301 gene locus_tag LOCUS_02770 gene tsaB 8864 8301 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766373.1 protein_id gnl|my_center|LOCUS_02770 8746 9003 gene locus_tag LOCUS_02780 8746 9003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02780 10339 9011 gene locus_tag LOCUS_02790 10339 9011 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964215.1 protein_id gnl|my_center|LOCUS_02790 11610 10342 gene locus_tag LOCUS_02800 11610 10342 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108315.1 protein_id gnl|my_center|LOCUS_02800 >Feature sequence023 <1 617 gene locus_tag LOCUS_02810 <1 617 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788170.1:CTP synthase 623 2521 gene locus_tag LOCUS_02820 gene yidC 623 2521 CDS product membrane protein insertase YidC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005815482.1 protein_id gnl|my_center|LOCUS_02820 2677 3273 gene locus_tag LOCUS_02830 2677 3273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02830 3411 5237 gene locus_tag LOCUS_02840 3411 5237 CDS product long-chain fatty acid--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026955981.1 protein_id gnl|my_center|LOCUS_02840 5516 5325 gene locus_tag LOCUS_02850 5516 5325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 7978 5516 gene locus_tag LOCUS_02860 gene feoB 7978 5516 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931750.1 protein_id gnl|my_center|LOCUS_02860 8088 8831 gene locus_tag LOCUS_02870 8088 8831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02870 10031 9072 gene locus_tag LOCUS_02880 10031 9072 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002680669.1 protein_id gnl|my_center|LOCUS_02880 <11817 10487 gene locus_tag LOCUS_02890 <11817 10487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964414.1:aldehyde dehydrogenase family protein >Feature sequence024 2208 1090 gene locus_tag LOCUS_02900 2208 1090 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001221646.1 protein_id gnl|my_center|LOCUS_02900 2347 3768 gene locus_tag LOCUS_02910 2347 3768 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082217.1 protein_id gnl|my_center|LOCUS_02910 3855 5135 gene locus_tag LOCUS_02920 3855 5135 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787540.1 protein_id gnl|my_center|LOCUS_02920 5262 6038 gene locus_tag LOCUS_02930 5262 6038 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083192.1 protein_id gnl|my_center|LOCUS_02930 6115 6450 gene locus_tag LOCUS_02940 6115 6450 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005816569.1 protein_id gnl|my_center|LOCUS_02940 8518 6725 gene locus_tag LOCUS_02950 8518 6725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02950 8609 9715 gene locus_tag LOCUS_02960 gene amrB 8609 9715 CDS product AmmeMemoRadiSam system protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_226986781.1 protein_id gnl|my_center|LOCUS_02960 9798 10901 gene locus_tag LOCUS_02970 gene ychF 9798 10901 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108642.1 protein_id gnl|my_center|LOCUS_02970 11745 10891 gene locus_tag LOCUS_02980 11745 10891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 >Feature sequence025 <1 1270 gene locus_tag LOCUS_02990 <1 1270 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107369.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD 2049 1273 gene locus_tag LOCUS_03000 2049 1273 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03000 2833 2030 gene locus_tag LOCUS_03010 2833 2030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03010 3632 2844 gene locus_tag LOCUS_03020 gene cdaA 3632 2844 CDS product diadenylate cyclase CdaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779023.1 protein_id gnl|my_center|LOCUS_03020 4157 4639 gene locus_tag LOCUS_03030 4157 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 6472 5057 gene locus_tag LOCUS_03040 6472 5057 CDS product transglycosylase SLT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107154.1 protein_id gnl|my_center|LOCUS_03040 7365 6577 gene locus_tag LOCUS_03050 7365 6577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 8206 7589 gene locus_tag LOCUS_03060 8206 7589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03060 8214 8858 gene locus_tag LOCUS_03070 gene pyrE 8214 8858 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784381.1 protein_id gnl|my_center|LOCUS_03070 8858 9256 gene locus_tag LOCUS_03080 8858 9256 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 9321 9734 gene locus_tag LOCUS_03090 9321 9734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03090 9890 10657 gene locus_tag LOCUS_03100 9890 10657 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963559.1 protein_id gnl|my_center|LOCUS_03100 >Feature sequence026 <1 4596 gene locus_tag LOCUS_03110 <1 4596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963026.1:oligopeptidase B 5281 4781 gene locus_tag LOCUS_03120 5281 4781 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 6377 5352 gene locus_tag LOCUS_03130 6377 5352 CDS product acyl-CoA reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962802.1 protein_id gnl|my_center|LOCUS_03130 6793 6377 gene locus_tag LOCUS_03140 6793 6377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03140 7266 7934 gene locus_tag LOCUS_03150 7266 7934 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009994756.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_03150 8483 8935 gene locus_tag LOCUS_03160 8483 8935 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03160 9270 9977 gene locus_tag LOCUS_03170 9270 9977 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03170 >Feature sequence027 118 2061 gene locus_tag LOCUS_03180 118 2061 CDS product DUF3857 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203669.1 protein_id gnl|my_center|LOCUS_03180 2085 3941 gene locus_tag LOCUS_03190 2085 3941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03190 5327 4254 gene locus_tag LOCUS_03200 5327 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 5777 5331 gene locus_tag LOCUS_03210 5777 5331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 7970 6381 gene locus_tag LOCUS_03220 7970 6381 CDS product C69 family dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767963.1 protein_id gnl|my_center|LOCUS_03220 9616 8090 gene locus_tag LOCUS_03230 9616 8090 CDS product DUF4301 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787470.1 protein_id gnl|my_center|LOCUS_03230 10345 10533 gene locus_tag LOCUS_03240 10345 10533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03240 >Feature sequence028 939 115 gene locus_tag LOCUS_03250 939 115 CDS product gluconate 5-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002362994.1 protein_id gnl|my_center|LOCUS_03250 1812 967 gene locus_tag LOCUS_03260 gene kduI 1812 967 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762839.1 protein_id gnl|my_center|LOCUS_03260 3178 1874 gene locus_tag LOCUS_03270 3178 1874 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994211.1 protein_id gnl|my_center|LOCUS_03270 4656 3190 gene locus_tag LOCUS_03280 gene gnd 4656 3190 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107660.1 protein_id gnl|my_center|LOCUS_03280 5755 4676 gene locus_tag LOCUS_03290 5755 4676 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007338792.1 protein_id gnl|my_center|LOCUS_03290 6622 5771 gene locus_tag LOCUS_03300 6622 5771 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005668002.1 protein_id gnl|my_center|LOCUS_03300 7698 6619 gene locus_tag LOCUS_03310 7698 6619 CDS product substrate-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_061474082.1 protein_id gnl|my_center|LOCUS_03310 >Feature sequence029 <1 1912 gene locus_tag LOCUS_03320 <1 1912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004552911.1:trimeric autotransporter adhesin BpaB 2195 3553 gene locus_tag LOCUS_03330 2195 3553 CDS product saccharopine dehydrogenase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964462.1 protein_id gnl|my_center|LOCUS_03330 4729 3707 gene locus_tag LOCUS_03340 4729 3707 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759752.1 protein_id gnl|my_center|LOCUS_03340 5460 4708 gene locus_tag LOCUS_03350 5460 4708 CDS product lipid A biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963017.1 protein_id gnl|my_center|LOCUS_03350 6623 5928 gene locus_tag LOCUS_03360 6623 5928 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108487.1 protein_id gnl|my_center|LOCUS_03360 6708 7025 gene locus_tag LOCUS_03370 gene trxA 6708 7025 CDS product thioredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962434.1 protein_id gnl|my_center|LOCUS_03370 7080 8000 gene locus_tag LOCUS_03380 7080 8000 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962433.1 protein_id gnl|my_center|LOCUS_03380 >Feature sequence030 1455 199 gene locus_tag LOCUS_03390 1455 199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03390 4028 1488 gene locus_tag LOCUS_03400 4028 1488 CDS product ATP-dependent Clp protease ATP-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962906.1 protein_id gnl|my_center|LOCUS_03400 4102 6660 gene locus_tag LOCUS_03410 gene gyrA 4102 6660 CDS product DNA gyrase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787886.1 protein_id gnl|my_center|LOCUS_03410 6767 8038 gene locus_tag LOCUS_03420 6767 8038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 8143 9030 gene locus_tag LOCUS_03430 8143 9030 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963928.1 protein_id gnl|my_center|LOCUS_03430 9069 10184 gene locus_tag LOCUS_03440 9069 10184 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence031 757 566 gene locus_tag LOCUS_03450 757 566 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03450 1563 862 gene locus_tag LOCUS_03460 1563 862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03460 2642 1560 gene locus_tag LOCUS_03470 gene mnmA 2642 1560 CDS product tRNA 2-thiouridine(34) synthase MnmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405206.1 protein_id gnl|my_center|LOCUS_03470 3499 2642 gene locus_tag LOCUS_03480 3499 2642 CDS product toxin-antitoxin system YwqK family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005895335.1 protein_id gnl|my_center|LOCUS_03480 4750 3773 gene locus_tag LOCUS_03490 4750 3773 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762649.1 protein_id gnl|my_center|LOCUS_03490 9155 4941 gene locus_tag LOCUS_03500 9155 4941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03500 10266 9400 gene locus_tag LOCUS_03510 10266 9400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03510 >Feature sequence032 <1 1729 gene locus_tag LOCUS_03520 <1 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791939.1:tetratricopeptide repeat protein 1815 2069 gene locus_tag LOCUS_03530 1815 2069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787898.1 protein_id gnl|my_center|LOCUS_03530 2156 2710 gene locus_tag LOCUS_03540 2156 2710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03540 2840 3226 gene locus_tag LOCUS_03550 2840 3226 CDS product START-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964105.1 protein_id gnl|my_center|LOCUS_03550 3281 4735 gene locus_tag LOCUS_03560 3281 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03560 4732 5925 gene locus_tag LOCUS_03570 4732 5925 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259615.1 protein_id gnl|my_center|LOCUS_03570 5972 7075 gene locus_tag LOCUS_03580 5972 7075 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 7141 8268 gene locus_tag LOCUS_03590 7141 8268 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947961.1 protein_id gnl|my_center|LOCUS_03590 9527 8292 gene locus_tag LOCUS_03600 9527 8292 CDS product competence/damage-inducible protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963555.1 protein_id gnl|my_center|LOCUS_03600 10224 9895 gene locus_tag LOCUS_03610 10224 9895 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 >Feature sequence033 912 103 gene locus_tag LOCUS_03620 912 103 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102407668.1 protein_id gnl|my_center|LOCUS_03620 2166 925 gene locus_tag LOCUS_03630 2166 925 CDS product nucleoside permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767999.1 protein_id gnl|my_center|LOCUS_03630 2733 2260 gene locus_tag LOCUS_03640 2733 2260 CDS product DUF4294 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048698124.1 protein_id gnl|my_center|LOCUS_03640 4467 2980 gene locus_tag LOCUS_03650 gene accC 4467 2980 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403246.1 protein_id gnl|my_center|LOCUS_03650 4710 4480 gene locus_tag LOCUS_03660 4710 4480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03660 5617 4739 gene locus_tag LOCUS_03670 gene lipA 5617 4739 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767975.1 protein_id gnl|my_center|LOCUS_03670 6386 5622 gene locus_tag LOCUS_03680 6386 5622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 7078 6452 gene locus_tag LOCUS_03690 7078 6452 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 8198 7230 gene locus_tag LOCUS_03700 8198 7230 CDS product DUF4837 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764535.1 protein_id gnl|my_center|LOCUS_03700 9690 8509 gene locus_tag LOCUS_03710 gene megL 9690 8509 CDS product methionine gamma-lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011017138.1 protein_id gnl|my_center|LOCUS_03710 >Feature sequence034 <1 869 gene locus_tag LOCUS_03720 <1 869 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963934.1:HAMP domain-containing sensor histidine kinase 847 1548 gene locus_tag LOCUS_03730 847 1548 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790952.1 protein_id gnl|my_center|LOCUS_03730 1600 2625 gene locus_tag LOCUS_03740 gene ruvB 1600 2625 CDS product Holliday junction branch migration DNA helicase RuvB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783731.1 protein_id gnl|my_center|LOCUS_03740 2698 3492 gene locus_tag LOCUS_03750 2698 3492 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797949.1 protein_id gnl|my_center|LOCUS_03750 5893 3527 gene locus_tag LOCUS_03760 5893 3527 CDS product MMPL family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964341.1 protein_id gnl|my_center|LOCUS_03760 6019 7848 gene locus_tag LOCUS_03770 6019 7848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03770 <10026 7903 gene locus_tag LOCUS_03780 <10026 7903 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005813448.1:TonB-dependent receptor >Feature sequence035 3677 1188 gene locus_tag LOCUS_03790 3677 1188 CDS product outer membrane beta-barrel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963618.1 protein_id gnl|my_center|LOCUS_03790 5103 3769 gene locus_tag LOCUS_03800 gene accC 5103 3769 CDS product acetyl-CoA carboxylase biotin carboxylase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964466.1 protein_id gnl|my_center|LOCUS_03800 5592 5113 gene locus_tag LOCUS_03810 gene accB 5592 5113 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964467.1 protein_id gnl|my_center|LOCUS_03810 6624 5620 gene locus_tag LOCUS_03820 6624 5620 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791878.1 protein_id gnl|my_center|LOCUS_03820 7567 6611 gene locus_tag LOCUS_03830 gene plsX 7567 6611 CDS product phosphate acyltransferase PlsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583799.1 protein_id gnl|my_center|LOCUS_03830 7768 7583 gene locus_tag LOCUS_03840 gene rpmF 7768 7583 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964469.1 protein_id gnl|my_center|LOCUS_03840 8303 7782 gene locus_tag LOCUS_03850 8303 7782 CDS product DUF177 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964470.1 protein_id gnl|my_center|LOCUS_03850 9956 8466 gene locus_tag LOCUS_03860 9956 8466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 >Feature sequence036 577 505 gene locus_tag LOCUS_t00100 577 505 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 1025 609 gene locus_tag LOCUS_03870 1025 609 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933658.1 protein_id gnl|my_center|LOCUS_03870 1124 2518 gene locus_tag LOCUS_03880 1124 2518 CDS product decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963818.1 protein_id gnl|my_center|LOCUS_03880 2826 3188 gene locus_tag LOCUS_03890 gene rsfS 2826 3188 CDS product ribosome silencing factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962763.1 protein_id gnl|my_center|LOCUS_03890 3203 5272 gene locus_tag LOCUS_03900 gene ftsH 3203 5272 CDS product ATP-dependent zinc metalloprotease FtsH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784860.1 protein_id gnl|my_center|LOCUS_03900 5276 5914 gene locus_tag LOCUS_03910 5276 5914 CDS product lactate utilization protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015944374.1 protein_id gnl|my_center|LOCUS_03910 5932 6147 gene locus_tag LOCUS_03920 5932 6147 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03920 6140 7042 gene locus_tag LOCUS_03930 6140 7042 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796208.1 protein_id gnl|my_center|LOCUS_03930 7055 7714 gene locus_tag LOCUS_03940 7055 7714 CDS product phosphatidylserine decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962767.1 protein_id gnl|my_center|LOCUS_03940 8951 7719 gene locus_tag LOCUS_03950 8951 7719 CDS product SpoIIE family protein phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_225866427.1 protein_id gnl|my_center|LOCUS_03950 9887 8955 gene locus_tag LOCUS_03960 9887 8955 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963121.1 protein_id gnl|my_center|LOCUS_03960 >Feature sequence037 7 3708 gene locus_tag LOCUS_03970 gene porU 7 3708 CDS product type IX secretion system sortase PorU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963516.1 protein_id gnl|my_center|LOCUS_03970 3762 5018 gene locus_tag LOCUS_03980 gene porV 3762 5018 CDS product type IX secretion system outer membrane channel protein PorV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963515.1 protein_id gnl|my_center|LOCUS_03980 5011 5502 gene locus_tag LOCUS_03990 gene ispF 5011 5502 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003225745.1 protein_id gnl|my_center|LOCUS_03990 5787 6146 gene locus_tag LOCUS_04000 5787 6146 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963434.1 protein_id gnl|my_center|LOCUS_04000 6292 6819 gene locus_tag LOCUS_04010 6292 6819 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04010 6819 7772 gene locus_tag LOCUS_04020 6819 7772 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760322.1 protein_id gnl|my_center|LOCUS_04020 9173 7920 gene locus_tag LOCUS_04030 9173 7920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208108.1 protein_id gnl|my_center|LOCUS_04030 <9851 9352 gene locus_tag LOCUS_04040 <9851 9352 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679769.1:outer membrane lipoprotein-sorting protein >Feature sequence038 129 2138 gene locus_tag LOCUS_04050 gene ligA 129 2138 CDS product NAD-dependent DNA ligase LigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765723.1 protein_id gnl|my_center|LOCUS_04050 2184 3107 gene locus_tag LOCUS_04060 2184 3107 CDS product DUF3078 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107713.1 protein_id gnl|my_center|LOCUS_04060 5348 3108 gene locus_tag LOCUS_04070 5348 3108 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962686.1 protein_id gnl|my_center|LOCUS_04070 6739 9831 gene locus_tag LOCUS_04080 6739 9831 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962684.1 protein_id gnl|my_center|LOCUS_04080 >Feature sequence039 1138 2766 gene locus_tag LOCUS_04090 1138 2766 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963147.1 protein_id gnl|my_center|LOCUS_04090 2912 4693 gene locus_tag LOCUS_04100 2912 4693 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073062727.1 protein_id gnl|my_center|LOCUS_04100 4690 5493 gene locus_tag LOCUS_04110 gene cysQ 4690 5493 CDS product 3'(2'),5'-bisphosphate nucleotidase CysQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786528.1 protein_id gnl|my_center|LOCUS_04110 5530 6204 gene locus_tag LOCUS_04120 5530 6204 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04120 6319 7263 gene locus_tag LOCUS_04130 6319 7263 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759891.1 protein_id gnl|my_center|LOCUS_04130 7266 8660 gene locus_tag LOCUS_04140 gene mnmE 7266 8660 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109330.1 protein_id gnl|my_center|LOCUS_04140 8700 9545 gene locus_tag LOCUS_04150 8700 9545 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04150 >Feature sequence040 275 1675 gene locus_tag LOCUS_04160 gene uxaC 275 1675 CDS product glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793937.1 protein_id gnl|my_center|LOCUS_04160 1684 2715 gene locus_tag LOCUS_04170 1684 2715 CDS product sugar kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391957.1 protein_id gnl|my_center|LOCUS_04170 2690 4015 gene locus_tag LOCUS_04180 2690 4015 CDS product lactate racemase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007334376.1 protein_id gnl|my_center|LOCUS_04180 4027 4701 gene locus_tag LOCUS_04190 4027 4701 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763050.1 protein_id gnl|my_center|LOCUS_04190 4706 5524 gene locus_tag LOCUS_04200 gene larE 4706 5524 CDS product ATP-dependent sacrificial sulfur transferase LarE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393988.1 protein_id gnl|my_center|LOCUS_04200 5526 6188 gene locus_tag LOCUS_04210 gene larB 5526 6188 CDS product nickel pincer cofactor biosynthesis protein LarB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011947959.1 protein_id gnl|my_center|LOCUS_04210 6181 7281 gene locus_tag LOCUS_04220 gene larC 6181 7281 CDS product nickel pincer cofactor biosynthesis protein LarC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583893.1 protein_id gnl|my_center|LOCUS_04220 7348 8565 gene locus_tag LOCUS_04230 7348 8565 CDS product DUF4861 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201856.1 protein_id gnl|my_center|LOCUS_04230 >Feature sequence041 294 1880 gene locus_tag LOCUS_04240 294 1880 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_04240 2473 5082 gene locus_tag LOCUS_04250 gene mutS 2473 5082 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203750.1 protein_id gnl|my_center|LOCUS_04250 5141 6322 gene locus_tag LOCUS_04260 5141 6322 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932730.1 protein_id gnl|my_center|LOCUS_04260 9389 6618 gene locus_tag LOCUS_04270 9389 6618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04270 >Feature sequence042 1 3003 gene locus_tag LOCUS_04280 1 3003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04280 3187 3960 gene locus_tag LOCUS_04290 3187 3960 CDS product AMP nucleosidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787839.1 protein_id gnl|my_center|LOCUS_04290 4613 3966 gene locus_tag LOCUS_04300 4613 3966 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 7400 4797 gene locus_tag LOCUS_04310 7400 4797 CDS product DNA gyrase/topoisomerase IV subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048696320.1 protein_id gnl|my_center|LOCUS_04310 9259 7436 gene locus_tag LOCUS_04320 9259 7436 CDS product DNA topoisomerase IV subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962807.1 protein_id gnl|my_center|LOCUS_04320 >Feature sequence043 1877 318 gene locus_tag LOCUS_04330 gene gltX 1877 318 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791502.1 protein_id gnl|my_center|LOCUS_04330 2429 4198 gene locus_tag LOCUS_04340 gene argS 2429 4198 CDS product arginine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005797416.1 protein_id gnl|my_center|LOCUS_04340 4341 5738 gene locus_tag LOCUS_04350 gene lpdA 4341 5738 CDS product dihydrolipoyl dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962865.1 protein_id gnl|my_center|LOCUS_04350 7363 6248 gene locus_tag LOCUS_04360 7363 6248 CDS product bifunctional 3-deoxy-7-phosphoheptulonate synthase/chorismate mutase type II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791103.1 protein_id gnl|my_center|LOCUS_04360 9117 7339 gene locus_tag LOCUS_04370 9117 7339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04370 >Feature sequence044 1493 24 gene locus_tag LOCUS_04380 gene guaB 1493 24 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791859.1 protein_id gnl|my_center|LOCUS_04380 1672 4119 gene locus_tag LOCUS_04390 gene pheT 1672 4119 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202920.1 protein_id gnl|my_center|LOCUS_04390 4119 4628 gene locus_tag LOCUS_04400 4119 4628 CDS product O-acetyl-ADP-ribose deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933872.1 protein_id gnl|my_center|LOCUS_04400 4628 5506 gene locus_tag LOCUS_04410 gene ubiA 4628 5506 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941108.1 protein_id gnl|my_center|LOCUS_04410 6466 5525 gene locus_tag LOCUS_04420 gene rsgA 6466 5525 CDS product ribosome small subunit-dependent GTPase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202106.1 protein_id gnl|my_center|LOCUS_04420 7406 6456 gene locus_tag LOCUS_04430 7406 6456 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784031.1 protein_id gnl|my_center|LOCUS_04430 8251 7403 gene locus_tag LOCUS_04440 