>Feature sequence001 <1 669 gene locus_tag LOCUS_00010 <1 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249061.1:diphthine synthase 710 787 gene locus_tag LOCUS_t00010 710 787 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1443 2210 gene locus_tag LOCUS_00020 1443 2210 CDS product putative RNA uridine N3 methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250494.1 protein_id gnl|my_center|LOCUS_00020 2212 3252 gene locus_tag LOCUS_00030 2212 3252 CDS product 50S ribosomal protein L3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250493.1 protein_id gnl|my_center|LOCUS_00030 3263 4030 gene locus_tag LOCUS_00040 gene rpl4p 3263 4030 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250492.1 protein_id gnl|my_center|LOCUS_00040 4037 4297 gene locus_tag LOCUS_00050 4037 4297 CDS product 50S ribosomal protein L23 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250491.1 protein_id gnl|my_center|LOCUS_00050 4309 5028 gene locus_tag LOCUS_00060 4309 5028 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250490.1 protein_id gnl|my_center|LOCUS_00060 5031 5432 gene locus_tag LOCUS_00070 5031 5432 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250489.1 protein_id gnl|my_center|LOCUS_00070 5443 5913 gene locus_tag LOCUS_00080 gene rplV 5443 5913 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250488.1 protein_id gnl|my_center|LOCUS_00080 5919 6548 gene locus_tag LOCUS_00090 5919 6548 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250487.1 protein_id gnl|my_center|LOCUS_00090 6535 6735 gene locus_tag LOCUS_00100 gene rpmC 6535 6735 CDS product 50S ribosomal protein L29 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250486.1 protein_id gnl|my_center|LOCUS_00100 6742 7038 gene locus_tag LOCUS_00110 gene yciH 6742 7038 CDS product stress response translation initiation inhibitor YciH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050002739.1 protein_id gnl|my_center|LOCUS_00110 6924 7301 gene locus_tag LOCUS_00120 6924 7301 CDS product ribonuclease P protein component 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250484.1 protein_id gnl|my_center|LOCUS_00120 7298 7642 gene locus_tag LOCUS_00130 7298 7642 CDS product 30S ribosomal protein S17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250483.1 protein_id gnl|my_center|LOCUS_00130 7647 8072 gene locus_tag LOCUS_00140 7647 8072 CDS product 50S ribosomal protein L14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250482.1 protein_id gnl|my_center|LOCUS_00140 8083 8448 gene locus_tag LOCUS_00150 gene rplX 8083 8448 CDS product 50S ribosomal protein L24 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250481.1 protein_id gnl|my_center|LOCUS_00150 8448 9179 gene locus_tag LOCUS_00160 8448 9179 CDS product 30S ribosomal protein S4e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250480.1 protein_id gnl|my_center|LOCUS_00160 9191 9742 gene locus_tag LOCUS_00170 9191 9742 CDS product 50S ribosomal protein L5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250479.1 protein_id gnl|my_center|LOCUS_00170 9744 9914 gene locus_tag LOCUS_00180 9744 9914 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250478.1 protein_id gnl|my_center|LOCUS_00180 9926 10318 gene locus_tag LOCUS_00190 9926 10318 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250477.1 protein_id gnl|my_center|LOCUS_00190 10329 10883 gene locus_tag LOCUS_00200 10329 10883 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250476.1 protein_id gnl|my_center|LOCUS_00200 10894 11277 gene locus_tag LOCUS_00210 10894 11277 CDS product 50S ribosomal protein L32e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250475.1 protein_id gnl|my_center|LOCUS_00210 11283 11729 gene locus_tag LOCUS_00220 11283 11729 CDS product 50S ribosomal protein L19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053733.1 protein_id gnl|my_center|LOCUS_00220 11740 12345 gene locus_tag LOCUS_00230 11740 12345 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250473.1 protein_id gnl|my_center|LOCUS_00230 12342 13046 gene locus_tag LOCUS_00240 gene rpsE 12342 13046 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250472.1 protein_id gnl|my_center|LOCUS_00240 13058 13525 gene locus_tag LOCUS_00250 13058 13525 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250471.1 protein_id gnl|my_center|LOCUS_00250 13537 13983 gene locus_tag LOCUS_00260 13537 13983 CDS product uL15 family ribosomal protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250470.1 protein_id gnl|my_center|LOCUS_00260 14013 15464 gene locus_tag LOCUS_00270 gene secY 14013 15464 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250469.1 protein_id gnl|my_center|LOCUS_00270 15534 16124 gene locus_tag LOCUS_00280 15534 16124 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250468.1 protein_id gnl|my_center|LOCUS_00280 16117 16641 gene locus_tag LOCUS_00290 16117 16641 CDS product EMC3/TMCO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250467.1 protein_id gnl|my_center|LOCUS_00290 16683 16952 gene locus_tag LOCUS_00300 16683 16952 CDS product 50S ribosomal protein L34e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250466.1 protein_id gnl|my_center|LOCUS_00300 16962 17540 gene locus_tag LOCUS_00310 16962 17540 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250465.1 protein_id gnl|my_center|LOCUS_00310 17541 17792 gene locus_tag LOCUS_00320 17541 17792 CDS product 50S ribosomal protein L14e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250464.1 protein_id gnl|my_center|LOCUS_00320 17864 18580 gene locus_tag LOCUS_00330 17864 18580 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250463.1 protein_id gnl|my_center|LOCUS_00330 18639 19649 gene locus_tag LOCUS_00340 18639 19649 CDS product RNA-guided pseudouridylation complex pseudouridine synthase subunit Cbf5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250460.1 protein_id gnl|my_center|LOCUS_00340 19725 20312 gene locus_tag LOCUS_00350 19725 20312 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250458.1 protein_id gnl|my_center|LOCUS_00350 20298 20384 gene locus_tag LOCUS_t00020 20298 20384 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 20427 20876 gene locus_tag LOCUS_00360 20427 20876 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250457.1 protein_id gnl|my_center|LOCUS_00360 20887 21429 gene locus_tag LOCUS_00370 20887 21429 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250456.1 protein_id gnl|my_center|LOCUS_00370 21426 21845 gene locus_tag LOCUS_00380 21426 21845 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867653.1 protein_id gnl|my_center|LOCUS_00380 21875 22657 gene locus_tag LOCUS_00390 21875 22657 CDS product DNA-directed RNA polymerase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053732.1 protein_id gnl|my_center|LOCUS_00390 22659 22746 gene locus_tag LOCUS_t00030 22659 22746 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 22805 23170 gene locus_tag LOCUS_00400 22805 23170 CDS product 50S ribosomal protein L18e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250453.1 protein_id gnl|my_center|LOCUS_00400 23177 23605 gene locus_tag LOCUS_00410 gene rplM 23177 23605 CDS product 50S ribosomal protein L13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250452.1 protein_id gnl|my_center|LOCUS_00410 23616 24023 gene locus_tag LOCUS_00420 23616 24023 CDS product 30S ribosomal protein S9 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250451.1 protein_id gnl|my_center|LOCUS_00420 24056 24253 gene locus_tag LOCUS_00430 24056 24253 CDS product DNA-directed RNA polymerase subunit N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250450.1 protein_id gnl|my_center|LOCUS_00430 24271 24348 gene locus_tag LOCUS_t00040 24271 24348 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 24405 24578 gene locus_tag LOCUS_00440 24405 24578 CDS product DNA-directed RNA polymerase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867659.1 protein_id gnl|my_center|LOCUS_00440 24585 25610 gene locus_tag LOCUS_00450 24585 25610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250448.1 protein_id gnl|my_center|LOCUS_00450 25625 26230 gene locus_tag LOCUS_00460 gene rpsB 25625 26230 CDS product 30S ribosomal protein S2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250447.1 protein_id gnl|my_center|LOCUS_00460 26272 26359 gene locus_tag LOCUS_t00050 26272 26359 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 26417 26572 gene locus_tag LOCUS_00470 26417 26572 CDS product 50S ribosomal protein L40e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250446.1 protein_id gnl|my_center|LOCUS_00470 26902 26573 gene locus_tag LOCUS_00480 26902 26573 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250445.1 protein_id gnl|my_center|LOCUS_00480 27008 27307 gene locus_tag LOCUS_00490 27008 27307 CDS product FUN14 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250444.1 protein_id gnl|my_center|LOCUS_00490 28076 27315 gene locus_tag LOCUS_00500 28076 27315 CDS product metallophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250443.1 protein_id gnl|my_center|LOCUS_00500 28764 28687 gene locus_tag LOCUS_t00060 28764 28687 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 28832 29281 gene locus_tag LOCUS_00510 28832 29281 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_197463606.1 protein_id gnl|my_center|LOCUS_00510 29593 29264 gene locus_tag LOCUS_00520 29593 29264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250441.1 protein_id gnl|my_center|LOCUS_00520 30311 29595 gene locus_tag LOCUS_00530 30311 29595 CDS product phosphoribosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250440.1 protein_id gnl|my_center|LOCUS_00530 30856 30368 gene locus_tag LOCUS_00540 30856 30368 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250439.1 protein_id gnl|my_center|LOCUS_00540 31100 30861 gene locus_tag LOCUS_00550 31100 30861 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250438.1 protein_id gnl|my_center|LOCUS_00550 32443 31097 gene locus_tag LOCUS_00560 32443 31097 CDS product signal recognition particle protein Srp54 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250437.1 protein_id gnl|my_center|LOCUS_00560 32853 33707 gene locus_tag LOCUS_00570 32853 33707 CDS product damage-control phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249335.1 protein_id gnl|my_center|LOCUS_00570 33786 33995 gene locus_tag LOCUS_00580 33786 33995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250435.1 protein_id gnl|my_center|LOCUS_00580 34075 35376 gene locus_tag LOCUS_00590 34075 35376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250434.1 protein_id gnl|my_center|LOCUS_00590 35419 36222 gene locus_tag LOCUS_00600 gene mtnP 35419 36222 CDS product S-methyl-5'-thioadenosine phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250433.1 protein_id gnl|my_center|LOCUS_00600 >Feature sequence002 1023 430 gene locus_tag LOCUS_00610 1023 430 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868582.1 protein_id gnl|my_center|LOCUS_00610 1537 1154 gene locus_tag LOCUS_00620 1537 1154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00620 1607 1861 gene locus_tag LOCUS_00630 1607 1861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 1906 2166 gene locus_tag LOCUS_00640 1906 2166 CDS product HypC/HybG/HupF family hydrogenase formation chaperone inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868354.1 protein_id gnl|my_center|LOCUS_00640 2168 3292 gene locus_tag LOCUS_00650 gene hypD 2168 3292 CDS product hydrogenase formation protein HypD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250950.1 protein_id gnl|my_center|LOCUS_00650 3384 5702 gene locus_tag LOCUS_00660 gene hypF 3384 5702 CDS product carbamoyltransferase HypF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250947.1 protein_id gnl|my_center|LOCUS_00660 5742 6758 gene locus_tag LOCUS_00670 gene hypE 5742 6758 CDS product hydrogenase expression/formation protein HypE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250943.1 protein_id gnl|my_center|LOCUS_00670 8695 6755 gene locus_tag LOCUS_00680 gene acs 8695 6755 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762026.1 protein_id gnl|my_center|LOCUS_00680 9699 8971 gene locus_tag LOCUS_00690 9699 8971 CDS product P-loop NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021358.1 protein_id gnl|my_center|LOCUS_00690 9824 10117 gene locus_tag LOCUS_00700 9824 10117 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250941.1 protein_id gnl|my_center|LOCUS_00700 10114 11313 gene locus_tag LOCUS_00710 10114 11313 CDS product cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250940.1 protein_id gnl|my_center|LOCUS_00710 11927 11310 gene locus_tag LOCUS_00720 11927 11310 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250253.1 protein_id gnl|my_center|LOCUS_00720 12893 11991 gene locus_tag LOCUS_00730 12893 11991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147069.1 protein_id gnl|my_center|LOCUS_00730 14068 12941 gene locus_tag LOCUS_00740 14068 12941 CDS product ATP-NAD kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250252.1 protein_id gnl|my_center|LOCUS_00740 15509 14073 gene locus_tag LOCUS_00750 15509 14073 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250251.1 protein_id gnl|my_center|LOCUS_00750 16479 15535 gene locus_tag LOCUS_00760 16479 15535 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867984.1 protein_id gnl|my_center|LOCUS_00760 16761 16519 gene locus_tag LOCUS_00770 16761 16519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 17558 16890 gene locus_tag LOCUS_00780 17558 16890 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00780 17690 18934 gene locus_tag LOCUS_00790 17690 18934 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249958.1 protein_id gnl|my_center|LOCUS_00790 20262 18940 gene locus_tag LOCUS_00800 gene cdr 20262 18940 CDS product CoA-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068576671.1 protein_id gnl|my_center|LOCUS_00800 21483 20320 gene locus_tag LOCUS_00810 21483 20320 CDS product 60S ribosomal export protein NMD3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250248.1 protein_id gnl|my_center|LOCUS_00810 21824 21525 gene locus_tag LOCUS_00820 21824 21525 CDS product DUF424 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250247.1 protein_id gnl|my_center|LOCUS_00820 26396 21867 gene locus_tag LOCUS_00830 26396 21867 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00830 26626 27300 gene locus_tag LOCUS_00840 26626 27300 CDS product TrmB family transcriptional regulator sugar-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867217.1 protein_id gnl|my_center|LOCUS_00840 27297 28289 gene locus_tag LOCUS_00850 27297 28289 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867218.1 protein_id gnl|my_center|LOCUS_00850 28276 29337 gene locus_tag LOCUS_00860 28276 29337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146481.1 protein_id gnl|my_center|LOCUS_00860 29319 30746 gene locus_tag LOCUS_00870 29319 30746 CDS product glycosyltransferase family 39 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867220.1 protein_id gnl|my_center|LOCUS_00870 30879 33335 gene locus_tag LOCUS_00880 gene ppsA 30879 33335 CDS product phosphoenolpyruvate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867221.1 protein_id gnl|my_center|LOCUS_00880 33459 34820 gene locus_tag LOCUS_00890 33459 34820 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250240.1 protein_id gnl|my_center|LOCUS_00890 >Feature sequence003 1276 131 gene locus_tag LOCUS_00900 1276 131 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249449.1 protein_id gnl|my_center|LOCUS_00900 1397 1474 gene locus_tag LOCUS_t00070 1397 1474 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 1486 1563 gene locus_tag LOCUS_t00080 1486 1563 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 1882 2169 gene locus_tag LOCUS_00910 1882 2169 CDS product DUF357 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250146.1 protein_id gnl|my_center|LOCUS_00910 2180 2551 gene locus_tag LOCUS_00920 2180 2551 CDS product DUF555 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250145.1 protein_id gnl|my_center|LOCUS_00920 2609 4207 gene locus_tag LOCUS_00930 gene pyrG 2609 4207 CDS product CTP synthase (glutamine hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250144.1 protein_id gnl|my_center|LOCUS_00930 5034 4201 gene locus_tag LOCUS_00940 5034 4201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00940 5151 5543 gene locus_tag LOCUS_00950 5151 5543 CDS product 30S ribosomal protein S8e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250142.1 protein_id gnl|my_center|LOCUS_00950 6720 5653 gene locus_tag LOCUS_00960 6720 5653 CDS product NOG1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250141.1 protein_id gnl|my_center|LOCUS_00960 6988 6779 gene locus_tag LOCUS_00970 6988 6779 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 7846 7052 gene locus_tag LOCUS_00980 7846 7052 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249686.1 protein_id gnl|my_center|LOCUS_00980 7903 8673 gene locus_tag LOCUS_00990 7903 8673 CDS product undecaprenyl-diphosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250140.1 protein_id gnl|my_center|LOCUS_00990 8670 9926 gene locus_tag LOCUS_01000 8670 9926 CDS product sugar phosphate nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250139.1 protein_id gnl|my_center|LOCUS_01000 9923 11038 gene locus_tag LOCUS_01010 9923 11038 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250138.1 protein_id gnl|my_center|LOCUS_01010 12206 11031 gene locus_tag LOCUS_01020 12206 11031 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250137.1 protein_id gnl|my_center|LOCUS_01020 12342 12428 gene locus_tag LOCUS_t00090 12342 12428 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 13428 12541 gene locus_tag LOCUS_01030 gene map 13428 12541 CDS product type II methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250134.1 protein_id gnl|my_center|LOCUS_01030 13519 14997 gene locus_tag LOCUS_01040 13519 14997 CDS product TrkH family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250133.1 protein_id gnl|my_center|LOCUS_01040 14994 15827 gene locus_tag LOCUS_01050 14994 15827 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250132.1 protein_id gnl|my_center|LOCUS_01050 16581 15730 gene locus_tag LOCUS_01060 16581 15730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250131.1 protein_id gnl|my_center|LOCUS_01060 17118 16582 gene locus_tag LOCUS_01070 gene cyaB 17118 16582 CDS product class IV adenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250130.1 protein_id gnl|my_center|LOCUS_01070 17678 17115 gene locus_tag LOCUS_01080 17678 17115 CDS product archaemetzincin family Zn-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250129.1 protein_id gnl|my_center|LOCUS_01080 18765 17725 gene locus_tag LOCUS_01090 18765 17725 CDS product lysyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250128.1 protein_id gnl|my_center|LOCUS_01090 20374 18839 gene locus_tag LOCUS_01100 20374 18839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250127.1 protein_id gnl|my_center|LOCUS_01100 20762 20364 gene locus_tag LOCUS_01110 gene hjc 20762 20364 CDS product Holliday junction resolvase Hjc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250126.1 protein_id gnl|my_center|LOCUS_01110 20834 21358 gene locus_tag LOCUS_01120 20834 21358 CDS product gamma carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250125.1 protein_id gnl|my_center|LOCUS_01120 21364 22158 gene locus_tag LOCUS_01130 gene uppS 21364 22158 CDS product polyprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250124.1 protein_id gnl|my_center|LOCUS_01130 22219 22893 gene locus_tag LOCUS_01140 22219 22893 CDS product TBP-interacting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250123.1 protein_id gnl|my_center|LOCUS_01140 22897 23211 gene locus_tag LOCUS_01150 22897 23211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01150 23239 23658 gene locus_tag LOCUS_01160 23239 23658 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_01160 25497 23617 gene locus_tag LOCUS_01170 25497 23617 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250121.1 protein_id gnl|my_center|LOCUS_01170 25609 26202 gene locus_tag LOCUS_01180 25609 26202 CDS product exosome complex RNA-binding protein Csl4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250120.1 protein_id gnl|my_center|LOCUS_01180 26199 26828 gene locus_tag LOCUS_01190 26199 26828 CDS product DUF2067 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250119.1 protein_id gnl|my_center|LOCUS_01190 26818 27105 gene locus_tag LOCUS_01200 26818 27105 CDS product DNA-directed RNA polymerase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250118.1 protein_id gnl|my_center|LOCUS_01200 27111 27506 gene locus_tag LOCUS_01210 27111 27506 CDS product ribonuclease III family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053838.1 protein_id gnl|my_center|LOCUS_01210 27832 27617 gene locus_tag LOCUS_01220 27832 27617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01220 29064 28258 gene locus_tag LOCUS_01230 29064 28258 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250116.1 protein_id gnl|my_center|LOCUS_01230 29156 30145 gene locus_tag LOCUS_01240 gene sppA 29156 30145 CDS product signal peptide peptidase SppA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250115.1 protein_id gnl|my_center|LOCUS_01240 30146 30622 gene locus_tag LOCUS_01250 30146 30622 CDS product PH1570 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250114.1 protein_id gnl|my_center|LOCUS_01250 30612 31616 gene locus_tag LOCUS_01260 30612 31616 CDS product AI-2E family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250113.1 protein_id gnl|my_center|LOCUS_01260 <32291 31594 gene locus_tag LOCUS_01270 <32291 31594 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250112.1:dihydropteroate synthase >Feature sequence004 997 1269 gene locus_tag LOCUS_01280 997 1269 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 1271 2407 gene locus_tag LOCUS_01290 1271 2407 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 2492 2944 gene locus_tag LOCUS_01300 2492 2944 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869225.1 protein_id gnl|my_center|LOCUS_01300 2946 4691 gene locus_tag LOCUS_01310 2946 4691 CDS product aldehyde ferredoxin oxidoreductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877537.1 protein_id gnl|my_center|LOCUS_01310 4688 5890 gene locus_tag LOCUS_01320 4688 5890 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083225.1 protein_id gnl|my_center|LOCUS_01320 7298 5874 gene locus_tag LOCUS_01330 7298 5874 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877386.1 protein_id gnl|my_center|LOCUS_01330 8402 7374 gene locus_tag LOCUS_01340 8402 7374 CDS product arsenic resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004080192.1 protein_id gnl|my_center|LOCUS_01340 8884 8399 gene locus_tag LOCUS_01350 8884 8399 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496545.1 protein_id gnl|my_center|LOCUS_01350 9035 9430 gene locus_tag LOCUS_01360 9035 9430 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250966.1 protein_id gnl|my_center|LOCUS_01360 10381 9431 gene locus_tag LOCUS_01370 10381 9431 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081655.1 protein_id gnl|my_center|LOCUS_01370 11088 10378 gene locus_tag LOCUS_01380 11088 10378 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004081657.1 protein_id gnl|my_center|LOCUS_01380 11225 11644 gene locus_tag LOCUS_01390 11225 11644 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250962.1 protein_id gnl|my_center|LOCUS_01390 12384 11650 gene locus_tag LOCUS_01400 12384 11650 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_01400 12514 13515 gene locus_tag LOCUS_01410 gene tdt 12514 13515 CDS product tellurite-resistance/dicarboxylate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867926.1 protein_id gnl|my_center|LOCUS_01410 13978 13496 gene locus_tag LOCUS_01420 13978 13496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01420 14356 14042 gene locus_tag LOCUS_01430 14356 14042 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01430 14509 16191 gene locus_tag LOCUS_01440 14509 16191 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064511.1 protein_id gnl|my_center|LOCUS_01440 16417 16836 gene locus_tag LOCUS_01450 gene hypA 16417 16836 CDS product hydrogenase nickel incorporation protein HypA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250958.1 protein_id gnl|my_center|LOCUS_01450 16833 17558 gene locus_tag LOCUS_01460 16833 17558 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250957.1 protein_id gnl|my_center|LOCUS_01460 17615 18100 gene locus_tag LOCUS_01470 17615 18100 CDS product hydrogenase 3 maturation endopeptidase HyCI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250954.1 protein_id gnl|my_center|LOCUS_01470 18364 18570 gene locus_tag LOCUS_01480 18364 18570 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01480 18548 18727 gene locus_tag LOCUS_01490 18548 18727 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 18772 18978 gene locus_tag LOCUS_01500 18772 18978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01500 19540 18950 gene locus_tag LOCUS_01510 gene mobA 19540 18950 CDS product molybdenum cofactor guanylyltransferase MobA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250952.1 protein_id gnl|my_center|LOCUS_01510 19989 19537 gene locus_tag LOCUS_01520 19989 19537 CDS product nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147034.1 protein_id gnl|my_center|LOCUS_01520 20346 20029 gene locus_tag LOCUS_01530 20346 20029 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147042.1 protein_id gnl|my_center|LOCUS_01530 21181 20348 gene locus_tag LOCUS_01540 21181 20348 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868589.1 protein_id gnl|my_center|LOCUS_01540 21810 21181 gene locus_tag LOCUS_01550 21810 21181 CDS product NADH-quinone oxidoreductase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868590.1 protein_id gnl|my_center|LOCUS_01550 23609 21810 gene locus_tag LOCUS_01560 23609 21810 CDS product hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868591.1 protein_id gnl|my_center|LOCUS_01560 24529 23612 gene locus_tag LOCUS_01570 24529 23612 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868592.1 protein_id gnl|my_center|LOCUS_01570 26531 24540 gene locus_tag LOCUS_01580 26531 24540 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147045.1 protein_id gnl|my_center|LOCUS_01580 27917 26538 gene locus_tag LOCUS_01590 27917 26538 CDS product hydrogenase 4 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147047.1 protein_id gnl|my_center|LOCUS_01590 28471 27971 gene locus_tag LOCUS_01600 28471 27971 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868595.1 protein_id gnl|my_center|LOCUS_01600 <30355 28482 gene locus_tag LOCUS_01610 <30355 28482 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868596.1:molybdopterin-dependent oxidoreductase >Feature sequence005 <1 829 gene locus_tag LOCUS_01620 <1 829 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249503.1:pyridoxal phosphate-dependent aminotransferase 1487 831 gene locus_tag LOCUS_01630 1487 831 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249502.1 protein_id gnl|my_center|LOCUS_01630 1616 1831 gene locus_tag LOCUS_01640 1616 1831 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249501.1 protein_id gnl|my_center|LOCUS_01640 3089 1872 gene locus_tag LOCUS_01650 3089 1872 CDS product methionine adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249500.1 protein_id gnl|my_center|LOCUS_01650 3412 4032 gene locus_tag LOCUS_01660 3412 4032 CDS product haloacid dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868496.1 protein_id gnl|my_center|LOCUS_01660 4025 4612 gene locus_tag LOCUS_01670 4025 4612 CDS product endonuclease V inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868497.1 protein_id gnl|my_center|LOCUS_01670 4609 5244 gene locus_tag LOCUS_01680 4609 5244 CDS product DUF120 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250223.1 protein_id gnl|my_center|LOCUS_01680 5241 5786 gene locus_tag LOCUS_01690 5241 5786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 5821 6030 gene locus_tag LOCUS_01700 5821 6030 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250221.1 protein_id gnl|my_center|LOCUS_01700 7490 6027 gene locus_tag LOCUS_01710 7490 6027 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250220.1 protein_id gnl|my_center|LOCUS_01710 7607 9280 gene locus_tag LOCUS_01720 7607 9280 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250219.1 protein_id gnl|my_center|LOCUS_01720 9432 10307 gene locus_tag LOCUS_01730 9432 10307 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250218.1 protein_id gnl|my_center|LOCUS_01730 10562 11128 gene locus_tag LOCUS_01740 10562 11128 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250217.1 protein_id gnl|my_center|LOCUS_01740 11209 13080 gene locus_tag LOCUS_01750 11209 13080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 13120 13290 gene locus_tag LOCUS_01760 13120 13290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 13978 13268 gene locus_tag LOCUS_01770 13978 13268 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387006.1 protein_id gnl|my_center|LOCUS_01770 14894 14085 gene locus_tag LOCUS_01780 14894 14085 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249678.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01780 15505 14879 gene locus_tag LOCUS_01790 15505 14879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01790 16014 15502 gene locus_tag LOCUS_01800 16014 15502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_01800 16218 17321 gene locus_tag LOCUS_01810 gene hydB 16218 17321 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867991.1 protein_id gnl|my_center|LOCUS_01810 17318 18202 gene locus_tag LOCUS_01820 gene hydG 17318 18202 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053883.1 protein_id gnl|my_center|LOCUS_01820 18213 19007 gene locus_tag LOCUS_01830 gene hydD 18213 19007 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251020.1 protein_id gnl|my_center|LOCUS_01830 19004 20296 gene locus_tag LOCUS_01840 gene hydA 19004 20296 CDS product NADPH-dependent hydrogenase/sulfhydrogenase 1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251019.1 protein_id gnl|my_center|LOCUS_01840 20746 20925 gene locus_tag LOCUS_01850 20746 20925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_01850 21686 20946 gene locus_tag LOCUS_01860 21686 20946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01860 21800 22285 gene locus_tag LOCUS_01870 21800 22285 CDS product hydrogenase maturation protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251016.1 protein_id gnl|my_center|LOCUS_01870 22310 23296 gene locus_tag LOCUS_01880 22310 23296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050003361.1 protein_id gnl|my_center|LOCUS_01880 23298 24194 gene locus_tag LOCUS_01890 23298 24194 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248979.1 protein_id gnl|my_center|LOCUS_01890 24204 24698 gene locus_tag LOCUS_01900 24204 24698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248978.1 protein_id gnl|my_center|LOCUS_01900 24700 25686 gene locus_tag LOCUS_01910 24700 25686 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248977.1 protein_id gnl|my_center|LOCUS_01910 >Feature sequence006 288 605 gene locus_tag LOCUS_01920 288 605 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598706.1 protein_id gnl|my_center|LOCUS_01920 986 612 gene locus_tag LOCUS_01930 986 612 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250598.1 protein_id gnl|my_center|LOCUS_01930 1051 1734 gene locus_tag LOCUS_01940 1051 1734 CDS product DUF4152 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250597.1 protein_id gnl|my_center|LOCUS_01940 1781 1996 gene locus_tag LOCUS_01950 1781 1996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250596.1 protein_id gnl|my_center|LOCUS_01950 1983 2429 gene locus_tag LOCUS_01960 1983 2429 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250595.1 protein_id gnl|my_center|LOCUS_01960 4333 2426 gene locus_tag LOCUS_01970 gene iorA 4333 2426 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250594.1 protein_id gnl|my_center|LOCUS_01970 4448 4735 gene locus_tag LOCUS_01980 4448 4735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250592.1 protein_id gnl|my_center|LOCUS_01980 5174 4707 gene locus_tag LOCUS_01990 5174 4707 CDS product HIT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250590.1 protein_id gnl|my_center|LOCUS_01990 5229 5444 gene locus_tag LOCUS_02000 5229 5444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250589.1 protein_id gnl|my_center|LOCUS_02000 5506 6288 gene locus_tag LOCUS_02010 gene psmA 5506 6288 CDS product archaeal proteasome endopeptidase complex subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250588.1 protein_id gnl|my_center|LOCUS_02010 6300 7010 gene locus_tag LOCUS_02020 6300 7010 CDS product ribosome assembly factor SBDS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250587.1 protein_id gnl|my_center|LOCUS_02020 7007 7780 gene locus_tag LOCUS_02030 gene rrp4 7007 7780 CDS product exosome complex RNA-binding protein Rrp4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250586.1 protein_id gnl|my_center|LOCUS_02030 7764 8513 gene locus_tag LOCUS_02040 gene rrp41 7764 8513 CDS product exosome complex exonuclease Rrp41 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250585.1 protein_id gnl|my_center|LOCUS_02040 8506 9324 gene locus_tag LOCUS_02050 gene rrp42 8506 9324 CDS product exosome complex protein Rrp42 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250584.1 protein_id gnl|my_center|LOCUS_02050 9351 9632 gene locus_tag LOCUS_02060 9351 9632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250583.1 protein_id gnl|my_center|LOCUS_02060 9684 10079 gene locus_tag LOCUS_02070 gene sepF 9684 10079 CDS product cell division protein SepF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250582.1 protein_id gnl|my_center|LOCUS_02070 10157 10834 gene locus_tag LOCUS_02080 10157 10834 CDS product ZPR1 zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250581.1 protein_id gnl|my_center|LOCUS_02080 11349 10825 gene locus_tag LOCUS_02090 11349 10825 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250580.1 protein_id gnl|my_center|LOCUS_02090 11408 11821 gene locus_tag LOCUS_02100 11408 11821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02100 12809 11808 gene locus_tag LOCUS_02110 12809 11808 CDS product homoserine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250578.1 protein_id gnl|my_center|LOCUS_02110 13689 12847 gene locus_tag LOCUS_02120 13689 12847 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250577.1 protein_id gnl|my_center|LOCUS_02120 14899 13760 gene locus_tag LOCUS_02130 14899 13760 CDS product sodium ion-translocating decarboxylase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250576.1 protein_id gnl|my_center|LOCUS_02130 15385 14906 gene locus_tag LOCUS_02140 15385 14906 CDS product acetyl-CoA carboxylase biotin carboxyl carrier protein subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250575.1 protein_id gnl|my_center|LOCUS_02140 15759 15388 gene locus_tag LOCUS_02150 15759 15388 CDS product OadG family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250574.1 protein_id gnl|my_center|LOCUS_02150 17337 15769 gene locus_tag LOCUS_02160 17337 15769 CDS product carboxyl transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250573.1 protein_id gnl|my_center|LOCUS_02160 17889 17461 gene locus_tag LOCUS_02170 17889 17461 CDS product translation initiation factor IF-2 subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250572.1 protein_id gnl|my_center|LOCUS_02170 21401 17934 gene locus_tag LOCUS_02180 21401 17934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02180 21895 21401 gene locus_tag LOCUS_02190 21895 21401 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250570.1 protein_id gnl|my_center|LOCUS_02190 22088 22600 gene locus_tag LOCUS_02200 22088 22600 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250569.1 protein_id gnl|my_center|LOCUS_02200 22610 23425 gene locus_tag LOCUS_02210 22610 23425 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053742.1 protein_id gnl|my_center|LOCUS_02210 23963 23406 gene locus_tag LOCUS_02220 23963 23406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250567.1 protein_id gnl|my_center|LOCUS_02220 >Feature sequence007 2112 922 gene locus_tag LOCUS_02230 2112 922 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3304 2102 gene locus_tag LOCUS_02240 3304 2102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 4060 3920 gene locus_tag LOCUS_02250 4060 3920 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 4307 4164 gene locus_tag LOCUS_02260 4307 4164 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 4623 4411 gene locus_tag LOCUS_02270 4623 4411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02270 5041 5271 gene locus_tag LOCUS_02280 5041 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_02280 5742 5939 gene locus_tag LOCUS_02290 5742 5939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02290 6333 5911 gene locus_tag LOCUS_02300 6333 5911 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249520.1 protein_id gnl|my_center|LOCUS_02300 6388 6900 gene locus_tag LOCUS_02310 6388 6900 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249519.1 protein_id gnl|my_center|LOCUS_02310 7365 6910 gene locus_tag LOCUS_02320 7365 6910 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249518.1 protein_id gnl|my_center|LOCUS_02320 7441 7791 gene locus_tag LOCUS_02330 7441 7791 CDS product DUF134 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249517.1 protein_id gnl|my_center|LOCUS_02330 10277 8934 gene locus_tag LOCUS_02340 gene purB 10277 8934 CDS product adenylosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868368.1 protein_id gnl|my_center|LOCUS_02340 10473 10748 gene locus_tag LOCUS_02350 gene albA 10473 10748 CDS product DNA-binding protein Alba inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249515.1 protein_id gnl|my_center|LOCUS_02350 10827 11381 gene locus_tag LOCUS_02360 10827 11381 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249514.1 protein_id gnl|my_center|LOCUS_02360 11419 11943 gene locus_tag LOCUS_02370 11419 11943 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249513.1 protein_id gnl|my_center|LOCUS_02370 12469 11933 gene locus_tag LOCUS_02380 12469 11933 CDS product NTPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249512.1 protein_id gnl|my_center|LOCUS_02380 12525 13598 gene locus_tag LOCUS_02390 gene mtnA 12525 13598 CDS product S-methyl-5-thioribose-1-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249511.1 protein_id gnl|my_center|LOCUS_02390 13998 13582 gene locus_tag LOCUS_02400 13998 13582 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011229164.1 protein_id gnl|my_center|LOCUS_02400 14153 13989 gene locus_tag LOCUS_02410 14153 13989 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02410 14447 14169 gene locus_tag LOCUS_02420 14447 14169 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02420 15016 14516 gene locus_tag LOCUS_02430 15016 14516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02430 16451 14988 gene locus_tag LOCUS_02440 16451 14988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 17514 16423 gene locus_tag LOCUS_02450 17514 16423 CDS product DUF1611 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143093.1 protein_id gnl|my_center|LOCUS_02450 18412 17423 gene locus_tag LOCUS_02460 gene thrC 18412 17423 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001255461.1 protein_id gnl|my_center|LOCUS_02460 18694 18879 gene locus_tag LOCUS_02470 18694 18879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 18949 20217 gene locus_tag LOCUS_02480 18949 20217 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249958.1 protein_id gnl|my_center|LOCUS_02480 20407 21303 gene locus_tag LOCUS_02490 20407 21303 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250971.1 protein_id gnl|my_center|LOCUS_02490 22303 21290 gene locus_tag LOCUS_02500 gene hisC 22303 21290 CDS product histidinol-phosphate transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249205.1 protein_id gnl|my_center|LOCUS_02500 22874 22293 gene locus_tag LOCUS_02510 22874 22293 CDS product regulator of amino acid metabolism, contains ACT domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147148.1 protein_id gnl|my_center|LOCUS_02510 23566 22871 gene locus_tag LOCUS_02520 23566 22871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 >Feature sequence008 972 1436 gene locus_tag LOCUS_02530 972 1436 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250905.1 protein_id gnl|my_center|LOCUS_02530 1979 1431 gene locus_tag LOCUS_02540 gene engB 1979 1431 CDS product GTP-binding protein EngB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250904.1 protein_id gnl|my_center|LOCUS_02540 2072 2722 gene locus_tag LOCUS_02550 2072 2722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250903.1 protein_id gnl|my_center|LOCUS_02550 2889 2719 gene locus_tag LOCUS_02560 2889 2719 CDS product preprotein translocase subunit Sec61beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250902.1 protein_id gnl|my_center|LOCUS_02560 3020 3400 gene locus_tag LOCUS_02570 3020 3400 CDS product 30S ribosomal protein S6e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250901.1 protein_id gnl|my_center|LOCUS_02570 3555 3968 gene locus_tag LOCUS_02580 3555 3968 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598722.1 protein_id gnl|my_center|LOCUS_02580 4479 5705 gene locus_tag LOCUS_02590 gene eif2g 4479 5705 CDS product translation initiation factor IF-2 subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250896.1 protein_id gnl|my_center|LOCUS_02590 5736 6146 gene locus_tag LOCUS_02600 5736 6146 CDS product nucleic acid-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250895.1 protein_id gnl|my_center|LOCUS_02600 6234 7010 gene locus_tag LOCUS_02610 6234 7010 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250894.1 protein_id gnl|my_center|LOCUS_02610 7031 7705 gene locus_tag LOCUS_02620 7031 7705 CDS product DUF434 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250893.1 protein_id gnl|my_center|LOCUS_02620 7780 8889 gene locus_tag LOCUS_02630 7780 8889 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146559.1 protein_id gnl|my_center|LOCUS_02630 8903 9571 gene locus_tag LOCUS_02640 8903 9571 CDS product DUF432 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250891.1 protein_id gnl|my_center|LOCUS_02640 9568 10608 gene locus_tag LOCUS_02650 9568 10608 CDS product mechanosensitive ion channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250890.1 protein_id gnl|my_center|LOCUS_02650 11940 10618 gene locus_tag LOCUS_02660 11940 10618 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250885.1 protein_id gnl|my_center|LOCUS_02660 12860 11940 gene locus_tag LOCUS_02670 12860 11940 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 13573 12962 gene locus_tag LOCUS_02680 13573 12962 CDS product METTL5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250883.1 protein_id gnl|my_center|LOCUS_02680 14604 13570 gene locus_tag LOCUS_02690 gene dph2 14604 13570 CDS product diphthamide biosynthesis enzyme Dph2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250878.1 protein_id gnl|my_center|LOCUS_02690 14816 15400 gene locus_tag LOCUS_02700 14816 15400 CDS product YiiX/YebB-like N1pC/P60 family cysteine hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250877.1 protein_id gnl|my_center|LOCUS_02700 15492 15812 gene locus_tag LOCUS_02710 15492 15812 CDS product heavy metal-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146564.1 protein_id gnl|my_center|LOCUS_02710 15818 16798 gene locus_tag LOCUS_02720 15818 16798 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02720 16840 17208 gene locus_tag LOCUS_02730 16840 17208 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250874.1 protein_id gnl|my_center|LOCUS_02730 17195 17983 gene locus_tag LOCUS_02740 17195 17983 CDS product DUF1648 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250873.1 protein_id gnl|my_center|LOCUS_02740 17970 18713 gene locus_tag LOCUS_02750 17970 18713 CDS product SdpI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879691.1 protein_id gnl|my_center|LOCUS_02750 19102 18710 gene locus_tag LOCUS_02760 19102 18710 CDS product sigma-70 region 4 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250870.1 protein_id gnl|my_center|LOCUS_02760 19793 19086 gene locus_tag LOCUS_02770 19793 19086 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02770 19888 20652 gene locus_tag LOCUS_02780 19888 20652 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867384.1 protein_id gnl|my_center|LOCUS_02780 21434 20640 gene locus_tag LOCUS_02790 21434 20640 CDS product nitrilase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250866.1 protein_id gnl|my_center|LOCUS_02790 21755 21877 gene locus_tag LOCUS_02800 21755 21877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02800 21892 22539 gene locus_tag LOCUS_02810 21892 22539 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250865.1 protein_id gnl|my_center|LOCUS_02810 22604 22930 gene locus_tag LOCUS_02820 22604 22930 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053759.1 protein_id gnl|my_center|LOCUS_02820 <24151 22917 gene locus_tag LOCUS_02830 <24151 22917 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250863.1:DUF4910 domain-containing protein >Feature sequence009 1234 2505 gene locus_tag LOCUS_02840 gene hflX 1234 2505 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250926.1 protein_id gnl|my_center|LOCUS_02840 3469 2507 gene locus_tag LOCUS_02850 3469 2507 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250927.1 protein_id gnl|my_center|LOCUS_02850 3668 4225 gene locus_tag LOCUS_02860 3668 4225 CDS product pyruvate/ketoisovalerate ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250928.1 protein_id gnl|my_center|LOCUS_02860 4267 4584 gene locus_tag LOCUS_02870 4267 4584 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit delta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250929.1 protein_id gnl|my_center|LOCUS_02870 4586 5779 gene locus_tag LOCUS_02880 4586 5779 CDS product 2-ketoisovalerate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250930.1 protein_id gnl|my_center|LOCUS_02880 5785 6720 gene locus_tag LOCUS_02890 5785 6720 CDS product 3-methyl-2-oxobutanoate dehydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250931.1 protein_id gnl|my_center|LOCUS_02890 6790 7107 gene locus_tag LOCUS_02900 gene porD 6790 7107 CDS product pyruvate synthase subunit PorD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250932.1 protein_id gnl|my_center|LOCUS_02900 7119 8303 gene locus_tag LOCUS_02910 gene porA 7119 8303 CDS product pyruvate synthase subunit PorA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250933.1 protein_id gnl|my_center|LOCUS_02910 8314 9309 gene locus_tag LOCUS_02920 gene porB 8314 9309 CDS product pyruvate synthase subunit PorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250934.1 protein_id gnl|my_center|LOCUS_02920 9403 10299 gene locus_tag LOCUS_02930 9403 10299 CDS product Mrp/NBP35 family ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250971.1 protein_id gnl|my_center|LOCUS_02930 10429 11787 gene locus_tag LOCUS_02940 10429 11787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250972.1 protein_id gnl|my_center|LOCUS_02940 12505 11774 gene locus_tag LOCUS_02950 12505 11774 CDS product DUF2110 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250973.1 protein_id gnl|my_center|LOCUS_02950 13084 12545 gene locus_tag LOCUS_02960 gene tfe 13084 12545 CDS product transcription factor E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250974.1 protein_id gnl|my_center|LOCUS_02960 13495 13208 gene locus_tag LOCUS_02970 13495 13208 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250975.1 protein_id gnl|my_center|LOCUS_02970 14450 13578 gene locus_tag LOCUS_02980 14450 13578 CDS product ADP-dependent ribose-1-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250979.1 protein_id gnl|my_center|LOCUS_02980 14557 15150 gene locus_tag LOCUS_02990 14557 15150 CDS product regulator of amino acid metabolism, contains ACT domain protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147148.1 protein_id gnl|my_center|LOCUS_02990 15409 15134 gene locus_tag LOCUS_03000 15409 15134 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250981.1 protein_id gnl|my_center|LOCUS_03000 15479 15793 gene locus_tag LOCUS_03010 gene cutA 15479 15793 CDS product divalent-cation tolerance protein CutA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250982.1 protein_id gnl|my_center|LOCUS_03010 15790 16377 gene locus_tag LOCUS_03020 15790 16377 CDS product DUF99 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250983.1 protein_id gnl|my_center|LOCUS_03020 17302 16466 gene locus_tag LOCUS_03030 17302 16466 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250984.1 protein_id gnl|my_center|LOCUS_03030 17371 18060 gene locus_tag LOCUS_03040 17371 18060 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010878966.1 protein_id gnl|my_center|LOCUS_03040 18057 19898 gene locus_tag LOCUS_03050 18057 19898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03050 19891 21114 gene locus_tag LOCUS_03060 19891 21114 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496851.1 protein_id gnl|my_center|LOCUS_03060 21158 22354 gene locus_tag LOCUS_03070 gene gcvT 21158 22354 CDS product glycine cleavage system aminomethyltransferase GcvT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250985.1 protein_id gnl|my_center|LOCUS_03070 22418 23176 gene locus_tag LOCUS_03080 22418 23176 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250986.1 protein_id gnl|my_center|LOCUS_03080 >Feature sequence010 681 1439 gene locus_tag LOCUS_03090 681 1439 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250423.1 protein_id gnl|my_center|LOCUS_03090 1480 2553 gene locus_tag LOCUS_03100 1480 2553 CDS product mRNA surveillance protein pelota inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249915.1 protein_id gnl|my_center|LOCUS_03100 3194 2556 gene locus_tag LOCUS_03110 3194 2556 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867232.1 protein_id gnl|my_center|LOCUS_03110 3294 5189 gene locus_tag LOCUS_03120 3294 5189 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250266.1 protein_id gnl|my_center|LOCUS_03120 5243 5857 gene locus_tag LOCUS_03130 5243 5857 CDS product HVO_0476 family zinc finger protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250264.1 protein_id gnl|my_center|LOCUS_03130 6040 7230 gene locus_tag LOCUS_03140 6040 7230 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250263.1 protein_id gnl|my_center|LOCUS_03140 7306 7677 gene locus_tag LOCUS_03150 gene rpl7ae 7306 7677 CDS product 50S ribosomal protein L7Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053845.1 protein_id gnl|my_center|LOCUS_03150 7745 7957 gene locus_tag LOCUS_03160 7745 7957 CDS product 30S ribosomal protein S28e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250261.1 protein_id gnl|my_center|LOCUS_03160 7954 8163 gene locus_tag LOCUS_03170 7954 8163 CDS product 50S ribosomal protein L24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250260.1 protein_id gnl|my_center|LOCUS_03170 8290 9447 gene locus_tag LOCUS_03180 8290 9447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250259.1 protein_id gnl|my_center|LOCUS_03180 9539 10063 gene locus_tag LOCUS_03190 gene ndk 9539 10063 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250258.1 protein_id gnl|my_center|LOCUS_03190 10155 11951 gene locus_tag LOCUS_03200 10155 11951 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 12001 12177 gene locus_tag LOCUS_03210 12001 12177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03210 12719 12186 gene locus_tag LOCUS_03220 12719 12186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03220 14275 13007 gene locus_tag LOCUS_03230 gene rlmD 14275 13007 CDS product 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250067.1 protein_id gnl|my_center|LOCUS_03230 14400 15683 gene locus_tag LOCUS_03240 14400 15683 CDS product serine hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249483.1 protein_id gnl|my_center|LOCUS_03240 15986 16411 gene locus_tag LOCUS_03250 15986 16411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053666.1 protein_id gnl|my_center|LOCUS_03250 16493 16825 gene locus_tag LOCUS_03260 16493 16825 CDS product transcription factor S inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249488.1 protein_id gnl|my_center|LOCUS_03260 16822 16983 gene locus_tag LOCUS_03270 16822 16983 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146988.1 protein_id gnl|my_center|LOCUS_03270 16986 17735 gene locus_tag LOCUS_03280 16986 17735 CDS product DNA polymerase sliding clamp inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249490.1 protein_id gnl|my_center|LOCUS_03280 17766 18341 gene locus_tag LOCUS_03290 17766 18341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249491.1 protein_id gnl|my_center|LOCUS_03290 18347 20254 gene locus_tag LOCUS_03300 18347 20254 CDS product molybdopterin-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249641.1 protein_id gnl|my_center|LOCUS_03300 20478 21128 gene locus_tag LOCUS_03310 20478 21128 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249492.1 protein_id gnl|my_center|LOCUS_03310 21673 21140 gene locus_tag LOCUS_03320 21673 21140 CDS product GNAT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249493.