8251 7403 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108841.1 protein_id gnl|my_center|LOCUS_04440 8770 9225 gene locus_tag LOCUS_04450 gene mraZ 8770 9225 CDS product division/cell wall cluster transcriptional repressor MraZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763721.1 protein_id gnl|my_center|LOCUS_04450 >Feature sequence045 136 750 gene locus_tag LOCUS_04460 136 750 CDS product deoxynucleoside kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962436.1 protein_id gnl|my_center|LOCUS_04460 870 1649 gene locus_tag LOCUS_04470 870 1649 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963856.1 protein_id gnl|my_center|LOCUS_04470 1701 4403 gene locus_tag LOCUS_04480 1701 4403 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_04480 4415 5542 gene locus_tag LOCUS_04490 gene recF 4415 5542 CDS product DNA replication and repair protein RecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964102.1 protein_id gnl|my_center|LOCUS_04490 5526 5822 gene locus_tag LOCUS_04500 5526 5822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 6201 7577 gene locus_tag LOCUS_04510 6201 7577 CDS product tryptophanase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107821.1 protein_id gnl|my_center|LOCUS_04510 >Feature sequence046 2421 325 gene locus_tag LOCUS_04520 2421 325 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202942.1 protein_id gnl|my_center|LOCUS_04520 3717 2485 gene locus_tag LOCUS_04530 3717 2485 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 2499 2508 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 5509 4049 gene locus_tag LOCUS_04540 5509 4049 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005798834.1 protein_id gnl|my_center|LOCUS_04540 >Feature sequence047 2873 1095 gene locus_tag LOCUS_04550 2873 1095 CDS product putative porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963329.1 protein_id gnl|my_center|LOCUS_04550 3592 2909 gene locus_tag LOCUS_04560 3592 2909 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109021.1 protein_id gnl|my_center|LOCUS_04560 3721 4167 gene locus_tag LOCUS_04570 3721 4167 CDS product cold shock domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009292665.1 protein_id gnl|my_center|LOCUS_04570 4684 5862 gene locus_tag LOCUS_04580 4684 5862 CDS product AIR synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764417.1 protein_id gnl|my_center|LOCUS_04580 5865 6959 gene locus_tag LOCUS_04590 gene prfA 5865 6959 CDS product peptide chain release factor 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964025.1 protein_id gnl|my_center|LOCUS_04590 7071 7892 gene locus_tag LOCUS_04600 gene pyrF 7071 7892 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202194.1 protein_id gnl|my_center|LOCUS_04600 7996 8745 gene locus_tag LOCUS_04610 7996 8745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 >Feature sequence048 954 370 gene locus_tag LOCUS_04620 954 370 CDS product electron transport complex subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788152.1 protein_id gnl|my_center|LOCUS_04620 1534 956 gene locus_tag LOCUS_04630 1534 956 CDS product RnfABCDGE type electron transport complex subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202941.1 protein_id gnl|my_center|LOCUS_04630 2528 1527 gene locus_tag LOCUS_04640 2528 1527 CDS product RnfABCDGE type electron transport complex subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788156.1 protein_id gnl|my_center|LOCUS_04640 3868 2525 gene locus_tag LOCUS_04650 gene rsxC 3868 2525 CDS product electron transport complex subunit RsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788158.1 protein_id gnl|my_center|LOCUS_04650 4834 3872 gene locus_tag LOCUS_04660 4834 3872 CDS product Fe-S cluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788160.1 protein_id gnl|my_center|LOCUS_04660 5252 4839 gene locus_tag LOCUS_04670 5252 4839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 5947 5324 gene locus_tag LOCUS_04680 5947 5324 CDS product LysE family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767802.1 protein_id gnl|my_center|LOCUS_04680 7453 6047 gene locus_tag LOCUS_04690 gene radA 7453 6047 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784538.1 protein_id gnl|my_center|LOCUS_04690 7796 7401 gene locus_tag LOCUS_04700 7796 7401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 8452 7961 gene locus_tag LOCUS_04710 8452 7961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 <9109 8439 gene locus_tag LOCUS_04720 <9109 8439 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_073173113.1:lysylphosphatidylglycerol synthase transmembrane domain-containing protein >Feature sequence049 1892 201 gene locus_tag LOCUS_04730 1892 201 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_04730 4490 2004 gene locus_tag LOCUS_04740 4490 2004 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04740 4605 6614 gene locus_tag LOCUS_04750 4605 6614 CDS product urocanate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964061.1 protein_id gnl|my_center|LOCUS_04750 6656 8584 gene locus_tag LOCUS_04760 6656 8584 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 >Feature sequence050 66 299 gene locus_tag LOCUS_04770 66 299 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760626.1 protein_id gnl|my_center|LOCUS_04770 317 1405 gene locus_tag LOCUS_04780 317 1405 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit VorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786497.1 protein_id gnl|my_center|LOCUS_04780 1409 2206 gene locus_tag LOCUS_04790 1409 2206 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760623.1 protein_id gnl|my_center|LOCUS_04790 2218 2769 gene locus_tag LOCUS_04800 2218 2769 CDS product 2-oxoacid:acceptor oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760622.1 protein_id gnl|my_center|LOCUS_04800 4762 2831 gene locus_tag LOCUS_04810 gene dnaG 4762 2831 CDS product DNA primase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802118.1 protein_id gnl|my_center|LOCUS_04810 5311 7119 gene locus_tag LOCUS_04820 gene typA 5311 7119 CDS product translational GTPase TypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108480.1 protein_id gnl|my_center|LOCUS_04820 <9051 7276 gene locus_tag LOCUS_04830 <9051 7276 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765523.1:pyruvate, phosphate dikinase >Feature sequence051 1066 1290 gene locus_tag LOCUS_04840 1066 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 1236 2237 gene locus_tag LOCUS_04850 gene pta 1236 2237 CDS product phosphate acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796541.1 protein_id gnl|my_center|LOCUS_04850 2292 3266 gene locus_tag LOCUS_04860 2292 3266 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088963.1 protein_id gnl|my_center|LOCUS_04860 3564 4709 gene locus_tag LOCUS_04870 3564 4709 CDS product acetate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762632.1 protein_id gnl|my_center|LOCUS_04870 4726 5622 gene locus_tag LOCUS_04880 4726 5622 CDS product phosphate butyryltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012048127.1 protein_id gnl|my_center|LOCUS_04880 5901 7001 gene locus_tag LOCUS_04890 gene buk 5901 7001 CDS product butyrate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003420702.1 protein_id gnl|my_center|LOCUS_04890 7856 7104 gene locus_tag LOCUS_04900 7856 7104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04900 7920 8810 gene locus_tag LOCUS_04910 7920 8810 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963784.1 protein_id gnl|my_center|LOCUS_04910 >Feature sequence052 97 2523 gene locus_tag LOCUS_04920 97 2523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 8659 2537 gene locus_tag LOCUS_04930 8659 2537 CDS product alpha-2-macroglobulin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122194.1 protein_id gnl|my_center|LOCUS_04930 >Feature sequence053 <1 777 gene locus_tag LOCUS_04940 <1 777 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762821.1:tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA 780 1547 gene locus_tag LOCUS_04950 780 1547 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011260929.1 protein_id gnl|my_center|LOCUS_04950 1616 1703 gene locus_tag LOCUS_t00110 1616 1703 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 1741 2586 gene locus_tag LOCUS_04960 1741 2586 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790652.1 protein_id gnl|my_center|LOCUS_04960 2593 3006 gene locus_tag LOCUS_04970 2593 3006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790650.1 protein_id gnl|my_center|LOCUS_04970 3061 3642 gene locus_tag LOCUS_04980 3061 3642 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790648.1 protein_id gnl|my_center|LOCUS_04980 3644 4117 gene locus_tag LOCUS_04990 3644 4117 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781259.1 protein_id gnl|my_center|LOCUS_04990 5165 4188 gene locus_tag LOCUS_05000 5165 4188 CDS product GSCFA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964056.1 protein_id gnl|my_center|LOCUS_05000 5827 5168 gene locus_tag LOCUS_05010 5827 5168 CDS product porin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962497.1 protein_id gnl|my_center|LOCUS_05010 6108 8354 gene locus_tag LOCUS_05020 6108 8354 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790607.1 protein_id gnl|my_center|LOCUS_05020 >Feature sequence054 259 1860 gene locus_tag LOCUS_05030 259 1860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05030 1862 3448 gene locus_tag LOCUS_05040 1862 3448 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05040 3598 5664 gene locus_tag LOCUS_05050 gene htpG 3598 5664 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765725.1 protein_id gnl|my_center|LOCUS_05050 7011 5866 gene locus_tag LOCUS_05060 7011 5866 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765918.1 protein_id gnl|my_center|LOCUS_05060 8557 7037 gene locus_tag LOCUS_05070 8557 7037 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002858826.1 protein_id gnl|my_center|LOCUS_05070 >Feature sequence055 <1 840 gene locus_tag LOCUS_05080 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002079012.1:protein-glutamate O-methyltransferase CheR 844 1416 gene locus_tag LOCUS_05090 844 1416 CDS product chemotaxis protein CheB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104154.1 protein_id gnl|my_center|LOCUS_05090 1639 2532 gene locus_tag LOCUS_05100 1639 2532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05100 2557 2967 gene locus_tag LOCUS_05110 2557 2967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05110 3034 4074 gene locus_tag LOCUS_05120 gene thiL 3034 4074 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964415.1 protein_id gnl|my_center|LOCUS_05120 4537 4612 gene locus_tag LOCUS_t00120 4537 4612 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 4627 5058 gene locus_tag LOCUS_05130 4627 5058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 <8772 5089 gene locus_tag LOCUS_05140 <8772 5089 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000449386.1:adenylate/guanylate cyclase domain-containing protein >Feature sequence056 <1 1323 gene locus_tag LOCUS_05150 <1 1323 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963312.1:DNA-directed RNA polymerase subunit beta 1348 5607 gene locus_tag LOCUS_05160 gene rpoC 1348 5607 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804126.1 protein_id gnl|my_center|LOCUS_05160 5615 5929 gene locus_tag LOCUS_05170 5615 5929 CDS product DUF3467 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762031.1 protein_id gnl|my_center|LOCUS_05170 7004 5961 gene locus_tag LOCUS_05180 gene pdxA 7004 5961 CDS product 4-hydroxythreonine-4-phosphate dehydrogenase PdxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760044.1 protein_id gnl|my_center|LOCUS_05180 8758 7301 gene locus_tag LOCUS_05190 8758 7301 CDS product leucyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932852.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence057 530 1222 gene locus_tag LOCUS_05200 530 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05200 1242 1811 gene locus_tag LOCUS_05210 1242 1811 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05210 1808 2488 gene locus_tag LOCUS_05220 gene rsmI 1808 2488 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108201.1 protein_id gnl|my_center|LOCUS_05220 2697 3194 gene locus_tag LOCUS_05230 2697 3194 CDS product Fic/DOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215631.1 protein_id gnl|my_center|LOCUS_05230 3318 4190 gene locus_tag LOCUS_05240 3318 4190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784668.1 protein_id gnl|my_center|LOCUS_05240 4194 5531 gene locus_tag LOCUS_05250 gene trkA 4194 5531 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785058.1 protein_id gnl|my_center|LOCUS_05250 5559 7004 gene locus_tag LOCUS_05260 5559 7004 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658690.1 protein_id gnl|my_center|LOCUS_05260 8133 7024 gene locus_tag LOCUS_05270 8133 7024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 <8686 8133 gene locus_tag LOCUS_05280 <8686 8133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005794507.1:C1 family peptidase >Feature sequence058 <1 1002 gene locus_tag LOCUS_05290 <1 1002 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962330.1:aminopeptidase P family protein 1173 1098 gene locus_tag LOCUS_t00130 1173 1098 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1958 1883 gene locus_tag LOCUS_t00140 1958 1883 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4338 2278 gene locus_tag LOCUS_05300 4338 2278 CDS product M13 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037840.1 protein_id gnl|my_center|LOCUS_05300 4435 7386 gene locus_tag LOCUS_05310 4435 7386 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05310 <8633 7644 gene locus_tag LOCUS_05320 <8633 7644 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022343.1:helix-turn-helix domain-containing protein >Feature sequence059 96 1094 gene locus_tag LOCUS_05330 96 1094 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964536.1 protein_id gnl|my_center|LOCUS_05330 1146 2216 gene locus_tag LOCUS_05340 gene porQ 1146 2216 CDS product type IX secretion system protein PorQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963823.1 protein_id gnl|my_center|LOCUS_05340 2235 3209 gene locus_tag LOCUS_05350 2235 3209 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 3260 4048 gene locus_tag LOCUS_05360 3260 4048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 4073 4765 gene locus_tag LOCUS_05370 4073 4765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05370 4758 5507 gene locus_tag LOCUS_05380 4758 5507 CDS product isoprenyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766989.1 protein_id gnl|my_center|LOCUS_05380 5500 7974 gene locus_tag LOCUS_05390 gene bamA 5500 7974 CDS product outer membrane protein assembly factor BamA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100221.1 protein_id gnl|my_center|LOCUS_05390 7991 8500 gene locus_tag LOCUS_05400 7991 8500 CDS product OmpH family outer membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784368.1 protein_id gnl|my_center|LOCUS_05400 >Feature sequence060 596 1570 gene locus_tag LOCUS_05410 596 1570 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796222.1 protein_id gnl|my_center|LOCUS_05410 1583 1933 gene locus_tag LOCUS_05420 1583 1933 CDS product MerR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784840.1 protein_id gnl|my_center|LOCUS_05420 1920 3014 gene locus_tag LOCUS_05430 1920 3014 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202852.1 protein_id gnl|my_center|LOCUS_05430 3018 3908 gene locus_tag LOCUS_05440 3018 3908 CDS product C4-type zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787827.1 protein_id gnl|my_center|LOCUS_05440 4378 3932 gene locus_tag LOCUS_05450 4378 3932 CDS product acyl-CoA thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109028.1 protein_id gnl|my_center|LOCUS_05450 6261 4396 gene locus_tag LOCUS_05460 6261 4396 CDS product nucleoside-diphosphate sugar epimerase/dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788730.1 protein_id gnl|my_center|LOCUS_05460 7784 6309 gene locus_tag LOCUS_05470 7784 6309 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963503.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence061 191 1018 gene locus_tag LOCUS_05480 191 1018 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 1770 1054 gene locus_tag LOCUS_05490 1770 1054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 3062 1818 gene locus_tag LOCUS_05500 3062 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05500 4382 3111 gene locus_tag LOCUS_05510 4382 3111 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784900.1 protein_id gnl|my_center|LOCUS_05510 5290 6519 gene locus_tag LOCUS_05520 gene purB 5290 6519 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963912.1 protein_id gnl|my_center|LOCUS_05520 6676 8385 gene locus_tag LOCUS_05530 6676 8385 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108810.1 protein_id gnl|my_center|LOCUS_05530 >Feature sequence062 <1 1550 gene locus_tag LOCUS_05540 <1 1550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963261.1:methylmalonyl-CoA mutase 1540 2049 gene locus_tag LOCUS_05550 1540 2049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05550 2257 3048 gene locus_tag LOCUS_05560 2257 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05560 6082 3461 gene locus_tag LOCUS_05570 6082 3461 CDS product adenosylcobalamin-dependent ribonucleoside-diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769973.1 protein_id gnl|my_center|LOCUS_05570 7534 6335 gene locus_tag LOCUS_05580 7534 6335 CDS product glycosyltransferase N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203604.1 protein_id gnl|my_center|LOCUS_05580 8377 7592 gene locus_tag LOCUS_05590 8377 7592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05590 >Feature sequence063 197 808 gene locus_tag LOCUS_05600 197 808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05600 799 1548 gene locus_tag LOCUS_05610 gene kdsB 799 1548 CDS product 3-deoxy-manno-octulosonate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761419.1 protein_id gnl|my_center|LOCUS_05610 2946 1636 gene locus_tag LOCUS_05620 2946 1636 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05620 4273 3029 gene locus_tag LOCUS_05630 4273 3029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05630 6873 4285 gene locus_tag LOCUS_05640 6873 4285 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762511.1 protein_id gnl|my_center|LOCUS_05640 6974 8011 gene locus_tag LOCUS_05650 6974 8011 CDS product endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767132.1 protein_id gnl|my_center|LOCUS_05650 >Feature sequence064 2323 374 gene locus_tag LOCUS_05660 2323 374 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020404386.1 protein_id gnl|my_center|LOCUS_05660 2952 2332 gene locus_tag LOCUS_05670 gene recR 2952 2332 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763508.1 protein_id gnl|my_center|LOCUS_05670 3155 4402 gene locus_tag LOCUS_05680 3155 4402 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964503.1 protein_id gnl|my_center|LOCUS_05680 5828 4599 gene locus_tag LOCUS_05690 5828 4599 CDS product S-adenosylmethionine:tRNA ribosyltransferase-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760889.1 protein_id gnl|my_center|LOCUS_05690 6868 5807 gene locus_tag LOCUS_05700 6868 5807 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962387.1 protein_id gnl|my_center|LOCUS_05700 6967 7311 gene locus_tag LOCUS_05710 6967 7311 CDS product translation initiation factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791744.1 protein_id gnl|my_center|LOCUS_05710 7699 8175 gene locus_tag LOCUS_05720 7699 8175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05720 >Feature sequence065 1366 980 gene locus_tag LOCUS_05730 gene rpsI 1366 980 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791749.1 protein_id gnl|my_center|LOCUS_05730 1889 1368 gene locus_tag LOCUS_05740 gene rplM 1889 1368 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962625.1 protein_id gnl|my_center|LOCUS_05740 2378 1908 gene locus_tag LOCUS_05750 gene gldH 2378 1908 CDS product gliding motility lipoprotein GldH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766923.1 protein_id gnl|my_center|LOCUS_05750 3755 2622 gene locus_tag LOCUS_05760 3755 2622 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05760 4261 3938 gene locus_tag LOCUS_05770 4261 3938 CDS product SUF system Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964475.1 protein_id gnl|my_center|LOCUS_05770 4686 4267 gene locus_tag LOCUS_05780 4686 4267 CDS product SufE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964476.1 protein_id gnl|my_center|LOCUS_05780 5472 4813 gene locus_tag LOCUS_05790 5472 4813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 6119 5562 gene locus_tag LOCUS_05800 gene def 6119 5562 CDS product peptide deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760700.1 protein_id gnl|my_center|LOCUS_05800 6529 6116 gene locus_tag LOCUS_05810 gene ruvX 6529 6116 CDS product Holliday junction resolvase RuvX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963861.1 protein_id gnl|my_center|LOCUS_05810 7855 6542 gene locus_tag LOCUS_05820 gene der 7855 6542 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964065.1 protein_id gnl|my_center|LOCUS_05820 7999 7912 gene locus_tag LOCUS_t00150 7999 7912 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 8083 8010 gene locus_tag LOCUS_t00160 8083 8010 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence066 393 2750 gene locus_tag LOCUS_05830 393 2750 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962850.1 protein_id gnl|my_center|LOCUS_05830 2806 3738 gene locus_tag LOCUS_05840 2806 3738 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05840 3790 4788 gene locus_tag LOCUS_05850 gene trxB 3790 4788 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109204.1 protein_id gnl|my_center|LOCUS_05850 4863 7616 gene locus_tag LOCUS_05860 4863 7616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence067 <1 1974 gene locus_tag LOCUS_05870 <1 1974 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011143425.1:FAD-binding and (Fe-S)-binding domain-containing protein 3366 2632 gene locus_tag LOCUS_05880 3366 2632 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012256749.1 protein_id gnl|my_center|LOCUS_05880 4498 3638 gene locus_tag LOCUS_05890 4498 3638 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05890 5340 4501 gene locus_tag LOCUS_05900 5340 4501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05900 5960 5517 gene locus_tag LOCUS_05910 5960 5517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05910 7053 6043 gene locus_tag LOCUS_05920 7053 6043 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791024.1 protein_id gnl|my_center|LOCUS_05920 >Feature sequence068 51 3539 gene locus_tag LOCUS_05930 gene dnaE 51 3539 CDS product DNA polymerase III subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962512.1 protein_id gnl|my_center|LOCUS_05930 3728 5911 gene locus_tag LOCUS_05940 3728 5911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05940 5927 7315 gene locus_tag LOCUS_05950 5927 7315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962820.1 protein_id gnl|my_center|LOCUS_05950 >Feature sequence069 1689 385 gene locus_tag LOCUS_05960 1689 385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 6298 1757 gene locus_tag LOCUS_05970 6298 1757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 6690 6301 gene locus_tag LOCUS_05980 6690 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05980 7720 6677 gene locus_tag LOCUS_05990 gene rfbB 7720 6677 CDS product dTDP-glucose 4,6-dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932000.1 protein_id gnl|my_center|LOCUS_05990 >Feature sequence070 80 1288 gene locus_tag LOCUS_06000 80 1288 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06000 1415 3580 gene locus_tag LOCUS_06010 1415 3580 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06010 4450 3653 gene locus_tag LOCUS_06020 gene ccsA 4450 3653 CDS product cytochrome c biogenesis protein CcsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933223.1 protein_id gnl|my_center|LOCUS_06020 5659 4451 gene locus_tag LOCUS_06030 5659 4451 CDS product cytochrome c biogenesis protein ResB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107763.1 protein_id gnl|my_center|LOCUS_06030 6411 5659 gene locus_tag LOCUS_06040 6411 5659 CDS product cytochrome b/b6 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940403.1 protein_id gnl|my_center|LOCUS_06040 <8042 6424 gene locus_tag LOCUS_06050 <8042 6424 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940402.1:tetrathionate reductase family octaheme c-type cytochrome >Feature sequence071 1912 527 gene locus_tag LOCUS_06060 1912 527 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06060 3280 2006 gene locus_tag LOCUS_06070 3280 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06070 4133 3426 gene locus_tag LOCUS_06080 4133 3426 CDS product TIGR00730 family Rossman fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963001.1 protein_id gnl|my_center|LOCUS_06080 4238 5281 gene locus_tag LOCUS_06090 4238 5281 CDS product DUF2027 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203494.1 protein_id gnl|my_center|LOCUS_06090 5474 6598 gene locus_tag LOCUS_06100 5474 6598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06100 7277 6588 gene locus_tag LOCUS_06110 gene trmD 7277 6588 CDS product tRNA (guanosine(37)-N1)-methyltransferase TrmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993029.1 protein_id gnl|my_center|LOCUS_06110 <7946 7292 gene locus_tag LOCUS_06120 <7946 7292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531371.1:OmpA family protein >Feature sequence072 1283 177 gene locus_tag LOCUS_06130 1283 177 CDS product IS4 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108005.1 protein_id gnl|my_center|LOCUS_06130 2567 1671 gene locus_tag LOCUS_06140 2567 1671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06140 3320 2574 gene locus_tag LOCUS_06150 3320 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06150 5872 3476 gene locus_tag LOCUS_06160 5872 3476 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768395.1 protein_id gnl|my_center|LOCUS_06160 7784 6339 gene locus_tag LOCUS_06170 7784 6339 CDS product glyceraldehyde-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963349.1 protein_id gnl|my_center|LOCUS_06170 >Feature sequence073 1 1134 gene locus_tag LOCUS_06180 1 1134 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06180 1191 1520 gene locus_tag LOCUS_06190 1191 1520 CDS product MGMT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962541.1 protein_id gnl|my_center|LOCUS_06190 1739 2815 gene locus_tag LOCUS_06200 1739 2815 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791723.1 protein_id gnl|my_center|LOCUS_06200 2936 6238 gene locus_tag LOCUS_06210 2936 6238 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962182.1 protein_id gnl|my_center|LOCUS_06210 6245 7531 gene locus_tag LOCUS_06220 6245 7531 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103654.1 protein_id gnl|my_center|LOCUS_06220 >Feature sequence074 475 1209 gene locus_tag LOCUS_06230 475 1209 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767893.1 protein_id gnl|my_center|LOCUS_06230 1266 4079 gene locus_tag LOCUS_06240 1266 4079 CDS product insulinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202237.1 protein_id gnl|my_center|LOCUS_06240 5435 4161 gene locus_tag LOCUS_06250 5435 4161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 7683 5608 gene locus_tag LOCUS_06260 7683 5608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06260 >Feature sequence075 3767 984 gene locus_tag LOCUS_06270 gene polA 3767 984 CDS product DNA polymerase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796991.1 protein_id gnl|my_center|LOCUS_06270 4857 3829 gene locus_tag LOCUS_06280 4857 3829 CDS product RluA family pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762648.1 protein_id gnl|my_center|LOCUS_06280 6715 4847 gene locus_tag LOCUS_06290 6715 4847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06290 7617 6760 gene locus_tag LOCUS_06300 7617 6760 CDS product PASTA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118839949.1 protein_id gnl|my_center|LOCUS_06300 >Feature sequence076 294 1043 gene locus_tag LOCUS_06310 294 1043 CDS product succinate dehydrogenase/fumarate reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783491.1 protein_id gnl|my_center|LOCUS_06310 1424 2707 gene locus_tag LOCUS_06320 1424 2707 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962704.1 protein_id gnl|my_center|LOCUS_06320 3992 2742 gene locus_tag LOCUS_06330 3992 2742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 4604 3996 gene locus_tag LOCUS_06340 4604 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06340 5647 4757 gene locus_tag LOCUS_06350 5647 4757 CDS product YegS/Rv2252/BmrU family lipid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793782.1 protein_id gnl|my_center|LOCUS_06350 6927 5653 gene locus_tag LOCUS_06360 6927 5653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 7133 7360 gene locus_tag LOCUS_06370 7133 7360 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06370 >Feature sequence077 1917 112 gene locus_tag LOCUS_06380 gene mrdA 1917 112 CDS product penicillin-binding protein 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792058.1 protein_id gnl|my_center|LOCUS_06380 2151 5204 gene locus_tag LOCUS_06390 2151 5204 CDS product DUF2723 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765759.1 protein_id gnl|my_center|LOCUS_06390 5207 5845 gene locus_tag LOCUS_06400 5207 5845 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962465.1 protein_id gnl|my_center|LOCUS_06400 6742 6068 gene locus_tag LOCUS_06410 6742 6068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_06410 <7644 6748 gene locus_tag LOCUS_06420 <7644 6748 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461050.1:efflux RND transporter permease subunit >Feature sequence078 1922 384 gene locus_tag LOCUS_06430 1922 384 CDS product YifB family Mg chelatase-like AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761917.1 protein_id gnl|my_center|LOCUS_06430 2629 2015 gene locus_tag LOCUS_06440 2629 2015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 5778 2968 gene locus_tag LOCUS_06450 5778 2968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 7049 5811 gene locus_tag LOCUS_06460 gene nusA 7049 5811 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783919.1 protein_id gnl|my_center|LOCUS_06460 7514 7062 gene locus_tag LOCUS_06470 gene rimP 7514 7062 CDS product ribosome assembly cofactor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767604.1 protein_id gnl|my_center|LOCUS_06470 >Feature sequence079 859 173 gene locus_tag LOCUS_06480 859 173 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 2227 1301 gene locus_tag LOCUS_06490 2227 1301 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080944.1 protein_id gnl|my_center|LOCUS_06490 2551 3609 gene locus_tag LOCUS_06500 2551 3609 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003426511.1 protein_id gnl|my_center|LOCUS_06500 3610 4947 gene locus_tag LOCUS_06510 3610 4947 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545232.1 protein_id gnl|my_center|LOCUS_06510 5006 5758 gene locus_tag LOCUS_06520 5006 5758 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003422862.1 protein_id gnl|my_center|LOCUS_06520 6984 5860 gene locus_tag LOCUS_06530 6984 5860 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582957.1 protein_id gnl|my_center|LOCUS_06530 >Feature sequence080 1436 183 gene locus_tag LOCUS_06540 1436 183 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963911.1 protein_id gnl|my_center|LOCUS_06540 1591 2979 gene locus_tag LOCUS_06550 1591 2979 CDS product UDP-glucose/GDP-mannose dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787721.1 protein_id gnl|my_center|LOCUS_06550 2976 3908 gene locus_tag LOCUS_06560 2976 3908 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763529.1 protein_id gnl|my_center|LOCUS_06560 4061 5851 gene locus_tag LOCUS_06570 gene lepA 4061 5851 CDS product translation elongation factor 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765513.1 protein_id gnl|my_center|LOCUS_06570 5852 6988 gene locus_tag LOCUS_06580 5852 6988 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108989.1 protein_id gnl|my_center|LOCUS_06580 >Feature sequence081 525 2342 gene locus_tag LOCUS_06590 525 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06590 2667 5330 gene locus_tag LOCUS_06600 2667 5330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06600 5457 6728 gene locus_tag LOCUS_06610 5457 6728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 <7447 6941 gene locus_tag LOCUS_06620 <7447 6941 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545272.1:ABC transporter permease >Feature sequence082 <1 503 gene locus_tag LOCUS_06630 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011201893.1:beta-ketoacyl-ACP synthase II 514 1218 gene locus_tag LOCUS_06640 514 1218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06640 1205 2584 gene locus_tag LOCUS_06650 gene glmM 1205 2584 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791020.1 protein_id gnl|my_center|LOCUS_06650 2674 5652 gene locus_tag LOCUS_06660 2674 5652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 7273 5816 gene locus_tag LOCUS_06670 7273 5816 CDS product aminoacyl-histidine dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784872.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence083 3379 2921 gene locus_tag LOCUS_06680 gene smpB 3379 2921 CDS product SsrA-binding protein SmpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011943280.1 protein_id gnl|my_center|LOCUS_06680 3936 3376 gene locus_tag LOCUS_06690 3936 3376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06690 4316 4044 gene locus_tag LOCUS_06700 4316 4044 CDS product HU family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761933.1 protein_id gnl|my_center|LOCUS_06700 4535 4622 gene locus_tag LOCUS_t00170 4535 4622 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4637 4882 gene locus_tag LOCUS_06710 4637 4882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 5029 7392 gene locus_tag LOCUS_06720 5029 7392 CDS product transglycosylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107425.1 protein_id gnl|my_center|LOCUS_06720 >Feature sequence084 2 349 gene locus_tag LOCUS_06730 2 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 2036 561 gene locus_tag LOCUS_06740 2036 561 CDS product OstA-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764125.1 protein_id gnl|my_center|LOCUS_06740 3278 2259 gene locus_tag LOCUS_06750 3278 2259 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963304.1 protein_id gnl|my_center|LOCUS_06750 4572 3232 gene locus_tag LOCUS_06760 4572 3232 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005799064.1 protein_id gnl|my_center|LOCUS_06760 5434 4562 gene locus_tag LOCUS_06770 5434 4562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06770 <7399 5435 gene locus_tag LOCUS_06780 <7399 5435 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963306.1:peptidylprolyl isomerase >Feature sequence085 96 983 gene locus_tag LOCUS_06790 96 983 CDS product NAD kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964192.1 protein_id gnl|my_center|LOCUS_06790 2742 1063 gene locus_tag LOCUS_06800 2742 1063 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_06800 4440 2896 gene locus_tag LOCUS_06810 4440 2896 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029327287.1 protein_id gnl|my_center|LOCUS_06810 <7329 4740 gene locus_tag LOCUS_06820 <7329 4740 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase >Feature sequence086 <1 2104 gene locus_tag LOCUS_06830 <1 2104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase 2167 6063 gene locus_tag LOCUS_06840 2167 6063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06840 6167 6523 gene locus_tag LOCUS_06850 6167 6523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06850 <7326 6574 gene locus_tag LOCUS_06860 <7326 6574 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005787899.1:tetratricopeptide repeat protein >Feature sequence087 <1 1116 gene locus_tag LOCUS_06870 <1 1116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005815367.1:TlpA disulfide reductase family protein 1995 1264 gene locus_tag LOCUS_06880 1995 1264 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962364.1 protein_id gnl|my_center|LOCUS_06880 3039 2002 gene locus_tag LOCUS_06890 gene galE 3039 2002 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788150.1 protein_id gnl|my_center|LOCUS_06890 4329 3040 gene locus_tag LOCUS_06900 4329 3040 CDS product nucleotide sugar dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942587.1 protein_id gnl|my_center|LOCUS_06900 4811 4371 gene locus_tag LOCUS_06910 4811 4371 CDS product endonuclease domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693271.1 protein_id gnl|my_center|LOCUS_06910 5890 4940 gene locus_tag LOCUS_06920 5890 4940 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208044.1 protein_id gnl|my_center|LOCUS_06920 6470 5883 gene locus_tag LOCUS_06930 6470 5883 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582951.1 protein_id gnl|my_center|LOCUS_06930 <7306 6473 gene locus_tag LOCUS_06940 <7306 6473 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962574.1:DegT/DnrJ/EryC1/StrS family aminotransferase >Feature sequence088 2201 693 gene locus_tag LOCUS_06950 gene dnaB 2201 693 CDS product replicative DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761250.1 protein_id gnl|my_center|LOCUS_06950 2381 3346 gene locus_tag LOCUS_06960 2381 3346 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963429.1 protein_id gnl|my_center|LOCUS_06960 3352 3846 gene locus_tag LOCUS_06970 3352 3846 CDS product UpxY family transcription antiterminator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932308.1 protein_id gnl|my_center|LOCUS_06970 3994 4257 gene locus_tag LOCUS_06980 3994 4257 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 4272 5258 gene locus_tag LOCUS_06990 4272 5258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06990 5281 5598 gene locus_tag LOCUS_07000 5281 5598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07000 5753 6241 gene locus_tag LOCUS_07010 5753 6241 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07010 6285 6515 gene locus_tag LOCUS_07020 6285 6515 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 6532 6846 gene locus_tag LOCUS_07030 6532 6846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07030 >Feature sequence089 2025 2726 gene locus_tag LOCUS_07040 2025 2726 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785389.1 protein_id gnl|my_center|LOCUS_07040 3796 2735 gene locus_tag LOCUS_07050 3796 2735 CDS product mannose-1-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791384.1 protein_id gnl|my_center|LOCUS_07050 4433 3816 gene locus_tag LOCUS_07060 4433 3816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07060 4470 5213 gene locus_tag LOCUS_07070 4470 5213 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791870.1 protein_id gnl|my_center|LOCUS_07070 5210 5959 gene locus_tag LOCUS_07080 5210 5959 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764109.1 protein_id gnl|my_center|LOCUS_07080 >Feature sequence090 88 1008 gene locus_tag LOCUS_07090 88 1008 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765870.1 protein_id gnl|my_center|LOCUS_07090 1025 2275 gene locus_tag LOCUS_07100 1025 2275 CDS product DUF1015 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763485.1 protein_id gnl|my_center|LOCUS_07100 2285 2959 gene locus_tag LOCUS_07110 2285 2959 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538563.1 protein_id gnl|my_center|LOCUS_07110 2970 3950 gene locus_tag LOCUS_07120 2970 3950 CDS product dihydroorotate dehydrogenase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203072.1 protein_id gnl|my_center|LOCUS_07120 4045 4836 gene locus_tag LOCUS_07130 4045 4836 CDS product helical backbone metal receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962702.1 protein_id gnl|my_center|LOCUS_07130 5579 4905 gene locus_tag LOCUS_07140 5579 4905 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07140 7080 5572 gene locus_tag LOCUS_07150 7080 5572 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_07150 >Feature sequence091 <1 746 gene locus_tag LOCUS_07160 <1 746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095689.1:ribonuclease HI 734 1516 gene locus_tag LOCUS_07170 734 1516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1519 2292 gene locus_tag LOCUS_07180 1519 2292 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963635.1 protein_id gnl|my_center|LOCUS_07180 2312 3574 gene locus_tag LOCUS_07190 gene tyrS 2312 3574 CDS product tyrosine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783655.1 protein_id gnl|my_center|LOCUS_07190 3921 4982 gene locus_tag LOCUS_07200 3921 4982 CDS product glutaminyl-peptide cyclotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963196.1 protein_id gnl|my_center|LOCUS_07200 5491 5652 gene locus_tag LOCUS_07210 gene rpmH 5491 5652 CDS product 50S ribosomal protein L34 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004292199.1 protein_id gnl|my_center|LOCUS_07210 5738 6301 gene locus_tag LOCUS_07220 5738 6301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 >Feature sequence092 1507 818 gene locus_tag LOCUS_07230 gene lipB 1507 818 CDS product lipoyl(octanoyl) transferase LipB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765857.1 protein_id gnl|my_center|LOCUS_07230 2826 1696 gene locus_tag LOCUS_07240 2826 1696 CDS product formimidoylglutamase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964076.1 protein_id gnl|my_center|LOCUS_07240 5154 2833 gene locus_tag LOCUS_07250 gene topA 5154 2833 CDS product type I DNA topoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791192.1 protein_id gnl|my_center|LOCUS_07250 5534 5304 gene locus_tag LOCUS_07260 5534 5304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07260 6572 5607 gene locus_tag LOCUS_07270 6572 5607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 >Feature sequence093 <1 1679 gene locus_tag LOCUS_07280 <1 1679 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:OmpA family protein 2669 1698 gene locus_tag LOCUS_07290 2669 1698 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964177.1 protein_id gnl|my_center|LOCUS_07290 3356 2697 gene locus_tag LOCUS_07300 3356 2697 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762585.1 protein_id gnl|my_center|LOCUS_07300 4142 3363 gene locus_tag LOCUS_07310 gene lpxA 4142 3363 CDS product acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963123.1 protein_id gnl|my_center|LOCUS_07310 5542 4142 gene locus_tag LOCUS_07320 5542 4142 CDS product bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785120.1 protein_id gnl|my_center|LOCUS_07320 6535 5708 gene locus_tag LOCUS_07330 gene tsf 6535 5708 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962622.1 protein_id gnl|my_center|LOCUS_07330 >Feature sequence094 2886 5978 gene locus_tag LOCUS_07340 2886 5978 CDS product UvrD-helicase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202755.1 protein_id gnl|my_center|LOCUS_07340 6188 6703 gene locus_tag LOCUS_07350 6188 6703 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788935.1 protein_id gnl|my_center|LOCUS_07350 >Feature sequence095 80 1441 gene locus_tag LOCUS_07360 gene sufD 80 1441 CDS product Fe-S cluster assembly protein SufD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767608.1 protein_id gnl|my_center|LOCUS_07360 1435 1881 gene locus_tag LOCUS_07370 1435 1881 CDS product type I restriction enzyme HsdR N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963199.1 protein_id gnl|my_center|LOCUS_07370 3223 1886 gene locus_tag LOCUS_07380 gene hisS 3223 1886 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767712.1 protein_id gnl|my_center|LOCUS_07380 3774 3223 gene locus_tag LOCUS_07390 3774 3223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 4666 3821 gene locus_tag LOCUS_07400 4666 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 5364 4687 gene locus_tag LOCUS_07410 5364 4687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 <6989 5368 gene locus_tag LOCUS_07420 <6989 5368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162445741.1:sensor histidine kinase >Feature sequence096 1222 128 gene locus_tag LOCUS_07430 1222 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07430 1464 2318 gene locus_tag LOCUS_07440 1464 2318 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005817352.1 protein_id gnl|my_center|LOCUS_07440 2323 3489 gene locus_tag LOCUS_07450 2323 3489 CDS product 1-deoxy-D-xylulose-5-phosphate reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802379.1 protein_id gnl|my_center|LOCUS_07450 3490 4812 gene locus_tag LOCUS_07460 gene rseP 3490 4812 CDS product RIP metalloprotease RseP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766369.1 protein_id gnl|my_center|LOCUS_07460 6705 4927 gene locus_tag LOCUS_07470 6705 4927 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963836.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence097 1107 94 gene locus_tag LOCUS_07480 1107 94 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 1661 1113 gene locus_tag LOCUS_07490 1661 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 2329 1883 gene locus_tag LOCUS_07500 2329 1883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07500 2548 3162 gene locus_tag LOCUS_07510 gene udk 2548 3162 CDS product uridine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789145.1 protein_id gnl|my_center|LOCUS_07510 3167 3865 gene locus_tag LOCUS_07520 3167 3865 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962213.1 protein_id gnl|my_center|LOCUS_07520 3886 4695 gene locus_tag LOCUS_07530 gene zupT 3886 4695 CDS product zinc transporter ZupT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011861091.1 protein_id gnl|my_center|LOCUS_07530 5560 4700 gene locus_tag LOCUS_07540 5560 4700 CDS product YicC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769918.1 protein_id gnl|my_center|LOCUS_07540 6025 5579 gene locus_tag LOCUS_07550 6025 5579 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 6331 6086 gene locus_tag LOCUS_07560 6331 6086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 6773 6336 gene locus_tag LOCUS_07570 6773 6336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 >Feature sequence098 2559 871 gene locus_tag LOCUS_07580 2559 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 3436 2891 gene locus_tag LOCUS_07590 gene hpt 3436 2891 CDS product hypoxanthine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785529.1 protein_id gnl|my_center|LOCUS_07590 3506 4027 gene locus_tag LOCUS_07600 gene purE 3506 4027 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763604.1 protein_id gnl|my_center|LOCUS_07600 4008 4850 gene locus_tag LOCUS_07610 4008 4850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07610 4847 5164 gene locus_tag LOCUS_07620 4847 5164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07620 <6761 5345 gene locus_tag LOCUS_07630 <6761 5345 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011101518.1:C69 family dipeptidase >Feature sequence099 1383 154 gene locus_tag LOCUS_07640 1383 154 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765300.1 protein_id gnl|my_center|LOCUS_07640 1734 1396 gene locus_tag LOCUS_07650 gene rbfA 1734 1396 CDS product 30S ribosome-binding factor RbfA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791944.1 protein_id gnl|my_center|LOCUS_07650 2779 1724 gene locus_tag LOCUS_07660 gene lpxD 2779 1724 CDS product UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963125.1 protein_id gnl|my_center|LOCUS_07660 3620 3096 gene locus_tag LOCUS_07670 3620 3096 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07670 6022 3809 gene locus_tag LOCUS_07680 6022 3809 CDS product peptidase domain-containing ABC transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791796.1 protein_id gnl|my_center|LOCUS_07680 >Feature sequence100 1086 334 gene locus_tag LOCUS_07690 1086 334 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203690.1 protein_id gnl|my_center|LOCUS_07690 2864 1086 gene locus_tag LOCUS_07700 gene mutL 2864 1086 CDS product DNA mismatch repair endonuclease MutL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010993641.1 protein_id gnl|my_center|LOCUS_07700 3133 2852 gene locus_tag LOCUS_07710 3133 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07710 3353 4516 gene locus_tag LOCUS_07720 3353 4516 CDS product acyl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000397283.1 protein_id gnl|my_center|LOCUS_07720 4611 4802 gene locus_tag LOCUS_07730 gene rpsU 4611 4802 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782152.1 protein_id gnl|my_center|LOCUS_07730 4841 5731 gene locus_tag LOCUS_07740 gene xerC 4841 5731 CDS product tyrosine recombinase XerC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804122.1 protein_id gnl|my_center|LOCUS_07740 5744 6040 gene locus_tag LOCUS_07750 gene raiA 5744 6040 CDS product ribosome-associated translation inhibitor RaiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963320.1 protein_id gnl|my_center|LOCUS_07750 6141 6216 gene locus_tag LOCUS_t00180 6141 6216 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 6226 6309 gene locus_tag LOCUS_t00190 6226 6309 tRNA product tRNA-Tyr inference COORDINATES:profile:Aragorn:1.2.38 6317 6391 gene locus_tag LOCUS_t00200 6317 6391 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 6398 6469 gene locus_tag LOCUS_t00210 6398 6469 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence101 1069 203 gene locus_tag LOCUS_07760 1069 203 CDS product IS1595 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013529345.1 protein_id gnl|my_center|LOCUS_07760 1235 1543 gene locus_tag LOCUS_07770 1235 1543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07770 1718 1521 gene locus_tag LOCUS_07780 1718 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07780 3513 2086 gene locus_tag LOCUS_07790 3513 2086 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962828.1 protein_id gnl|my_center|LOCUS_07790 4464 3520 gene locus_tag LOCUS_07800 4464 3520 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962829.1 protein_id gnl|my_center|LOCUS_07800 5616 4465 gene locus_tag LOCUS_07810 gene dnaJ 5616 4465 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202549.