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence011 <1 885 gene locus_tag LOCUS_03330 <1 885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249074.1:FAD-dependent oxidoreductase 882 1424 gene locus_tag LOCUS_03340 882 1424 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249075.1 protein_id gnl|my_center|LOCUS_03340 1393 1665 gene locus_tag LOCUS_03350 1393 1665 CDS product (2Fe-2S)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867436.1 protein_id gnl|my_center|LOCUS_03350 1658 2824 gene locus_tag LOCUS_03360 1658 2824 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867437.1 protein_id gnl|my_center|LOCUS_03360 2893 3570 gene locus_tag LOCUS_03370 gene pyrH 2893 3570 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249260.1 protein_id gnl|my_center|LOCUS_03370 3675 4994 gene locus_tag LOCUS_03380 3675 4994 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249259.1 protein_id gnl|my_center|LOCUS_03380 5026 5562 gene locus_tag LOCUS_03390 5026 5562 CDS product RNA 2'-phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249257.1 protein_id gnl|my_center|LOCUS_03390 6784 5546 gene locus_tag LOCUS_03400 6784 5546 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249078.1 protein_id gnl|my_center|LOCUS_03400 8008 6848 gene locus_tag LOCUS_03410 8008 6848 CDS product FAD-binding oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249072.1 protein_id gnl|my_center|LOCUS_03410 9489 8011 gene locus_tag LOCUS_03420 9489 8011 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249071.1 protein_id gnl|my_center|LOCUS_03420 10773 9607 gene locus_tag LOCUS_03430 10773 9607 CDS product GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250237.1 protein_id gnl|my_center|LOCUS_03430 10889 11344 gene locus_tag LOCUS_03440 10889 11344 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250236.1 protein_id gnl|my_center|LOCUS_03440 11414 11914 gene locus_tag LOCUS_03450 gene pfpI 11414 11914 CDS product deglycase PfpI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250235.1 protein_id gnl|my_center|LOCUS_03450 11959 12882 gene locus_tag LOCUS_03460 11959 12882 CDS product triphosphoribosyl-dephospho-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249108.1 protein_id gnl|my_center|LOCUS_03460 13144 12866 gene locus_tag LOCUS_03470 13144 12866 CDS product family 4A encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053633.1 protein_id gnl|my_center|LOCUS_03470 13844 13194 gene locus_tag LOCUS_03480 gene snatA 13844 13194 CDS product neutral amino acid NAAT transporter SnatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250610.1 protein_id gnl|my_center|LOCUS_03480 13973 14248 gene locus_tag LOCUS_03490 13973 14248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250611.1 protein_id gnl|my_center|LOCUS_03490 14955 14203 gene locus_tag LOCUS_03500 14955 14203 CDS product DUF2101 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062389714.1 protein_id gnl|my_center|LOCUS_03500 16109 14961 gene locus_tag LOCUS_03510 16109 14961 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250613.1 protein_id gnl|my_center|LOCUS_03510 18710 16110 gene locus_tag LOCUS_03520 18710 16110 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250614.1 protein_id gnl|my_center|LOCUS_03520 20494 18716 gene locus_tag LOCUS_03530 20494 18716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 20958 20491 gene locus_tag LOCUS_03540 20958 20491 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250616.1 protein_id gnl|my_center|LOCUS_03540 21388 20948 gene locus_tag LOCUS_03550 21388 20948 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867933.1 protein_id gnl|my_center|LOCUS_03550 22007 21390 gene locus_tag LOCUS_03560 22007 21390 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250618.1 protein_id gnl|my_center|LOCUS_03560 >Feature sequence012 126 1505 gene locus_tag LOCUS_03570 126 1505 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249828.1 protein_id gnl|my_center|LOCUS_03570 1573 1983 gene locus_tag LOCUS_03580 1573 1983 CDS product translation initiation factor IF-5A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249829.1 protein_id gnl|my_center|LOCUS_03580 2043 2588 gene locus_tag LOCUS_03590 2043 2588 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249830.1 protein_id gnl|my_center|LOCUS_03590 2598 3875 gene locus_tag LOCUS_03600 2598 3875 CDS product ArsB/NhaD family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249831.1 protein_id gnl|my_center|LOCUS_03600 3887 4336 gene locus_tag LOCUS_03610 3887 4336 CDS product universal stress protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868808.1 protein_id gnl|my_center|LOCUS_03610 4376 5245 gene locus_tag LOCUS_03620 gene speB 4376 5245 CDS product agmatinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249833.1 protein_id gnl|my_center|LOCUS_03620 6565 5240 gene locus_tag LOCUS_03630 6565 5240 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868413.1 protein_id gnl|my_center|LOCUS_03630 8429 6714 gene locus_tag LOCUS_03640 8429 6714 CDS product chloride channel protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249837.1 protein_id gnl|my_center|LOCUS_03640 8904 8434 gene locus_tag LOCUS_03650 8904 8434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249836.1 protein_id gnl|my_center|LOCUS_03650 8994 10253 gene locus_tag LOCUS_03660 8994 10253 CDS product TIGR00375 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249838.1 protein_id gnl|my_center|LOCUS_03660 10250 11212 gene locus_tag LOCUS_03670 10250 11212 CDS product thiamine-phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249841.1 protein_id gnl|my_center|LOCUS_03670 11300 11512 gene locus_tag LOCUS_03680 11300 11512 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 12051 13196 gene locus_tag LOCUS_03690 12051 13196 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249842.1 protein_id gnl|my_center|LOCUS_03690 13189 13917 gene locus_tag LOCUS_03700 13189 13917 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249843.1 protein_id gnl|my_center|LOCUS_03700 13936 14985 gene locus_tag LOCUS_03710 gene amrS 13936 14985 CDS product AmmeMemoRadiSam system radical SAM enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249844.1 protein_id gnl|my_center|LOCUS_03710 14988 15785 gene locus_tag LOCUS_03720 14988 15785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249845.1 protein_id gnl|my_center|LOCUS_03720 15979 17850 gene locus_tag LOCUS_03730 15979 17850 CDS product S-layer protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249846.1 protein_id gnl|my_center|LOCUS_03730 17900 18679 gene locus_tag LOCUS_03740 17900 18679 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249847.1 protein_id gnl|my_center|LOCUS_03740 20414 18669 gene locus_tag LOCUS_03750 20414 18669 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249848.1 protein_id gnl|my_center|LOCUS_03750 20474 20995 gene locus_tag LOCUS_03760 20474 20995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03760 21806 20973 gene locus_tag LOCUS_03770 gene rsmA 21806 20973 CDS product 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249850.1 protein_id gnl|my_center|LOCUS_03770 >Feature sequence013 1221 346 gene locus_tag LOCUS_03780 1221 346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198407738.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03780 1339 2394 gene locus_tag LOCUS_03790 gene bpsA 1339 2394 CDS product N(4)-bis(aminopropyl)spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250642.1 protein_id gnl|my_center|LOCUS_03790 4136 2400 gene locus_tag LOCUS_03800 4136 2400 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250641.1 protein_id gnl|my_center|LOCUS_03800 6242 4179 gene locus_tag LOCUS_03810 6242 4179 CDS product S8 family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250640.1 protein_id gnl|my_center|LOCUS_03810 8338 6518 gene locus_tag LOCUS_03820 gene aor 8338 6518 CDS product aldehyde ferredoxin oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868080.1 protein_id gnl|my_center|LOCUS_03820 9573 8449 gene locus_tag LOCUS_03830 9573 8449 CDS product tungsten cofactor oxidoreductase radical SAM maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868082.1 protein_id gnl|my_center|LOCUS_03830 9685 9762 gene locus_tag LOCUS_t00100 9685 9762 tRNA product tRNA-Lys inference COORDINATES:profile:Aragorn:1.2.38 10167 9964 gene locus_tag LOCUS_03840 10167 9964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 10860 10783 gene locus_tag LOCUS_t00110 10860 10783 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 10955 11320 gene locus_tag LOCUS_03850 10955 11320 CDS product BlaI/MecI/CopY family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251209.1 protein_id gnl|my_center|LOCUS_03850 11327 12106 gene locus_tag LOCUS_03860 11327 12106 CDS product M48 family metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251208.1 protein_id gnl|my_center|LOCUS_03860 12108 12641 gene locus_tag LOCUS_03870 12108 12641 CDS product cytidine/deoxycytidylate deaminase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251207.1 protein_id gnl|my_center|LOCUS_03870 13002 12634 gene locus_tag LOCUS_03880 13002 12634 CDS product DUF2304 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251206.1 protein_id gnl|my_center|LOCUS_03880 14330 13008 gene locus_tag LOCUS_03890 14330 13008 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251205.1 protein_id gnl|my_center|LOCUS_03890 14384 15280 gene locus_tag LOCUS_03900 14384 15280 CDS product UDP-N-acetylglucosamine--dolichyl-phosphate N-acetylglucosaminephosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251204.1 protein_id gnl|my_center|LOCUS_03900 15986 15237 gene locus_tag LOCUS_03910 gene cas6 15986 15237 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251203.1 protein_id gnl|my_center|LOCUS_03910 16196 17386 gene locus_tag LOCUS_03920 16196 17386 CDS product proteasome-activating nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251202.1 protein_id gnl|my_center|LOCUS_03920 18524 17373 gene locus_tag LOCUS_03930 18524 17373 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251201.1 protein_id gnl|my_center|LOCUS_03930 18584 19516 gene locus_tag LOCUS_03940 18584 19516 CDS product serine/threonine-protein kinase RIO2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251200.1 protein_id gnl|my_center|LOCUS_03940 19506 19997 gene locus_tag LOCUS_03950 19506 19997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053787.1 protein_id gnl|my_center|LOCUS_03950 20904 19966 gene locus_tag LOCUS_03960 20904 19966 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251198.1 protein_id gnl|my_center|LOCUS_03960 <21701 20894 gene locus_tag LOCUS_03970 <21701 20894 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251197.1:MFS transporter >Feature sequence014 285 85 gene locus_tag LOCUS_03980 285 85 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03980 443 297 gene locus_tag LOCUS_03990 443 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03990 627 496 gene locus_tag LOCUS_04000 627 496 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04000 1252 755 gene locus_tag LOCUS_04010 1252 755 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250987.1 protein_id gnl|my_center|LOCUS_04010 1782 1228 gene locus_tag LOCUS_04020 1782 1228 CDS product DUF531 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250988.1 protein_id gnl|my_center|LOCUS_04020 1839 2915 gene locus_tag LOCUS_04030 1839 2915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053765.1 protein_id gnl|my_center|LOCUS_04030 2920 3852 gene locus_tag LOCUS_04040 2920 3852 CDS product dipeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250990.1 protein_id gnl|my_center|LOCUS_04040 4292 3849 gene locus_tag LOCUS_04050 4292 3849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250991.1 protein_id gnl|my_center|LOCUS_04050 4984 4289 gene locus_tag LOCUS_04060 4984 4289 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250992.1 protein_id gnl|my_center|LOCUS_04060 5061 5921 gene locus_tag LOCUS_04070 5061 5921 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250995.1 protein_id gnl|my_center|LOCUS_04070 6336 5899 gene locus_tag LOCUS_04080 6336 5899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04080 8285 6426 gene locus_tag LOCUS_04090 8285 6426 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250999.1 protein_id gnl|my_center|LOCUS_04090 8404 8730 gene locus_tag LOCUS_04100 8404 8730 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251000.1 protein_id gnl|my_center|LOCUS_04100 9348 8698 gene locus_tag LOCUS_04110 9348 8698 CDS product serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251001.1 protein_id gnl|my_center|LOCUS_04110 9399 9626 gene locus_tag LOCUS_04120 9399 9626 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251002.1 protein_id gnl|my_center|LOCUS_04120 10334 9660 gene locus_tag LOCUS_04130 10334 9660 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251010.1 protein_id gnl|my_center|LOCUS_04130 11550 10339 gene locus_tag LOCUS_04140 11550 10339 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053767.1 protein_id gnl|my_center|LOCUS_04140 13296 11659 gene locus_tag LOCUS_04150 13296 11659 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251012.1 protein_id gnl|my_center|LOCUS_04150 13380 13736 gene locus_tag LOCUS_04160 13380 13736 CDS product cupin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251013.1 protein_id gnl|my_center|LOCUS_04160 14299 13733 gene locus_tag LOCUS_04170 14299 13733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 14816 14394 gene locus_tag LOCUS_04180 14816 14394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04180 14982 14800 gene locus_tag LOCUS_04190 14982 14800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04190 16249 14975 gene locus_tag LOCUS_04200 16249 14975 CDS product tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251014.1 protein_id gnl|my_center|LOCUS_04200 16556 16326 gene locus_tag LOCUS_04210 16556 16326 CDS product TRAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251015.1 protein_id gnl|my_center|LOCUS_04210 16821 17993 gene locus_tag LOCUS_04220 gene frhA 16821 17993 CDS product coenzyme F420 hydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083774535.1 protein_id gnl|my_center|LOCUS_04220 17999 18679 gene locus_tag LOCUS_04230 gene frhG 17999 18679 CDS product coenzyme F420 hydrogenase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496370.1 protein_id gnl|my_center|LOCUS_04230 18676 19506 gene locus_tag LOCUS_04240 gene frhB 18676 19506 CDS product coenzyme F420 hydrogenase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496371.1 protein_id gnl|my_center|LOCUS_04240 >Feature sequence015 2441 747 gene locus_tag LOCUS_04250 gene top6B 2441 747 CDS product DNA topoisomerase VI subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249750.1 protein_id gnl|my_center|LOCUS_04250 3136 2438 gene locus_tag LOCUS_04260 3136 2438 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249751.1 protein_id gnl|my_center|LOCUS_04260 3917 3141 gene locus_tag LOCUS_04270 3917 3141 CDS product serine protein kinase RIO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249752.1 protein_id gnl|my_center|LOCUS_04270 4285 3935 gene locus_tag LOCUS_04280 gene eif1A 4285 3935 CDS product translation initiation factor eIF-1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249753.1 protein_id gnl|my_center|LOCUS_04280 4460 5248 gene locus_tag LOCUS_04290 4460 5248 CDS product metal ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249754.1 protein_id gnl|my_center|LOCUS_04290 5245 6066 gene locus_tag LOCUS_04300 5245 6066 CDS product metal ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249755.1 protein_id gnl|my_center|LOCUS_04300 6071 6757 gene locus_tag LOCUS_04310 gene rnhB 6071 6757 CDS product ribonuclease HII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249756.1 protein_id gnl|my_center|LOCUS_04310 8266 6884 gene locus_tag LOCUS_04320 8266 6884 CDS product dolichyl-phosphate-mannose--protein mannosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475414.1 protein_id gnl|my_center|LOCUS_04320 8327 9478 gene locus_tag LOCUS_04330 8327 9478 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249758.1 protein_id gnl|my_center|LOCUS_04330 9667 9473 gene locus_tag LOCUS_04340 9667 9473 CDS product PCNA-inhibitor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249759.1 protein_id gnl|my_center|LOCUS_04340 9790 11598 gene locus_tag LOCUS_04350 gene glmS 9790 11598 CDS product glutamine--fructose-6-phosphate transaminase (isomerizing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249760.1 protein_id gnl|my_center|LOCUS_04350 11609 14611 gene locus_tag LOCUS_04360 11609 14611 CDS product STT3 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249761.1 protein_id gnl|my_center|LOCUS_04360 14968 14687 gene locus_tag LOCUS_04370 14968 14687 CDS product MoaD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012869227.1 protein_id gnl|my_center|LOCUS_04370 15044 15787 gene locus_tag LOCUS_04380 15044 15787 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 16424 15753 gene locus_tag LOCUS_04390 16424 15753 CDS product adenylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249763.1 protein_id gnl|my_center|LOCUS_04390 16482 16928 gene locus_tag LOCUS_04400 16482 16928 CDS product DUF2258 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249764.1 protein_id gnl|my_center|LOCUS_04400 17520 16912 gene locus_tag LOCUS_04410 gene trmY 17520 16912 CDS product tRNA (pseudouridine(54)-N(1))-methyltransferase TrmY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249509.1 protein_id gnl|my_center|LOCUS_04410 17905 17522 gene locus_tag LOCUS_04420 17905 17522 CDS product DUF2095 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249981.1 protein_id gnl|my_center|LOCUS_04420 17964 18386 gene locus_tag LOCUS_04430 17964 18386 CDS product DUF123 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249980.1 protein_id gnl|my_center|LOCUS_04430 18402 19160 gene locus_tag LOCUS_04440 18402 19160 CDS product geranylgeranylglyceryl/heptaprenylglyceryl phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249977.1 protein_id gnl|my_center|LOCUS_04440 19275 20465 gene locus_tag LOCUS_04450 19275 20465 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081432771.1 protein_id gnl|my_center|LOCUS_04450 20717 20484 gene locus_tag LOCUS_04460 20717 20484 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249974.1 protein_id gnl|my_center|LOCUS_04460 >Feature sequence016 483 851 gene locus_tag LOCUS_04470 483 851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250378.1 protein_id gnl|my_center|LOCUS_04470 856 1545 gene locus_tag LOCUS_04480 gene rpiA 856 1545 CDS product ribose-5-phosphate isomerase RpiA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250377.1 protein_id gnl|my_center|LOCUS_04480 1722 2681 gene locus_tag LOCUS_04490 1722 2681 CDS product integrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250293.1 protein_id gnl|my_center|LOCUS_04490 3607 2735 gene locus_tag LOCUS_04500 3607 2735 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04500 3851 3609 gene locus_tag LOCUS_04510 3851 3609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04510 4206 3856 gene locus_tag LOCUS_04520 4206 3856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250298.1 protein_id gnl|my_center|LOCUS_04520 4432 4211 gene locus_tag LOCUS_04530 4432 4211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4701 4429 gene locus_tag LOCUS_04540 4701 4429 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250300.1 protein_id gnl|my_center|LOCUS_04540 4904 4698 gene locus_tag LOCUS_04550 4904 4698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 5763 5011 gene locus_tag LOCUS_04560 5763 5011 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 6747 5770 gene locus_tag LOCUS_04570 6747 5770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250302.1 protein_id gnl|my_center|LOCUS_04570 7418 6750 gene locus_tag LOCUS_04580 7418 6750 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04580 8524 7577 gene locus_tag LOCUS_04590 8524 7577 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250304.1 protein_id gnl|my_center|LOCUS_04590 8937 8788 gene locus_tag LOCUS_04600 8937 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04600 9422 8943 gene locus_tag LOCUS_04610 9422 8943 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250294.1 protein_id gnl|my_center|LOCUS_04610 9762 9424 gene locus_tag LOCUS_04620 9762 9424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04620 10170 9814 gene locus_tag LOCUS_04630 10170 9814 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870428.1 protein_id gnl|my_center|LOCUS_04630 10354 10163 gene locus_tag LOCUS_04640 10354 10163 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04640 10526 10344 gene locus_tag LOCUS_04650 10526 10344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 10791 10555 gene locus_tag LOCUS_04660 10791 10555 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250306.1 protein_id gnl|my_center|LOCUS_04660 11498 10797 gene locus_tag LOCUS_04670 11498 10797 CDS product DUF87 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250307.1 protein_id gnl|my_center|LOCUS_04670 12169 11522 gene locus_tag LOCUS_04680 12169 11522 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250308.1 protein_id gnl|my_center|LOCUS_04680 12437 12162 gene locus_tag LOCUS_04690 12437 12162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250310.1 protein_id gnl|my_center|LOCUS_04690 13036 12440 gene locus_tag LOCUS_04700 13036 12440 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250311.1 protein_id gnl|my_center|LOCUS_04700 13212 13358 gene locus_tag LOCUS_04710 13212 13358 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 13355 13540 gene locus_tag LOCUS_04720 13355 13540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 13509 13898 gene locus_tag LOCUS_04730 13509 13898 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 16568 13911 gene locus_tag LOCUS_04740 16568 13911 CDS product minichromosome maintenance protein MCM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250312.1 protein_id gnl|my_center|LOCUS_04740 16795 16607 gene locus_tag LOCUS_04750 16795 16607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250316.1 protein_id gnl|my_center|LOCUS_04750 16948 17343 gene locus_tag LOCUS_04760 16948 17343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250313.1 protein_id gnl|my_center|LOCUS_04760 17866 17354 gene locus_tag LOCUS_04770 17866 17354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250315.1 protein_id gnl|my_center|LOCUS_04770 18267 17863 gene locus_tag LOCUS_04780 18267 17863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04780 18473 18264 gene locus_tag LOCUS_04790 18473 18264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250317.1 protein_id gnl|my_center|LOCUS_04790 18781 18479 gene locus_tag LOCUS_04800 18781 18479 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04800 18972 18778 gene locus_tag LOCUS_04810 18972 18778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250319.1 protein_id gnl|my_center|LOCUS_04810 19187 18969 gene locus_tag LOCUS_04820 19187 18969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053723.1 protein_id gnl|my_center|LOCUS_04820 19344 19559 gene locus_tag LOCUS_04830 19344 19559 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 19806 19594 gene locus_tag LOCUS_04840 19806 19594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250324.1 protein_id gnl|my_center|LOCUS_04840 20072 19803 gene locus_tag LOCUS_04850 20072 19803 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04850 20206 20069 gene locus_tag LOCUS_04860 20206 20069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04860 20505 20296 gene locus_tag LOCUS_04870 20505 20296 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250324.1 protein_id gnl|my_center|LOCUS_04870 20840 20502 gene locus_tag LOCUS_04880 20840 20502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04880 >Feature sequence017 1124 429 gene locus_tag LOCUS_04890 1124 429 CDS product TrkA C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250526.1 protein_id gnl|my_center|LOCUS_04890 1772 1209 gene locus_tag LOCUS_04900 1772 1209 CDS product DUF308 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250527.1 protein_id gnl|my_center|LOCUS_04900 1890 2405 gene locus_tag LOCUS_04910 1890 2405 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250531.1 protein_id gnl|my_center|LOCUS_04910 2831 2995 gene locus_tag LOCUS_04920 2831 2995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 3027 3530 gene locus_tag LOCUS_04930 3027 3530 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250532.1 protein_id gnl|my_center|LOCUS_04930 3615 4358 gene locus_tag LOCUS_04940 3615 4358 CDS product KaiC domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250541.1 protein_id gnl|my_center|LOCUS_04940 4382 4927 gene locus_tag LOCUS_04950 4382 4927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062371128.1 protein_id gnl|my_center|LOCUS_04950 5360 4929 gene locus_tag LOCUS_04960 gene speD 5360 4929 CDS product adenosylmethionine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053856.1 protein_id gnl|my_center|LOCUS_04960 5666 6574 gene locus_tag LOCUS_04970 5666 6574 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250544.1 protein_id gnl|my_center|LOCUS_04970 6571 8091 gene locus_tag LOCUS_04980 6571 8091 CDS product preprotein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250545.1 protein_id gnl|my_center|LOCUS_04980 8091 8774 gene locus_tag LOCUS_04990 8091 8774 CDS product TrkA family potassium uptake protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250546.1 protein_id gnl|my_center|LOCUS_04990 8913 9224 gene locus_tag LOCUS_05000 8913 9224 CDS product V-type ATP synthase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250547.1 protein_id gnl|my_center|LOCUS_05000 9226 11235 gene locus_tag LOCUS_05010 9226 11235 CDS product V-type ATP synthase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250548.1 protein_id gnl|my_center|LOCUS_05010 11239 11724 gene locus_tag LOCUS_05020 11239 11724 CDS product V-type ATP synthase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250549.1 protein_id gnl|my_center|LOCUS_05020 11760 12371 gene locus_tag LOCUS_05030 11760 12371 CDS product V-type ATP synthase subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250550.1 protein_id gnl|my_center|LOCUS_05030 12377 13471 gene locus_tag LOCUS_05040 12377 13471 CDS product V-type ATP synthase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250551.1 protein_id gnl|my_center|LOCUS_05040 13468 13776 gene locus_tag LOCUS_05050 13468 13776 CDS product V-type ATP synthase subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250552.1 protein_id gnl|my_center|LOCUS_05050 13783 15540 gene locus_tag LOCUS_05060 13783 15540 CDS product ATP synthase subunit A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250553.1 protein_id gnl|my_center|LOCUS_05060 15540 16937 gene locus_tag LOCUS_05070 15540 16937 CDS product ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053740.1 protein_id gnl|my_center|LOCUS_05070 16966 17610 gene locus_tag LOCUS_05080 16966 17610 CDS product V-type ATP synthase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250555.1 protein_id gnl|my_center|LOCUS_05080 17712 18479 gene locus_tag LOCUS_05090 17712 18479 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250556.1 protein_id gnl|my_center|LOCUS_05090 18489 19241 gene locus_tag LOCUS_05100 18489 19241 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250557.1 protein_id gnl|my_center|LOCUS_05100 19255 20469 gene locus_tag LOCUS_05110 19255 20469 CDS product DHHA1 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250558.1 protein_id gnl|my_center|LOCUS_05110 >Feature sequence018 <1 581 gene locus_tag LOCUS_05120 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250348.1:glycerophosphodiester phosphodiesterase family protein 651 1388 gene locus_tag LOCUS_05130 651 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 1432 2913 gene locus_tag LOCUS_05140 gene glpK 1432 2913 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146520.1 protein_id gnl|my_center|LOCUS_05140 2970 3665 gene locus_tag LOCUS_05150 2970 3665 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867392.1 protein_id gnl|my_center|LOCUS_05150 3811 5301 gene locus_tag LOCUS_05160 3811 5301 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250344.1 protein_id gnl|my_center|LOCUS_05160 5298 6554 gene locus_tag LOCUS_05170 5298 6554 CDS product FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209476615.1 protein_id gnl|my_center|LOCUS_05170 6551 6895 gene locus_tag LOCUS_05180 6551 6895 CDS product DUF1667 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250342.1 protein_id gnl|my_center|LOCUS_05180 7683 6892 gene locus_tag LOCUS_05190 7683 6892 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05190 8062 7844 gene locus_tag LOCUS_05200 8062 7844 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250339.1 protein_id gnl|my_center|LOCUS_05200 8763 8062 gene locus_tag LOCUS_05210 8763 8062 CDS product PrsW family glutamic-type intramembrane protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250338.1 protein_id gnl|my_center|LOCUS_05210 9486 8809 gene locus_tag LOCUS_05220 9486 8809 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250337.1 protein_id gnl|my_center|LOCUS_05220 9578 9856 gene locus_tag LOCUS_05230 9578 9856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250336.1 protein_id gnl|my_center|LOCUS_05230 10418 9843 gene locus_tag LOCUS_05240 10418 9843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158298053.1 protein_id gnl|my_center|LOCUS_05240 11144 10461 gene locus_tag LOCUS_05250 11144 10461 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250334.1 protein_id gnl|my_center|LOCUS_05250 11320 12618 gene locus_tag LOCUS_05260 11320 12618 CDS product phospholipase C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250332.1 protein_id gnl|my_center|LOCUS_05260 12742 14088 gene locus_tag LOCUS_05270 gene gcvPA 12742 14088 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250331.1 protein_id gnl|my_center|LOCUS_05270 14089 15597 gene locus_tag LOCUS_05280 gene gcvPB 14089 15597 CDS product aminomethyl-transferring glycine dehydrogenase subunit GcvPB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250330.1 protein_id gnl|my_center|LOCUS_05280 15686 15979 gene locus_tag LOCUS_05290 15686 15979 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05290 16674 16597 gene locus_tag LOCUS_t00120 16674 16597 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 16755 16680 gene locus_tag LOCUS_t00130 16755 16680 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 16853 16929 gene locus_tag LOCUS_t00140 16853 16929 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 17551 16931 gene locus_tag LOCUS_05300 gene tmk 17551 16931 CDS product dTMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250354.1 protein_id gnl|my_center|LOCUS_05300 18326 17616 gene locus_tag LOCUS_05310 18326 17616 CDS product phospho-sugar mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250355.1 protein_id gnl|my_center|LOCUS_05310 19422 18337 gene locus_tag LOCUS_05320 19422 18337 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867600.1 protein_id gnl|my_center|LOCUS_05320 >Feature sequence019 2285 1677 gene locus_tag LOCUS_05330 gene psmB 2285 1677 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250380.1 protein_id gnl|my_center|LOCUS_05330 2388 3554 gene locus_tag LOCUS_05340 2388 3554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250381.1 protein_id gnl|my_center|LOCUS_05340 4876 3611 gene locus_tag LOCUS_05350 gene gdhA 4876 3611 CDS product glutamate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250382.1 protein_id gnl|my_center|LOCUS_05350 5471 7036 gene locus_tag LOCUS_05360 5471 7036 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250383.1 protein_id gnl|my_center|LOCUS_05360 7192 7926 gene locus_tag LOCUS_05370 7192 7926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250385.1 protein_id gnl|my_center|LOCUS_05370 9968 7923 gene locus_tag LOCUS_05380 9968 7923 CDS product 1,4-alpha-glucan branching protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250387.1 protein_id gnl|my_center|LOCUS_05380 10094 10348 gene locus_tag LOCUS_05390 10094 10348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05390 10388 12340 gene locus_tag LOCUS_05400 gene rqcH 10388 12340 CDS product ribosome rescue protein RqcH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250389.1 protein_id gnl|my_center|LOCUS_05400 12753 12337 gene locus_tag LOCUS_05410 gene nikR 12753 12337 CDS product nickel-responsive transcriptional regulator NikR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250390.1 protein_id gnl|my_center|LOCUS_05410 12835 13278 gene locus_tag LOCUS_05420 12835 13278 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250391.1 protein_id gnl|my_center|LOCUS_05420 13288 14067 gene locus_tag LOCUS_05430 13288 14067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598700.1 protein_id gnl|my_center|LOCUS_05430 14073 14843 gene locus_tag LOCUS_05440 14073 14843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598700.1 protein_id gnl|my_center|LOCUS_05440 14930 16249 gene locus_tag LOCUS_05450 14930 16249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05450 16528 17853 gene locus_tag LOCUS_05460 16528 17853 CDS product TrpB-like pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250393.1 protein_id gnl|my_center|LOCUS_05460 18534 17860 gene locus_tag LOCUS_05470 18534 17860 CDS product Ribonuclease P protein component 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250401.1 protein_id gnl|my_center|LOCUS_05470 18986 18531 gene locus_tag LOCUS_05480 18986 18531 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250402.1 protein_id gnl|my_center|LOCUS_05480 19090 19326 gene locus_tag LOCUS_05490 19090 19326 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05490 19323 19697 gene locus_tag LOCUS_05500 19323 19697 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846631.