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence102 3379 3822 gene locus_tag LOCUS_07820 3379 3822 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07820 3943 4101 gene locus_tag LOCUS_07830 3943 4101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 4595 4143 gene locus_tag LOCUS_07840 gene tsaE 4595 4143 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963212.1 protein_id gnl|my_center|LOCUS_07840 6295 4736 gene locus_tag LOCUS_07850 6295 4736 CDS product PglZ domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963211.1 protein_id gnl|my_center|LOCUS_07850 >Feature sequence103 1065 628 gene locus_tag LOCUS_07860 1065 628 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080739.1 protein_id gnl|my_center|LOCUS_07860 2374 1136 gene locus_tag LOCUS_07870 2374 1136 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792023.1 protein_id gnl|my_center|LOCUS_07870 3327 2371 gene locus_tag LOCUS_07880 3327 2371 CDS product nitronate monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963872.1 protein_id gnl|my_center|LOCUS_07880 3958 4581 gene locus_tag LOCUS_07890 3958 4581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07890 4584 5804 gene locus_tag LOCUS_07900 4584 5804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 >Feature sequence104 389 637 gene locus_tag LOCUS_07910 389 637 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791868.1 protein_id gnl|my_center|LOCUS_07910 1685 939 gene locus_tag LOCUS_07920 gene fabG 1685 939 CDS product 3-oxoacyl-[acyl-carrier-protein] reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792012.1 protein_id gnl|my_center|LOCUS_07920 4871 2061 gene locus_tag LOCUS_07930 gene uvrA 4871 2061 CDS product excinuclease ABC subunit UvrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107958.1 protein_id gnl|my_center|LOCUS_07930 5022 5612 gene locus_tag LOCUS_07940 5022 5612 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963245.1 protein_id gnl|my_center|LOCUS_07940 <6513 5872 gene locus_tag LOCUS_07950 <6513 5872 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012843245.1:TrkH family potassium uptake protein >Feature sequence105 <1 1562 gene locus_tag LOCUS_07960 <1 1562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461603.1:histidine kinase 2052 2702 gene locus_tag LOCUS_07970 2052 2702 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011727243.1 protein_id gnl|my_center|LOCUS_07970 2812 3618 gene locus_tag LOCUS_07980 2812 3618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764091.1 protein_id gnl|my_center|LOCUS_07980 3646 4863 gene locus_tag LOCUS_07990 3646 4863 CDS product ammonium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023814.1 protein_id gnl|my_center|LOCUS_07990 6450 5152 gene locus_tag LOCUS_08000 6450 5152 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108087.1 protein_id gnl|my_center|LOCUS_08000 >Feature sequence106 371 42 gene locus_tag LOCUS_08010 371 42 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 3267 988 gene locus_tag LOCUS_08020 3267 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08020 3650 3267 gene locus_tag LOCUS_08030 3650 3267 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 6256 3647 gene locus_tag LOCUS_08040 6256 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08040 >Feature sequence107 56 1417 gene locus_tag LOCUS_08050 56 1417 CDS product Mur ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963483.1 protein_id gnl|my_center|LOCUS_08050 1978 2613 gene locus_tag LOCUS_08060 1978 2613 CDS product DUF5063 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785376.1 protein_id gnl|my_center|LOCUS_08060 2610 3194 gene locus_tag LOCUS_08070 2610 3194 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785374.1 protein_id gnl|my_center|LOCUS_08070 3187 5319 gene locus_tag LOCUS_08080 3187 5319 CDS product Tex family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202602.1 protein_id gnl|my_center|LOCUS_08080 6334 5519 gene locus_tag LOCUS_08090 6334 5519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08090 >Feature sequence108 1679 231 gene locus_tag LOCUS_08100 1679 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08100 3330 1696 gene locus_tag LOCUS_08110 3330 1696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08110 5639 3474 gene locus_tag LOCUS_08120 5639 3474 CDS product ComEC/Rec2 family competence protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203504.1 protein_id gnl|my_center|LOCUS_08120 6128 5646 gene locus_tag LOCUS_08130 6128 5646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08130 >Feature sequence109 227 5794 gene locus_tag LOCUS_08140 227 5794 CDS product MG2 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202408.1 protein_id gnl|my_center|LOCUS_08140 >Feature sequence110 <1 557 gene locus_tag LOCUS_08150 <1 557 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963271.1:tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB 547 1341 gene locus_tag LOCUS_08160 547 1341 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546263.1 protein_id gnl|my_center|LOCUS_08160 1345 2232 gene locus_tag LOCUS_08170 1345 2232 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250748.1 protein_id gnl|my_center|LOCUS_08170 3098 2412 gene locus_tag LOCUS_08180 3098 2412 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584036.1 protein_id gnl|my_center|LOCUS_08180 3764 3234 gene locus_tag LOCUS_08190 3764 3234 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962566.1 protein_id gnl|my_center|LOCUS_08190 3840 5030 gene locus_tag LOCUS_08200 gene sucC 3840 5030 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963059.1 protein_id gnl|my_center|LOCUS_08200 5507 6166 gene locus_tag LOCUS_08210 gene rpe 5507 6166 CDS product ribulose-phosphate 3-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964149.1 protein_id gnl|my_center|LOCUS_08210 >Feature sequence111 221 2107 gene locus_tag LOCUS_08220 221 2107 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838696.1 protein_id gnl|my_center|LOCUS_08220 4918 2150 gene locus_tag LOCUS_08230 4918 2150 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08230 4988 5194 gene locus_tag LOCUS_08240 4988 5194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 6267 5443 gene locus_tag LOCUS_08250 6267 5443 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404480.1 protein_id gnl|my_center|LOCUS_08250 >Feature sequence112 1451 381 gene locus_tag LOCUS_08260 1451 381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08260 1513 2316 gene locus_tag LOCUS_08270 gene panB 1513 2316 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963041.1 protein_id gnl|my_center|LOCUS_08270 2735 3430 gene locus_tag LOCUS_08280 2735 3430 CDS product pseudouridine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005792014.1 protein_id gnl|my_center|LOCUS_08280 3423 4412 gene locus_tag LOCUS_08290 3423 4412 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933791.1 protein_id gnl|my_center|LOCUS_08290 4922 4437 gene locus_tag LOCUS_08300 4922 4437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 5768 5001 gene locus_tag LOCUS_08310 5768 5001 CDS product enoyl-CoA hydratase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228679.1 protein_id gnl|my_center|LOCUS_08310 >Feature sequence113 3462 40 gene locus_tag LOCUS_08320 3462 40 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964489.1 protein_id gnl|my_center|LOCUS_08320 4520 3468 gene locus_tag LOCUS_08330 4520 3468 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964490.1 protein_id gnl|my_center|LOCUS_08330 6020 4680 gene locus_tag LOCUS_08340 6020 4680 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_08340 >Feature sequence114 <1 697 gene locus_tag LOCUS_08350 <1 697 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761931.1:rhomboid family intramembrane serine protease 845 1798 gene locus_tag LOCUS_08360 845 1798 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963288.1 protein_id gnl|my_center|LOCUS_08360 1871 3115 gene locus_tag LOCUS_08370 1871 3115 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_166151256.1 protein_id gnl|my_center|LOCUS_08370 4590 3211 gene locus_tag LOCUS_08380 4590 3211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08380 5260 4595 gene locus_tag LOCUS_08390 5260 4595 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964191.1 protein_id gnl|my_center|LOCUS_08390 >Feature sequence115 4254 1363 gene locus_tag LOCUS_08400 4254 1363 CDS product AsmA-like C-terminal region-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011109118.1 protein_id gnl|my_center|LOCUS_08400 6110 4368 gene locus_tag LOCUS_08410 6110 4368 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962685.1 protein_id gnl|my_center|LOCUS_08410 >Feature sequence116 330 67 gene locus_tag LOCUS_08420 330 67 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08420 529 882 gene locus_tag LOCUS_08430 529 882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 1781 879 gene locus_tag LOCUS_08440 1781 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 1958 2713 gene locus_tag LOCUS_08450 1958 2713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08450 2793 3068 gene locus_tag LOCUS_08460 gene hup 2793 3068 CDS product DNA-binding protein HU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010865085.1 protein_id gnl|my_center|LOCUS_08460 3112 3642 gene locus_tag LOCUS_08470 3112 3642 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08470 3635 4099 gene locus_tag LOCUS_08480 3635 4099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 4089 4550 gene locus_tag LOCUS_08490 4089 4550 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 4560 5117 gene locus_tag LOCUS_08500 4560 5117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08500 5135 5419 gene locus_tag LOCUS_08510 5135 5419 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 5430 5882 gene locus_tag LOCUS_08520 5430 5882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence117 996 418 gene locus_tag LOCUS_08530 996 418 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_08530 1690 1103 gene locus_tag LOCUS_08540 1690 1103 CDS product DUF3109 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783983.1 protein_id gnl|my_center|LOCUS_08540 2304 1690 gene locus_tag LOCUS_08550 2304 1690 CDS product lipoprotein signal peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765667.1 protein_id gnl|my_center|LOCUS_08550 2697 2314 gene locus_tag LOCUS_08560 2697 2314 CDS product TraR/DksA C4-type zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005931903.1 protein_id gnl|my_center|LOCUS_08560 6059 2703 gene locus_tag LOCUS_08570 gene ileS 6059 2703 CDS product isoleucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202809.1 protein_id gnl|my_center|LOCUS_08570 >Feature sequence118 2754 3698 gene locus_tag LOCUS_08580 2754 3698 CDS product NAD-dependent epimerase/dehydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_236615482.1 protein_id gnl|my_center|LOCUS_08580 5994 3745 gene locus_tag LOCUS_08590 gene pqqU 5994 3745 CDS product TonB-dependent receptor PqqU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000692046.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence119 2259 631 gene locus_tag LOCUS_08600 gene ade 2259 631 CDS product adenine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963204.1 protein_id gnl|my_center|LOCUS_08600 4146 2284 gene locus_tag LOCUS_08610 gene mnmG 4146 2284 CDS product tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783704.1 protein_id gnl|my_center|LOCUS_08610 4831 4214 gene locus_tag LOCUS_08620 4831 4214 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207311.1 protein_id gnl|my_center|LOCUS_08620 5629 4856 gene locus_tag LOCUS_08630 5629 4856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08630 5927 5613 gene locus_tag LOCUS_08640 5927 5613 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868800.1 protein_id gnl|my_center|LOCUS_08640 >Feature sequence120 932 33 gene locus_tag LOCUS_08650 932 33 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08650 1205 4453 gene locus_tag LOCUS_08660 1205 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140825.1 protein_id gnl|my_center|LOCUS_08660 4453 5085 gene locus_tag LOCUS_08670 4453 5085 CDS product ribonuclease H family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011201899.1 protein_id gnl|my_center|LOCUS_08670 <6030 5381 gene locus_tag LOCUS_08680 <6030 5381 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008767804.1:dTDP-4-dehydrorhamnose reductase >Feature sequence121 790 101 gene locus_tag LOCUS_08690 gene cmk 790 101 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008769932.1 protein_id gnl|my_center|LOCUS_08690 2169 1033 gene locus_tag LOCUS_08700 2169 1033 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000573847.1 protein_id gnl|my_center|LOCUS_08700 2964 2182 gene locus_tag LOCUS_08710 2964 2182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000482941.1 protein_id gnl|my_center|LOCUS_08710 3501 3428 gene locus_tag LOCUS_t00220 3501 3428 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 3747 4910 gene locus_tag LOCUS_08720 3747 4910 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118840118.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence122 1303 128 gene locus_tag LOCUS_08730 1303 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08730 1458 3335 gene locus_tag LOCUS_08740 gene asnB 1458 3335 CDS product asparagine synthase (glutamine-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003022291.1 protein_id gnl|my_center|LOCUS_08740 3415 4602 gene locus_tag LOCUS_08750 3415 4602 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121802.1 protein_id gnl|my_center|LOCUS_08750 5960 4797 gene locus_tag LOCUS_08760 gene wecB 5960 4797 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871027.1 protein_id gnl|my_center|LOCUS_08760 >Feature sequence123 3694 2933 gene locus_tag LOCUS_08770 3694 2933 CDS product Bax inhibitor-1/YccA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036182.1 protein_id gnl|my_center|LOCUS_08770 4376 3714 gene locus_tag LOCUS_08780 4376 3714 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08780 5637 4366 gene locus_tag LOCUS_08790 5637 4366 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_157860184.1 protein_id gnl|my_center|LOCUS_08790 >Feature sequence124 2077 1715 gene locus_tag LOCUS_08800 2077 1715 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 3310 2084 gene locus_tag LOCUS_08810 3310 2084 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 3774 3310 gene locus_tag LOCUS_08820 3774 3310 CDS product LptE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008658877.1 protein_id gnl|my_center|LOCUS_08820 5023 3812 gene locus_tag LOCUS_08830 5023 3812 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785466.1 protein_id gnl|my_center|LOCUS_08830 >Feature sequence125 2683 491 gene locus_tag LOCUS_08840 2683 491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 5242 2825 gene locus_tag LOCUS_08850 5242 2825 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 >Feature sequence126 432 3524 gene locus_tag LOCUS_08860 432 3524 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_08860 5388 3598 gene locus_tag LOCUS_08870 gene uvrC 5388 3598 CDS product excinuclease ABC subunit UvrC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962398.1 protein_id gnl|my_center|LOCUS_08870 >Feature sequence127 10 360 gene locus_tag LOCUS_08880 gene rplR 10 360 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765430.1 protein_id gnl|my_center|LOCUS_08880 366 881 gene locus_tag LOCUS_08890 gene rpsE 366 881 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762045.1 protein_id gnl|my_center|LOCUS_08890 892 1071 gene locus_tag LOCUS_08900 gene rpmD 892 1071 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963452.1 protein_id gnl|my_center|LOCUS_08900 1084 1539 gene locus_tag LOCUS_08910 gene rplO 1084 1539 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005804135.1 protein_id gnl|my_center|LOCUS_08910 1536 2873 gene locus_tag LOCUS_08920 gene secY 1536 2873 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762047.1 protein_id gnl|my_center|LOCUS_08920 2877 3653 gene locus_tag LOCUS_08930 gene map 2877 3653 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791569.1 protein_id gnl|my_center|LOCUS_08930 3706 3924 gene locus_tag LOCUS_08940 gene infA 3706 3924 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558052.1 protein_id gnl|my_center|LOCUS_08940 4088 4465 gene locus_tag LOCUS_08950 gene rpsM 4088 4465 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296328.1 protein_id gnl|my_center|LOCUS_08950 4476 4865 gene locus_tag LOCUS_08960 gene rpsK 4476 4865 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004296327.1 protein_id gnl|my_center|LOCUS_08960 4891 5496 gene locus_tag LOCUS_08970 gene rpsD 4891 5496 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791575.1 protein_id gnl|my_center|LOCUS_08970 >Feature sequence128 2374 482 gene locus_tag LOCUS_08980 2374 482 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08980 2967 5579 gene locus_tag LOCUS_08990 gene clpB 2967 5579 CDS product ATP-dependent chaperone ClpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785772.1 protein_id gnl|my_center|LOCUS_08990 >Feature sequence129 535 41 gene locus_tag LOCUS_09000 gene gmhB 535 41 CDS product D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694551.1 protein_id gnl|my_center|LOCUS_09000 1147 536 gene locus_tag LOCUS_09010 1147 536 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002117778.1 protein_id gnl|my_center|LOCUS_09010 1567 3156 gene locus_tag LOCUS_09020 1567 3156 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09020 3166 4656 gene locus_tag LOCUS_09030 3166 4656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09030 >Feature sequence130 3771 148 gene locus_tag LOCUS_09040 3771 148 CDS product HAMP domain-containing sensor histidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062542257.1 protein_id gnl|my_center|LOCUS_09040 4285 3773 gene locus_tag LOCUS_09050 gene rlmH 4285 3773 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963965.1 protein_id gnl|my_center|LOCUS_09050 4731 5189 gene locus_tag LOCUS_09060 4731 5189 CDS product phosphoribosyl-AMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001189466.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence131 <1 1061 gene locus_tag LOCUS_09070 <1 1061 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762841.1:DUF4861 domain-containing protein 1061 1711 gene locus_tag LOCUS_09080 gene eda 1061 1711 CDS product bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583017.1 protein_id gnl|my_center|LOCUS_09080 1737 2477 gene locus_tag LOCUS_09090 1737 2477 CDS product FadR/GntR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003356424.1 protein_id gnl|my_center|LOCUS_09090 2481 3311 gene locus_tag LOCUS_09100 gene kduI 2481 3311 CDS product 5-dehydro-4-deoxy-D-glucuronate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000383248.1 protein_id gnl|my_center|LOCUS_09100 3336 4097 gene locus_tag LOCUS_09110 gene kduD 3336 4097 CDS product 2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210830.1 protein_id gnl|my_center|LOCUS_09110 >Feature sequence132 1996 1064 gene locus_tag LOCUS_09120 1996 1064 CDS product PhoH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963220.1 protein_id gnl|my_center|LOCUS_09120 2062 2841 gene locus_tag LOCUS_09130 2062 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 2834 3625 gene locus_tag LOCUS_09140 gene mazG 2834 3625 CDS product nucleoside triphosphate pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963865.1 protein_id gnl|my_center|LOCUS_09140 5334 3913 gene locus_tag LOCUS_09150 5334 3913 CDS product aldehyde dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582867.1 protein_id gnl|my_center|LOCUS_09150 >Feature sequence133 77 664 gene locus_tag LOCUS_09160 77 664 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962634.1 protein_id gnl|my_center|LOCUS_09160 674 1444 gene locus_tag LOCUS_09170 gene rsmA 674 1444 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760928.1 protein_id gnl|my_center|LOCUS_09170 1860 2153 gene locus_tag LOCUS_09180 1860 2153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09180 2154 3518 gene locus_tag LOCUS_09190 2154 3518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09190 3822 5165 gene locus_tag LOCUS_09200 3822 5165 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 >Feature sequence134 1161 976 gene locus_tag LOCUS_09210 1161 976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09210 1915 1232 gene locus_tag LOCUS_09220 1915 1232 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054522704.1 protein_id gnl|my_center|LOCUS_09220 4753 1922 gene locus_tag LOCUS_09230 4753 1922 CDS product type I restriction-modification enzyme R subunit C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022108.1 protein_id gnl|my_center|LOCUS_09230 >Feature sequence135 513 1 gene locus_tag LOCUS_09240 513 1 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 562 897 gene locus_tag LOCUS_09250 562 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 1070 1222 gene locus_tag LOCUS_09260 1070 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09260 1288 2346 gene locus_tag LOCUS_09270 1288 2346 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964031.1 protein_id gnl|my_center|LOCUS_09270 3366 2590 gene locus_tag LOCUS_09280 gene folP 3366 2590 CDS product dihydropteroate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767053.1 protein_id gnl|my_center|LOCUS_09280 3511 4506 gene locus_tag LOCUS_09290 gene rfaE1 3511 4506 CDS product D-glycero-beta-D-manno-heptose-7-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932840.1 protein_id gnl|my_center|LOCUS_09290 5416 4553 gene locus_tag LOCUS_09300 5416 4553 CDS product aminotransferase class IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964106.1 protein_id gnl|my_center|LOCUS_09300 >Feature sequence136 237 632 gene locus_tag LOCUS_09310 237 632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 638 1480 gene locus_tag LOCUS_09320 gene nadC 638 1480 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786213.1 protein_id gnl|my_center|LOCUS_09320 1482 2414 gene locus_tag LOCUS_09330 1482 2414 CDS product YihY/virulence factor BrkB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963960.1 protein_id gnl|my_center|LOCUS_09330 3354 2464 gene locus_tag LOCUS_09340 3354 2464 CDS product 3-hydroxybutyryl-CoA dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964015.1 protein_id gnl|my_center|LOCUS_09340 4043 3387 gene locus_tag LOCUS_09350 gene elbB 4043 3387 CDS product isoprenoid biosynthesis glyoxalase ElbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390979.1 protein_id gnl|my_center|LOCUS_09350 4914 4474 gene locus_tag LOCUS_09360 4914 4474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 >Feature sequence137 285 2657 gene locus_tag LOCUS_09370 285 2657 CDS product DEAD/DEAH box helicase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105653.1 protein_id gnl|my_center|LOCUS_09370 2659 3663 gene locus_tag LOCUS_09380 2659 3663 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035718.1 protein_id gnl|my_center|LOCUS_09380 3689 4054 gene locus_tag LOCUS_09390 3689 4054 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016267883.1 protein_id gnl|my_center|LOCUS_09390 >Feature sequence138 1470 664 gene locus_tag LOCUS_09400 1470 664 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099991.1 protein_id gnl|my_center|LOCUS_09400 1827 3389 gene locus_tag LOCUS_09410 1827 3389 CDS product transglutaminase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108818.1 protein_id gnl|my_center|LOCUS_09410 <5486 3661 gene locus_tag LOCUS_09420 <5486 3661 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:OmpA family protein >Feature sequence139 1288 347 gene locus_tag LOCUS_09430 1288 347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09430 2623 1292 gene locus_tag LOCUS_09440 2623 1292 CDS product flippase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021083.1 protein_id gnl|my_center|LOCUS_09440 5273 3573 gene locus_tag LOCUS_09450 5273 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence140 2511 82 gene locus_tag LOCUS_09460 2511 82 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09460 4399 2597 gene locus_tag LOCUS_09470 4399 2597 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09470 4438 4537 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence141 1389 676 gene locus_tag LOCUS_09480 1389 676 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962517.1 protein_id gnl|my_center|LOCUS_09480 3083 1389 gene locus_tag LOCUS_09490 3083 1389 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765353.1 protein_id gnl|my_center|LOCUS_09490 3814 3407 gene locus_tag LOCUS_09500 3814 3407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 4604 3843 gene locus_tag LOCUS_09510 4604 3843 CDS product uroporphyrinogen-III synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962359.1 protein_id gnl|my_center|LOCUS_09510 5173 4631 gene locus_tag LOCUS_09520 5173 4631 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 >Feature sequence142 1511 795 gene locus_tag LOCUS_09530 1511 795 CDS product pyridoxine 5'-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760838.1 protein_id gnl|my_center|LOCUS_09530 1578 2228 gene locus_tag LOCUS_09540 1578 2228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09540 2239 2976 gene locus_tag LOCUS_09550 gene cobB 2239 2976 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_053240270.1 protein_id gnl|my_center|LOCUS_09550 3021 5297 gene locus_tag LOCUS_09560 gene pbpC 3021 5297 CDS product penicillin-binding protein 1C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964324.1 protein_id gnl|my_center|LOCUS_09560 >Feature sequence143 687 241 gene locus_tag LOCUS_09570 gene rplI 687 241 CDS product 50S ribosomal protein L9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941329.1 protein_id gnl|my_center|LOCUS_09570 971 705 gene locus_tag LOCUS_09580 gene rpsR 971 705 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790946.1 protein_id gnl|my_center|LOCUS_09580 1327 974 gene locus_tag LOCUS_09590 gene rpsF 1327 974 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005781453.1 protein_id gnl|my_center|LOCUS_09590 1443 2111 gene locus_tag LOCUS_09600 1443 2111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 2183 3982 gene locus_tag LOCUS_09610 2183 3982 CDS product DNA polymerase III subunit gamma/tau inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767911.1 protein_id gnl|my_center|LOCUS_09610 >Feature sequence144 1815 1003 gene locus_tag LOCUS_09620 1815 1003 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810982.1 protein_id gnl|my_center|LOCUS_09620 1899 2342 gene locus_tag LOCUS_09630 1899 2342 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 4269 2734 gene locus_tag LOCUS_09640 gene gldJ 4269 2734 CDS product gliding motility lipoprotein GldJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963517.1 protein_id gnl|my_center|LOCUS_09640 5285 4296 gene locus_tag LOCUS_09650 5285 4296 CDS product type IX secretion system membrane protein PorP/SprF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964500.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence145 719 1957 gene locus_tag LOCUS_09660 719 1957 CDS product peptidase U32 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032555746.1 protein_id gnl|my_center|LOCUS_09660 2395 3078 gene locus_tag LOCUS_09670 2395 3078 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09670 3764 3411 gene locus_tag LOCUS_09680 gene rplT 3764 3411 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297540.1 protein_id gnl|my_center|LOCUS_09680 4046 3849 gene locus_tag LOCUS_09690 gene rpmI 4046 3849 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004297539.1 protein_id gnl|my_center|LOCUS_09690 4525 4073 gene locus_tag LOCUS_09700 4525 4073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09700 <5274 4652 gene locus_tag LOCUS_09710 <5274 4652 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107262.1:threonine--tRNA ligase >Feature sequence146 2481 1840 gene locus_tag LOCUS_09720 2481 1840 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 2596 3252 gene locus_tag LOCUS_09730 gene folE 2596 3252 CDS product GTP cyclohydrolase I FolE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760851.1 protein_id gnl|my_center|LOCUS_09730 3265 4167 gene locus_tag LOCUS_09740 gene fabD 3265 4167 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793967.1 protein_id gnl|my_center|LOCUS_09740 4201 4899 gene locus_tag LOCUS_09750 4201 4899 CDS product FKBP-type peptidyl-prolyl cis-trans isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957701.1 protein_id gnl|my_center|LOCUS_09750 >Feature sequence147 612 25 gene locus_tag LOCUS_09760 612 25 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760706.1 protein_id gnl|my_center|LOCUS_09760 2245 629 gene locus_tag LOCUS_09770 2245 629 CDS product thiamine pyrophosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766069.1 protein_id gnl|my_center|LOCUS_09770 2731 2387 gene locus_tag LOCUS_09780 2731 2387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09780 2870 3499 gene locus_tag LOCUS_09790 2870 3499 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09790 <5174 3514 gene locus_tag LOCUS_09800 <5174 3514 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964000.1:LysM peptidoglycan-binding domain-containing protein >Feature sequence148 304 477 gene locus_tag LOCUS_09810 304 477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 804 2081 gene locus_tag LOCUS_09820 804 2081 CDS product DUF2851 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108767.1 protein_id gnl|my_center|LOCUS_09820 2081 3103 gene locus_tag LOCUS_09830 2081 3103 CDS product potassium channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546063.1 protein_id gnl|my_center|LOCUS_09830 5086 3836 gene locus_tag LOCUS_09840 gene metK 5086 3836 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783643.1 protein_id gnl|my_center|LOCUS_09840 >Feature sequence149 62 643 gene locus_tag LOCUS_09850 62 643 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763678.1 protein_id gnl|my_center|LOCUS_09850 1166 633 gene locus_tag LOCUS_09860 1166 633 CDS product RsmD family RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202123.1 protein_id gnl|my_center|LOCUS_09860 1999 1154 gene locus_tag LOCUS_09870 1999 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09870 2563 2006 gene locus_tag LOCUS_09880 2563 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09880 4270 2741 gene locus_tag LOCUS_09890 gene guaA 4270 2741 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785252.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence150 749 201 gene locus_tag LOCUS_09900 749 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09900 1342 1893 gene locus_tag LOCUS_09910 1342 1893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09910 1899 2828 gene locus_tag LOCUS_09920 1899 2828 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_09920 3187 3909 gene locus_tag LOCUS_09930 3187 3909 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838670.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence151 55 1485 gene locus_tag LOCUS_09940 gene dnaA 55 1485 CDS product chromosomal replication initiator protein DnaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034099187.1 protein_id gnl|my_center|LOCUS_09940 1818 2684 gene locus_tag LOCUS_09950 1818 2684 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689009.1 protein_id gnl|my_center|LOCUS_09950 2677 3285 gene locus_tag LOCUS_09960 2677 3285 CDS product YigZ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765869.1 protein_id gnl|my_center|LOCUS_09960 3321 4244 gene locus_tag LOCUS_09970 gene pyrB 3321 4244 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761416.1 protein_id gnl|my_center|LOCUS_09970 4251 4709 gene locus_tag LOCUS_09980 gene pyrI 4251 4709 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787546.1 protein_id gnl|my_center|LOCUS_09980 >Feature sequence152 217 3387 gene locus_tag LOCUS_09990 217 3387 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09990 3665 4645 gene locus_tag LOCUS_10000 3665 4645 CDS product acetyl-CoA carboxylase carboxyltransferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962774.1 protein_id gnl|my_center|LOCUS_10000 >Feature sequence153 141 587 gene locus_tag LOCUS_10010 gene bcp 141 587 CDS product thioredoxin-dependent thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760349.1 protein_id gnl|my_center|LOCUS_10010 600 1628 gene locus_tag LOCUS_10020 gene recA 600 1628 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964335.1 protein_id gnl|my_center|LOCUS_10020 1665 2675 gene locus_tag LOCUS_10030 1665 2675 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10030 3772 2789 gene locus_tag LOCUS_10040 3772 2789 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034097278.1 protein_id gnl|my_center|LOCUS_10040 5028 3769 gene locus_tag LOCUS_10050 5028 3769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10050 >Feature sequence154 1226 120 gene locus_tag LOCUS_10060 1226 120 CDS product serine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_130543805.1 protein_id gnl|my_center|LOCUS_10060 1329 2072 gene locus_tag LOCUS_10070 1329 2072 CDS product NADPH-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203459.1 protein_id gnl|my_center|LOCUS_10070 3596 2139 gene locus_tag LOCUS_10080 3596 2139 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107905.1 protein_id gnl|my_center|LOCUS_10080 4380 3652 gene locus_tag LOCUS_10090 4380 3652 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150234528.1 protein_id gnl|my_center|LOCUS_10090 4835 4377 gene locus_tag LOCUS_10100 4835 4377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10100 >Feature sequence155 232 1926 gene locus_tag LOCUS_10110 232 1926 CDS product M23 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963281.1 protein_id gnl|my_center|LOCUS_10110 3106 2252 gene locus_tag LOCUS_10120 3106 2252 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10120 3491 4726 gene locus_tag LOCUS_10130 gene hutI 3491 4726 CDS product imidazolonepropionase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963888.1 protein_id gnl|my_center|LOCUS_10130 >Feature sequence156 868 110 gene locus_tag LOCUS_10140 868 110 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073146.1 protein_id gnl|my_center|LOCUS_10140 1778 852 gene locus_tag LOCUS_10150 1778 852 CDS product transketolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009903779.1 protein_id gnl|my_center|LOCUS_10150 2596 1775 gene locus_tag LOCUS_10160 2596 1775 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_10160 3653 2586 gene locus_tag LOCUS_10170 3653 2586 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence157 260 1687 gene locus_tag LOCUS_10180 gene rodA 260 1687 CDS product rod shape-determining protein RodA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766924.1 protein_id gnl|my_center|LOCUS_10180 1690 2175 gene locus_tag LOCUS_10190 1690 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10190 2731 2180 gene locus_tag LOCUS_10200 2731 2180 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012870105.1 protein_id gnl|my_center|LOCUS_10200 3554 2799 gene locus_tag LOCUS_10210 3554 2799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10210 4689 3571 gene locus_tag LOCUS_10220 4689 3571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783472.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence158 177 428 gene locus_tag LOCUS_10230 177 428 CDS product Smr/MutS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013224398.1 protein_id gnl|my_center|LOCUS_10230 755 1555 gene locus_tag LOCUS_10240 755 1555 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963269.1 protein_id gnl|my_center|LOCUS_10240 1567 2448 gene locus_tag LOCUS_10250 1567 2448 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760916.1 protein_id gnl|my_center|LOCUS_10250 2504 2513 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2631 3206 gene locus_tag LOCUS_10260 2631 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 4217 3219 gene locus_tag LOCUS_10270 4217 3219 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766582.1 protein_id gnl|my_center|LOCUS_10270 >Feature sequence159 472 137 gene locus_tag LOCUS_10280 472 137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10280 922 476 gene locus_tag LOCUS_10290 922 476 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10290 1475 1113 gene locus_tag LOCUS_10300 1475 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10300 1933 1460 gene locus_tag LOCUS_10310 1933 1460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10310 2234 2001 gene locus_tag LOCUS_10320 2234 2001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 2602 2234 gene locus_tag LOCUS_10330 2602 2234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10330 3378 4481 gene locus_tag LOCUS_10340 3378 4481 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10340 4746 4669 gene locus_tag LOCUS_t00230 4746 4669 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence160 1793 459 gene locus_tag LOCUS_10350 gene murD 1793 459 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964158.1 protein_id gnl|my_center|LOCUS_10350 3043 1793 gene locus_tag LOCUS_10360 gene mraY 3043 1793 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964159.1 protein_id gnl|my_center|LOCUS_10360 4512 3055 gene locus_tag LOCUS_10370 4512 3055 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964160.1 protein_id gnl|my_center|LOCUS_10370 >Feature sequence161 326 976 gene locus_tag LOCUS_10380 326 976 CDS product DUF4159 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963730.1 protein_id gnl|my_center|LOCUS_10380 1472 1032 gene locus_tag LOCUS_10390 1472 1032 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295281.1 protein_id gnl|my_center|LOCUS_10390 3169 1754 gene locus_tag LOCUS_10400 3169 1754 CDS product aminopeptidase P family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203671.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence162 3124 1931 gene locus_tag LOCUS_10410 3124 1931 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763756.1 protein_id gnl|my_center|LOCUS_10410 4804 3866 gene locus_tag LOCUS_10420 4804 3866 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966516.1 protein_id gnl|my_center|LOCUS_10420 >Feature sequence163 174 356 gene locus_tag LOCUS_10430 174 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10430 382 903 gene locus_tag LOCUS_10440 382 903 CDS product HAD-IIIA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802822.1 protein_id gnl|my_center|LOCUS_10440 1023 1874 gene locus_tag LOCUS_10450 1023 1874 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963542.1 protein_id gnl|my_center|LOCUS_10450 1896 2489 gene locus_tag LOCUS_10460 1896 2489 CDS product Maf-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107938.1 protein_id gnl|my_center|LOCUS_10460 2520 3347 gene locus_tag LOCUS_10470 2520 3347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10470 4740 3388 gene locus_tag LOCUS_10480 gene miaB 4740 3388 CDS product tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767433.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence164 722 1027 gene locus_tag LOCUS_10490 722 1027 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021485.1 protein_id gnl|my_center|LOCUS_10490 1066 1992 gene locus_tag LOCUS_10500 1066 1992 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249140.1 protein_id gnl|my_center|LOCUS_10500 2018 4087 gene locus_tag LOCUS_10510 2018 4087 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 4087 4743 gene locus_tag LOCUS_10520 4087 4743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10520 >Feature sequence165 1657 41 gene locus_tag LOCUS_10530 1657 41 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785240.1 protein_id gnl|my_center|LOCUS_10530 2115 1675 gene locus_tag LOCUS_10540 2115 1675 CDS product dCMP deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785242.1 protein_id gnl|my_center|LOCUS_10540 2224 2140 gene locus_tag LOCUS_t00240 2224 2140 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence166 1090 206 gene locus_tag LOCUS_10550 1090 206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 2265 1111 gene locus_tag LOCUS_10560 2265 1111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 3168 2281 gene locus_tag LOCUS_10570 3168 2281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 3675 3196 gene locus_tag LOCUS_10580 3675 3196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10580 3835 3677 gene locus_tag LOCUS_10590 3835 3677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10590 4440 3949 gene locus_tag LOCUS_10600 4440 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_10600 >Feature sequence167 1636 1160 gene locus_tag LOCUS_10610 gene rpsG 1636 1160 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791536.1 protein_id gnl|my_center|LOCUS_10610 2019 1645 gene locus_tag LOCUS_10620 gene rpsL 2019 1645 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005675419.1 protein_id gnl|my_center|LOCUS_10620 2305 4467 gene locus_tag LOCUS_10630 2305 4467 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008763951.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence168 664 173 gene locus_tag LOCUS_10640 gene rplV 664 173 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963465.1 protein_id gnl|my_center|LOCUS_10640 959 693 gene locus_tag LOCUS_10650 gene rpsS 959 693 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782197.1 protein_id gnl|my_center|LOCUS_10650 1797 967 gene locus_tag LOCUS_10660 gene rplB 1797 967 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791545.1 protein_id gnl|my_center|LOCUS_10660 2105 1809 gene locus_tag LOCUS_10670 gene rplW 2105 1809 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007747932.1 protein_id gnl|my_center|LOCUS_10670 2738 2112 gene locus_tag LOCUS_10680 gene rplD 2738 2112 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963468.1 protein_id gnl|my_center|LOCUS_10680 3355 2738 gene locus_tag LOCUS_10690 gene rplC 3355 2738 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005782189.1 protein_id gnl|my_center|LOCUS_10690 3672 3367 gene locus_tag LOCUS_10700 gene rpsJ 3672 3367 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558075.1 protein_id gnl|my_center|LOCUS_10700 <4752 3683 gene locus_tag LOCUS_10710 <4752 3683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963471.1:elongation factor G >Feature sequence169 310 1995 gene locus_tag LOCUS_10720 310 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 2200 3042 gene locus_tag LOCUS_10730 2200 3042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 3017 3625 gene locus_tag LOCUS_10740 3017 3625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10740 3630 4184 gene locus_tag LOCUS_10750 3630 4184 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_10750 4565 4296 gene locus_tag LOCUS_10760 4565 4296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10760 >Feature sequence170 <1 926 gene locus_tag LOCUS_10770 <1 926 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002857980.1:acyl-[ACP]--phospholipid O-acyltransferase 923 1654 gene locus_tag LOCUS_10780 923 1654 CDS product 1-acyl-sn-glycerol-3-phosphate acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010725339.1 protein_id gnl|my_center|LOCUS_10780 2867 1824 gene locus_tag LOCUS_10790 gene rlmN 2867 1824 CDS product 23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964179.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence171 1198 236 gene locus_tag LOCUS_10800 1198 236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10800 2112 1198 gene locus_tag LOCUS_10810 2112 1198 CDS product proline dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000436772.1 protein_id gnl|my_center|LOCUS_10810 3183 2443 gene locus_tag LOCUS_10820 3183 2443 CDS product electron transfer flavoprotein subunit beta/FixA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962507.1 protein_id gnl|my_center|LOCUS_10820 3857 3201 gene locus_tag LOCUS_10830 3857 3201 CDS product 3-oxoacid CoA-transferase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962211.1 protein_id gnl|my_center|LOCUS_10830 4561 3869 gene locus_tag LOCUS_10840 4561 3869 CDS product CoA transferase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962207.1 protein_id gnl|my_center|LOCUS_10840 >Feature sequence172 2252 417 gene locus_tag LOCUS_10850 gene glmS 2252 417 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765067.1 protein_id gnl|my_center|LOCUS_10850 3517 2255 gene locus_tag LOCUS_10860 3517 2255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 4340 3507 gene locus_tag LOCUS_10870 4340 3507 CDS product glycogen/starch synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759978.1 protein_id gnl|my_center|LOCUS_10870 >Feature sequence173 3035 2727 gene locus_tag LOCUS_10880 3035 2727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10880 4043 3060 gene locus_tag LOCUS_10890 4043 3060 CDS product virulence RhuM family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108603.1 protein_id gnl|my_center|LOCUS_10890 4567 4040 gene locus_tag LOCUS_10900 4567 4040 CDS product transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694149.1 protein_id gnl|my_center|LOCUS_10900 >Feature sequence174 199 786 gene locus_tag LOCUS_10910 199 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence175 2771 39 gene locus_tag LOCUS_10920 2771 39 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10920 3353 2805 gene locus_tag LOCUS_10930 3353 2805 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962744.1 protein_id gnl|my_center|LOCUS_10930 4044 3343 gene locus_tag LOCUS_10940 4044 3343 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_10940 <4664 4069 gene locus_tag LOCUS_10950 <4664 4069 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_034100725.1:class I SAM-dependent methyltransferase >Feature sequence176 42 2144 gene locus_tag LOCUS_10960 42 2144 CDS product SurA N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016194724.1 protein_id gnl|my_center|LOCUS_10960 2229 3860 gene locus_tag LOCUS_10970 2229 3860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10970 >Feature sequence177 333 1427 gene locus_tag LOCUS_10980 333 1427 CDS product glycosyltransferase family 1 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_039851544.1 protein_id gnl|my_center|LOCUS_10980 1529 2701 gene locus_tag LOCUS_10990 1529 2701 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 4581 2854 gene locus_tag LOCUS_11000 gene recJ 4581 2854 CDS product single-stranded-DNA-specific exonuclease RecJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203525.1 protein_id gnl|my_center|LOCUS_11000 >Feature sequence178 300 1043 gene locus_tag LOCUS_11010 300 1043 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206817975.1 protein_id gnl|my_center|LOCUS_11010 3367 1748 gene locus_tag LOCUS_11020 3367 1748 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 >Feature sequence179 3267 2404 gene locus_tag LOCUS_11030 3267 2404 CDS product RNA polymerase sigma factor RpoD/SigA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002561589.1 protein_id gnl|my_center|LOCUS_11030 4483 3398 gene locus_tag LOCUS_11040 4483 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 >Feature sequence180 226 1596 gene locus_tag LOCUS_11050 226 1596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11050 1598 3256 gene locus_tag LOCUS_11060 1598 3256 CDS product MBOAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765451.1 protein_id gnl|my_center|LOCUS_11060 3257 4498 gene locus_tag LOCUS_11070 3257 4498 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244232.1 protein_id gnl|my_center|LOCUS_11070 >Feature sequence181 625 1161 gene locus_tag LOCUS_11080 625 1161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 1275 1204 gene locus_tag LOCUS_t00250 1275 1204 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 1724 1329 gene locus_tag LOCUS_11090 1724 1329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11090 2072 1731 gene locus_tag LOCUS_11100 2072 1731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11100 2203 3000 gene locus_tag LOCUS_11110 2203 3000 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762736.1 protein_id gnl|my_center|LOCUS_11110 3051 4067 gene locus_tag LOCUS_11120 gene pheS 3051 4067 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789293.1 protein_id gnl|my_center|LOCUS_11120 >Feature sequence182 3032 2076 gene locus_tag LOCUS_11130 3032 2076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11130 4486 3047 gene locus_tag LOCUS_11140 gene asnS 4486 3047 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964340.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence183 4213 563 gene locus_tag LOCUS_11150 4213 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 >Feature sequence184 140 847 gene locus_tag LOCUS_11160 140 847 CDS product MotA/TolQ/ExbB proton channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760839.1 protein_id gnl|my_center|LOCUS_11160 873 1265 gene locus_tag LOCUS_11170 873 1265 CDS product biopolymer transporter ExbD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760840.1 protein_id gnl|my_center|LOCUS_11170 1283 2032 gene locus_tag LOCUS_11180 1283 2032 CDS product TonB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203535.1 protein_id gnl|my_center|LOCUS_11180 2113 2385 gene locus_tag LOCUS_11190 gene rpsO 2113 2385 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761978.1 protein_id gnl|my_center|LOCUS_11190 >Feature sequence185 4154 2487 gene locus_tag LOCUS_11200 4154 2487 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108753.1 protein_id gnl|my_center|LOCUS_11200 >Feature sequence186 782 177 gene locus_tag LOCUS_11210 782 177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 1390 800 gene locus_tag LOCUS_11220 1390 800 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963075.1 protein_id gnl|my_center|LOCUS_11220 1633 1451 gene locus_tag LOCUS_11230 1633 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1842 1654 gene locus_tag LOCUS_11240 1842 1654 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11240 2521 2141 gene locus_tag LOCUS_11250 2521 2141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11250 3913 2549 gene locus_tag LOCUS_11260 3913 2549 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_184492906.1 protein_id gnl|my_center|LOCUS_11260 >Feature sequence187 2181 1666 gene locus_tag LOCUS_11270 2181 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11270 3368 2202 gene locus_tag LOCUS_11280 3368 2202 CDS product acyl-CoA dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962518.1 protein_id gnl|my_center|LOCUS_11280 4385 3372 gene locus_tag LOCUS_11290 gene ldeG 4385 3372 CDS product hydroxymethylglutaryl-CoA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003231525.1 protein_id gnl|my_center|LOCUS_11290 >Feature sequence188 1427 435 gene locus_tag LOCUS_11300 1427 435 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 2531 1509 gene locus_tag LOCUS_11310 2531 1509 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108506.1 protein_id gnl|my_center|LOCUS_11310 4382 2535 gene locus_tag LOCUS_11320 4382 2535 CDS product 2-oxoacid:acceptor oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_107821429.