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence020 261 1382 gene locus_tag LOCUS_05510 261 1382 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249524.1 protein_id gnl|my_center|LOCUS_05510 1453 2910 gene locus_tag LOCUS_05520 1453 2910 CDS product extracellular solute-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249525.1 protein_id gnl|my_center|LOCUS_05520 3061 4905 gene locus_tag LOCUS_05530 3061 4905 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249526.1 protein_id gnl|my_center|LOCUS_05530 4919 5983 gene locus_tag LOCUS_05540 4919 5983 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249527.1 protein_id gnl|my_center|LOCUS_05540 6010 6588 gene locus_tag LOCUS_05550 6010 6588 CDS product DUF447 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249528.1 protein_id gnl|my_center|LOCUS_05550 6662 8674 gene locus_tag LOCUS_05560 6662 8674 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249529.1 protein_id gnl|my_center|LOCUS_05560 8735 8811 gene locus_tag LOCUS_t00150 8735 8811 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 8832 9125 gene locus_tag LOCUS_05570 8832 9125 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249651.1 protein_id gnl|my_center|LOCUS_05570 9770 11188 gene locus_tag LOCUS_05580 9770 11188 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249650.1 protein_id gnl|my_center|LOCUS_05580 11199 12521 gene locus_tag LOCUS_05590 11199 12521 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249649.1 protein_id gnl|my_center|LOCUS_05590 13727 12528 gene locus_tag LOCUS_05600 13727 12528 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249190.1 protein_id gnl|my_center|LOCUS_05600 14193 13732 gene locus_tag LOCUS_05610 14193 13732 CDS product COG2426 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249640.1 protein_id gnl|my_center|LOCUS_05610 14836 14186 gene locus_tag LOCUS_05620 14836 14186 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209478368.1 protein_id gnl|my_center|LOCUS_05620 15439 14891 gene locus_tag LOCUS_05630 15439 14891 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249638.1 protein_id gnl|my_center|LOCUS_05630 16157 15429 gene locus_tag LOCUS_05640 16157 15429 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249637.1 protein_id gnl|my_center|LOCUS_05640 16593 16189 gene locus_tag LOCUS_05650 16593 16189 CDS product DUF3783 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146570.1 protein_id gnl|my_center|LOCUS_05650 17342 16590 gene locus_tag LOCUS_05660 gene cobB 17342 16590 CDS product NAD-dependent protein deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249636.1 protein_id gnl|my_center|LOCUS_05660 17475 18662 gene locus_tag LOCUS_05670 17475 18662 CDS product aromatic amino acid transport family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053677.1 protein_id gnl|my_center|LOCUS_05670 18698 19699 gene locus_tag LOCUS_05680 gene gyaR 18698 19699 CDS product glyoxylate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249634.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence021 2282 1512 gene locus_tag LOCUS_05690 2282 1512 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088854783.1 protein_id gnl|my_center|LOCUS_05690 3217 2279 gene locus_tag LOCUS_05700 3217 2279 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868174.1 protein_id gnl|my_center|LOCUS_05700 3417 3704 gene locus_tag LOCUS_05710 3417 3704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250105.1 protein_id gnl|my_center|LOCUS_05710 3738 4595 gene locus_tag LOCUS_05720 3738 4595 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250104.1 protein_id gnl|my_center|LOCUS_05720 4967 5449 gene locus_tag LOCUS_05730 4967 5449 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053707.1 protein_id gnl|my_center|LOCUS_05730 5644 8034 gene locus_tag LOCUS_05740 5644 8034 CDS product CDC48 family AAA ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250108.1 protein_id gnl|my_center|LOCUS_05740 8082 8546 gene locus_tag LOCUS_05750 8082 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05750 8543 8788 gene locus_tag LOCUS_05760 8543 8788 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496835.1 protein_id gnl|my_center|LOCUS_05760 8934 8785 gene locus_tag LOCUS_05770 8934 8785 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 9257 9108 gene locus_tag LOCUS_05780 9257 9108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05780 9321 9719 gene locus_tag LOCUS_05790 9321 9719 CDS product M67 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249984.1 protein_id gnl|my_center|LOCUS_05790 9766 9978 gene locus_tag LOCUS_05800 9766 9978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_05800 10056 13115 gene locus_tag LOCUS_05810 10056 13115 CDS product N-6 DNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053708.1 protein_id gnl|my_center|LOCUS_05810 13184 13507 gene locus_tag LOCUS_05820 13184 13507 CDS product type II toxin-antitoxin system ParD family antitoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249646.1 protein_id gnl|my_center|LOCUS_05820 13504 13899 gene locus_tag LOCUS_05830 13504 13899 CDS product putative toxin-antitoxin system toxin component, PIN family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249647.1 protein_id gnl|my_center|LOCUS_05830 14720 13986 gene locus_tag LOCUS_05840 gene mobB 14720 13986 CDS product molybdopterin-guanine dinucleotide biosynthesis protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249885.1 protein_id gnl|my_center|LOCUS_05840 14945 14730 gene locus_tag LOCUS_05850 14945 14730 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249884.1 protein_id gnl|my_center|LOCUS_05850 15043 15870 gene locus_tag LOCUS_05860 15043 15870 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249881.1 protein_id gnl|my_center|LOCUS_05860 16561 15854 gene locus_tag LOCUS_05870 16561 15854 CDS product DUF115 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249248.1 protein_id gnl|my_center|LOCUS_05870 17061 16561 gene locus_tag LOCUS_05880 17061 16561 CDS product Mut7-C RNAse domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249247.1 protein_id gnl|my_center|LOCUS_05880 17092 17841 gene locus_tag LOCUS_05890 17092 17841 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249243.1 protein_id gnl|my_center|LOCUS_05890 18440 17838 gene locus_tag LOCUS_05900 18440 17838 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249130.1 protein_id gnl|my_center|LOCUS_05900 18803 18471 gene locus_tag LOCUS_05910 18803 18471 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249131.1 protein_id gnl|my_center|LOCUS_05910 19012 18791 gene locus_tag LOCUS_05920 19012 18791 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249132.1 protein_id gnl|my_center|LOCUS_05920 <19876 19049 gene locus_tag LOCUS_05930 <19876 19049 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249133.1:IGHMBP2 family helicase >Feature sequence022 1129 284 gene locus_tag LOCUS_05940 gene fba 1129 284 CDS product class I fructose-bisphosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249940.1 protein_id gnl|my_center|LOCUS_05940 1253 1966 gene locus_tag LOCUS_05950 1253 1966 CDS product biotin--[acetyl-CoA-carboxylase] ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249938.1 protein_id gnl|my_center|LOCUS_05950 2087 3370 gene locus_tag LOCUS_05960 2087 3370 CDS product dicarboxylate/amino acid:cation symporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249937.1 protein_id gnl|my_center|LOCUS_05960 3448 4851 gene locus_tag LOCUS_05970 3448 4851 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088885245.1 protein_id gnl|my_center|LOCUS_05970 4929 5084 gene locus_tag LOCUS_05980 4929 5084 CDS product 50S ribosomal protein L39e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250270.1 protein_id gnl|my_center|LOCUS_05980 5095 5367 gene locus_tag LOCUS_05990 5095 5367 CDS product 50S ribosomal protein L31e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250271.1 protein_id gnl|my_center|LOCUS_05990 5395 6081 gene locus_tag LOCUS_06000 5395 6081 CDS product translation initiation factor IF-6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250272.1 protein_id gnl|my_center|LOCUS_06000 6122 6361 gene locus_tag LOCUS_06010 gene rpl18a 6122 6361 CDS product 50S ribosomal protein L18Ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250273.1 protein_id gnl|my_center|LOCUS_06010 6959 6345 gene locus_tag LOCUS_06020 6959 6345 CDS product asparagine synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053718.1 protein_id gnl|my_center|LOCUS_06020 7050 7298 gene locus_tag LOCUS_06030 7050 7298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 7295 7690 gene locus_tag LOCUS_06040 7295 7690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 7748 8158 gene locus_tag LOCUS_06050 7748 8158 CDS product YhbY family RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250226.1 protein_id gnl|my_center|LOCUS_06050 8162 8614 gene locus_tag LOCUS_06060 8162 8614 CDS product 30S ribosomal protein S19e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250227.1 protein_id gnl|my_center|LOCUS_06060 8686 9024 gene locus_tag LOCUS_06070 8686 9024 CDS product DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250229.1 protein_id gnl|my_center|LOCUS_06070 9039 9332 gene locus_tag LOCUS_06080 9039 9332 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053717.1 protein_id gnl|my_center|LOCUS_06080 9355 10254 gene locus_tag LOCUS_06090 9355 10254 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250231.1 protein_id gnl|my_center|LOCUS_06090 11270 10251 gene locus_tag LOCUS_06100 gene fen 11270 10251 CDS product flap endonuclease-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250232.1 protein_id gnl|my_center|LOCUS_06100 11817 11362 gene locus_tag LOCUS_06110 11817 11362 CDS product phosphate-starvation-inducible PsiE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250089.1 protein_id gnl|my_center|LOCUS_06110 12041 13432 gene locus_tag LOCUS_06120 12041 13432 CDS product acetate--CoA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249616.1 protein_id gnl|my_center|LOCUS_06120 13518 14225 gene locus_tag LOCUS_06130 13518 14225 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249618.1 protein_id gnl|my_center|LOCUS_06130 14557 14222 gene locus_tag LOCUS_06140 14557 14222 CDS product PRC-barrel domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249619.1 protein_id gnl|my_center|LOCUS_06140 15050 14637 gene locus_tag LOCUS_06150 gene pfdA 15050 14637 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249956.1 protein_id gnl|my_center|LOCUS_06150 15802 15098 gene locus_tag LOCUS_06160 15802 15098 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249896.1 protein_id gnl|my_center|LOCUS_06160 15884 16306 gene locus_tag LOCUS_06170 15884 16306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249897.1 protein_id gnl|my_center|LOCUS_06170 17474 16293 gene locus_tag LOCUS_06180 17474 16293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209473904.1 protein_id gnl|my_center|LOCUS_06180 18555 17536 gene locus_tag LOCUS_06190 18555 17536 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249899.1 protein_id gnl|my_center|LOCUS_06190 <19222 18595 gene locus_tag LOCUS_06200 <19222 18595 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249900.1:glycosyltransferase family 4 protein >Feature sequence023 376 1368 gene locus_tag LOCUS_06210 gene trxB 376 1368 CDS product thioredoxin-disulfide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251050.1 protein_id gnl|my_center|LOCUS_06210 1578 1369 gene locus_tag LOCUS_06220 1578 1369 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06220 1825 1583 gene locus_tag LOCUS_06230 1825 1583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06230 2000 3337 gene locus_tag LOCUS_06240 2000 3337 CDS product acetyl ornithine aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251051.1 protein_id gnl|my_center|LOCUS_06240 3378 3977 gene locus_tag LOCUS_06250 3378 3977 CDS product ECF transporter S component inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251052.1 protein_id gnl|my_center|LOCUS_06250 4258 3974 gene locus_tag LOCUS_06260 4258 3974 CDS product family 4B encapsulin nanocompartment shell protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598724.1 protein_id gnl|my_center|LOCUS_06260 4926 4255 gene locus_tag LOCUS_06270 gene deoC 4926 4255 CDS product deoxyribose-phosphate aldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251054.1 protein_id gnl|my_center|LOCUS_06270 5319 5008 gene locus_tag LOCUS_06280 5319 5008 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251055.1 protein_id gnl|my_center|LOCUS_06280 5402 6694 gene locus_tag LOCUS_06290 gene eno 5402 6694 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251056.1 protein_id gnl|my_center|LOCUS_06290 6756 7583 gene locus_tag LOCUS_06300 6756 7583 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251059.1 protein_id gnl|my_center|LOCUS_06300 7707 7543 gene locus_tag LOCUS_06310 7707 7543 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 8416 7724 gene locus_tag LOCUS_06320 8416 7724 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004070262.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_06320 9085 8546 gene locus_tag LOCUS_06330 9085 8546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 10089 9133 gene locus_tag LOCUS_06340 10089 9133 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598723.1 protein_id gnl|my_center|LOCUS_06340 10857 10405 gene locus_tag LOCUS_06350 10857 10405 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251060.1 protein_id gnl|my_center|LOCUS_06350 11468 10917 gene locus_tag LOCUS_06360 11468 10917 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251061.1 protein_id gnl|my_center|LOCUS_06360 11996 11508 gene locus_tag LOCUS_06370 11996 11508 CDS product adenosine-specific kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251062.1 protein_id gnl|my_center|LOCUS_06370 12062 12982 gene locus_tag LOCUS_06380 12062 12982 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251063.1 protein_id gnl|my_center|LOCUS_06380 13902 12979 gene locus_tag LOCUS_06390 13902 12979 CDS product SPASM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062388956.1 protein_id gnl|my_center|LOCUS_06390 14425 14000 gene locus_tag LOCUS_06400 14425 14000 CDS product molybdenum cofactor biosynthesis protein MoaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251065.1 protein_id gnl|my_center|LOCUS_06400 14496 15308 gene locus_tag LOCUS_06410 14496 15308 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053774.1 protein_id gnl|my_center|LOCUS_06410 15999 15301 gene locus_tag LOCUS_06420 15999 15301 CDS product ThiF family adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867188.1 protein_id gnl|my_center|LOCUS_06420 16267 16001 gene locus_tag LOCUS_06430 gene moaD 16267 16001 CDS product molybdopterin converting factor subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251068.1 protein_id gnl|my_center|LOCUS_06430 16560 16402 gene locus_tag LOCUS_06440 16560 16402 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06440 18074 17910 gene locus_tag LOCUS_06450 18074 17910 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06450 >Feature sequence024 1331 72 gene locus_tag LOCUS_06460 1331 72 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250179.1 protein_id gnl|my_center|LOCUS_06460 1500 2000 gene locus_tag LOCUS_06470 1500 2000 CDS product ACT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250178.1 protein_id gnl|my_center|LOCUS_06470 2225 2758 gene locus_tag LOCUS_06480 2225 2758 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250177.1 protein_id gnl|my_center|LOCUS_06480 2755 3009 gene locus_tag LOCUS_06490 2755 3009 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867825.1 protein_id gnl|my_center|LOCUS_06490 3006 3404 gene locus_tag LOCUS_06500 gene mnhG 3006 3404 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250175.1 protein_id gnl|my_center|LOCUS_06500 3401 3685 gene locus_tag LOCUS_06510 3401 3685 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250174.1 protein_id gnl|my_center|LOCUS_06510 3679 4395 gene locus_tag LOCUS_06520 3679 4395 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053840.1 protein_id gnl|my_center|LOCUS_06520 4392 4748 gene locus_tag LOCUS_06530 4392 4748 CDS product NADH-quinone oxidoreductase subunit K inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867829.1 protein_id gnl|my_center|LOCUS_06530 4745 6232 gene locus_tag LOCUS_06540 4745 6232 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250171.1 protein_id gnl|my_center|LOCUS_06540 6229 8076 gene locus_tag LOCUS_06550 6229 8076 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250170.1 protein_id gnl|my_center|LOCUS_06550 8077 8976 gene locus_tag LOCUS_06560 8077 8976 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250169.1 protein_id gnl|my_center|LOCUS_06560 8980 9558 gene locus_tag LOCUS_06570 8980 9558 CDS product NADH-quinone oxidoreductase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053713.1 protein_id gnl|my_center|LOCUS_06570 9549 10124 gene locus_tag LOCUS_06580 9549 10124 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053712.1 protein_id gnl|my_center|LOCUS_06580 10135 11319 gene locus_tag LOCUS_06590 10135 11319 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250166.1 protein_id gnl|my_center|LOCUS_06590 11325 11993 gene locus_tag LOCUS_06600 gene nuoI 11325 11993 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053711.1 protein_id gnl|my_center|LOCUS_06600 13339 12002 gene locus_tag LOCUS_06610 13339 12002 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250162.1 protein_id gnl|my_center|LOCUS_06610 13455 13916 gene locus_tag LOCUS_06620 13455 13916 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250161.1 protein_id gnl|my_center|LOCUS_06620 15314 13941 gene locus_tag LOCUS_06630 gene hcp 15314 13941 CDS product hydroxylamine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868115.1 protein_id gnl|my_center|LOCUS_06630 15483 15869 gene locus_tag LOCUS_06640 15483 15869 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146785.1 protein_id gnl|my_center|LOCUS_06640 15900 16475 gene locus_tag LOCUS_06650 15900 16475 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 16546 16899 gene locus_tag LOCUS_06660 16546 16899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06660 17607 16885 gene locus_tag LOCUS_06670 17607 16885 CDS product electron transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250160.1 protein_id gnl|my_center|LOCUS_06670 <18250 17678 gene locus_tag LOCUS_06680 <18250 17678 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_209477090.1:glutaredoxin >Feature sequence025 1359 421 gene locus_tag LOCUS_06690 1359 421 CDS product tRNA (cytosine(49)-C(5))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249315.1 protein_id gnl|my_center|LOCUS_06690 1794 1369 gene locus_tag LOCUS_06700 1794 1369 CDS product archease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249316.1 protein_id gnl|my_center|LOCUS_06700 2005 2856 gene locus_tag LOCUS_06710 gene panB 2005 2856 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867972.1 protein_id gnl|my_center|LOCUS_06710 2995 3411 gene locus_tag LOCUS_06720 2995 3411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06720 3488 3412 gene locus_tag LOCUS_t00160 3488 3412 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 4343 3528 gene locus_tag LOCUS_06730 4343 3528 CDS product phosphatase PAP2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_082781427.1 protein_id gnl|my_center|LOCUS_06730 4448 4894 gene locus_tag LOCUS_06740 4448 4894 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249473.1 protein_id gnl|my_center|LOCUS_06740 4903 5271 gene locus_tag LOCUS_06750 4903 5271 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06750 5624 7396 gene locus_tag LOCUS_06760 5624 7396 CDS product ribosome biogenesis/translation initiation ATPase RLI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249982.1 protein_id gnl|my_center|LOCUS_06760 7437 8411 gene locus_tag LOCUS_06770 7437 8411 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249983.1 protein_id gnl|my_center|LOCUS_06770 8478 9053 gene locus_tag LOCUS_06780 8478 9053 CDS product 7-cyano-7-deazaguanine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249321.1 protein_id gnl|my_center|LOCUS_06780 9226 10002 gene locus_tag LOCUS_06790 9226 10002 CDS product PLP-dependent cysteine synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867496.1 protein_id gnl|my_center|LOCUS_06790 10038 10391 gene locus_tag LOCUS_06800 10038 10391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249023.1 protein_id gnl|my_center|LOCUS_06800 11149 10388 gene locus_tag LOCUS_06810 11149 10388 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249894.1 protein_id gnl|my_center|LOCUS_06810 12591 11167 gene locus_tag LOCUS_06820 12591 11167 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249895.1 protein_id gnl|my_center|LOCUS_06820 13452 12679 gene locus_tag LOCUS_06830 13452 12679 CDS product sugar phosphate isomerase/epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011024526.1 protein_id gnl|my_center|LOCUS_06830 14612 13449 gene locus_tag LOCUS_06840 14612 13449 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_081432771.1 protein_id gnl|my_center|LOCUS_06840 14698 15303 gene locus_tag LOCUS_06850 14698 15303 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867340.1 protein_id gnl|my_center|LOCUS_06850 15296 15871 gene locus_tag LOCUS_06860 15296 15871 CDS product potassium channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250407.1 protein_id gnl|my_center|LOCUS_06860 16588 15875 gene locus_tag LOCUS_06870 16588 15875 CDS product endonuclease III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250092.1 protein_id gnl|my_center|LOCUS_06870 16985 16557 gene locus_tag LOCUS_06880 16985 16557 CDS product ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250093.1 protein_id gnl|my_center|LOCUS_06880 17081 17533 gene locus_tag LOCUS_06890 17081 17533 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146602.1 protein_id gnl|my_center|LOCUS_06890 >Feature sequence026 391 74 gene locus_tag LOCUS_06900 gene pbp11 391 74 CDS product tRNA-binding protein Pbp11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250561.1 protein_id gnl|my_center|LOCUS_06900 547 1008 gene locus_tag LOCUS_06910 gene nuoE 547 1008 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250565.1 protein_id gnl|my_center|LOCUS_06910 1001 2800 gene locus_tag LOCUS_06920 gene nuoF 1001 2800 CDS product NADH-quinone oxidoreductase subunit NuoF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250564.1 protein_id gnl|my_center|LOCUS_06920 2802 5651 gene locus_tag LOCUS_06930 2802 5651 CDS product NAD(P)-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053741.1 protein_id gnl|my_center|LOCUS_06930 6362 5664 gene locus_tag LOCUS_06940 6362 5664 CDS product DUF257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250560.1 protein_id gnl|my_center|LOCUS_06940 7023 6349 gene locus_tag LOCUS_06950 7023 6349 CDS product DUF257 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250559.1 protein_id gnl|my_center|LOCUS_06950 8126 7224 gene locus_tag LOCUS_06960 8126 7224 CDS product asparagine synthetase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250501.1 protein_id gnl|my_center|LOCUS_06960 8334 8915 gene locus_tag LOCUS_06970 8334 8915 CDS product ATPase, T2SS/T4P/T4SS family inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250500.1 protein_id gnl|my_center|LOCUS_06970 9649 8912 gene locus_tag LOCUS_06980 9649 8912 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 10832 9678 gene locus_tag LOCUS_06990 10832 9678 CDS product alanine--glyoxylate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250499.1 protein_id gnl|my_center|LOCUS_06990 10996 12153 gene locus_tag LOCUS_07000 10996 12153 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250498.1 protein_id gnl|my_center|LOCUS_07000 12229 12777 gene locus_tag LOCUS_07010 12229 12777 CDS product 50S ribosomal protein L16 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250497.1 protein_id gnl|my_center|LOCUS_07010 12848 13990 gene locus_tag LOCUS_07020 12848 13990 CDS product RNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250496.1 protein_id gnl|my_center|LOCUS_07020 14147 14070 gene locus_tag LOCUS_t00170 14147 14070 tRNA product tRNA-Gly inference COORDINATES:profile:Aragorn:1.2.38 14232 14156 gene locus_tag LOCUS_t00180 14232 14156 tRNA product tRNA-Phe inference COORDINATES:profile:Aragorn:1.2.38 15019 14300 gene locus_tag LOCUS_07030 gene queC 15019 14300 CDS product 7-cyano-7-deazaguanine synthase QueC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251213.1 protein_id gnl|my_center|LOCUS_07030 15426 15016 gene locus_tag LOCUS_07040 15426 15016 CDS product PIN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251212.1 protein_id gnl|my_center|LOCUS_07040 15650 15414 gene locus_tag LOCUS_07050 15650 15414 CDS product AbrB/MazE/SpoVT family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251211.1 protein_id gnl|my_center|LOCUS_07050 16602 15700 gene locus_tag LOCUS_07060 16602 15700 CDS product dihydroorotate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053788.1 protein_id gnl|my_center|LOCUS_07060 >Feature sequence027 79 1086 gene locus_tag LOCUS_07070 79 1086 CDS product deoxyhypusine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249622.1 protein_id gnl|my_center|LOCUS_07070 1146 1265 gene locus_tag LOCUS_07080 1146 1265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07080 1864 1995 gene locus_tag LOCUS_07090 1864 1995 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07090 2638 1988 gene locus_tag LOCUS_07100 2638 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07100 2938 2741 gene locus_tag LOCUS_07110 2938 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07110 3141 4313 gene locus_tag LOCUS_07120 3141 4313 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958343.1 protein_id gnl|my_center|LOCUS_07120 5618 4344 gene locus_tag LOCUS_07130 gene tiaS 5618 4344 CDS product tRNA(Ile2) 2-agmatinylcytidine synthetase TiaS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249508.1 protein_id gnl|my_center|LOCUS_07130 6675 5641 gene locus_tag LOCUS_07140 6675 5641 CDS product SLC13 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867610.1 protein_id gnl|my_center|LOCUS_07140 7180 6719 gene locus_tag LOCUS_07150 7180 6719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07150 7710 7177 gene locus_tag LOCUS_07160 7710 7177 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249780.1 protein_id gnl|my_center|LOCUS_07160 9315 7756 gene locus_tag LOCUS_07170 9315 7756 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868584.1 protein_id gnl|my_center|LOCUS_07170 9828 9325 gene locus_tag LOCUS_07180 9828 9325 CDS product Na+/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868585.1 protein_id gnl|my_center|LOCUS_07180 10211 9825 gene locus_tag LOCUS_07190 10211 9825 CDS product Na+/H+ antiporter subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868586.1 protein_id gnl|my_center|LOCUS_07190 10971 10204 gene locus_tag LOCUS_07200 10971 10204 CDS product MnhB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868587.1 protein_id gnl|my_center|LOCUS_07200 11225 10968 gene locus_tag LOCUS_07210 11225 10968 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147037.1 protein_id gnl|my_center|LOCUS_07210 11680 11222 gene locus_tag LOCUS_07220 11680 11222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07220 11961 11677 gene locus_tag LOCUS_07230 11961 11677 CDS product monovalent cation/H+ antiporter complex subunit F inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147040.1 protein_id gnl|my_center|LOCUS_07230 13844 11958 gene locus_tag LOCUS_07240 13844 11958 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147045.1 protein_id gnl|my_center|LOCUS_07240 15328 13841 gene locus_tag LOCUS_07250 15328 13841 CDS product hydrogenase 4 subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147047.1 protein_id gnl|my_center|LOCUS_07250 16367 15447 gene locus_tag LOCUS_07260 16367 15447 CDS product polyprenyl synthetase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880544.