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence189 228 779 gene locus_tag LOCUS_11330 228 779 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963755.1 protein_id gnl|my_center|LOCUS_11330 1889 792 gene locus_tag LOCUS_11340 gene mqnC 1889 792 CDS product cyclic dehypoxanthinyl futalosine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921709.1 protein_id gnl|my_center|LOCUS_11340 2703 1894 gene locus_tag LOCUS_11350 2703 1894 CDS product purine-nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789915.1 protein_id gnl|my_center|LOCUS_11350 3775 2675 gene locus_tag LOCUS_11360 gene lpxK 3775 2675 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008765467.1 protein_id gnl|my_center|LOCUS_11360 4371 3778 gene locus_tag LOCUS_11370 4371 3778 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142403.1 protein_id gnl|my_center|LOCUS_11370 >Feature sequence190 2032 4347 gene locus_tag LOCUS_11380 2032 4347 CDS product two-component regulator propeller domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962444.1 protein_id gnl|my_center|LOCUS_11380 >Feature sequence191 3404 777 gene locus_tag LOCUS_11390 gene alaS 3404 777 CDS product alanine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796226.1 protein_id gnl|my_center|LOCUS_11390 3555 4313 gene locus_tag LOCUS_11400 3555 4313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11400 >Feature sequence192 104 688 gene locus_tag LOCUS_11410 104 688 CDS product YqgE/AlgH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403273.1 protein_id gnl|my_center|LOCUS_11410 3097 1040 gene locus_tag LOCUS_11420 gene htpG 3097 1040 CDS product molecular chaperone HtpG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202859.1 protein_id gnl|my_center|LOCUS_11420 4422 3907 gene locus_tag LOCUS_11430 4422 3907 CDS product fibrobacter succinogenes major paralogous domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164927068.1 protein_id gnl|my_center|LOCUS_11430 >Feature sequence193 <1 858 gene locus_tag LOCUS_11440 <1 858 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762051.1:DNA-directed RNA polymerase subunit alpha 928 1614 gene locus_tag LOCUS_11450 928 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11450 1831 3117 gene locus_tag LOCUS_11460 gene eno 1831 3117 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391810.1 protein_id gnl|my_center|LOCUS_11460 3182 3255 gene locus_tag LOCUS_t00260 3182 3255 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence194 494 2044 gene locus_tag LOCUS_11470 494 2044 CDS product Rne/Rng family ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786352.1 protein_id gnl|my_center|LOCUS_11470 <4332 2107 gene locus_tag LOCUS_11480 <4332 2107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023607.1:PKD domain-containing protein >Feature sequence195 <1 915 gene locus_tag LOCUS_11490 <1 915 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048064463.1:M42 family metallopeptidase 2095 971 gene locus_tag LOCUS_11500 gene mqnE 2095 971 CDS product aminofutalosine synthase MqnE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546001.1 protein_id gnl|my_center|LOCUS_11500 3315 2101 gene locus_tag LOCUS_11510 3315 2101 CDS product glycoside hydrolase family 57 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764493.1 protein_id gnl|my_center|LOCUS_11510 <4326 3499 gene locus_tag LOCUS_11520 <4326 3499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008759975.1:glycosyltransferase family 4 protein >Feature sequence196 <4303 2395 gene locus_tag LOCUS_11530 <4303 2395 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010877962.1:FAD-dependent oxidoreductase >Feature sequence197 727 341 gene locus_tag LOCUS_11540 727 341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 1070 732 gene locus_tag LOCUS_11550 1070 732 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986701.1 protein_id gnl|my_center|LOCUS_11550 2125 1247 gene locus_tag LOCUS_11560 2125 1247 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392921.1 protein_id gnl|my_center|LOCUS_11560 2982 2122 gene locus_tag LOCUS_11570 2982 2122 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004079932.1 protein_id gnl|my_center|LOCUS_11570 3663 3385 gene locus_tag LOCUS_11580 3663 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11580 4086 3679 gene locus_tag LOCUS_11590 4086 3679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence198 3233 1101 gene locus_tag LOCUS_11600 3233 1101 CDS product hydrophobe/amphiphile efflux-3 (HAE3) family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878724.1 protein_id gnl|my_center|LOCUS_11600 <4268 3417 gene locus_tag LOCUS_11610 <4268 3417 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000791479.1:DNA-binding protein >Feature sequence199 73 1290 gene locus_tag LOCUS_11620 73 1290 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545898.1 protein_id gnl|my_center|LOCUS_11620 1330 2985 gene locus_tag LOCUS_11630 gene pckA 1330 2985 CDS product phosphoenolpyruvate carboxykinase (ATP) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393393.1 protein_id gnl|my_center|LOCUS_11630 3148 4149 gene locus_tag LOCUS_11640 gene holA 3148 4149 CDS product DNA polymerase III subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963198.1 protein_id gnl|my_center|LOCUS_11640 >Feature sequence200 3665 756 gene locus_tag LOCUS_11650 3665 756 CDS product glycoside hydrolase family 3 N-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962917.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence201 <1 753 gene locus_tag LOCUS_11660 <1 753 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788098.1:exodeoxyribonuclease III 755 1645 gene locus_tag LOCUS_11670 755 1645 CDS product LD-carboxypeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162179062.1 protein_id gnl|my_center|LOCUS_11670 2399 1974 gene locus_tag LOCUS_11680 2399 1974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11680 3654 2521 gene locus_tag LOCUS_11690 3654 2521 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_11690 >Feature sequence202 101 451 gene locus_tag LOCUS_11700 gene rplS 101 451 CDS product 50S ribosomal protein L19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005778830.1 protein_id gnl|my_center|LOCUS_11700 2021 528 gene locus_tag LOCUS_11710 2021 528 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 3331 2051 gene locus_tag LOCUS_11720 3331 2051 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202792.1 protein_id gnl|my_center|LOCUS_11720 4039 3419 gene locus_tag LOCUS_11730 4039 3419 CDS product HAD family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010905122.1 protein_id gnl|my_center|LOCUS_11730 4109 4183 gene locus_tag LOCUS_t00270 4109 4183 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence203 <1 2199 gene locus_tag LOCUS_11740 <1 2199 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764112.1:DNA helicase RecQ 2259 3599 gene locus_tag LOCUS_11750 2259 3599 CDS product short-chain fatty acid transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814726.1 protein_id gnl|my_center|LOCUS_11750 >Feature sequence204 599 1189 gene locus_tag LOCUS_11760 599 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 1246 2247 gene locus_tag LOCUS_11770 1246 2247 CDS product aminodeoxychorismate synthase component I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694271.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence205 942 40 gene locus_tag LOCUS_11780 gene aglG 942 40 CDS product glucosyl-dolichyl phosphate glucuronosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012289272.1 protein_id gnl|my_center|LOCUS_11780 3325 998 gene locus_tag LOCUS_11790 3325 998 CDS product carboxypeptidase-like regulatory domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963280.1 protein_id gnl|my_center|LOCUS_11790 <4167 3582 gene locus_tag LOCUS_11800 <4167 3582 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788748.1:DNA polymerase III subunit beta >Feature sequence206 <1 1587 gene locus_tag LOCUS_11810 <1 1587 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000686845.1:AAA family ATPase 3091 1640 gene locus_tag LOCUS_11820 gene rpoN 3091 1640 CDS product RNA polymerase factor sigma-54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203672.1 protein_id gnl|my_center|LOCUS_11820 3278 3724 gene locus_tag LOCUS_11830 3278 3724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11830 >Feature sequence207 650 84 gene locus_tag LOCUS_11840 650 84 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760019.1 protein_id gnl|my_center|LOCUS_11840 1601 651 gene locus_tag LOCUS_11850 1601 651 CDS product transketolase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962843.1 protein_id gnl|my_center|LOCUS_11850 3146 1608 gene locus_tag LOCUS_11860 gene rny 3146 1608 CDS product ribonuclease Y inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005790424.1 protein_id gnl|my_center|LOCUS_11860 3684 3385 gene locus_tag LOCUS_11870 3684 3385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11870 4004 3687 gene locus_tag LOCUS_11880 4004 3687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11880 >Feature sequence208 1421 1041 gene locus_tag LOCUS_11890 1421 1041 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963569.1 protein_id gnl|my_center|LOCUS_11890 1898 1972 gene locus_tag LOCUS_t00280 1898 1972 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2863 2180 gene locus_tag LOCUS_11900 gene radC 2863 2180 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767010.1 protein_id gnl|my_center|LOCUS_11900 4086 2875 gene locus_tag LOCUS_11910 4086 2875 CDS product NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962645.1 protein_id gnl|my_center|LOCUS_11910 >Feature sequence209 29 676 gene locus_tag LOCUS_11920 29 676 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787229.1 protein_id gnl|my_center|LOCUS_11920 1004 2770 gene locus_tag LOCUS_11930 gene aspS 1004 2770 CDS product aspartate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962449.1 protein_id gnl|my_center|LOCUS_11930 2823 3119 gene locus_tag LOCUS_11940 2823 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11940 3119 3418 gene locus_tag LOCUS_11950 3119 3418 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409896.1 protein_id gnl|my_center|LOCUS_11950 3462 4040 gene locus_tag LOCUS_11960 3462 4040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence210 <1 1259 gene locus_tag LOCUS_11970 <1 1259 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920611.1:type II toxin-antitoxin system HipA family toxin 1393 1578 gene locus_tag LOCUS_11980 1393 1578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 1736 3976 gene locus_tag LOCUS_11990 1736 3976 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11990 >Feature sequence211 <1 1057 gene locus_tag LOCUS_12000 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762559.1:glycine--tRNA ligase <4062 1135 gene locus_tag LOCUS_12010 <4062 1135 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005793715.1:S41 family peptidase >Feature sequence212 217 1938 gene locus_tag LOCUS_12020 217 1938 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767964.1 protein_id gnl|my_center|LOCUS_12020 2009 2404 gene locus_tag LOCUS_12030 2009 2404 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963234.1 protein_id gnl|my_center|LOCUS_12030 2416 3114 gene locus_tag LOCUS_12040 2416 3114 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964103.1 protein_id gnl|my_center|LOCUS_12040 3212 3703 gene locus_tag LOCUS_12050 gene ribH 3212 3703 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785230.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence213 48 356 gene locus_tag LOCUS_12060 48 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 368 625 gene locus_tag LOCUS_12070 gene rpmA 368 625 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067214.1 protein_id gnl|my_center|LOCUS_12070 1271 900 gene locus_tag LOCUS_12080 1271 900 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047760.1 protein_id gnl|my_center|LOCUS_12080 1766 1368 gene locus_tag LOCUS_12090 1766 1368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12090 2643 1786 gene locus_tag LOCUS_12100 2643 1786 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964484.1 protein_id gnl|my_center|LOCUS_12100 <4014 2800 gene locus_tag LOCUS_12110 <4014 2800 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963213.1:alanine dehydrogenase >Feature sequence214 563 3865 gene locus_tag LOCUS_12120 gene mfd 563 3865 CDS product transcription-repair coupling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962369.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence215 69 1412 gene locus_tag LOCUS_12130 gene ffh 69 1412 CDS product signal recognition particle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767918.1 protein_id gnl|my_center|LOCUS_12130 1598 1963 gene locus_tag LOCUS_12140 1598 1963 CDS product four helix bundle protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964356.1 protein_id gnl|my_center|LOCUS_12140 2022 2900 gene locus_tag LOCUS_12150 gene folD 2022 2900 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005780414.1 protein_id gnl|my_center|LOCUS_12150 2921 3379 gene locus_tag LOCUS_12160 2921 3379 CDS product DUF4293 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788196.1 protein_id gnl|my_center|LOCUS_12160 >Feature sequence216 1294 416 gene locus_tag LOCUS_12170 1294 416 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12170 2163 1291 gene locus_tag LOCUS_12180 2163 1291 CDS product nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785714.1 protein_id gnl|my_center|LOCUS_12180 2204 3058 gene locus_tag LOCUS_12190 2204 3058 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12190 3277 3798 gene locus_tag LOCUS_12200 3277 3798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963023.1 protein_id gnl|my_center|LOCUS_12200 >Feature sequence217 2034 202 gene locus_tag LOCUS_12210 2034 202 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_025814212.1 protein_id gnl|my_center|LOCUS_12210 2888 2109 gene locus_tag LOCUS_12220 2888 2109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12220 3807 2893 gene locus_tag LOCUS_12230 3807 2893 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787920.1 protein_id gnl|my_center|LOCUS_12230 >Feature sequence218 479 324 gene locus_tag LOCUS_12240 479 324 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12240 3586 548 gene locus_tag LOCUS_12250 3586 548 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173072481.1 protein_id gnl|my_center|LOCUS_12250 >Feature sequence219 3056 819 gene locus_tag LOCUS_12260 3056 819 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760913.1 protein_id gnl|my_center|LOCUS_12260 3750 3064 gene locus_tag LOCUS_12270 gene purQ 3750 3064 CDS product phosphoribosylformylglycinamidine synthase subunit PurQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403297.1 protein_id gnl|my_center|LOCUS_12270 >Feature sequence220 2666 93 gene locus_tag LOCUS_12280 gene acnB 2666 93 CDS product bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942304.1 protein_id gnl|my_center|LOCUS_12280 <3791 2892 gene locus_tag LOCUS_12290 <3791 2892 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011016958.1:pyruvate:ferredoxin (flavodoxin) oxidoreductase >Feature sequence221 3713 3060 gene locus_tag LOCUS_12300 3713 3060 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12300 >Feature sequence222 199 504 gene locus_tag LOCUS_12310 199 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 504 1475 gene locus_tag LOCUS_12320 504 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 1475 2092 gene locus_tag LOCUS_12330 1475 2092 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12330 2085 2555 gene locus_tag LOCUS_12340 2085 2555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence223 <3727 2804 gene locus_tag LOCUS_12350 <3727 2804 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005795937.1:tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA >Feature sequence224 1584 1 gene locus_tag LOCUS_12360 gene atpA 1584 1 CDS product F0F1 ATP synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787491.1 protein_id gnl|my_center|LOCUS_12360 2151 1588 gene locus_tag LOCUS_12370 2151 1588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12370 2693 2151 gene locus_tag LOCUS_12380 2693 2151 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964547.1 protein_id gnl|my_center|LOCUS_12380 2967 2710 gene locus_tag LOCUS_12390 gene atpE 2967 2710 CDS product ATP synthase F0 subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004295758.1 protein_id gnl|my_center|LOCUS_12390 <3725 3003 gene locus_tag LOCUS_12400 <3725 3003 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107411.1:F0F1 ATP synthase subunit A >Feature sequence225 >Feature sequence226 695 492 gene locus_tag LOCUS_12410 695 492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 947 705 gene locus_tag LOCUS_12420 947 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12420 1459 956 gene locus_tag LOCUS_12430 1459 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12430 1904 1533 gene locus_tag LOCUS_12440 1904 1533 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 2848 2369 gene locus_tag LOCUS_12450 2848 2369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12450 3090 2845 gene locus_tag LOCUS_12460 3090 2845 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12460 >Feature sequence227 1756 662 gene locus_tag LOCUS_12470 1756 662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12470 2620 1814 gene locus_tag LOCUS_12480 2620 1814 CDS product transketolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041272027.1 protein_id gnl|my_center|LOCUS_12480 3093 2626 gene locus_tag LOCUS_12490 3093 2626 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 >Feature sequence228 327 1175 gene locus_tag LOCUS_12500 327 1175 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429044.1 protein_id gnl|my_center|LOCUS_12500 1239 1430 gene locus_tag LOCUS_12510 1239 1430 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12510 3426 1795 gene locus_tag LOCUS_12520 gene pruA 3426 1795 CDS product L-glutamate gamma-semialdehyde dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962584.1 protein_id gnl|my_center|LOCUS_12520 >Feature sequence229 378 1763 gene locus_tag LOCUS_12530 gene gatD 378 1763 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867819.1 protein_id gnl|my_center|LOCUS_12530 1792 2334 gene locus_tag LOCUS_12540 1792 2334 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12540 3058 2552 gene locus_tag LOCUS_12550 3058 2552 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838404.1 protein_id gnl|my_center|LOCUS_12550 3625 3119 gene locus_tag LOCUS_12560 3625 3119 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12560 >Feature sequence230 479 2710 gene locus_tag LOCUS_12570 479 2710 CDS product cbb3-type cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015444167.1 protein_id gnl|my_center|LOCUS_12570 2831 2905 gene locus_tag LOCUS_t00290 2831 2905 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3468 3013 gene locus_tag LOCUS_12580 3468 3013 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964338.1 protein_id gnl|my_center|LOCUS_12580 >Feature sequence231 <1 1530 gene locus_tag LOCUS_12590 <1 1530 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963876.1:DUF349 domain-containing protein >Feature sequence232 891 19 gene locus_tag LOCUS_12600 891 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 961 970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1114 2844 gene locus_tag LOCUS_12610 gene lysS 1114 2844 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005802230.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence233 <1 1308 gene locus_tag LOCUS_12620 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005788731.1:PhoH family protein 1441 2670 gene locus_tag LOCUS_12630 1441 2670 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011460982.1 protein_id gnl|my_center|LOCUS_12630 >Feature sequence234 123 764 gene locus_tag LOCUS_12640 123 764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 3408 1138 gene locus_tag LOCUS_12650 3408 1138 CDS product NADP-dependent malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008766293.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence235 1633 440 gene locus_tag LOCUS_12660 1633 440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12660 2881 1661 gene locus_tag LOCUS_12670 gene rocD 2881 1661 CDS product ornithine--oxo-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962898.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence236 343 726 gene locus_tag LOCUS_12680 343 726 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 2089 902 gene locus_tag LOCUS_12690 gene kbl 2089 902 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962334.1 protein_id gnl|my_center|LOCUS_12690 2567 2313 gene locus_tag LOCUS_12700 gene purS 2567 2313 CDS product phosphoribosylformylglycinamidine synthase subunit PurS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011140445.1 protein_id gnl|my_center|LOCUS_12700 3264 2623 gene locus_tag LOCUS_12710 gene pssA 3264 2623 CDS product CDP-diacylglycerol--serine O-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784737.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence237 2190 3194 gene locus_tag LOCUS_12720 2190 3194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 >Feature sequence238 797 93 gene locus_tag LOCUS_12730 797 93 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12730 1978 794 gene locus_tag LOCUS_12740 gene mqnF 1978 794 CDS product aminofutalosine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001155847.1 protein_id gnl|my_center|LOCUS_12740 2625 1975 gene locus_tag LOCUS_12750 2625 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 3231 2650 gene locus_tag LOCUS_12760 3231 2650 CDS product non-canonical purine NTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108650.1 protein_id gnl|my_center|LOCUS_12760 >Feature sequence239 <1 507 gene locus_tag LOCUS_12770 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011172761.1:phosphoadenylyl-sulfate reductase 811 1749 gene locus_tag LOCUS_12780 811 1749 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12780 2665 2979 gene locus_tag LOCUS_12790 2665 2979 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118195647.1 protein_id gnl|my_center|LOCUS_12790 3015 3137 gene locus_tag LOCUS_12800 3015 3137 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12800 >Feature sequence240 1045 1611 gene locus_tag LOCUS_12810 1045 1611 CDS product succinate dehydrogenase/fumarate reductase cytochrome b subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761733.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence241 915 3398 gene locus_tag LOCUS_12820 915 3398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence242 528 1205 gene locus_tag LOCUS_12830 528 1205 CDS product energy transducer TonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761051.1 protein_id gnl|my_center|LOCUS_12830 1290 2474 gene locus_tag LOCUS_12840 1290 2474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 >Feature sequence243 833 168 gene locus_tag LOCUS_12850 833 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 <3400 1320 gene locus_tag LOCUS_12860 <3400 1320 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080789.1:PEGA domain-containing protein >Feature sequence244 199 504 gene locus_tag LOCUS_12870 199 504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 504 1475 gene locus_tag LOCUS_12880 504 1475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12880 1475 2086 gene locus_tag LOCUS_12890 1475 2086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12890 2079 2549 gene locus_tag LOCUS_12900 2079 2549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence245 317 1204 gene locus_tag LOCUS_12910 317 1204 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962636.1 protein_id gnl|my_center|LOCUS_12910 1276 2088 gene locus_tag LOCUS_12920 1276 2088 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010869781.1 protein_id gnl|my_center|LOCUS_12920 >Feature sequence246 3138 223 gene locus_tag LOCUS_12930 3138 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence247 575 234 gene locus_tag LOCUS_12940 575 234 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12940 813 556 gene locus_tag LOCUS_12950 813 556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 1505 813 gene locus_tag LOCUS_12960 1505 813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 >Feature sequence248 347 69 gene locus_tag LOCUS_12970 347 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12970 1497 814 gene locus_tag LOCUS_12980 1497 814 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12980 2871 1840 gene locus_tag LOCUS_12990 2871 1840 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962242.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence249 103 1146 gene locus_tag LOCUS_13000 103 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13000 1588 3015 gene locus_tag LOCUS_13010 1588 3015 CDS product bifunctional UDP-sugar hydrolase/5'-nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012584140.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence250 1933 1124 gene locus_tag LOCUS_13020 1933 1124 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13020 1992 1906 gene locus_tag LOCUS_t00300 1992 1906 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2191 2106 gene locus_tag LOCUS_t00310 2191 2106 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 <3345 2244 gene locus_tag LOCUS_13030 <3345 2244 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964428.1:S9 family peptidase >Feature sequence251 223 777 gene locus_tag LOCUS_13040 223 777 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002657895.1 protein_id gnl|my_center|LOCUS_13040 788 1594 gene locus_tag LOCUS_13050 788 1594 CDS product DUF3108 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962403.1 protein_id gnl|my_center|LOCUS_13050 2474 1866 gene locus_tag LOCUS_13060 2474 1866 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13060 >Feature sequence252 1879 536 gene locus_tag LOCUS_13070 1879 536 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838376.1 protein_id gnl|my_center|LOCUS_13070 3116 1893 gene locus_tag LOCUS_13080 3116 1893 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760037.1 protein_id gnl|my_center|LOCUS_13080 >Feature sequence253 1561 2019 gene locus_tag LOCUS_13090 1561 2019 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 2044 2646 gene locus_tag LOCUS_13100 2044 2646 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13100 >Feature sequence254 2525 753 gene locus_tag LOCUS_13110 2525 753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence255 26 997 gene locus_tag LOCUS_13120 26 997 CDS product MlaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759761.1 protein_id gnl|my_center|LOCUS_13120 1196 2512 gene locus_tag LOCUS_13130 1196 2512 CDS product (Fe-S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962913.1 protein_id gnl|my_center|LOCUS_13130 >Feature sequence256 292 573 gene locus_tag LOCUS_13140 292 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 577 816 gene locus_tag LOCUS_13150 577 816 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 1083 1373 gene locus_tag LOCUS_13160 1083 1373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13160 1740 1979 gene locus_tag LOCUS_13170 1740 1979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13170 2118 2399 gene locus_tag LOCUS_13180 2118 2399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13180 >Feature sequence257 314 1468 gene locus_tag LOCUS_13190 314 1468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 2217 1525 gene locus_tag LOCUS_13200 2217 1525 CDS product DUF4956 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767684.1 protein_id gnl|my_center|LOCUS_13200 2890 2204 gene locus_tag LOCUS_13210 2890 2204 CDS product polyphosphate polymerase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767683.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence258 1276 2061 gene locus_tag LOCUS_13220 1276 2061 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_034100725.1 protein_id gnl|my_center|LOCUS_13220 2086 2787 gene locus_tag LOCUS_13230 2086 2787 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962745.1 protein_id gnl|my_center|LOCUS_13230 >Feature sequence259 606 2459 gene locus_tag LOCUS_13240 606 2459 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963575.1 protein_id gnl|my_center|LOCUS_13240 >Feature sequence260 258 1142 gene locus_tag LOCUS_13250 258 1142 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13250 1482 3074 gene locus_tag LOCUS_13260 1482 3074 CDS product alkaline phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963871.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence261 1639 848 gene locus_tag LOCUS_13270 1639 848 CDS product thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203420.1 protein_id gnl|my_center|LOCUS_13270 2283 1702 gene locus_tag LOCUS_13280 2283 1702 CDS product bifunctional nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013062451.1 protein_id gnl|my_center|LOCUS_13280 3115 2357 gene locus_tag LOCUS_13290 3115 2357 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761499.1 protein_id gnl|my_center|LOCUS_13290 >Feature sequence262 2305 1913 gene locus_tag LOCUS_13300 2305 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 3192 2302 gene locus_tag LOCUS_13310 gene rsmH 3192 2302 CDS product 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005784016.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence263 <1 507 gene locus_tag LOCUS_13320 <1 507 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008766213.1:S46 family peptidase 745 2550 gene locus_tag LOCUS_13330 gene mutA 745 2550 CDS product methylmalonyl-CoA mutase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011203449.1 protein_id gnl|my_center|LOCUS_13330 >Feature sequence264 396 2612 gene locus_tag LOCUS_13340 396 2612 CDS product RelA/SpoT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963971.1 protein_id gnl|my_center|LOCUS_13340 2721 3179 gene locus_tag LOCUS_13350 2721 3179 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964007.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence265 117 1724 gene locus_tag LOCUS_13360 117 1724 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303090.1 protein_id gnl|my_center|LOCUS_13360 1758 2432 gene locus_tag LOCUS_13370 1758 2432 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762400.1 protein_id gnl|my_center|LOCUS_13370 <3199 2448 gene locus_tag LOCUS_13380 <3199 2448 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107600.1:PD-(D/E)XK nuclease family protein >Feature sequence266 891 616 gene locus_tag LOCUS_13390 891 616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 984 912 gene locus_tag LOCUS_t00320 984 912 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 2221 1265 gene locus_tag LOCUS_13400 gene tal 2221 1265 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073375.1 protein_id gnl|my_center|LOCUS_13400 <3188 2350 gene locus_tag LOCUS_13410 <3188 2350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015943055.1:FAD-dependent oxidoreductase >Feature sequence267 47 2761 gene locus_tag LOCUS_13420 47 2761 CDS product exo-alpha-sialidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_208256196.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence268 <1 833 gene locus_tag LOCUS_13430 <1 833 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963265.1:signal peptidase I 905 2236 gene locus_tag LOCUS_13440 905 2236 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202711.1 protein_id gnl|my_center|LOCUS_13440 2294 3013 gene locus_tag LOCUS_13450 2294 3013 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010937679.1 protein_id gnl|my_center|LOCUS_13450 >Feature sequence269 <1 1391 gene locus_tag LOCUS_13460 <1 1391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938960.1:ABC transporter transmembrane domain-containing protein 1477 2574 gene locus_tag LOCUS_13470 1477 2574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence270 1563 751 gene locus_tag LOCUS_13480 1563 751 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 2456 1623 gene locus_tag LOCUS_13490 2456 1623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13490 >Feature sequence271 1 1593 gene locus_tag LOCUS_13500 1 1593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2858 1590 gene locus_tag LOCUS_13510 2858 1590 CDS product arginine deiminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403437.1 protein_id gnl|my_center|LOCUS_13510 >Feature sequence272 2467 1892 gene locus_tag LOCUS_13520 2467 1892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13520 2601 3104 gene locus_tag LOCUS_13530 2601 3104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence273 1671 22 gene locus_tag LOCUS_13540 gene fumB 1671 22 CDS product class I fumarate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000066697.1 protein_id gnl|my_center|LOCUS_13540 <3115 2051 gene locus_tag LOCUS_13550 <3115 2051 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764111.1:ATP-dependent Clp protease ATP-binding subunit ClpX >Feature sequence274 >Feature sequence275 212 667 gene locus_tag LOCUS_13560 212 667 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13560 677 2287 gene locus_tag LOCUS_13570 677 2287 CDS product type I restriction-modification system subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011058062.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence276 196 639 gene locus_tag LOCUS_13580 gene rpiB 196 639 CDS product ribose 5-phosphate isomerase B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010874952.1 protein_id gnl|my_center|LOCUS_13580 2041 659 gene locus_tag LOCUS_13590 2041 659 CDS product folylpolyglutamate synthase/dihydrofolate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010965694.1 protein_id gnl|my_center|LOCUS_13590 2735 2031 gene locus_tag LOCUS_13600 gene ilvE 2735 2031 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583718.1 protein_id gnl|my_center|LOCUS_13600 >Feature sequence277 <1 2688 gene locus_tag LOCUS_13610 <1 2688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005790471.1:PEP/pyruvate-binding domain-containing protein >Feature sequence278 <1 1202 gene locus_tag LOCUS_13620 <1 1202 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056091.1:asparagine synthase (glutamine-hydrolyzing) 1189 2379 gene locus_tag LOCUS_13630 1189 2379 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011056098.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence279 <1 907 gene locus_tag LOCUS_13640 <1 907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005462500.1:glycosyl transferase family 90 2300 984 gene locus_tag LOCUS_13650 2300 984 CDS product citrate (Si)-synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941767.1 protein_id gnl|my_center|LOCUS_13650 2366 2494 gene locus_tag LOCUS_13660 2366 2494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 <3044 2487 gene locus_tag LOCUS_13670 <3044 2487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964458.1:C1 family peptidase >Feature sequence280 659 823 gene locus_tag LOCUS_13680 659 823 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 861 1049 gene locus_tag LOCUS_13690 861 1049 CDS product type II toxin-antitoxin system HicA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003530010.1 protein_id gnl|my_center|LOCUS_13690 1061 1456 gene locus_tag LOCUS_13700 1061 1456 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 1675 1908 gene locus_tag LOCUS_13710 1675 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964043.1 protein_id gnl|my_center|LOCUS_13710 1908 2225 gene locus_tag LOCUS_13720 1908 2225 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964042.1 protein_id gnl|my_center|LOCUS_13720 2558 2881 gene locus_tag LOCUS_13730 2558 2881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13730 >Feature sequence281 520 852 gene locus_tag LOCUS_13740 gene yajC 520 852 CDS product preprotein translocase subunit YajC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931759.1 protein_id gnl|my_center|LOCUS_13740 859 1869 gene locus_tag LOCUS_13750 859 1869 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13750 1862 2452 gene locus_tag LOCUS_13760 gene coaE 1862 2452 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764748.1 protein_id gnl|my_center|LOCUS_13760 >Feature sequence282 <1 703 gene locus_tag LOCUS_13770 <1 703 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008762870.1:deoxyribose-phosphate aldolase 1011 1826 gene locus_tag LOCUS_13780 1011 1826 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963740.1 protein_id gnl|my_center|LOCUS_13780 1828 2805 gene locus_tag LOCUS_13790 1828 2805 CDS product glycosyltransferase family 9 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011016467.1 protein_id gnl|my_center|LOCUS_13790 >Feature sequence283 2680 1481 gene locus_tag LOCUS_13800 2680 1481 CDS product GlmU family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963272.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence284 1795 1166 gene locus_tag LOCUS_13810 1795 1166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 2994 2356 gene locus_tag LOCUS_13820 2994 2356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 >Feature sequence285 2562 877 gene locus_tag LOCUS_13830 2562 877 CDS product peptide MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788185.1 protein_id gnl|my_center|LOCUS_13830 >Feature sequence286 1806 514 gene locus_tag LOCUS_13840 gene serS 1806 514 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785334.1 protein_id gnl|my_center|LOCUS_13840 2841 1897 gene locus_tag LOCUS_13850 2841 1897 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962326.1 protein_id gnl|my_center|LOCUS_13850 >Feature sequence287 1428 79 gene locus_tag LOCUS_13860 gene gdhA 1428 79 CDS product NADP-specific glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962445.1 protein_id gnl|my_center|LOCUS_13860 2967 1612 gene locus_tag LOCUS_13870 2967 1612 CDS product DNA recombination protein RmuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964093.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence288 411 1982 gene locus_tag LOCUS_13880 411 1982 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005786918.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence289 1108 356 gene locus_tag LOCUS_13890 1108 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13890 >Feature sequence290 1427 990 gene locus_tag LOCUS_13900 1427 990 CDS product Rrf2 family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003509013.1 protein_id gnl|my_center|LOCUS_13900 2802 1417 gene locus_tag LOCUS_13910 2802 1417 CDS product LutB/LldF family L-lactate oxidation iron-sulfur protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002216936.1 protein_id gnl|my_center|LOCUS_13910 >Feature sequence291 1370 2248 gene locus_tag LOCUS_13920 1370 2248 CDS product permease-like cell division protein FtsX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005779718.1 protein_id gnl|my_center|LOCUS_13920 2241 2492 gene locus_tag LOCUS_13930 2241 2492 CDS product DUF3098 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964448.1 protein_id gnl|my_center|LOCUS_13930 >Feature sequence292 1499 27 gene locus_tag LOCUS_13940 gene proS 1499 27 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005793720.1 protein_id gnl|my_center|LOCUS_13940 >Feature sequence293 34 669 gene locus_tag LOCUS_13950 34 669 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787656.1 protein_id gnl|my_center|LOCUS_13950 2806 779 gene locus_tag LOCUS_13960 2806 779 CDS product OmpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964499.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence294 1479 415 gene locus_tag LOCUS_13970 gene serC 1479 415 CDS product 3-phosphoserine/phosphohydroxythreonine transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005794503.1 protein_id gnl|my_center|LOCUS_13970 2439 1738 gene locus_tag LOCUS_13980 2439 1738 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963290.1 protein_id gnl|my_center|LOCUS_13980 >Feature sequence295 120 1175 gene locus_tag LOCUS_13990 120 1175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13990 1175 2272 gene locus_tag LOCUS_14000 1175 2272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 >Feature sequence296 2492 210 gene locus_tag LOCUS_14010 2492 210 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 >Feature sequence297 1783 2487 gene locus_tag LOCUS_14020 1783 2487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14020 >Feature sequence298 >Feature sequence299 95 805 gene locus_tag LOCUS_14030 95 805 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963166.1 protein_id gnl|my_center|LOCUS_14030 808 1992 gene locus_tag LOCUS_14040 808 1992 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963881.1 protein_id gnl|my_center|LOCUS_14040 >Feature sequence300 618 2534 gene locus_tag LOCUS_14050 gene dxs 618 2534 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008764325.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence301 1975 878 gene locus_tag LOCUS_14060 gene murG 1975 878 CDS product undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108837.1 protein_id gnl|my_center|LOCUS_14060 <2864 1959 gene locus_tag LOCUS_14070 <2864 1959 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964157.1:FtsW/RodA/SpoVE family cell cycle protein >Feature sequence302 1546 650 gene locus_tag LOCUS_14080 gene era 1546 650 CDS product GTPase Era inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964066.1 protein_id gnl|my_center|LOCUS_14080 <2840 1548 gene locus_tag LOCUS_14090 <2840 1548 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962609.1:DUF5686 family protein >Feature sequence303 1661 183 gene locus_tag LOCUS_14100 gene cysS 1661 183 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009291350.1 protein_id gnl|my_center|LOCUS_14100 2515 1664 gene locus_tag LOCUS_14110 2515 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 >Feature sequence304 339 412 gene locus_tag LOCUS_t00330 339 412 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 2481 1024 gene locus_tag LOCUS_14120 2481 1024 CDS product sodium:solute symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767085.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence305 356 1384 gene locus_tag LOCUS_14130 356 1384 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962315.1 protein_id gnl|my_center|LOCUS_14130 1608 2480 gene locus_tag LOCUS_14140 1608 2480 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761572.1 protein_id gnl|my_center|LOCUS_14140 >Feature sequence306 335 460 gene locus_tag LOCUS_14150 335 460 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14150 2128 443 gene locus_tag LOCUS_14160 2128 443 CDS product M3 family oligoendopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080599.1 protein_id gnl|my_center|LOCUS_14160 2676 2236 gene locus_tag LOCUS_14170 2676 2236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14170 >Feature sequence307 <2754 163 gene locus_tag LOCUS_14180 <2754 163 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943762.1:M1 family aminopeptidase >Feature sequence308 >Feature sequence309 3 899 gene locus_tag LOCUS_14190 3 899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14190 892 2043 gene locus_tag LOCUS_14200 892 2043 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962827.1 protein_id gnl|my_center|LOCUS_14200 2664 2053 gene locus_tag LOCUS_14210 2664 2053 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 >Feature sequence310 118 984 gene locus_tag LOCUS_14220 118 984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14220 >Feature sequence311 242 817 gene locus_tag LOCUS_14230 242 817 CDS product aminodeoxychorismate/anthranilate synthase component II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962676.1 protein_id gnl|my_center|LOCUS_14230 1338 961 gene locus_tag LOCUS_14240 1338 961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14240 1878 1351 gene locus_tag LOCUS_14250 1878 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14250 <2721 2083 gene locus_tag LOCUS_14260 <2721 2083 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008765734.1:30S ribosomal protein S12 methylthiotransferase RimO >Feature sequence312 <1 787 gene locus_tag LOCUS_14270 <1 787 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008761572.1:DUF58 domain-containing protein 780 1706 gene locus_tag LOCUS_14280 780 1706 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 1699 2691 gene locus_tag LOCUS_14290 1699 2691 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787921.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence313 1134 1712 gene locus_tag LOCUS_14300 1134 1712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14300 >Feature sequence314 <1 950 gene locus_tag LOCUS_14310 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962409.1:bifunctional riboflavin kinase/FAD synthetase 947 2620 gene locus_tag LOCUS_14320 947 2620 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920781.1 protein_id gnl|my_center|LOCUS_14320 >Feature sequence315 1 468 gene locus_tag LOCUS_14330 1 468 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 577 1680 gene locus_tag LOCUS_14340 577 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14340 >Feature sequence316 211 1119 gene locus_tag LOCUS_14350 211 1119 CDS product DUF368 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263632.1 protein_id gnl|my_center|LOCUS_14350 1401 2132 gene locus_tag LOCUS_14360 1401 2132 CDS product shikimate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963879.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence317 2155 1613 gene locus_tag LOCUS_14370 2155 1613 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 >Feature sequence318 <1 2246 gene locus_tag LOCUS_14380 <1 2246 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963500.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence319 <2654 688 gene locus_tag LOCUS_14390 <2654 688 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005791925.1:methionine--tRNA ligase >Feature sequence320 73 1191 gene locus_tag LOCUS_14400 73 1191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14400 1188 2531 gene locus_tag LOCUS_14410 1188 2531 CDS product DASS family sodium-coupled anion symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006285466.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence321 407 1579 gene locus_tag LOCUS_14420 407 1579 CDS product TolC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788229.1 protein_id gnl|my_center|LOCUS_14420 1591 2511 gene locus_tag LOCUS_14430 1591 2511 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107324.1 protein_id gnl|my_center|LOCUS_14430 >Feature sequence322 1218 199 gene locus_tag LOCUS_14440 gene neuB 1218 199 CDS product N-acetylneuraminate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000262516.1 protein_id gnl|my_center|LOCUS_14440 1897 1199 gene locus_tag LOCUS_14450 1897 1199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870576.1 protein_id gnl|my_center|LOCUS_14450 2470 1919 gene locus_tag LOCUS_14460 2470 1919 CDS product CatB-related O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011022159.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence323 1874 933 gene locus_tag LOCUS_14470 1874 933 CDS product 2-hydroxyacid dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962245.1 protein_id gnl|my_center|LOCUS_14470 <2607 1893 gene locus_tag LOCUS_14480 <2607 1893 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706420.1:dihydroorotase >Feature sequence324 724 80 gene locus_tag LOCUS_14490 724 80 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964013.1 protein_id gnl|my_center|LOCUS_14490 811 1794 gene locus_tag LOCUS_14500 811 1794 CDS product Gfo/Idh/MocA family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964014.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence325 833 910 gene locus_tag LOCUS_t00340 833 910 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 2218 929 gene locus_tag LOCUS_14510 2218 929 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771113.1 protein_id gnl|my_center|LOCUS_14510 2316 2388 gene locus_tag LOCUS_t00350 2316 2388 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence326 365 1378 gene locus_tag LOCUS_14520 gene tsaD 365 1378 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011107518.1 protein_id gnl|my_center|LOCUS_14520 >Feature sequence327 2142 1267 gene locus_tag LOCUS_14530 2142 1267 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_14530 2315 2139 gene locus_tag LOCUS_14540 2315 2139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14540 >Feature sequence328 160 2178 gene locus_tag LOCUS_14550 gene uvrB 160 2178 CDS product excinuclease ABC subunit UvrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202946.1 protein_id gnl|my_center|LOCUS_14550 >Feature sequence329 156 1025 gene locus_tag LOCUS_14560 gene rfbA 156 1025 CDS product glucose-1-phosphate thymidylyltransferase RfbA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000857520.1 protein_id gnl|my_center|LOCUS_14560 1029 1577 gene locus_tag LOCUS_14570 gene rfbC 1029 1577 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023680.1 protein_id gnl|my_center|LOCUS_14570 1632 2006 gene locus_tag LOCUS_14580 1632 2006 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 >Feature sequence330 1103 264 gene locus_tag LOCUS_14590 gene tatC 1103 264 CDS product twin-arginine translocase subunit TatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963367.1 protein_id gnl|my_center|LOCUS_14590 1681 1175 gene locus_tag LOCUS_14600 1681 1175 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015943062.1 protein_id gnl|my_center|LOCUS_14600 2042 1692 gene locus_tag LOCUS_14610 2042 1692 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808391.