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence028 1149 796 gene locus_tag LOCUS_07270 1149 796 CDS product TIGR04076 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250807.1 protein_id gnl|my_center|LOCUS_07270 1239 2687 gene locus_tag LOCUS_07280 1239 2687 CDS product DUF515 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250806.1 protein_id gnl|my_center|LOCUS_07280 2698 3723 gene locus_tag LOCUS_07290 2698 3723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250805.1 protein_id gnl|my_center|LOCUS_07290 3730 5775 gene locus_tag LOCUS_07300 3730 5775 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 5785 6837 gene locus_tag LOCUS_07310 5785 6837 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250803.1 protein_id gnl|my_center|LOCUS_07310 6843 7754 gene locus_tag LOCUS_07320 6843 7754 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053754.1 protein_id gnl|my_center|LOCUS_07320 8210 7710 gene locus_tag LOCUS_07330 8210 7710 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250801.1 protein_id gnl|my_center|LOCUS_07330 8847 8356 gene locus_tag LOCUS_07340 8847 8356 CDS product DUF2118 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250800.1 protein_id gnl|my_center|LOCUS_07340 8969 9832 gene locus_tag LOCUS_07350 8969 9832 CDS product DUF4129 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250799.1 protein_id gnl|my_center|LOCUS_07350 9834 10253 gene locus_tag LOCUS_07360 9834 10253 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250798.1 protein_id gnl|my_center|LOCUS_07360 10243 11196 gene locus_tag LOCUS_07370 10243 11196 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250797.1 protein_id gnl|my_center|LOCUS_07370 11206 12501 gene locus_tag LOCUS_07380 11206 12501 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250796.1 protein_id gnl|my_center|LOCUS_07380 12498 12926 gene locus_tag LOCUS_07390 12498 12926 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07390 13746 12916 gene locus_tag LOCUS_07400 13746 12916 CDS product carbohydrate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598716.1 protein_id gnl|my_center|LOCUS_07400 13926 14912 gene locus_tag LOCUS_07410 13926 14912 CDS product DUF4855 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249397.1 protein_id gnl|my_center|LOCUS_07410 14897 16498 gene locus_tag LOCUS_07420 14897 16498 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence029 632 129 gene locus_tag LOCUS_07430 632 129 CDS product PadR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249721.1 protein_id gnl|my_center|LOCUS_07430 733 4794 gene locus_tag LOCUS_07440 733 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07440 4866 5747 gene locus_tag LOCUS_07450 4866 5747 CDS product transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249725.1 protein_id gnl|my_center|LOCUS_07450 5843 6214 gene locus_tag LOCUS_07460 5843 6214 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867856.1 protein_id gnl|my_center|LOCUS_07460 6231 6827 gene locus_tag LOCUS_07470 6231 6827 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07470 6824 9490 gene locus_tag LOCUS_07480 6824 9490 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 9588 10043 gene locus_tag LOCUS_07490 9588 10043 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250202.1 protein_id gnl|my_center|LOCUS_07490 10075 11490 gene locus_tag LOCUS_07500 10075 11490 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250203.1 protein_id gnl|my_center|LOCUS_07500 11480 11740 gene locus_tag LOCUS_07510 11480 11740 CDS product KEOPS complex subunit Pcc1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250204.1 protein_id gnl|my_center|LOCUS_07510 11756 12358 gene locus_tag LOCUS_07520 11756 12358 CDS product 30S ribosomal protein S3ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250205.1 protein_id gnl|my_center|LOCUS_07520 12844 12452 gene locus_tag LOCUS_07530 12844 12452 CDS product DUF126 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250199.1 protein_id gnl|my_center|LOCUS_07530 14014 12854 gene locus_tag LOCUS_07540 14014 12854 CDS product aconitase X catalytic domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250200.1 protein_id gnl|my_center|LOCUS_07540 14108 14185 gene locus_tag LOCUS_t00190 14108 14185 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 14268 15287 gene locus_tag LOCUS_07550 14268 15287 CDS product M42 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249726.1 protein_id gnl|my_center|LOCUS_07550 15569 15877 gene locus_tag LOCUS_07560 15569 15877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07560 >Feature sequence030 747 439 gene locus_tag LOCUS_07570 747 439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07570 1171 860 gene locus_tag LOCUS_07580 1171 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07580 4286 1389 gene locus_tag LOCUS_07590 4286 1389 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07590 4629 4297 gene locus_tag LOCUS_07600 4629 4297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 5250 4738 gene locus_tag LOCUS_07610 5250 4738 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251069.1 protein_id gnl|my_center|LOCUS_07610 5324 6229 gene locus_tag LOCUS_07620 5324 6229 CDS product LEA type 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053775.1 protein_id gnl|my_center|LOCUS_07620 6270 6788 gene locus_tag LOCUS_07630 6270 6788 CDS product DUF3201 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251071.1 protein_id gnl|my_center|LOCUS_07630 6799 7926 gene locus_tag LOCUS_07640 6799 7926 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251072.1 protein_id gnl|my_center|LOCUS_07640 7929 8951 gene locus_tag LOCUS_07650 7929 8951 CDS product flippase-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251073.1 protein_id gnl|my_center|LOCUS_07650 8965 9801 gene locus_tag LOCUS_07660 8965 9801 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251074.1 protein_id gnl|my_center|LOCUS_07660 10550 9798 gene locus_tag LOCUS_07670 10550 9798 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251075.1 protein_id gnl|my_center|LOCUS_07670 11518 10541 gene locus_tag LOCUS_07680 11518 10541 CDS product bifunctional N(6)-L-threonylcarbamoyladenine synthase/serine/threonine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251076.1 protein_id gnl|my_center|LOCUS_07680 12927 11602 gene locus_tag LOCUS_07690 12927 11602 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251077.1 protein_id gnl|my_center|LOCUS_07690 14122 12917 gene locus_tag LOCUS_07700 14122 12917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07700 14192 14689 gene locus_tag LOCUS_07710 gene coaD 14192 14689 CDS product phosphopantetheine adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251078.1 protein_id gnl|my_center|LOCUS_07710 14722 15402 gene locus_tag LOCUS_07720 gene tpiA 14722 15402 CDS product triose-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251079.1 protein_id gnl|my_center|LOCUS_07720 <16118 15463 gene locus_tag LOCUS_07730 <16118 15463 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257603.1:SDR family oxidoreductase >Feature sequence031 <1 1133 gene locus_tag LOCUS_07740 <1 1133 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251218.1:pyridoxal phosphate-dependent aminotransferase 1143 1406 gene locus_tag LOCUS_07750 1143 1406 CDS product TMEM165/GDT1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251217.1 protein_id gnl|my_center|LOCUS_07750 1418 2614 gene locus_tag LOCUS_07760 1418 2614 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053896.1 protein_id gnl|my_center|LOCUS_07760 3711 2611 gene locus_tag LOCUS_07770 3711 2611 CDS product TRM11 family methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248963.1 protein_id gnl|my_center|LOCUS_07770 3781 5082 gene locus_tag LOCUS_07780 3781 5082 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248964.1 protein_id gnl|my_center|LOCUS_07780 5036 5317 gene locus_tag LOCUS_07790 5036 5317 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07790 5323 5745 gene locus_tag LOCUS_07800 5323 5745 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248966.1 protein_id gnl|my_center|LOCUS_07800 6303 5746 gene locus_tag LOCUS_07810 6303 5746 CDS product Era-like GTP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248967.1 protein_id gnl|my_center|LOCUS_07810 6353 6664 gene locus_tag LOCUS_07820 6353 6664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248968.1 protein_id gnl|my_center|LOCUS_07820 6667 7224 gene locus_tag LOCUS_07830 6667 7224 CDS product HD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248969.1 protein_id gnl|my_center|LOCUS_07830 7285 8352 gene locus_tag LOCUS_07840 gene wtpA 7285 8352 CDS product tungstate ABC transporter substrate-binding protein WtpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248970.1 protein_id gnl|my_center|LOCUS_07840 8386 8877 gene locus_tag LOCUS_07850 8386 8877 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07850 8907 9659 gene locus_tag LOCUS_07860 gene wtpB 8907 9659 CDS product tungstate ABC transporter permease WtpB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248973.1 protein_id gnl|my_center|LOCUS_07860 9646 10680 gene locus_tag LOCUS_07870 gene wtpC 9646 10680 CDS product tungstate ABC transporter ATP-binding protein WtpC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867278.1 protein_id gnl|my_center|LOCUS_07870 11314 10652 gene locus_tag LOCUS_07880 gene tsaA 11314 10652 CDS product tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248982.1 protein_id gnl|my_center|LOCUS_07880 12612 11347 gene locus_tag LOCUS_07890 12612 11347 CDS product adenosylhomocysteinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248983.1 protein_id gnl|my_center|LOCUS_07890 12686 13420 gene locus_tag LOCUS_07900 12686 13420 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048064452.1 protein_id gnl|my_center|LOCUS_07900 13454 14026 gene locus_tag LOCUS_07910 13454 14026 CDS product cyclase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248985.1 protein_id gnl|my_center|LOCUS_07910 14250 15392 gene locus_tag LOCUS_07920 14250 15392 CDS product cell wall-binding repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867621.1 protein_id gnl|my_center|LOCUS_07920 15747 15394 gene locus_tag LOCUS_07930 15747 15394 CDS product ribonuclease P protein component 4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248986.1 protein_id gnl|my_center|LOCUS_07930 >Feature sequence032 172 747 gene locus_tag LOCUS_07940 172 747 CDS product PH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251123.1 protein_id gnl|my_center|LOCUS_07940 1382 744 gene locus_tag LOCUS_07950 1382 744 CDS product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209474667.1 protein_id gnl|my_center|LOCUS_07950 2713 1430 gene locus_tag LOCUS_07960 2713 1430 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251120.1 protein_id gnl|my_center|LOCUS_07960 4068 2710 gene locus_tag LOCUS_07970 4068 2710 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251119.1 protein_id gnl|my_center|LOCUS_07970 4151 4660 gene locus_tag LOCUS_07980 4151 4660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 4657 4911 gene locus_tag LOCUS_07990 4657 4911 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07990 4967 6889 gene locus_tag LOCUS_08000 4967 6889 CDS product CGP-CTERM sorting domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251118.1 protein_id gnl|my_center|LOCUS_08000 8151 6886 gene locus_tag LOCUS_08010 8151 6886 CDS product phosphoadenosine phosphosulfate reductase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251117.1 protein_id gnl|my_center|LOCUS_08010 9348 8242 gene locus_tag LOCUS_08020 9348 8242 CDS product M20 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251116.1 protein_id gnl|my_center|LOCUS_08020 9880 9335 gene locus_tag LOCUS_08030 9880 9335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 10004 9927 gene locus_tag LOCUS_t00200 10004 9927 tRNA product tRNA-Ala inference COORDINATES:profile:Aragorn:1.2.38 10150 10899 gene locus_tag LOCUS_08040 10150 10899 CDS product biotin/lipoate A/B protein ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250859.1 protein_id gnl|my_center|LOCUS_08040 11534 10896 gene locus_tag LOCUS_08050 11534 10896 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250858.1 protein_id gnl|my_center|LOCUS_08050 11677 11753 gene locus_tag LOCUS_t00210 11677 11753 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 12506 11841 gene locus_tag LOCUS_08060 gene radB 12506 11841 CDS product DNA repair and recombination protein RadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251181.1 protein_id gnl|my_center|LOCUS_08060 13151 12516 gene locus_tag LOCUS_08070 13151 12516 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251182.1 protein_id gnl|my_center|LOCUS_08070 13234 13608 gene locus_tag LOCUS_08080 13234 13608 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251183.1 protein_id gnl|my_center|LOCUS_08080 13601 14308 gene locus_tag LOCUS_08090 13601 14308 CDS product DUF1614 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251184.1 protein_id gnl|my_center|LOCUS_08090 14364 15203 gene locus_tag LOCUS_08100 14364 15203 CDS product ribose-phosphate diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251185.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence033 1541 813 gene locus_tag LOCUS_08110 1541 813 CDS product phosphoglycolate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251251.1 protein_id gnl|my_center|LOCUS_08110 2840 1593 gene locus_tag LOCUS_08120 gene truD 2840 1593 CDS product tRNA pseudouridine(13) synthase TruD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251252.1 protein_id gnl|my_center|LOCUS_08120 3206 2844 gene locus_tag LOCUS_08130 gene pth2 3206 2844 CDS product peptidyl-tRNA hydrolase Pth2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251250.1 protein_id gnl|my_center|LOCUS_08130 5286 3241 gene locus_tag LOCUS_08140 5286 3241 CDS product BatD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249448.1 protein_id gnl|my_center|LOCUS_08140 6673 5357 gene locus_tag LOCUS_08150 gene aspS 6673 5357 CDS product aspartate--tRNA(Asn) ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249447.1 protein_id gnl|my_center|LOCUS_08150 7246 6734 gene locus_tag LOCUS_08160 7246 6734 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249436.1 protein_id gnl|my_center|LOCUS_08160 7960 7340 gene locus_tag LOCUS_08170 7960 7340 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249435.1 protein_id gnl|my_center|LOCUS_08170 8651 7992 gene locus_tag LOCUS_08180 8651 7992 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08180 9034 8681 gene locus_tag LOCUS_08190 9034 8681 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877438.1 protein_id gnl|my_center|LOCUS_08190 9522 9040 gene locus_tag LOCUS_08200 9522 9040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08200 10521 10886 gene locus_tag LOCUS_08210 10521 10886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08210 11705 10887 gene locus_tag LOCUS_08220 11705 10887 CDS product DUF4392 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249434.1 protein_id gnl|my_center|LOCUS_08220 11881 11702 gene locus_tag LOCUS_08230 11881 11702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249433.1 protein_id gnl|my_center|LOCUS_08230 12522 11887 gene locus_tag LOCUS_08240 12522 11887 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254069.1 protein_id gnl|my_center|LOCUS_08240 13267 12503 gene locus_tag LOCUS_08250 13267 12503 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249431.1 protein_id gnl|my_center|LOCUS_08250 14493 13273 gene locus_tag LOCUS_08260 gene hxlA 14493 13273 CDS product 3-hexulose-6-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249430.1 protein_id gnl|my_center|LOCUS_08260 14632 15357 gene locus_tag LOCUS_08270 14632 15357 CDS product arginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249429.1 protein_id gnl|my_center|LOCUS_08270 >Feature sequence034 278 733 gene locus_tag LOCUS_08280 278 733 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250158.1 protein_id gnl|my_center|LOCUS_08280 834 1088 gene locus_tag LOCUS_08290 834 1088 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250157.1 protein_id gnl|my_center|LOCUS_08290 1639 1091 gene locus_tag LOCUS_08300 1639 1091 CDS product YbhB/YbcL family Raf kinase inhibitor-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147291.1 protein_id gnl|my_center|LOCUS_08300 1797 2174 gene locus_tag LOCUS_08310 1797 2174 CDS product DUF2284 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250155.1 protein_id gnl|my_center|LOCUS_08310 2180 2668 gene locus_tag LOCUS_08320 2180 2668 CDS product DUF1887 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250154.1 protein_id gnl|my_center|LOCUS_08320 2655 3656 gene locus_tag LOCUS_08330 2655 3656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250153.1 protein_id gnl|my_center|LOCUS_08330 3946 3653 gene locus_tag LOCUS_08340 3946 3653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250151.1 protein_id gnl|my_center|LOCUS_08340 4620 3943 gene locus_tag LOCUS_08350 4620 3943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250152.1 protein_id gnl|my_center|LOCUS_08350 6002 4677 gene locus_tag LOCUS_08360 6002 4677 CDS product RuvB-like helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250150.1 protein_id gnl|my_center|LOCUS_08360 7008 6067 gene locus_tag LOCUS_08370 7008 6067 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248979.1 protein_id gnl|my_center|LOCUS_08370 8036 7005 gene locus_tag LOCUS_08380 8036 7005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_050003361.1 protein_id gnl|my_center|LOCUS_08380 8191 9915 gene locus_tag LOCUS_08390 8191 9915 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 10663 9902 gene locus_tag LOCUS_08400 10663 9902 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250149.1 protein_id gnl|my_center|LOCUS_08400 10926 10660 gene locus_tag LOCUS_08410 10926 10660 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250148.1 protein_id gnl|my_center|LOCUS_08410 11497 10997 gene locus_tag LOCUS_08420 11497 10997 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250147.1 protein_id gnl|my_center|LOCUS_08420 12249 11548 gene locus_tag LOCUS_08430 12249 11548 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08430 13304 12246 gene locus_tag LOCUS_08440 13304 12246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08440 <15290 14080 gene locus_tag LOCUS_08450 <15290 14080 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146523.1:DEAD/DEAH box helicase >Feature sequence035 519 1829 gene locus_tag LOCUS_08460 519 1829 CDS product sodium-dependent transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250358.1 protein_id gnl|my_center|LOCUS_08460 3549 1831 gene locus_tag LOCUS_08470 3549 1831 CDS product glutamate--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250359.1 protein_id gnl|my_center|LOCUS_08470 3768 3598 gene locus_tag LOCUS_08480 3768 3598 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08480 5213 3840 gene locus_tag LOCUS_08490 gene dnaG 5213 3840 CDS product DNA primase DnaG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250361.1 protein_id gnl|my_center|LOCUS_08490 5611 5210 gene locus_tag LOCUS_08500 5611 5210 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250362.1 protein_id gnl|my_center|LOCUS_08500 5988 5656 gene locus_tag LOCUS_08510 5988 5656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 7309 6038 gene locus_tag LOCUS_08520 7309 6038 CDS product TIGR04013 family B12-binding domain/radical SAM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250363.1 protein_id gnl|my_center|LOCUS_08520 7584 7381 gene locus_tag LOCUS_08530 gene hpkA 7584 7381 CDS product archaeal histone HpkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250364.1 protein_id gnl|my_center|LOCUS_08530 8333 7857 gene locus_tag LOCUS_08540 gene dcd 8333 7857 CDS product dCTP deaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250365.1 protein_id gnl|my_center|LOCUS_08540 9158 9081 gene locus_tag LOCUS_t00220 9158 9081 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 9584 9264 gene locus_tag LOCUS_08550 9584 9264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08550 10663 9644 gene locus_tag LOCUS_08560 10663 9644 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250367.1 protein_id gnl|my_center|LOCUS_08560 11319 10669 gene locus_tag LOCUS_08570 11319 10669 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250368.1 protein_id gnl|my_center|LOCUS_08570 11891 11400 gene locus_tag LOCUS_08580 11891 11400 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250369.1 protein_id gnl|my_center|LOCUS_08580 12384 11926 gene locus_tag LOCUS_08590 12384 11926 CDS product transcription elongation factor Spt5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250370.1 protein_id gnl|my_center|LOCUS_08590 12580 12395 gene locus_tag LOCUS_08600 12580 12395 CDS product protein translocase SEC61 complex subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250371.1 protein_id gnl|my_center|LOCUS_08600 13734 12613 gene locus_tag LOCUS_08610 gene ftsZ 13734 12613 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250372.1 protein_id gnl|my_center|LOCUS_08610 14668 13850 gene locus_tag LOCUS_08620 14668 13850 CDS product D-aminoacyl-tRNA deacylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250373.1 protein_id gnl|my_center|LOCUS_08620 >Feature sequence036 <1 1674 gene locus_tag LOCUS_08630 <1 1674 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249620.1:CDC48 family AAA ATPase 2793 3218 gene locus_tag LOCUS_08640 2793 3218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08640 4155 3238 gene locus_tag LOCUS_08650 4155 3238 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249955.1 protein_id gnl|my_center|LOCUS_08650 4482 4186 gene locus_tag LOCUS_08660 4482 4186 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08660 4636 5655 gene locus_tag LOCUS_08670 4636 5655 CDS product adenylosuccinate synthetase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249953.1 protein_id gnl|my_center|LOCUS_08670 7699 5648 gene locus_tag LOCUS_08680 7699 5648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08680 8550 7774 gene locus_tag LOCUS_08690 8550 7774 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249950.1 protein_id gnl|my_center|LOCUS_08690 8963 8553 gene locus_tag LOCUS_08700 8963 8553 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868840.1 protein_id gnl|my_center|LOCUS_08700 9137 8982 gene locus_tag LOCUS_08710 9137 8982 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08710 9948 9295 gene locus_tag LOCUS_08720 9948 9295 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249947.1 protein_id gnl|my_center|LOCUS_08720 10234 9950 gene locus_tag LOCUS_08730 10234 9950 CDS product iron-sulfur cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249946.1 protein_id gnl|my_center|LOCUS_08730 11216 10224 gene locus_tag LOCUS_08740 11216 10224 CDS product ArsA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249945.1 protein_id gnl|my_center|LOCUS_08740 11508 11227 gene locus_tag LOCUS_08750 11508 11227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249944.1 protein_id gnl|my_center|LOCUS_08750 13308 11554 gene locus_tag LOCUS_08760 13308 11554 CDS product carbon starvation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249942.1 protein_id gnl|my_center|LOCUS_08760 <15164 13460 gene locus_tag LOCUS_08770 <15164 13460 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249941.1:sodium-extruding oxaloacetate decarboxylase subunit alpha >Feature sequence037 1475 180 gene locus_tag LOCUS_08780 gene asnS 1475 180 CDS product asparagine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249710.1 protein_id gnl|my_center|LOCUS_08780 1693 2910 gene locus_tag LOCUS_08790 1693 2910 CDS product amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249709.1 protein_id gnl|my_center|LOCUS_08790 3427 2879 gene locus_tag LOCUS_08800 3427 2879 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 5392 3431 gene locus_tag LOCUS_08810 5392 3431 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 6991 5396 gene locus_tag LOCUS_08820 6991 5396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08820 7574 6993 gene locus_tag LOCUS_08830 7574 6993 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08830 8160 7576 gene locus_tag LOCUS_08840 8160 7576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 10009 8162 gene locus_tag LOCUS_08850 10009 8162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08850 10517 9996 gene locus_tag LOCUS_08860 10517 9996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08860 11816 10653 gene locus_tag LOCUS_08870 11816 10653 CDS product thiamine ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053820.1 protein_id gnl|my_center|LOCUS_08870 12381 11902 gene locus_tag LOCUS_08880 12381 11902 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249707.1 protein_id gnl|my_center|LOCUS_08880 12899 12378 gene locus_tag LOCUS_08890 12899 12378 CDS product TIGR00288 family NYN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249706.1 protein_id gnl|my_center|LOCUS_08890 <14928 12967 gene locus_tag LOCUS_08900 <14928 12967 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249705.1:tRNA(Met) cytidine acetyltransferase TmcA >Feature sequence038 25 483 gene locus_tag LOCUS_08910 25 483 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249507.1 protein_id gnl|my_center|LOCUS_08910 488 1252 gene locus_tag LOCUS_08920 488 1252 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249930.1 protein_id gnl|my_center|LOCUS_08920 1823 2575 gene locus_tag LOCUS_08930 1823 2575 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868648.1 protein_id gnl|my_center|LOCUS_08930 2580 2852 gene locus_tag LOCUS_08940 2580 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250003.1 protein_id gnl|my_center|LOCUS_08940 2914 4047 gene locus_tag LOCUS_08950 2914 4047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 4072 4911 gene locus_tag LOCUS_08960 4072 4911 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055428724.1 protein_id gnl|my_center|LOCUS_08960 5048 5944 gene locus_tag LOCUS_08970 5048 5944 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250002.1 protein_id gnl|my_center|LOCUS_08970 5961 6959 gene locus_tag LOCUS_08980 5961 6959 CDS product helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_055428724.1 protein_id gnl|my_center|LOCUS_08980 9144 6952 gene locus_tag LOCUS_08990 gene metG 9144 6952 CDS product methionine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250000.1 protein_id gnl|my_center|LOCUS_08990 11012 9771 gene locus_tag LOCUS_09000 11012 9771 CDS product NDP-sugar synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249906.1 protein_id gnl|my_center|LOCUS_09000 11506 11243 gene locus_tag LOCUS_09010 11506 11243 CDS product FeoC-like transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_068320664.1 protein_id gnl|my_center|LOCUS_09010 13497 11509 gene locus_tag LOCUS_09020 gene feoB 13497 11509 CDS product ferrous iron transport protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249908.1 protein_id gnl|my_center|LOCUS_09020 13735 13508 gene locus_tag LOCUS_09030 13735 13508 CDS product FeoA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053694.1 protein_id gnl|my_center|LOCUS_09030 13912 14556 gene locus_tag LOCUS_09040 13912 14556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09040 >Feature sequence039 <1 654 gene locus_tag LOCUS_09050 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250508.1:NAD(P)/FAD-dependent oxidoreductase 798 1835 gene locus_tag LOCUS_09060 798 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09060 2886 3806 gene locus_tag LOCUS_09070 2886 3806 CDS product TIGR00269 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250507.1 protein_id gnl|my_center|LOCUS_09070 3952 4605 gene locus_tag LOCUS_09080 3952 4605 CDS product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867404.1 protein_id gnl|my_center|LOCUS_09080 6533 4602 gene locus_tag LOCUS_09090 6533 4602 CDS product DUF1926 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250760.1 protein_id gnl|my_center|LOCUS_09090 7204 6584 gene locus_tag LOCUS_09100 7204 6584 CDS product SEC59/DGK1/VTE5 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250761.1 protein_id gnl|my_center|LOCUS_09100 7871 7176 gene locus_tag LOCUS_09110 7871 7176 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250762.1 protein_id gnl|my_center|LOCUS_09110 7945 8193 gene locus_tag LOCUS_09120 7945 8193 CDS product DUF131 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250763.1 protein_id gnl|my_center|LOCUS_09120 8195 9367 gene locus_tag LOCUS_09130 8195 9367 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250764.1 protein_id gnl|my_center|LOCUS_09130 9401 10552 gene locus_tag LOCUS_09140 gene mfnA 9401 10552 CDS product tyrosine decarboxylase MfnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250765.1 protein_id gnl|my_center|LOCUS_09140 11402 10542 gene locus_tag LOCUS_09150 11402 10542 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250768.1 protein_id gnl|my_center|LOCUS_09150 11748 11963 gene locus_tag LOCUS_09160 11748 11963 CDS product ribbon-helix-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146889.1 protein_id gnl|my_center|LOCUS_09160 11999 13138 gene locus_tag LOCUS_09170 gene sat 11999 13138 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868287.1 protein_id gnl|my_center|LOCUS_09170 >Feature sequence040 <1 635 gene locus_tag LOCUS_09180 <1 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250846.1:S-methyl-5'-thioadenosine phosphorylase 727 2001 gene locus_tag LOCUS_09190 727 2001 CDS product amidohydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250842.1 protein_id gnl|my_center|LOCUS_09190 1988 2971 gene locus_tag LOCUS_09200 1988 2971 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867770.1 protein_id gnl|my_center|LOCUS_09200 2964 3506 gene locus_tag LOCUS_09210 2964 3506 CDS product [protein ADP-ribosylglutamate] hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250841.1 protein_id gnl|my_center|LOCUS_09210 3511 3882 gene locus_tag LOCUS_09220 3511 3882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09220 3930 5372 gene locus_tag LOCUS_09230 3930 5372 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250837.1 protein_id gnl|my_center|LOCUS_09230 5926 5369 gene locus_tag LOCUS_09240 5926 5369 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250834.1 protein_id gnl|my_center|LOCUS_09240 6233 5928 gene locus_tag LOCUS_09250 6233 5928 CDS product DUF211 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250833.1 protein_id gnl|my_center|LOCUS_09250 6814 6239 gene locus_tag LOCUS_09260 6814 6239 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250832.1 protein_id gnl|my_center|LOCUS_09260 6991 8400 gene locus_tag LOCUS_09270 6991 8400 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250831.1 protein_id gnl|my_center|LOCUS_09270 9164 8397 gene locus_tag LOCUS_09280 9164 8397 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250829.1 protein_id gnl|my_center|LOCUS_09280 10006 9161 gene locus_tag LOCUS_09290 10006 9161 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250827.1 protein_id gnl|my_center|LOCUS_09290 10150 11295 gene locus_tag LOCUS_09300 10150 11295 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250825.1 protein_id gnl|my_center|LOCUS_09300 12236 11292 gene locus_tag LOCUS_09310 12236 11292 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09310 12336 13013 gene locus_tag LOCUS_09320 12336 13013 CDS product fumarylacetoacetate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250823.1 protein_id gnl|my_center|LOCUS_09320 13402 13010 gene locus_tag LOCUS_09330 13402 13010 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250822.1 protein_id gnl|my_center|LOCUS_09330 >Feature sequence041 1221 544 gene locus_tag LOCUS_09340 1221 544 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249096.1 protein_id gnl|my_center|LOCUS_09340 1387 2763 gene locus_tag LOCUS_09350 1387 2763 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249094.1 protein_id gnl|my_center|LOCUS_09350 2756 2923 gene locus_tag LOCUS_09360 2756 2923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 2910 3371 gene locus_tag LOCUS_09370 2910 3371 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249092.1 protein_id gnl|my_center|LOCUS_09370 3372 5315 gene locus_tag LOCUS_09380 gene iorA 3372 5315 CDS product indolepyruvate ferredoxin oxidoreductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868411.1 protein_id gnl|my_center|LOCUS_09380 5317 5925 gene locus_tag LOCUS_09390 5317 5925 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249090.1 protein_id gnl|my_center|LOCUS_09390 6006 7652 gene locus_tag LOCUS_09400 6006 7652 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09400 7642 9381 gene locus_tag LOCUS_09410 7642 9381 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09410 9444 10550 gene locus_tag LOCUS_09420 9444 10550 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868419.1 protein_id gnl|my_center|LOCUS_09420 11553 10552 gene locus_tag LOCUS_09430 11553 10552 CDS product histone deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249089.1 protein_id gnl|my_center|LOCUS_09430 12131 11559 gene locus_tag LOCUS_09440 12131 11559 CDS product TATA-box-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249087.1 protein_id gnl|my_center|LOCUS_09440 <13532 12234 gene locus_tag LOCUS_09450 <13532 12234 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_042691877.1:DUF505 family protein >Feature sequence042 1216 257 gene locus_tag LOCUS_09460 1216 257 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250752.1 protein_id gnl|my_center|LOCUS_09460 2771 1227 gene locus_tag LOCUS_09470 2771 1227 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250753.1 protein_id gnl|my_center|LOCUS_09470 3822 2782 gene locus_tag LOCUS_09480 3822 2782 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250754.1 protein_id gnl|my_center|LOCUS_09480 6492 3988 gene locus_tag LOCUS_09490 6492 3988 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250755.1 protein_id gnl|my_center|LOCUS_09490 6832 8055 gene locus_tag LOCUS_09500 6832 8055 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250756.1 protein_id gnl|my_center|LOCUS_09500 8039 8740 gene locus_tag LOCUS_09510 8039 8740 CDS product dihydroorotate dehydrogenase electron transfer subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250757.1 protein_id gnl|my_center|LOCUS_09510 8788 9693 gene locus_tag LOCUS_09520 8788 9693 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868873.1 protein_id gnl|my_center|LOCUS_09520 9734 10732 gene locus_tag LOCUS_09530 9734 10732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 10725 12041 gene locus_tag LOCUS_09540 10725 12041 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250811.1 protein_id gnl|my_center|LOCUS_09540 12054 12719 gene locus_tag LOCUS_09550 12054 12719 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598714.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence043 383 1579 gene locus_tag LOCUS_09560 gene csm5 383 1579 CDS product type III-A CRISPR-associated RAMP protein Csm5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021931.1 protein_id gnl|my_center|LOCUS_09560 1576 2868 gene locus_tag LOCUS_09570 gene csx1 1576 2868 CDS product CRISPR-associated CARF protein Csx1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010871190.1 protein_id gnl|my_center|LOCUS_09570 2869 4185 gene locus_tag LOCUS_09580 2869 4185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09580 4182 5165 gene locus_tag LOCUS_09590 gene cas7i 4182 5165 CDS product type I-B CRISPR-associated protein Cas7/Cst2/DevR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011023574.1 protein_id gnl|my_center|LOCUS_09590 5167 5850 gene locus_tag LOCUS_09600 5167 5850 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09600 6353 7388 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgtaggacagaattgtgtggaaag 7421 8374 gene locus_tag LOCUS_09610 gene cas1b 7421 8374 CDS product type I-B CRISPR-associated endonuclease Cas1b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879922.1 protein_id gnl|my_center|LOCUS_09610 8374 8631 gene locus_tag LOCUS_09620 gene cas2 8374 8631 CDS product CRISPR-associated endonuclease Cas2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249400.1 protein_id gnl|my_center|LOCUS_09620 8631 9119 gene locus_tag LOCUS_09630 gene cas4 8631 9119 CDS product CRISPR-associated protein Cas4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930592.1 protein_id gnl|my_center|LOCUS_09630 9123 11186 gene locus_tag LOCUS_09640 9123 11186 CDS product CRISPR-associated helicase/endonuclease Cas3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880192.1 protein_id gnl|my_center|LOCUS_09640 11685 12605 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq gtttccgtagaacagtattgtgtggaaag <13166 12619 gene locus_tag LOCUS_09650 <13166 12619 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249145.1:GMP synthase subunit A >Feature sequence044 42 452 gene locus_tag LOCUS_09660 42 452 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249992.1 protein_id gnl|my_center|LOCUS_09660 449 1732 gene locus_tag LOCUS_09670 449 1732 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053702.1 protein_id gnl|my_center|LOCUS_09670 1738 2400 gene locus_tag LOCUS_09680 1738 2400 CDS product DUF4097 family beta strand repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048149073.1 protein_id gnl|my_center|LOCUS_09680 2470 3714 gene locus_tag LOCUS_09690 2470 3714 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249995.1 protein_id gnl|my_center|LOCUS_09690 3778 4146 gene locus_tag LOCUS_09700 3778 4146 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877438.1 protein_id gnl|my_center|LOCUS_09700 4174 4539 gene locus_tag LOCUS_09710 4174 4539 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09710 5047 4523 gene locus_tag LOCUS_09720 5047 4523 CDS product cob(I)yrinic acid a,c-diamide adenosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249996.1 protein_id gnl|my_center|LOCUS_09720 5137 7239 gene locus_tag LOCUS_09730 5137 7239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09730 8080 7253 gene locus_tag LOCUS_09740 8080 7253 CDS product translation initiation factor IF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249998.1 protein_id gnl|my_center|LOCUS_09740 8788 8090 gene locus_tag LOCUS_09750 8788 8090 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249999.1 protein_id gnl|my_center|LOCUS_09750 9053 11251 gene locus_tag LOCUS_09760 9053 11251 CDS product elongation factor EF-2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249264.1 protein_id gnl|my_center|LOCUS_09760 11520 12806 gene locus_tag LOCUS_09770 gene tuf 11520 12806 CDS product translation elongation factor EF-1 subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249263.1 protein_id gnl|my_center|LOCUS_09770 >Feature sequence045 155 1117 gene locus_tag LOCUS_09780 155 1117 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867172.1 protein_id gnl|my_center|LOCUS_09780 1165 2217 gene locus_tag LOCUS_09790 1165 2217 CDS product SPOUT family RNA methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250208.1 protein_id gnl|my_center|LOCUS_09790 2984 2286 gene locus_tag LOCUS_09800 2984 2286 CDS product DUF92 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209477179.1 protein_id gnl|my_center|LOCUS_09800 3521 3072 gene locus_tag LOCUS_09810 3521 3072 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053714.1 protein_id gnl|my_center|LOCUS_09810 3996 3685 gene locus_tag LOCUS_09820 3996 3685 CDS product MazG nucleotide pyrophosphohydrolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250211.1 protein_id gnl|my_center|LOCUS_09820 4372 3989 gene locus_tag LOCUS_09830 4372 3989 CDS product metalloregulator ArsR/SmtB family transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250212.1 protein_id gnl|my_center|LOCUS_09830 4798 4430 gene locus_tag LOCUS_09840 4798 4430 CDS product Mov34/MPN/PAD-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250213.1 protein_id gnl|my_center|LOCUS_09840 5208 4822 gene locus_tag LOCUS_09850 5208 4822 CDS product RidA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868364.1 protein_id gnl|my_center|LOCUS_09850 6063 5272 gene locus_tag LOCUS_09860 6063 5272 CDS product DUF2666 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250214.1 protein_id gnl|my_center|LOCUS_09860 6159 8081 gene locus_tag LOCUS_09870 gene lonB 6159 8081 CDS product ATP-dependent protease LonB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250215.1 protein_id gnl|my_center|LOCUS_09870 8198 8938 gene locus_tag LOCUS_09880 gene sufC 8198 8938 CDS product Fe-S cluster assembly ATPase SufC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249682.1 protein_id gnl|my_center|LOCUS_09880 8935 10275 gene locus_tag LOCUS_09890 8935 10275 CDS product SufD family Fe-S cluster assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249681.1 protein_id gnl|my_center|LOCUS_09890 10921 10259 gene locus_tag LOCUS_09900 10921 10259 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867428.1 protein_id gnl|my_center|LOCUS_09900 11394 10963 gene locus_tag LOCUS_09910 11394 10963 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249332.1 protein_id gnl|my_center|LOCUS_09910 12287 11559 gene locus_tag LOCUS_09920 gene serK 12287 11559 CDS product L-serine kinase SerK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249333.1 protein_id gnl|my_center|LOCUS_09920 >Feature sequence046 555 1553 gene locus_tag LOCUS_09930 555 1553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09930 1557 2564 gene locus_tag LOCUS_09940 1557 2564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 3399 2605 gene locus_tag LOCUS_09950 gene trmBL2 3399 2605 CDS product HTH-type transcriptional regulator TrmBL2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249426.1 protein_id gnl|my_center|LOCUS_09950 7369 3695 gene locus_tag LOCUS_09960 gene rgy 7369 3695 CDS product reverse gyrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868381.1 protein_id gnl|my_center|LOCUS_09960 7909 7409 gene locus_tag LOCUS_09970 7909 7409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053664.1 protein_id gnl|my_center|LOCUS_09970 8001 8237 gene locus_tag LOCUS_09980 8001 8237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053807.1 protein_id gnl|my_center|LOCUS_09980 9487 8234 gene locus_tag LOCUS_09990 9487 8234 CDS product biotin--protein ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053663.1 protein_id gnl|my_center|LOCUS_09990 9629 10327 gene locus_tag LOCUS_10000 9629 10327 CDS product acetate--CoA ligase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249420.1 protein_id gnl|my_center|LOCUS_10000 10487 10413 gene locus_tag LOCUS_t00230 10487 10413 tRNA product tRNA-Cys inference COORDINATES:profile:Aragorn:1.2.38 10593 10508 gene locus_tag LOCUS_t00240 10593 10508 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 10678 11853 gene locus_tag LOCUS_10010 10678 11853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 11049 11148 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence047 1550 891 gene locus_tag LOCUS_10020 1550 891 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249387.1 protein_id gnl|my_center|LOCUS_10020 2835 1555 gene locus_tag LOCUS_10030 gene thiC 2835 1555 CDS product phosphomethylpyrimidine synthase ThiC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249388.1 protein_id gnl|my_center|LOCUS_10030 2930 3682 gene locus_tag LOCUS_10040 2930 3682 CDS product sulfide-dependent adenosine diphosphate thiazole synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249389.1 protein_id gnl|my_center|LOCUS_10040 3688 4797 gene locus_tag LOCUS_10050 gene thiD 3688 4797 CDS product bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249390.1 protein_id gnl|my_center|LOCUS_10050 4794 4991 gene locus_tag LOCUS_10060 4794 4991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10060 5031 8150 gene locus_tag LOCUS_10070 5031 8150 CDS product Eco57I restriction-modification methylase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_158298054.1 note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10070 8258 8079 gene locus_tag LOCUS_10080 8258 8079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 8391 8846 gene locus_tag LOCUS_10090 8391 8846 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_10090 8890 10815 gene locus_tag LOCUS_10100 8890 10815 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249391.1 protein_id gnl|my_center|LOCUS_10100 11360 10755 gene locus_tag LOCUS_10110 11360 10755 CDS product CPBP-Thermo-1 family intramembane metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249394.1 protein_id gnl|my_center|LOCUS_10110 12266 11364 gene locus_tag LOCUS_10120 12266 11364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249395.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence048 321 2645 gene locus_tag LOCUS_10130 321 2645 CDS product DNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868838.1 protein_id gnl|my_center|LOCUS_10130 3360 2662 gene locus_tag LOCUS_10140 3360 2662 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249065.1 protein_id gnl|my_center|LOCUS_10140 4423 3401 gene locus_tag LOCUS_10150 4423 3401 CDS product DUF3226 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249064.1 protein_id gnl|my_center|LOCUS_10150 4918 4424 gene locus_tag LOCUS_10160 4918 4424 CDS product DUF2391 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209474425.1 protein_id gnl|my_center|LOCUS_10160 5039 7264 gene locus_tag LOCUS_10170 5039 7264 CDS product DHH family phosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249110.1 protein_id gnl|my_center|LOCUS_10170 7314 7568 gene locus_tag LOCUS_10180 7314 7568 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250609.1 protein_id gnl|my_center|LOCUS_10180 7617 7829 gene locus_tag LOCUS_10190 7617 7829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250608.1 protein_id gnl|my_center|LOCUS_10190 8799 7813 gene locus_tag LOCUS_10200 8799 7813 CDS product asparaginase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250607.1 protein_id gnl|my_center|LOCUS_10200 10059 8887 gene locus_tag LOCUS_10210 10059 8887 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250606.1 protein_id gnl|my_center|LOCUS_10210 10456 10073 gene locus_tag LOCUS_10220 10456 10073 CDS product PaaI family thioesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868197.1 protein_id gnl|my_center|LOCUS_10220 10502 10906 gene locus_tag LOCUS_10230 10502 10906 CDS product DUF2240 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053860.1 protein_id gnl|my_center|LOCUS_10230 10951 11487 gene locus_tag LOCUS_10240 10951 11487 CDS product nicotinamidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250601.1 protein_id gnl|my_center|LOCUS_10240 <12346 11423 gene locus_tag LOCUS_10250 <12346 11423 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250600.1:AI-2E family transporter >Feature sequence049 2313 385 gene locus_tag LOCUS_10260 2313 385 CDS product CARDB domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868603.1 protein_id gnl|my_center|LOCUS_10260 4040 2313 gene locus_tag LOCUS_10270 gene flaJ 4040 2313 CDS product archaellar assembly protein FlaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249004.1 protein_id gnl|my_center|LOCUS_10270 5691 4051 gene locus_tag LOCUS_10280 5691 4051 CDS product type II/IV secretion system ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249003.1 protein_id gnl|my_center|LOCUS_10280 6391 5693 gene locus_tag LOCUS_10290 6391 5693 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249002.1 protein_id gnl|my_center|LOCUS_10290 6919 6431 gene locus_tag LOCUS_10300 6919 6431 CDS product flagellar protein G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249001.1 protein_id gnl|my_center|LOCUS_10300 7437 6919 gene locus_tag LOCUS_10310 7437 6919 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249000.1 protein_id gnl|my_center|LOCUS_10310 8873 7458 gene locus_tag LOCUS_10320 8873 7458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10320 9353 8877 gene locus_tag LOCUS_10330 9353 8877 CDS product flagella accessory protein C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248998.1 protein_id gnl|my_center|LOCUS_10330 10157 9366 gene locus_tag LOCUS_10340 gene flaB5 10157 9366 CDS product flagellin B5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248997.1 protein_id gnl|my_center|LOCUS_10340 10835 10170 gene locus_tag LOCUS_10350 10835 10170 CDS product flagellin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868612.1 protein_id gnl|my_center|LOCUS_10350 11857 10883 gene locus_tag LOCUS_10360 11857 10883 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10360 >Feature sequence050 1991 594 gene locus_tag LOCUS_10370 1991 594 CDS product mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250060.1 protein_id gnl|my_center|LOCUS_10370 2731 1988 gene locus_tag LOCUS_10380 gene mpgP 2731 1988 CDS product mannosyl-3-phosphoglycerate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868346.1 protein_id gnl|my_center|LOCUS_10380 3909 2734 gene locus_tag LOCUS_10390 gene mpgS 3909 2734 CDS product mannosyl-3-phosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868345.1 protein_id gnl|my_center|LOCUS_10390 5332 3968 gene locus_tag LOCUS_10400 5332 3968 CDS product ADP-specific glucokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250061.1 protein_id gnl|my_center|LOCUS_10400 5944 5381 gene locus_tag LOCUS_10410 gene pgiA 5944 5381 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250062.1 protein_id gnl|my_center|LOCUS_10410 6194 6012 gene locus_tag LOCUS_10420 6194 6012 CDS product KH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250063.1 protein_id gnl|my_center|LOCUS_10420 6891 6223 gene locus_tag LOCUS_10430 6891 6223 CDS product TraB/GumN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250064.1 protein_id gnl|my_center|LOCUS_10430 7796 6888 gene locus_tag LOCUS_10440 7796 6888 CDS product ribonuclease Z inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250065.1 protein_id gnl|my_center|LOCUS_10440 7914 8873 gene locus_tag LOCUS_10450 7914 8873 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053704.1 protein_id gnl|my_center|LOCUS_10450 9610 8870 gene locus_tag LOCUS_10460 9610 8870 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250970.1 protein_id gnl|my_center|LOCUS_10460 10647 9607 gene locus_tag LOCUS_10470 10647 9607 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250969.1 protein_id gnl|my_center|LOCUS_10470 11816 10647 gene locus_tag LOCUS_10480 11816 10647 CDS product iron ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250968.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence051 350 700 gene locus_tag LOCUS_10490 350 700 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10490 703 1227 gene locus_tag LOCUS_10500 703 1227 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249601.1 protein_id gnl|my_center|LOCUS_10500 1715 1272 gene locus_tag LOCUS_10510 1715 1272 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10510 2067 1765 gene locus_tag LOCUS_10520 2067 1765 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250011.1 protein_id gnl|my_center|LOCUS_10520 2658 2107 gene locus_tag LOCUS_10530 gene dps 2658 2107 CDS product DNA protection during starvation protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250010.1 protein_id gnl|my_center|LOCUS_10530 2781 3140 gene locus_tag LOCUS_10540 2781 3140 CDS product transcriptional repressor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879721.1 protein_id gnl|my_center|LOCUS_10540 3527 3174 gene locus_tag LOCUS_10550 3527 3174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10550 4173 3532 gene locus_tag LOCUS_10560 4173 3532 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10560 4328 5587 gene locus_tag LOCUS_10570 4328 5587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10570 5627 5917 gene locus_tag LOCUS_10580 5627 5917 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10580 5914 6195 gene locus_tag LOCUS_10590 5914 6195 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10590 6200 6784 gene locus_tag LOCUS_10600 6200 6784 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 6789 7118 gene locus_tag LOCUS_10610 6789 7118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10610 7598 7122 gene locus_tag LOCUS_10620 7598 7122 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250007.1 protein_id gnl|my_center|LOCUS_10620 7653 8183 gene locus_tag LOCUS_10630 7653 8183 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250005.1 protein_id gnl|my_center|LOCUS_10630 8449 9327 gene locus_tag LOCUS_10640 8449 9327 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053641.1 protein_id gnl|my_center|LOCUS_10640 9324 9941 gene locus_tag LOCUS_10650 gene hisG 9324 9941 CDS product ATP phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249198.1 protein_id gnl|my_center|LOCUS_10650 9931 11064 gene locus_tag LOCUS_10660 gene hisD 9931 11064 CDS product histidinol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249199.1 protein_id gnl|my_center|LOCUS_10660 11061 11603 gene locus_tag LOCUS_10670 gene hisB 11061 11603 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249200.