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence331 1757 1119 gene locus_tag LOCUS_14620 1757 1119 CDS product DUF5752 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978371.1 protein_id gnl|my_center|LOCUS_14620 <2444 1754 gene locus_tag LOCUS_14630 <2444 1754 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011392881.1:trehalose-phosphatase >Feature sequence332 <2440 1916 gene locus_tag LOCUS_14640 <2440 1916 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940918.1:radical SAM protein >Feature sequence333 707 258 gene locus_tag LOCUS_14650 707 258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14650 1015 1785 gene locus_tag LOCUS_14660 1015 1785 CDS product Type 1 glutamine amidotransferase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003245002.1 protein_id gnl|my_center|LOCUS_14660 >Feature sequence334 1560 325 gene locus_tag LOCUS_14670 1560 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 >Feature sequence335 422 1498 gene locus_tag LOCUS_14680 422 1498 CDS product LptF/LptG family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005787732.1 protein_id gnl|my_center|LOCUS_14680 1926 1510 gene locus_tag LOCUS_14690 gene ybeY 1926 1510 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962183.1 protein_id gnl|my_center|LOCUS_14690 2342 1929 gene locus_tag LOCUS_14700 gene rsbW 2342 1929 CDS product anti-sigma B factor RsbW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000970576.1 protein_id gnl|my_center|LOCUS_14700 >Feature sequence336 1563 430 gene locus_tag LOCUS_14710 1563 430 CDS product DoxX family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791116.1 protein_id gnl|my_center|LOCUS_14710 2309 1626 gene locus_tag LOCUS_14720 2309 1626 CDS product thymidylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009892113.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence337 1111 1908 gene locus_tag LOCUS_14730 1111 1908 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence338 >Feature sequence339 <1 596 gene locus_tag LOCUS_14740 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004080975.1:glycosyltransferase family 4 protein 721 1269 gene locus_tag LOCUS_14750 721 1269 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964176.1 protein_id gnl|my_center|LOCUS_14750 >Feature sequence340 305 868 gene locus_tag LOCUS_14760 305 868 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870595.1 protein_id gnl|my_center|LOCUS_14760 1100 1837 gene locus_tag LOCUS_14770 1100 1837 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence341 99 172 gene locus_tag LOCUS_t00360 99 172 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 338 712 gene locus_tag LOCUS_14780 338 712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 767 2344 gene locus_tag LOCUS_14790 gene nadB 767 2344 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005783573.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence342 728 1993 gene locus_tag LOCUS_14800 728 1993 CDS product mechanosensitive ion channel inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008760938.1 protein_id gnl|my_center|LOCUS_14800 >Feature sequence343 3 158 gene locus_tag LOCUS_14810 3 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 749 159 gene locus_tag LOCUS_14820 749 159 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010538541.1 protein_id gnl|my_center|LOCUS_14820 922 1359 gene locus_tag LOCUS_14830 922 1359 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14830 >Feature sequence344 <1 2265 gene locus_tag LOCUS_14840 <1 2265 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964499.1:OmpA family protein >Feature sequence345 2135 663 gene locus_tag LOCUS_14850 2135 663 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_032728610.1 protein_id gnl|my_center|LOCUS_14850 >Feature sequence346 1134 325 gene locus_tag LOCUS_14860 1134 325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14860 2160 1351 gene locus_tag LOCUS_14870 2160 1351 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 >Feature sequence347 <1 1645 gene locus_tag LOCUS_14880 <1 1645 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:T9SS type A sorting domain-containing protein 2169 1684 gene locus_tag LOCUS_14890 2169 1684 CDS product histidine phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852934.1 protein_id gnl|my_center|LOCUS_14890 >Feature sequence348 1218 655 gene locus_tag LOCUS_14900 gene frr 1218 655 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005775374.1 protein_id gnl|my_center|LOCUS_14900 >Feature sequence349 354 430 gene locus_tag LOCUS_t00370 354 430 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 668 1393 gene locus_tag LOCUS_14910 gene pyrH 668 1393 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142336.1 protein_id gnl|my_center|LOCUS_14910 1756 1454 gene locus_tag LOCUS_14920 1756 1454 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545551.1 protein_id gnl|my_center|LOCUS_14920 >Feature sequence350 1387 176 gene locus_tag LOCUS_14930 1387 176 CDS product aminotransferase class V-fold PLP-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963843.1 protein_id gnl|my_center|LOCUS_14930 1524 1994 gene locus_tag LOCUS_14940 1524 1994 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964461.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence351 473 75 gene locus_tag LOCUS_14950 473 75 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 2088 514 gene locus_tag LOCUS_14960 2088 514 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 >Feature sequence352 >Feature sequence353 1062 385 gene locus_tag LOCUS_14970 1062 385 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005788535.1 protein_id gnl|my_center|LOCUS_14970 1440 1835 gene locus_tag LOCUS_14980 1440 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence354 <2220 648 gene locus_tag LOCUS_14990 <2220 648 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122194.1:alpha-2-macroglobulin family protein >Feature sequence355 510 229 gene locus_tag LOCUS_15000 510 229 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence356 2202 64 gene locus_tag LOCUS_15010 gene rnr 2202 64 CDS product ribonuclease R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008761713.1 protein_id gnl|my_center|LOCUS_15010 >Feature sequence357 >Feature sequence358 115 906 gene locus_tag LOCUS_15020 gene dapF 115 906 CDS product diaminopimelate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963347.1 protein_id gnl|my_center|LOCUS_15020 911 1486 gene locus_tag LOCUS_15030 911 1486 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762794.1 protein_id gnl|my_center|LOCUS_15030 >Feature sequence359 1912 650 gene locus_tag LOCUS_15040 1912 650 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_15040 >Feature sequence360 1074 424 gene locus_tag LOCUS_15050 1074 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 2000 1089 gene locus_tag LOCUS_15060 gene gldA 2000 1089 CDS product gliding motility-associated ABC transporter ATP-binding subunit GldA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962427.1 protein_id gnl|my_center|LOCUS_15060 >Feature sequence361 532 164 gene locus_tag LOCUS_15070 gene rplN 532 164 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963460.1 protein_id gnl|my_center|LOCUS_15070 792 535 gene locus_tag LOCUS_15080 gene rpsQ 792 535 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762040.1 protein_id gnl|my_center|LOCUS_15080 1004 801 gene locus_tag LOCUS_15090 gene rpmC 1004 801 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762039.1 protein_id gnl|my_center|LOCUS_15090 1396 1022 gene locus_tag LOCUS_15100 gene rplP 1396 1022 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002558067.1 protein_id gnl|my_center|LOCUS_15100 <2144 1474 gene locus_tag LOCUS_15110 <2144 1474 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005782201.1:30S ribosomal protein S3 >Feature sequence362 650 216 gene locus_tag LOCUS_15120 gene dut 650 216 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767650.1 protein_id gnl|my_center|LOCUS_15120 2121 640 gene locus_tag LOCUS_15130 2121 640 CDS product oligosaccharide flippase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005813883.1 protein_id gnl|my_center|LOCUS_15130 >Feature sequence363 <2137 354 gene locus_tag LOCUS_15140 <2137 354 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000557282.1:OmpA family protein >Feature sequence364 >Feature sequence365 38 253 gene locus_tag LOCUS_15150 38 253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15150 268 1410 gene locus_tag LOCUS_15160 268 1410 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962888.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence366 <2116 1272 gene locus_tag LOCUS_15170 <2116 1272 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012048141.1:Hsp33 family molecular chaperone HslO >Feature sequence367 1189 1482 gene locus_tag LOCUS_15180 1189 1482 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_028175975.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence368 719 1963 gene locus_tag LOCUS_15190 719 1963 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008768269.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence369 879 103 gene locus_tag LOCUS_15200 879 103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15200 1508 1074 gene locus_tag LOCUS_15210 1508 1074 CDS product TPM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964049.1 protein_id gnl|my_center|LOCUS_15210 <2100 1512 gene locus_tag LOCUS_15220 <2100 1512 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008764419.1:LemA family protein >Feature sequence370 <1 731 gene locus_tag LOCUS_15230 <1 731 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048065307.1:helix-turn-helix domain-containing protein 1019 1711 gene locus_tag LOCUS_15240 1019 1711 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012583759.1 protein_id gnl|my_center|LOCUS_15240 >Feature sequence371 <1 707 gene locus_tag LOCUS_15250 <1 707 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011922218.1:DEAD/DEAH box helicase family protein >Feature sequence372 >Feature sequence373 353 1720 gene locus_tag LOCUS_15260 gene lepB 353 1720 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108766.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence374 186 1208 gene locus_tag LOCUS_15270 186 1208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15270 >Feature sequence375 <2058 1267 gene locus_tag LOCUS_15280 <2058 1267 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011107523.1:HAMP domain-containing sensor histidine kinase >Feature sequence376 <1 1204 gene locus_tag LOCUS_15290 <1 1204 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005797944.1:IgA Peptidase M64 >Feature sequence377 <2055 1392 gene locus_tag LOCUS_15300 <2055 1392 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962842.1:transketolase >Feature sequence378 676 879 gene locus_tag LOCUS_15310 676 879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15310 876 1076 gene locus_tag LOCUS_15320 876 1076 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15320 >Feature sequence379 228 1058 gene locus_tag LOCUS_15330 228 1058 CDS product KilA-N domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004804477.1 protein_id gnl|my_center|LOCUS_15330 >Feature sequence380 75 431 gene locus_tag LOCUS_15340 75 431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 927 421 gene locus_tag LOCUS_15350 gene ftnA 927 421 CDS product non-heme ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211092.1 protein_id gnl|my_center|LOCUS_15350 <2003 964 gene locus_tag LOCUS_15360 <2003 964 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932043.1:NADP-dependent isocitrate dehydrogenase >Feature sequence381 1985 171 gene locus_tag LOCUS_15370 1985 171 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15370 >Feature sequence382 >Feature sequence383 <1 1057 gene locus_tag LOCUS_15380 <1 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007052539.1:AAA family ATPase >Feature sequence384 1786 101 gene locus_tag LOCUS_15390 1786 101 CDS product Ig-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011108779.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence385 <1 656 gene locus_tag LOCUS_15400 <1 656 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000387713.1:ethanolamine utilization microcompartment protein EutM 656 1288 gene locus_tag LOCUS_15410 gene gmk 656 1288 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082205.1 protein_id gnl|my_center|LOCUS_15410 >Feature sequence386 437 96 gene locus_tag LOCUS_15420 gene arsC 437 96 CDS product arsenate reductase (glutaredoxin) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208565.1 protein_id gnl|my_center|LOCUS_15420 1891 464 gene locus_tag LOCUS_15430 1891 464 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162303110.1 protein_id gnl|my_center|LOCUS_15430 >Feature sequence387 >Feature sequence388 >Feature sequence389 179 985 gene locus_tag LOCUS_15440 gene trmBL2 179 985 CDS product HTH-type transcriptional regulator TrmBL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249426.1 protein_id gnl|my_center|LOCUS_15440 1691 999 gene locus_tag LOCUS_15450 1691 999 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005918869.1 protein_id gnl|my_center|LOCUS_15450 >Feature sequence390 358 1344 gene locus_tag LOCUS_15460 358 1344 CDS product class I mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963896.1 protein_id gnl|my_center|LOCUS_15460 >Feature sequence391 162 1718 gene locus_tag LOCUS_15470 162 1718 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582596.1 protein_id gnl|my_center|LOCUS_15470 >Feature sequence392 3 839 gene locus_tag LOCUS_15480 3 839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15480 843 1493 gene locus_tag LOCUS_15490 843 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15490 >Feature sequence393 <1 1241 gene locus_tag LOCUS_15500 <1 1241 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926964.1:sodium-translocating pyrophosphatase >Feature sequence394 475 960 gene locus_tag LOCUS_15510 gene cdd 475 960 CDS product cytidine deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762228.1 protein_id gnl|my_center|LOCUS_15510 971 1828 gene locus_tag LOCUS_15520 971 1828 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence395 129 302 gene locus_tag LOCUS_15530 129 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 277 1680 gene locus_tag LOCUS_15540 277 1680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15540 >Feature sequence396 450 728 gene locus_tag LOCUS_15550 450 728 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964086.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence397 295 981 gene locus_tag LOCUS_15560 gene trmB 295 981 CDS product tRNA (guanosine(46)-N7)-methyltransferase TrmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962539.1 protein_id gnl|my_center|LOCUS_15560 >Feature sequence398 113 667 gene locus_tag LOCUS_15570 gene rfbC 113 667 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011987006.1 protein_id gnl|my_center|LOCUS_15570 718 1608 gene locus_tag LOCUS_15580 718 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15580 >Feature sequence399 854 1627 gene locus_tag LOCUS_15590 854 1627 CDS product C40 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962928.1 protein_id gnl|my_center|LOCUS_15590 >Feature sequence400 177 926 gene locus_tag LOCUS_15600 177 926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15600 <1792 982 gene locus_tag LOCUS_15610 <1792 982 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011337624.1:calcium/sodium antiporter >Feature sequence401 879 217 gene locus_tag LOCUS_15620 879 217 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005785759.1 protein_id gnl|my_center|LOCUS_15620 <1782 1025 gene locus_tag LOCUS_15630 <1782 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962230.1:enoyl-CoA hydratase-related protein >Feature sequence402 >Feature sequence403 147 683 gene locus_tag LOCUS_15640 147 683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15640 686 1549 gene locus_tag LOCUS_15650 gene dapA 686 1549 CDS product 4-hydroxy-tetrahydrodipicolinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011202857.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence404 724 1233 gene locus_tag LOCUS_15660 724 1233 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 >Feature sequence405 1497 139 gene locus_tag LOCUS_15670 1497 139 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15670 >Feature sequence406 1716 874 gene locus_tag LOCUS_15680 1716 874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence407 1572 1129 gene locus_tag LOCUS_15690 1572 1129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence408 >Feature sequence409 >Feature sequence410 1141 758 gene locus_tag LOCUS_15700 1141 758 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15700 >Feature sequence411 >Feature sequence412 962 336 gene locus_tag LOCUS_15710 962 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15710 1490 1499 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence413 1040 447 gene locus_tag LOCUS_15720 gene recR 1040 447 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814133.1 protein_id gnl|my_center|LOCUS_15720 1357 1040 gene locus_tag LOCUS_15730 1357 1040 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090837.1 protein_id gnl|my_center|LOCUS_15730 >Feature sequence414 1163 231 gene locus_tag LOCUS_15740 1163 231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15740 <1717 1190 gene locus_tag LOCUS_15750 <1717 1190 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947828.1:Abi family protein >Feature sequence415 420 1529 gene locus_tag LOCUS_15760 420 1529 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15760 >Feature sequence416 805 263 gene locus_tag LOCUS_15770 805 263 CDS product MarC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011962629.1 protein_id gnl|my_center|LOCUS_15770 1683 880 gene locus_tag LOCUS_15780 1683 880 CDS product ferredoxin--NADP reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122780.1 protein_id gnl|my_center|LOCUS_15780 >Feature sequence417 526 1089 gene locus_tag LOCUS_15790 526 1089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15790 1083 1415 gene locus_tag LOCUS_15800 1083 1415 CDS product nucleotide pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008762871.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence418 525 259 gene locus_tag LOCUS_15810 525 259 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15810 1185 538 gene locus_tag LOCUS_15820 1185 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 <1700 1182 gene locus_tag LOCUS_15830 <1700 1182 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002678678.1:prolyl oligopeptidase family serine peptidase >Feature sequence419 <1698 247 gene locus_tag LOCUS_15840 <1698 247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545223.1:restriction endonuclease subunit M >Feature sequence420 1059 1433 gene locus_tag LOCUS_15850 1059 1433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 >Feature sequence421 549 836 gene locus_tag LOCUS_15860 549 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15860 >Feature sequence422 >Feature sequence423 211 633 gene locus_tag LOCUS_15870 211 633 CDS product hotdog fold thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957885.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence424 >Feature sequence425 105 1613 gene locus_tag LOCUS_15880 105 1613 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005795889.1 protein_id gnl|my_center|LOCUS_15880 >Feature sequence426 <1 674 gene locus_tag LOCUS_15890 <1 674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011023725.1:phage terminase large subunit >Feature sequence427 >Feature sequence428 101 670 gene locus_tag LOCUS_15900 101 670 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence429 <1 613 gene locus_tag LOCUS_15910 <1 613 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938172.1:translation elongation factor Ts >Feature sequence430 1070 111 gene locus_tag LOCUS_15920 1070 111 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15920 >Feature sequence431 331 768 gene locus_tag LOCUS_15930 331 768 CDS product nucleoside deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008759603.1 protein_id gnl|my_center|LOCUS_15930 1642 824 gene locus_tag LOCUS_15940 1642 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15940 >Feature sequence432 <1625 214 gene locus_tag LOCUS_15950 <1625 214 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011119127.1:chloride channel protein >Feature sequence433 1618 356 gene locus_tag LOCUS_15960 1618 356 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15960 >Feature sequence434 <1618 751 gene locus_tag LOCUS_15970 <1618 751 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924817.1:bi-domain-containing oxidoreductase >Feature sequence435 >Feature sequence436 <1615 220 gene locus_tag LOCUS_15980 <1615 220 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_008658876.1:SurA N-terminal domain-containing protein >Feature sequence437 1206 400 gene locus_tag LOCUS_15990 1206 400 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15990 >Feature sequence438 276 1373 gene locus_tag LOCUS_16000 276 1373 CDS product Ldh family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867978.1 protein_id gnl|my_center|LOCUS_16000 >Feature sequence439 222 731 gene locus_tag LOCUS_16010 222 731 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16010 >Feature sequence440 1568 480 gene locus_tag LOCUS_16020 1568 480 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16020 >Feature sequence441 >Feature sequence442 43 1329 gene locus_tag LOCUS_16030 43 1329 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000103658.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence443 >Feature sequence444 344 769 gene locus_tag LOCUS_16040 344 769 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16040 787 1401 gene locus_tag LOCUS_16050 787 1401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence445 842 1555 gene locus_tag LOCUS_16060 842 1555 CDS product DUF2520 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_008767849.1 protein_id gnl|my_center|LOCUS_16060 >Feature sequence446 >Feature sequence447 >Feature sequence448 100 351 gene locus_tag LOCUS_16070 100 351 CDS product type B 50S ribosomal protein L31 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005789565.1 protein_id gnl|my_center|LOCUS_16070 1172 426 gene locus_tag LOCUS_16080 1172 426 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_089713553.1 protein_id gnl|my_center|LOCUS_16080 >Feature sequence449 299 856 gene locus_tag LOCUS_16090 gene rplE 299 856 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005791556.1 protein_id gnl|my_center|LOCUS_16090 867 1136 gene locus_tag LOCUS_16100 gene rpsN 867 1136 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963457.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence450 861 870 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence451 503 430 gene locus_tag LOCUS_t00380 503 430 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 1183 569 gene locus_tag LOCUS_16110 1183 569 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963025.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence452 207 1301 gene locus_tag LOCUS_16120 207 1301 CDS product Fic family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_065538056.1 protein_id gnl|my_center|LOCUS_16120 >Feature sequence453 359 1030 gene locus_tag LOCUS_16130 gene bamD 359 1030 CDS product outer membrane protein assembly factor BamD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000197677.1 protein_id gnl|my_center|LOCUS_16130 1043 1378 gene locus_tag LOCUS_16140 1043 1378 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004299989.1 protein_id gnl|my_center|LOCUS_16140 >Feature sequence454 600 821 gene locus_tag LOCUS_16150 600 821 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006312031.1 protein_id gnl|my_center|LOCUS_16150 821 1255 gene locus_tag LOCUS_16160 821 1255 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064243822.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence455 815 9 gene locus_tag LOCUS_16170 815 9 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 >Feature sequence456 377 1279 gene locus_tag LOCUS_16180 377 1279 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932675.1 protein_id gnl|my_center|LOCUS_16180 >Feature sequence457