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence052 1106 2554 gene locus_tag LOCUS_10680 gene proS 1106 2554 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249505.1 protein_id gnl|my_center|LOCUS_10680 2605 4242 gene locus_tag LOCUS_10690 2605 4242 CDS product carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249504.1 protein_id gnl|my_center|LOCUS_10690 4403 4239 gene locus_tag LOCUS_10700 4403 4239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10700 4642 4391 gene locus_tag LOCUS_10710 4642 4391 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_10710 4911 4639 gene locus_tag LOCUS_10720 4911 4639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10720 6492 5284 gene locus_tag LOCUS_10730 gene coaBC 6492 5284 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249472.1 protein_id gnl|my_center|LOCUS_10730 7059 6541 gene locus_tag LOCUS_10740 7059 6541 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249471.1 protein_id gnl|my_center|LOCUS_10740 7526 7146 gene locus_tag LOCUS_10750 7526 7146 CDS product DUF190 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249470.1 protein_id gnl|my_center|LOCUS_10750 7903 7532 gene locus_tag LOCUS_10760 gene crcB 7903 7532 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249469.1 protein_id gnl|my_center|LOCUS_10760 8418 7984 gene locus_tag LOCUS_10770 8418 7984 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867860.1 protein_id gnl|my_center|LOCUS_10770 8720 8415 gene locus_tag LOCUS_10780 8720 8415 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10780 9376 8699 gene locus_tag LOCUS_10790 9376 8699 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10790 10242 9373 gene locus_tag LOCUS_10800 10242 9373 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249468.1 protein_id gnl|my_center|LOCUS_10800 10421 11128 gene locus_tag LOCUS_10810 10421 11128 CDS product archaemetzincin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249467.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence053 814 218 gene locus_tag LOCUS_10820 814 218 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 1262 1017 gene locus_tag LOCUS_10830 1262 1017 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10830 2643 1294 gene locus_tag LOCUS_10840 2643 1294 CDS product cyclic 2,3-diphosphoglycerate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251150.1 protein_id gnl|my_center|LOCUS_10840 2967 2725 gene locus_tag LOCUS_10850 2967 2725 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10850 2851 3309 gene locus_tag LOCUS_10860 2851 3309 CDS product alanyl-tRNA editing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147325.1 protein_id gnl|my_center|LOCUS_10860 4099 3311 gene locus_tag LOCUS_10870 4099 3311 CDS product extradiol dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251153.1 protein_id gnl|my_center|LOCUS_10870 5247 4105 gene locus_tag LOCUS_10880 gene thrC 5247 4105 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251155.1 protein_id gnl|my_center|LOCUS_10880 6337 5237 gene locus_tag LOCUS_10890 6337 5237 CDS product DUF4157 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251156.1 protein_id gnl|my_center|LOCUS_10890 6976 6383 gene locus_tag LOCUS_10900 gene psmB 6976 6383 CDS product archaeal proteasome endopeptidase complex subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251157.1 protein_id gnl|my_center|LOCUS_10900 7733 7011 gene locus_tag LOCUS_10910 7733 7011 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251158.1 protein_id gnl|my_center|LOCUS_10910 8739 7726 gene locus_tag LOCUS_10920 8739 7726 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251159.1 protein_id gnl|my_center|LOCUS_10920 10107 8776 gene locus_tag LOCUS_10930 gene nurA 10107 8776 CDS product DNA double-strand break repair nuclease NurA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251160.1 protein_id gnl|my_center|LOCUS_10930 <11102 10110 gene locus_tag LOCUS_10940 <11102 10110 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251161.1:DNA double-strand break repair ATPase Rad50 >Feature sequence054 2037 1069 gene locus_tag LOCUS_10950 2037 1069 CDS product ribose 1,5-bisphosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249140.1 protein_id gnl|my_center|LOCUS_10950 2300 3556 gene locus_tag LOCUS_10960 2300 3556 CDS product PLP-dependent aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249141.1 protein_id gnl|my_center|LOCUS_10960 3602 4441 gene locus_tag LOCUS_10970 3602 4441 CDS product gamma-glutamyl-gamma-aminobutyrate hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249142.1 protein_id gnl|my_center|LOCUS_10970 5210 4371 gene locus_tag LOCUS_10980 5210 4371 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249143.1 protein_id gnl|my_center|LOCUS_10980 5267 5677 gene locus_tag LOCUS_10990 5267 5677 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249144.1 protein_id gnl|my_center|LOCUS_10990 5867 6580 gene locus_tag LOCUS_11000 gene cas6 5867 6580 CDS product CRISPR-associated endoribonuclease Cas6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870746.1 protein_id gnl|my_center|LOCUS_11000 6585 8936 gene locus_tag LOCUS_11010 gene cas10 6585 8936 CDS product type III-A CRISPR-associated protein Cas10/Csm1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004082358.1 protein_id gnl|my_center|LOCUS_11010 8941 9516 gene locus_tag LOCUS_11020 8941 9516 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11020 9513 10388 gene locus_tag LOCUS_11030 gene csm3 9513 10388 CDS product type III-A CRISPR-associated RAMP protein Csm3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545354.1 protein_id gnl|my_center|LOCUS_11030 >Feature sequence055 2471 2614 gene locus_tag LOCUS_11040 2471 2614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 2647 2841 gene locus_tag LOCUS_11050 2647 2841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11050 2854 3045 gene locus_tag LOCUS_11060 2854 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_11060 3454 3080 gene locus_tag LOCUS_11070 3454 3080 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250697.1 protein_id gnl|my_center|LOCUS_11070 4331 3504 gene locus_tag LOCUS_11080 4331 3504 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250696.1 protein_id gnl|my_center|LOCUS_11080 4670 4362 gene locus_tag LOCUS_11090 4670 4362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250695.1 protein_id gnl|my_center|LOCUS_11090 4774 6504 gene locus_tag LOCUS_11100 4774 6504 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250694.1 protein_id gnl|my_center|LOCUS_11100 6547 6765 gene locus_tag LOCUS_11110 6547 6765 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11110 8052 6688 gene locus_tag LOCUS_11120 gene cca 8052 6688 CDS product CCA tRNA nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250692.1 protein_id gnl|my_center|LOCUS_11120 8612 8058 gene locus_tag LOCUS_11130 gene thpR 8612 8058 CDS product RNA 2',3'-cyclic phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250689.1 protein_id gnl|my_center|LOCUS_11130 10040 8673 gene locus_tag LOCUS_11140 10040 8673 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209476694.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence056 <1 2283 gene locus_tag LOCUS_11150 <1 2283 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867684.1:RtcB family protein 2316 2783 gene locus_tag LOCUS_11160 gene moaC 2316 2783 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249309.1 protein_id gnl|my_center|LOCUS_11160 2833 3345 gene locus_tag LOCUS_11170 2833 3345 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249308.1 protein_id gnl|my_center|LOCUS_11170 4862 3351 gene locus_tag LOCUS_11180 4862 3351 CDS product AMP phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249307.1 protein_id gnl|my_center|LOCUS_11180 5223 4975 gene locus_tag LOCUS_11190 5223 4975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 5560 5312 gene locus_tag LOCUS_11200 5560 5312 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249305.1 protein_id gnl|my_center|LOCUS_11200 6339 5560 gene locus_tag LOCUS_11210 gene minD 6339 5560 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249304.1 protein_id gnl|my_center|LOCUS_11210 7283 6474 gene locus_tag LOCUS_11220 7283 6474 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867773.1 protein_id gnl|my_center|LOCUS_11220 8617 7283 gene locus_tag LOCUS_11230 8617 7283 CDS product nodulation protein NfeD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598734.1 protein_id gnl|my_center|LOCUS_11230 8696 9031 gene locus_tag LOCUS_11240 8696 9031 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249301.1 protein_id gnl|my_center|LOCUS_11240 8992 9834 gene locus_tag LOCUS_11250 8992 9834 CDS product DNA-3-methyladenine glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249300.1 protein_id gnl|my_center|LOCUS_11250 >Feature sequence057 180 314 gene locus_tag LOCUS_11260 180 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11260 820 359 gene locus_tag LOCUS_11270 820 359 CDS product DUF1931 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249701.1 protein_id gnl|my_center|LOCUS_11270 907 1524 gene locus_tag LOCUS_11280 907 1524 CDS product molybdopterin-guanine dinucleotide biosynthesis protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249700.1 protein_id gnl|my_center|LOCUS_11280 2038 1499 gene locus_tag LOCUS_11290 2038 1499 CDS product biotin transporter BioY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249699.1 protein_id gnl|my_center|LOCUS_11290 2070 2867 gene locus_tag LOCUS_11300 2070 2867 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249697.1 protein_id gnl|my_center|LOCUS_11300 2845 3609 gene locus_tag LOCUS_11310 2845 3609 CDS product energy-coupling factor transporter transmembrane component T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249696.1 protein_id gnl|my_center|LOCUS_11310 4231 3593 gene locus_tag LOCUS_11320 4231 3593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249695.1 protein_id gnl|my_center|LOCUS_11320 4680 4270 gene locus_tag LOCUS_11330 4680 4270 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250041.1 protein_id gnl|my_center|LOCUS_11330 5145 4909 gene locus_tag LOCUS_11340 5145 4909 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11340 8057 5436 gene locus_tag LOCUS_11350 8057 5436 CDS product DUF5814 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249521.1 protein_id gnl|my_center|LOCUS_11350 8570 8094 gene locus_tag LOCUS_11360 8570 8094 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249522.1 protein_id gnl|my_center|LOCUS_11360 <9716 8599 gene locus_tag LOCUS_11370 <9716 8599 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249523.1:tyrosine--tRNA ligase >Feature sequence058 3649 278 gene locus_tag LOCUS_11380 3649 278 CDS product DNA-directed RNA polymerase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250034.1 protein_id gnl|my_center|LOCUS_11380 3916 3668 gene locus_tag LOCUS_11390 3916 3668 CDS product DNA-directed RNA polymerase subunit H inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250035.1 protein_id gnl|my_center|LOCUS_11390 4829 4149 gene locus_tag LOCUS_11400 4829 4149 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250036.1 protein_id gnl|my_center|LOCUS_11400 4962 5657 gene locus_tag LOCUS_11410 gene surR 4962 5657 CDS product transcriptional regulator SurR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250037.1 protein_id gnl|my_center|LOCUS_11410 5641 5844 gene locus_tag LOCUS_11420 5641 5844 CDS product 4Fe-4S binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250038.1 protein_id gnl|my_center|LOCUS_11420 5841 7028 gene locus_tag LOCUS_11430 5841 7028 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250039.1 protein_id gnl|my_center|LOCUS_11430 7812 7012 gene locus_tag LOCUS_11440 7812 7012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250040.1 protein_id gnl|my_center|LOCUS_11440 <9531 7843 gene locus_tag LOCUS_11450 <9531 7843 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868544.1:DNA topoisomerase I >Feature sequence059 150 1496 gene locus_tag LOCUS_11460 150 1496 CDS product glycogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250719.1 protein_id gnl|my_center|LOCUS_11460 1861 1493 gene locus_tag LOCUS_11470 1861 1493 CDS product ribonuclease P protein component 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250718.1 protein_id gnl|my_center|LOCUS_11470 1928 3013 gene locus_tag LOCUS_11480 1928 3013 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250717.1 protein_id gnl|my_center|LOCUS_11480 3076 3852 gene locus_tag LOCUS_11490 3076 3852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147278.1 protein_id gnl|my_center|LOCUS_11490 4910 3858 gene locus_tag LOCUS_11500 4910 3858 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867186.1 protein_id gnl|my_center|LOCUS_11500 5005 5235 gene locus_tag LOCUS_11510 5005 5235 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250703.1 protein_id gnl|my_center|LOCUS_11510 5205 5576 gene locus_tag LOCUS_11520 5205 5576 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867525.1 protein_id gnl|my_center|LOCUS_11520 6128 6583 gene locus_tag LOCUS_11530 6128 6583 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11530 6785 7723 gene locus_tag LOCUS_11540 6785 7723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11540 7776 8021 gene locus_tag LOCUS_11550 7776 8021 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11550 8069 8374 gene locus_tag LOCUS_11560 8069 8374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11560 <9413 8394 gene locus_tag LOCUS_11570 <9413 8394 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250699.1:isoleucine--tRNA ligase >Feature sequence060 1575 709 gene locus_tag LOCUS_11580 1575 709 CDS product lysylphosphatidylglycerol synthase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249101.1 protein_id gnl|my_center|LOCUS_11580 2423 1581 gene locus_tag LOCUS_11590 gene speE 2423 1581 CDS product polyamine aminopropyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249102.1 protein_id gnl|my_center|LOCUS_11590 2517 2990 gene locus_tag LOCUS_11600 2517 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249103.1 protein_id gnl|my_center|LOCUS_11600 3457 2984 gene locus_tag LOCUS_11610 3457 2984 CDS product arginine decarboxylase, pyruvoyl-dependent inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249104.1 protein_id gnl|my_center|LOCUS_11610 4654 3530 gene locus_tag LOCUS_11620 4654 3530 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249578.1 protein_id gnl|my_center|LOCUS_11620 4766 5170 gene locus_tag LOCUS_11630 gene gcvH 4766 5170 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249105.1 protein_id gnl|my_center|LOCUS_11630 5218 5556 gene locus_tag LOCUS_11640 5218 5556 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146594.1 protein_id gnl|my_center|LOCUS_11640 7240 5792 gene locus_tag LOCUS_11650 gene gltA 7240 5792 CDS product NADPH-dependent glutamate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598693.1 protein_id gnl|my_center|LOCUS_11650 8102 7242 gene locus_tag LOCUS_11660 8102 7242 CDS product sulfide/dihydroorotate dehydrogenase-like FAD/NAD-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250277.1 protein_id gnl|my_center|LOCUS_11660 8279 8497 gene locus_tag LOCUS_11670 8279 8497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250278.1 protein_id gnl|my_center|LOCUS_11670 >Feature sequence061 188 1732 gene locus_tag LOCUS_11680 188 1732 CDS product proton-conducting transporter membrane subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251037.1 protein_id gnl|my_center|LOCUS_11680 1734 2081 gene locus_tag LOCUS_11690 1734 2081 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053770.1 protein_id gnl|my_center|LOCUS_11690 2088 2597 gene locus_tag LOCUS_11700 2088 2597 CDS product NADH-quinone oxidoreductase subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251039.1 protein_id gnl|my_center|LOCUS_11700 2594 2800 gene locus_tag LOCUS_11710 2594 2800 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11710 2804 3370 gene locus_tag LOCUS_11720 2804 3370 CDS product NADH-quinone oxidoreductase subunit C inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251040.1 protein_id gnl|my_center|LOCUS_11720 3367 4644 gene locus_tag LOCUS_11730 3367 4644 CDS product nickel-dependent hydrogenase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251041.1 protein_id gnl|my_center|LOCUS_11730 4650 5642 gene locus_tag LOCUS_11740 4650 5642 CDS product respiratory chain complex I subunit 1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053771.1 protein_id gnl|my_center|LOCUS_11740 5639 6070 gene locus_tag LOCUS_11750 5639 6070 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251043.1 protein_id gnl|my_center|LOCUS_11750 6259 6062 gene locus_tag LOCUS_11760 6259 6062 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11760 7091 6603 gene locus_tag LOCUS_11770 7091 6603 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251045.1 protein_id gnl|my_center|LOCUS_11770 7572 7093 gene locus_tag LOCUS_11780 7572 7093 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053772.1 protein_id gnl|my_center|LOCUS_11780 8103 7621 gene locus_tag LOCUS_11790 8103 7621 CDS product THUMP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251047.1 protein_id gnl|my_center|LOCUS_11790 >Feature sequence062 532 936 gene locus_tag LOCUS_11800 532 936 CDS product DUF61 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250746.1 protein_id gnl|my_center|LOCUS_11800 942 1220 gene locus_tag LOCUS_11810 942 1220 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 1261 2862 gene locus_tag LOCUS_11820 1261 2862 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598712.1 protein_id gnl|my_center|LOCUS_11820 4069 3224 gene locus_tag LOCUS_11830 4069 3224 CDS product EamA family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250743.1 protein_id gnl|my_center|LOCUS_11830 5100 4066 gene locus_tag LOCUS_11840 gene priS 5100 4066 CDS product DNA primase catalytic subunit PriS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250742.1 protein_id gnl|my_center|LOCUS_11840 6301 5093 gene locus_tag LOCUS_11850 gene priL 6301 5093 CDS product DNA primase large subunit PriL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250741.1 protein_id gnl|my_center|LOCUS_11850 6505 7257 gene locus_tag LOCUS_11860 6505 7257 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250740.1 protein_id gnl|my_center|LOCUS_11860 7299 8462 gene locus_tag LOCUS_11870 7299 8462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209475225.1 protein_id gnl|my_center|LOCUS_11870 >Feature sequence063 787 170 gene locus_tag LOCUS_11880 787 170 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250619.1 protein_id gnl|my_center|LOCUS_11880 1940 780 gene locus_tag LOCUS_11890 1940 780 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250620.1 protein_id gnl|my_center|LOCUS_11890 4172 1947 gene locus_tag LOCUS_11900 4172 1947 CDS product terpene cyclase/mutase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_083755810.1 protein_id gnl|my_center|LOCUS_11900 5235 4234 gene locus_tag LOCUS_11910 gene twy1 5235 4234 CDS product 4-demethylwyosine synthase TYW1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250622.1 protein_id gnl|my_center|LOCUS_11910 6051 5476 gene locus_tag LOCUS_11920 6051 5476 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250624.1 protein_id gnl|my_center|LOCUS_11920 6258 6088 gene locus_tag LOCUS_11930 6258 6088 CDS product 30S ribosomal protein S27ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250646.1 protein_id gnl|my_center|LOCUS_11930 6565 6269 gene locus_tag LOCUS_11940 6565 6269 CDS product 30S ribosomal protein S24e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250647.1 protein_id gnl|my_center|LOCUS_11940 7082 6555 gene locus_tag LOCUS_11950 7082 6555 CDS product GTP-dependent dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053746.1 protein_id gnl|my_center|LOCUS_11950 7287 7084 gene locus_tag LOCUS_11960 7287 7084 CDS product DNA-directed RNA polymerase subunit E'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250649.1 protein_id gnl|my_center|LOCUS_11960 7850 7290 gene locus_tag LOCUS_11970 7850 7290 CDS product DNA-directed RNA polymerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250650.1 protein_id gnl|my_center|LOCUS_11970 8422 7886 gene locus_tag LOCUS_11980 8422 7886 CDS product inorganic diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250651.1 protein_id gnl|my_center|LOCUS_11980 >Feature sequence064 <1 741 gene locus_tag LOCUS_11990 <1 741 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250852.1:ORC1-type DNA replication protein 741 2906 gene locus_tag LOCUS_12000 741 2906 CDS product DNA-directed DNA polymerase II small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250853.1 protein_id gnl|my_center|LOCUS_12000 2908 8205 gene locus_tag LOCUS_12010 2908 8205 CDS product DNA-directed DNA polymerase II large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250854.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence065 205 1227 gene locus_tag LOCUS_12020 205 1227 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251247.1 protein_id gnl|my_center|LOCUS_12020 1588 1313 gene locus_tag LOCUS_12030 1588 1313 CDS product elongation factor 1-beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249067.1 protein_id gnl|my_center|LOCUS_12030 1785 1606 gene locus_tag LOCUS_12040 1785 1606 CDS product zinc finger domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088862262.1 protein_id gnl|my_center|LOCUS_12040 2856 2769 gene locus_tag LOCUS_t00250 2856 2769 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 2959 3339 gene locus_tag LOCUS_12050 2959 3339 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12050 3357 3554 gene locus_tag LOCUS_12060 3357 3554 CDS product helix-turn-helix transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250290.1 protein_id gnl|my_center|LOCUS_12060 3556 3924 gene locus_tag LOCUS_12070 3556 3924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867753.1 protein_id gnl|my_center|LOCUS_12070 3911 4669 gene locus_tag LOCUS_12080 3911 4669 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250288.1 protein_id gnl|my_center|LOCUS_12080 4666 5943 gene locus_tag LOCUS_12090 4666 5943 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250287.1 protein_id gnl|my_center|LOCUS_12090 6374 5958 gene locus_tag LOCUS_12100 6374 5958 CDS product RNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250286.1 protein_id gnl|my_center|LOCUS_12100 6443 7255 gene locus_tag LOCUS_12110 6443 7255 CDS product ZIP family metal transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249603.1 protein_id gnl|my_center|LOCUS_12110 7793 7224 gene locus_tag LOCUS_12120 7793 7224 CDS product dephospho-CoA kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250285.1 protein_id gnl|my_center|LOCUS_12120 7898 8230 gene locus_tag LOCUS_12130 7898 8230 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250284.1 protein_id gnl|my_center|LOCUS_12130 >Feature sequence066 901 1566 gene locus_tag LOCUS_12140 901 1566 CDS product HAD hydrolase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249919.1 protein_id gnl|my_center|LOCUS_12140 1601 1867 gene locus_tag LOCUS_12150 1601 1867 CDS product 50S ribosomal protein L35ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053695.1 protein_id gnl|my_center|LOCUS_12150 1910 3040 gene locus_tag LOCUS_12160 1910 3040 CDS product tRNA (guanine(10)-N(2))-dimethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249921.1 protein_id gnl|my_center|LOCUS_12160 3021 4118 gene locus_tag LOCUS_12170 3021 4118 CDS product VIT1/CCC1 transporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249922.1 protein_id gnl|my_center|LOCUS_12170 5703 4336 gene locus_tag LOCUS_12180 5703 4336 CDS product MATE family efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249925.1 protein_id gnl|my_center|LOCUS_12180 6004 5813 gene locus_tag LOCUS_12190 6004 5813 CDS product 50S ribosomal protein L37e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249926.1 protein_id gnl|my_center|LOCUS_12190 6253 6023 gene locus_tag LOCUS_12200 6253 6023 CDS product LSm family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249927.1 protein_id gnl|my_center|LOCUS_12200 6503 7708 gene locus_tag LOCUS_12210 6503 7708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12210 >Feature sequence067 1799 429 gene locus_tag LOCUS_12220 1799 429 CDS product DUF2079 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011012764.1 protein_id gnl|my_center|LOCUS_12220 2154 1858 gene locus_tag LOCUS_12230 2154 1858 CDS product DUF2103 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251103.1 protein_id gnl|my_center|LOCUS_12230 3890 2184 gene locus_tag LOCUS_12240 gene arcS 3890 2184 CDS product archaeosine synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251106.1 protein_id gnl|my_center|LOCUS_12240 4801 3896 gene locus_tag LOCUS_12250 4801 3896 CDS product coiled-coil protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251107.1 protein_id gnl|my_center|LOCUS_12250 5778 4924 gene locus_tag LOCUS_12260 5778 4924 CDS product ATP-dependent Clp protease proteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867380.1 protein_id gnl|my_center|LOCUS_12260 6766 5825 gene locus_tag LOCUS_12270 gene arcC 6766 5825 CDS product carbamate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251108.1 protein_id gnl|my_center|LOCUS_12270 <8173 6907 gene locus_tag LOCUS_12280 <8173 6907 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251109.1:NAD(P)/FAD-dependent oxidoreductase >Feature sequence068 160 1176 gene locus_tag LOCUS_12290 160 1176 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251173.1 protein_id gnl|my_center|LOCUS_12290 2681 1188 gene locus_tag LOCUS_12300 2681 1188 CDS product replication factor C large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251169.1 protein_id gnl|my_center|LOCUS_12300 3679 2687 gene locus_tag LOCUS_12310 3679 2687 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12310 3728 4186 gene locus_tag LOCUS_12320 3728 4186 CDS product metal-dependent hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867284.1 protein_id gnl|my_center|LOCUS_12320 4242 5429 gene locus_tag LOCUS_12330 4242 5429 CDS product glycine C-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251167.1 protein_id gnl|my_center|LOCUS_12330 5694 6353 gene locus_tag LOCUS_12340 5694 6353 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048152716.1 protein_id gnl|my_center|LOCUS_12340 6357 6710 gene locus_tag LOCUS_12350 6357 6710 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12350 7206 7508 gene locus_tag LOCUS_12360 7206 7508 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12360 >Feature sequence069 34 1479 gene locus_tag LOCUS_12370 34 1479 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011763483.1 protein_id gnl|my_center|LOCUS_12370 1481 2377 gene locus_tag LOCUS_12380 gene ubiA 1481 2377 CDS product putative 4-hydroxybenzoate polyprenyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011762363.1 protein_id gnl|my_center|LOCUS_12380 2378 3343 gene locus_tag LOCUS_12390 2378 3343 CDS product NrtA/SsuA/CpmA family ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038967169.1 protein_id gnl|my_center|LOCUS_12390 3346 4077 gene locus_tag LOCUS_12400 3346 4077 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12400 4053 4694 gene locus_tag LOCUS_12410 4053 4694 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010964710.1 protein_id gnl|my_center|LOCUS_12410 4675 5358 gene locus_tag LOCUS_12420 gene ubiE 4675 5358 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000711694.1 protein_id gnl|my_center|LOCUS_12420 5932 5336 gene locus_tag LOCUS_12430 5932 5336 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004083064.1 protein_id gnl|my_center|LOCUS_12430 6717 5929 gene locus_tag LOCUS_12440 6717 5929 CDS product complex I NDUFA9 subunit family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880030.1 protein_id gnl|my_center|LOCUS_12440 7240 6719 gene locus_tag LOCUS_12450 7240 6719 CDS product ferritin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250949.1 protein_id gnl|my_center|LOCUS_12450 >Feature sequence070 1644 424 gene locus_tag LOCUS_12460 gene hmgA 1644 424 CDS product hydroxymethylglutaryl-CoA reductase (NADPH) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249865.1 protein_id gnl|my_center|LOCUS_12460 2404 1661 gene locus_tag LOCUS_12470 2404 1661 CDS product MinD/ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249866.1 protein_id gnl|my_center|LOCUS_12470 2597 3649 gene locus_tag LOCUS_12480 gene tdh 2597 3649 CDS product L-threonine 3-dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249867.1 protein_id gnl|my_center|LOCUS_12480 3719 5221 gene locus_tag LOCUS_12490 3719 5221 CDS product phenylalanine--tRNA ligase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249872.1 protein_id gnl|my_center|LOCUS_12490 5228 6934 gene locus_tag LOCUS_12500 gene pheT 5228 6934 CDS product phenylalanine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249876.1 protein_id gnl|my_center|LOCUS_12500 >Feature sequence071 98 1087 gene locus_tag LOCUS_12510 98 1087 CDS product biotin-dependent carboxyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249287.1 protein_id gnl|my_center|LOCUS_12510 1518 1084 gene locus_tag LOCUS_12520 1518 1084 CDS product UPF0179 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254059.1 protein_id gnl|my_center|LOCUS_12520 2605 1553 gene locus_tag LOCUS_12530 2605 1553 CDS product NAD(P)-dependent glycerol-1-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249740.1 protein_id gnl|my_center|LOCUS_12530 2679 3485 gene locus_tag LOCUS_12540 2679 3485 CDS product DUF63 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249739.1 protein_id gnl|my_center|LOCUS_12540 3491 4258 gene locus_tag LOCUS_12550 3491 4258 CDS product bifunctional fructose-bisphosphatase/inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249738.1 protein_id gnl|my_center|LOCUS_12550 4248 4862 gene locus_tag LOCUS_12560 4248 4862 CDS product rhomboid family intramembrane serine protease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249737.1 protein_id gnl|my_center|LOCUS_12560 5624 6007 gene locus_tag LOCUS_12570 5624 6007 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053685.1 protein_id gnl|my_center|LOCUS_12570 <7756 5994 gene locus_tag LOCUS_12580 <7756 5994 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249735.1:helicase C-terminal domain-containing protein >Feature sequence072 724 176 gene locus_tag LOCUS_12590 gene pyrE 724 176 CDS product orotate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251088.1 protein_id gnl|my_center|LOCUS_12590 846 1625 gene locus_tag LOCUS_12600 846 1625 CDS product protease PrsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251089.1 protein_id gnl|my_center|LOCUS_12600 3297 1609 gene locus_tag LOCUS_12610 3297 1609 CDS product ATP-dependent DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053886.1 protein_id gnl|my_center|LOCUS_12610 3381 3596 gene locus_tag LOCUS_12620 3381 3596 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 3759 3929 gene locus_tag LOCUS_12630 3759 3929 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12630 4828 3926 gene locus_tag LOCUS_12640 4828 3926 CDS product pantoate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251091.1 protein_id gnl|my_center|LOCUS_12640 6495 4888 gene locus_tag LOCUS_12650 6495 4888 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867411.1 protein_id gnl|my_center|LOCUS_12650 7372 6785 gene locus_tag LOCUS_12660 gene udg 7372 6785 CDS product type-4 uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053779.1 protein_id gnl|my_center|LOCUS_12660 7713 7378 gene locus_tag LOCUS_12670 7713 7378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251094.1 protein_id gnl|my_center|LOCUS_12670 >Feature sequence073 6 398 gene locus_tag LOCUS_12680 6 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12680 1405 383 gene locus_tag LOCUS_12690 1405 383 CDS product endo alpha-1,4 polygalactosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870998.1 protein_id gnl|my_center|LOCUS_12690 1499 2002 gene locus_tag LOCUS_12700 1499 2002 CDS product NTP transferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867165.1 protein_id gnl|my_center|LOCUS_12700 1999 2211 gene locus_tag LOCUS_12710 1999 2211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12710 2268 2702 gene locus_tag LOCUS_12720 2268 2702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12720 4150 2699 gene locus_tag LOCUS_12730 4150 2699 CDS product cobyric acid synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249805.1 protein_id gnl|my_center|LOCUS_12730 4219 5220 gene locus_tag LOCUS_12740 4219 5220 CDS product TIGR00303 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062387325.1 protein_id gnl|my_center|LOCUS_12740 5339 6079 gene locus_tag LOCUS_12750 5339 6079 CDS product DUF364 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867779.1 protein_id gnl|my_center|LOCUS_12750 6144 6554 gene locus_tag LOCUS_12760 6144 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12760 >Feature sequence074 <1 2151 gene locus_tag LOCUS_12770 <1 2151 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250033.1:DNA-directed RNA polymerase subunit A' 2157 3332 gene locus_tag LOCUS_12780 gene rpoA2 2157 3332 CDS product DNA-directed RNA polymerase subunit A'' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250032.1 protein_id gnl|my_center|LOCUS_12780 3346 3654 gene locus_tag LOCUS_12790 3346 3654 CDS product 50S ribosomal protein L30e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250031.1 protein_id gnl|my_center|LOCUS_12790 3654 4091 gene locus_tag LOCUS_12800 3654 4091 CDS product NusA-like transcription termination signal-binding factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250030.1 protein_id gnl|my_center|LOCUS_12800 4102 4545 gene locus_tag LOCUS_12810 4102 4545 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250029.1 protein_id gnl|my_center|LOCUS_12810 4551 5198 gene locus_tag LOCUS_12820 gene rpsG 4551 5198 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250028.1 protein_id gnl|my_center|LOCUS_12820 6431 6024 gene locus_tag LOCUS_12830 6431 6024 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010969154.1 protein_id gnl|my_center|LOCUS_12830 6601 6413 gene locus_tag LOCUS_12840 6601 6413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12840 6681 7193 gene locus_tag LOCUS_12850 6681 7193 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12850 >Feature sequence075 500 39 gene locus_tag LOCUS_12860 500 39 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249685.1 protein_id gnl|my_center|LOCUS_12860 681 487 gene locus_tag LOCUS_12870 681 487 CDS product antitoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053681.1 protein_id gnl|my_center|LOCUS_12870 1293 715 gene locus_tag LOCUS_12880 1293 715 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053782.1 protein_id gnl|my_center|LOCUS_12880 2096 1290 gene locus_tag LOCUS_12890 2096 1290 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251143.1 protein_id gnl|my_center|LOCUS_12890 2191 2796 gene locus_tag LOCUS_12900 2191 2796 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251144.1 protein_id gnl|my_center|LOCUS_12900 3299 2844 gene locus_tag LOCUS_12910 gene pyrI 3299 2844 CDS product aspartate carbamoyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251145.1 protein_id gnl|my_center|LOCUS_12910 4226 3300 gene locus_tag LOCUS_12920 gene pyrB 4226 3300 CDS product aspartate carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251146.1 protein_id gnl|my_center|LOCUS_12920 4342 5226 gene locus_tag LOCUS_12930 4342 5226 CDS product thiamine-phosphate synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251147.1 protein_id gnl|my_center|LOCUS_12930 5226 5639 gene locus_tag LOCUS_12940 5226 5639 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251148.1 protein_id gnl|my_center|LOCUS_12940 6259 5690 gene locus_tag LOCUS_12950 6259 5690 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12950 <7513 6329 gene locus_tag LOCUS_12960 <7513 6329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010868019.1:ATP-binding protein >Feature sequence076 3070 299 gene locus_tag LOCUS_12970 3070 299 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249966.1 protein_id gnl|my_center|LOCUS_12970 3153 4652 gene locus_tag LOCUS_12980 3153 4652 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010979012.1 protein_id gnl|my_center|LOCUS_12980 6605 5175 gene locus_tag LOCUS_12990 gene cysS 6605 5175 CDS product cysteine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249399.1 protein_id gnl|my_center|LOCUS_12990 >Feature sequence077 1783 857 gene locus_tag LOCUS_13000 gene moaA 1783 857 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251175.1 protein_id gnl|my_center|LOCUS_13000 1917 2651 gene locus_tag LOCUS_13010 1917 2651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251176.1 protein_id gnl|my_center|LOCUS_13010 2623 4038 gene locus_tag LOCUS_13020 2623 4038 CDS product DUF402 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251177.1 protein_id gnl|my_center|LOCUS_13020 4099 4587 gene locus_tag LOCUS_13030 4099 4587 CDS product Tfx family DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251101.1 protein_id gnl|my_center|LOCUS_13030 5129 4836 gene locus_tag LOCUS_13040 5129 4836 CDS product DUF3213 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251096.1 protein_id gnl|my_center|LOCUS_13040 6915 5140 gene locus_tag LOCUS_13050 6915 5140 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251095.1 protein_id gnl|my_center|LOCUS_13050 7061 7411 gene locus_tag LOCUS_13060 7061 7411 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251094.1 protein_id gnl|my_center|LOCUS_13060 >Feature sequence078 <1 2123 gene locus_tag LOCUS_13070 <1 2123 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249589.1:methyl-accepting chemotaxis protein 2163 2903 gene locus_tag LOCUS_13080 2163 2903 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868666.1 protein_id gnl|my_center|LOCUS_13080 2922 3947 gene locus_tag LOCUS_13090 2922 3947 CDS product CheF family chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868665.1 protein_id gnl|my_center|LOCUS_13090 5175 3940 gene locus_tag LOCUS_13100 5175 3940 CDS product PQQ-binding-like beta-propeller repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248990.1 protein_id gnl|my_center|LOCUS_13100 5269 6024 gene locus_tag LOCUS_13110 5269 6024 CDS product HEAT repeat domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248989.1 protein_id gnl|my_center|LOCUS_13110 7035 5998 gene locus_tag LOCUS_13120 7035 5998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248988.1 protein_id gnl|my_center|LOCUS_13120 >Feature sequence079 53 391 gene locus_tag LOCUS_13130 53 391 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249010.1 protein_id gnl|my_center|LOCUS_13130 388 957 gene locus_tag LOCUS_13140 388 957 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249011.1 protein_id gnl|my_center|LOCUS_13140 1219 938 gene locus_tag LOCUS_13150 1219 938 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249012.1 protein_id gnl|my_center|LOCUS_13150 1370 2071 gene locus_tag LOCUS_13160 1370 2071 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249013.1 protein_id gnl|my_center|LOCUS_13160 2710 2141 gene locus_tag LOCUS_13170 gene pgsA 2710 2141 CDS product archaetidylinositol phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249014.1 protein_id gnl|my_center|LOCUS_13170 3253 2711 gene locus_tag LOCUS_13180 3253 2711 CDS product tRNA (cytidine(56)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053622.1 protein_id gnl|my_center|LOCUS_13180 4848 3253 gene locus_tag LOCUS_13190 4848 3253 CDS product transglutaminase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249016.1 protein_id gnl|my_center|LOCUS_13190 4904 5683 gene locus_tag LOCUS_13200 4904 5683 CDS product S-adenosyl-l-methionine hydroxide adenosyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249017.1 protein_id gnl|my_center|LOCUS_13200 5721 6260 gene locus_tag LOCUS_13210 5721 6260 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598657.1 protein_id gnl|my_center|LOCUS_13210 6250 6690 gene locus_tag LOCUS_13220 6250 6690 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249295.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence080 505 1800 gene locus_tag LOCUS_13230 505 1800 CDS product bifunctional L-myo-inositol-1-phosphate cytidylyltransferase/CDP-L-myo-inositol myo-inositolphosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251229.1 protein_id gnl|my_center|LOCUS_13230 1845 2993 gene locus_tag LOCUS_13240 1845 2993 CDS product inositol-3-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251228.1 protein_id gnl|my_center|LOCUS_13240 3040 3633 gene locus_tag LOCUS_13250 3040 3633 CDS product DUF4443 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251227.1 protein_id gnl|my_center|LOCUS_13250 3638 4273 gene locus_tag LOCUS_13260 gene pyrF 3638 4273 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251226.1 protein_id gnl|my_center|LOCUS_13260 4264 4782 gene locus_tag LOCUS_13270 4264 4782 CDS product RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251225.1 protein_id gnl|my_center|LOCUS_13270 4784 5230 gene locus_tag LOCUS_13280 4784 5230 CDS product adenylyltransferase/cytidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251224.1 protein_id gnl|my_center|LOCUS_13280 5608 5279 gene locus_tag LOCUS_13290 5608 5279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251223.1 protein_id gnl|my_center|LOCUS_13290 6365 5595 gene locus_tag LOCUS_13300 6365 5595 CDS product ParA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251222.1 protein_id gnl|my_center|LOCUS_13300 <7158 6391 gene locus_tag LOCUS_13310 <7158 6391 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011251221.1:cell division protein FtsZ >Feature sequence081 1099 1527 gene locus_tag LOCUS_13320 1099 1527 CDS product UPF0146 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250727.1 protein_id gnl|my_center|LOCUS_13320 1541 2902 gene locus_tag LOCUS_13330 gene glmM 1541 2902 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250728.1 protein_id gnl|my_center|LOCUS_13330 3695 2880 gene locus_tag LOCUS_13340 3695 2880 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250729.1 protein_id gnl|my_center|LOCUS_13340 3802 5064 gene locus_tag LOCUS_13350 3802 5064 CDS product M20 family metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250732.1 protein_id gnl|my_center|LOCUS_13350 5101 5844 gene locus_tag LOCUS_13360 5101 5844 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250735.1 protein_id gnl|my_center|LOCUS_13360 6166 5849 gene locus_tag LOCUS_13370 6166 5849 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13370 6359 6168 gene locus_tag LOCUS_13380 6359 6168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13380 6660 6397 gene locus_tag LOCUS_13390 6660 6397 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13390 >Feature sequence082 <1 681 gene locus_tag LOCUS_13400 <1 681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250791.1:carboxypeptidase M32 752 988 gene locus_tag LOCUS_13410 752 988 CDS product antitoxin VapB family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146550.1 protein_id gnl|my_center|LOCUS_13410 1665 1330 gene locus_tag LOCUS_13420 1665 1330 CDS product ASCH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250788.1 protein_id gnl|my_center|LOCUS_13420 2787 1675 gene locus_tag LOCUS_13430 2787 1675 CDS product NAD(P)/FAD-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250787.1 protein_id gnl|my_center|LOCUS_13430 2849 3448 gene locus_tag LOCUS_13440 gene pcp 2849 3448 CDS product pyroglutamyl-peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250786.1 protein_id gnl|my_center|LOCUS_13440 3769 3434 gene locus_tag LOCUS_13450 3769 3434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250785.1 protein_id gnl|my_center|LOCUS_13450 3873 5864 gene locus_tag LOCUS_13460 3873 5864 CDS product DUF460 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598715.1 protein_id gnl|my_center|LOCUS_13460 6068 5871 gene locus_tag LOCUS_13470 6068 5871 CDS product TIGR04140 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250774.1 protein_id gnl|my_center|LOCUS_13470 6411 6055 gene locus_tag LOCUS_13480 6411 6055 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13480 >Feature sequence083 1541 426 gene locus_tag LOCUS_13490 gene trm10 1541 426 CDS product tRNA (guanine(9)-/adenine(9)-N1)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249377.1 protein_id gnl|my_center|LOCUS_13490 1624 1701 gene locus_tag LOCUS_t00260 1624 1701 tRNA product tRNA-Glu inference COORDINATES:profile:Aragorn:1.2.38 2524 2246 gene locus_tag LOCUS_13500 2524 2246 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13500 2888 3880 gene locus_tag LOCUS_13510 2888 3880 CDS product class I SAM-dependent methyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249452.1 protein_id gnl|my_center|LOCUS_13510 5283 3958 gene locus_tag LOCUS_13520 5283 3958 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249454.1 protein_id gnl|my_center|LOCUS_13520 6661 5294 gene locus_tag LOCUS_13530 6661 5294 CDS product TldD/PmbA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249457.1 protein_id gnl|my_center|LOCUS_13530 >Feature sequence084 340 882 gene locus_tag LOCUS_13540 340 882 CDS product DUF998 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_054841215.1 protein_id gnl|my_center|LOCUS_13540 2290 923 gene locus_tag LOCUS_13550 gene serS 2290 923 CDS product serine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250091.1 protein_id gnl|my_center|LOCUS_13550 2407 3492 gene locus_tag LOCUS_13560 2407 3492 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250090.1 protein_id gnl|my_center|LOCUS_13560 4691 3489 gene locus_tag LOCUS_13570 4691 3489 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250233.1 protein_id gnl|my_center|LOCUS_13570 5063 4923 gene locus_tag LOCUS_13580 5063 4923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 5187 5942 gene locus_tag LOCUS_13590 5187 5942 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249621.1 protein_id gnl|my_center|LOCUS_13590 >Feature sequence085 321 623 gene locus_tag LOCUS_13600 321 623 CDS product MTH1187 family thiamine-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249128.1 protein_id gnl|my_center|LOCUS_13600 616 1791 gene locus_tag LOCUS_13610 616 1791 CDS product DUF373 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053635.1 protein_id gnl|my_center|LOCUS_13610 1748 2806 gene locus_tag LOCUS_13620 1748 2806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053634.1 protein_id gnl|my_center|LOCUS_13620 2849 3694 gene locus_tag LOCUS_13630 2849 3694 CDS product deoxyribonuclease IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249125.1 protein_id gnl|my_center|LOCUS_13630 5305 3695 gene locus_tag LOCUS_13640 5305 3695 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249122.1 protein_id gnl|my_center|LOCUS_13640 6478 5435 gene locus_tag LOCUS_13650 6478 5435 CDS product P1 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249115.1 protein_id gnl|my_center|LOCUS_13650 >Feature sequence086 688 320 gene locus_tag LOCUS_13660 688 320 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 1562 669 gene locus_tag LOCUS_13670 gene hemH 1562 669 CDS product ferrochelatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880584.1 protein_id gnl|my_center|LOCUS_13670 2013 1591 gene locus_tag LOCUS_13680 2013 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13680 3172 2024 gene locus_tag LOCUS_13690 3172 2024 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 3316 3519 gene locus_tag LOCUS_13700 3316 3519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 3639 5162 gene locus_tag LOCUS_13710 3639 5162 CDS product cytochrome ubiquinol oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880872.1 protein_id gnl|my_center|LOCUS_13710 5162 6157 gene locus_tag LOCUS_13720 gene cydB 5162 6157 CDS product cytochrome d ubiquinol oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940528.1 protein_id gnl|my_center|LOCUS_13720 >Feature sequence087 670 1095 gene locus_tag LOCUS_13730 670 1095 CDS product DUF356 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249084.1 protein_id gnl|my_center|LOCUS_13730 1630 1097 gene locus_tag LOCUS_13740 1630 1097 CDS product multiprotein bridging factor aMBF1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249081.1 protein_id gnl|my_center|LOCUS_13740 1699 2172 gene locus_tag LOCUS_13750 1699 2172 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249080.1 protein_id gnl|my_center|LOCUS_13750 2212 2502 gene locus_tag LOCUS_13760 2212 2502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249079.1 protein_id gnl|my_center|LOCUS_13760 2796 2641 gene locus_tag LOCUS_13770 2796 2641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 3248 2844 gene locus_tag LOCUS_13780 3248 2844 CDS product Zn-ribbon domain-containing OB-fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868486.1 protein_id gnl|my_center|LOCUS_13780 4417 3251 gene locus_tag LOCUS_13790 4417 3251 CDS product thiolase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249135.1 protein_id gnl|my_center|LOCUS_13790 5480 4428 gene locus_tag LOCUS_13800 5480 4428 CDS product hydroxymethylglutaryl-CoA synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249136.1 protein_id gnl|my_center|LOCUS_13800 6260 5580 gene locus_tag LOCUS_13810 6260 5580 CDS product fibrillarin-like rRNA/tRNA 2'-O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249138.1 protein_id gnl|my_center|LOCUS_13810 >Feature sequence088 105 782 gene locus_tag LOCUS_13820 105 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13820 1901 768 gene locus_tag LOCUS_13830 gene wecB 1901 768 CDS product UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250181.1 protein_id gnl|my_center|LOCUS_13830 3169 1898 gene locus_tag LOCUS_13840 3169 1898 CDS product UDP-N-acetyl-D-mannosamine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_062390429.1 protein_id gnl|my_center|LOCUS_13840 3463 4563 gene locus_tag LOCUS_13850 3463 4563 CDS product DUF354 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250183.1 protein_id gnl|my_center|LOCUS_13850 5055 4510 gene locus_tag LOCUS_13860 5055 4510 CDS product stage II sporulation protein M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250184.1 protein_id gnl|my_center|LOCUS_13860 5338 5060 gene locus_tag LOCUS_13870 5338 5060 CDS product lipoate protein ligase C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250185.1 protein_id gnl|my_center|LOCUS_13870 >Feature sequence089 609 184 gene locus_tag LOCUS_13880 609 184 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249967.1 protein_id gnl|my_center|LOCUS_13880 1112 714 gene locus_tag LOCUS_13890 gene mce 1112 714 CDS product methylmalonyl-CoA epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249285.1 protein_id gnl|my_center|LOCUS_13890 2085 1117 gene locus_tag LOCUS_13900 gene meaB 2085 1117 CDS product methylmalonyl Co-A mutase-associated GTPase MeaB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249284.1 protein_id gnl|my_center|LOCUS_13900 2557 2126 gene locus_tag LOCUS_13910 2557 2126 CDS product cobalamin B12-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146517.1 protein_id gnl|my_center|LOCUS_13910 2678 3325 gene locus_tag LOCUS_13920 2678 3325 CDS product PHP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249282.1 protein_id gnl|my_center|LOCUS_13920 3411 4943 gene locus_tag LOCUS_13930 3411 4943 CDS product dihydropteroate synthase-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249274.1 protein_id gnl|my_center|LOCUS_13930 5227 4937 gene locus_tag LOCUS_13940 5227 4937 CDS product DUF3216 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249273.1 protein_id gnl|my_center|LOCUS_13940 5988 5224 gene locus_tag LOCUS_13950 5988 5224 CDS product YchF/TatD family DNA exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249272.1 protein_id gnl|my_center|LOCUS_13950 6372 6124 gene locus_tag LOCUS_13960 6372 6124 CDS product DUF504 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249270.1 protein_id gnl|my_center|LOCUS_13960 >Feature sequence090 980 1573 gene locus_tag LOCUS_13970 980 1573 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249675.1 protein_id gnl|my_center|LOCUS_13970 1609 1839 gene locus_tag LOCUS_13980 1609 1839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13980 1896 2342 gene locus_tag LOCUS_13990 1896 2342 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867887.1 protein_id gnl|my_center|LOCUS_13990 2802 3089 gene locus_tag LOCUS_14000 2802 3089 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14000 3707 3886 gene locus_tag LOCUS_14010 3707 3886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14010 4220 4567 gene locus_tag LOCUS_14020 4220 4567 CDS product 6-carboxytetrahydropterin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250070.1 protein_id gnl|my_center|LOCUS_14020 5040 4570 gene locus_tag LOCUS_14030 5040 4570 CDS product DUF192 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250071.1 protein_id gnl|my_center|LOCUS_14030 5140 5568 gene locus_tag LOCUS_14040 gene pfdA 5140 5568 CDS product prefoldin subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048811235.1 protein_id gnl|my_center|LOCUS_14040 5612 5902 gene locus_tag LOCUS_14050 5612 5902 CDS product prefoldin subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053706.1 protein_id gnl|my_center|LOCUS_14050 >Feature sequence091 247 969 gene locus_tag LOCUS_14060 247 969 CDS product proteasome assembly chaperone family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250847.1 protein_id gnl|my_center|LOCUS_14060 979 1362 gene locus_tag LOCUS_14070 979 1362 CDS product DUF473 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250848.1 protein_id gnl|my_center|LOCUS_14070 2108 1359 gene locus_tag LOCUS_14080 gene nucS 2108 1359 CDS product endonuclease NucS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250849.1 protein_id gnl|my_center|LOCUS_14080 2370 2128 gene locus_tag LOCUS_14090 2370 2128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 3326 2385 gene locus_tag LOCUS_14100 3326 2385 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14100 4575 3763 gene locus_tag LOCUS_14110 4575 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14110 5674 4622 gene locus_tag LOCUS_14120 gene radA 5674 4622 CDS product DNA repair and recombination protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146514.1 protein_id gnl|my_center|LOCUS_14120 >Feature sequence092 1555 1127 gene locus_tag LOCUS_14130 1555 1127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250862.1 protein_id gnl|my_center|LOCUS_14130 2265 1552 gene locus_tag LOCUS_14140 2265 1552 CDS product ATPase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250861.1 protein_id gnl|my_center|LOCUS_14140 3450 2329 gene locus_tag LOCUS_14150 3450 2329 CDS product glycosyltransferase family 2 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250860.1 protein_id gnl|my_center|LOCUS_14150 3451 3528 gene locus_tag LOCUS_t00270 3451 3528 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3978 3547 gene locus_tag LOCUS_14160 3978 3547 CDS product CoA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248960.1 protein_id gnl|my_center|LOCUS_14160 4221 4466 gene locus_tag LOCUS_14170 4221 4466 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14170 4821 4423 gene locus_tag LOCUS_14180 4821 4423 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248958.1 protein_id gnl|my_center|LOCUS_14180 5465 4818 gene locus_tag LOCUS_14190 5465 4818 CDS product SprT family zinc-dependent metalloprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248957.1 protein_id gnl|my_center|LOCUS_14190 6119 5478 gene locus_tag LOCUS_14200 6119 5478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14200 >Feature sequence093 163 390 gene locus_tag LOCUS_14210 163 390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14210 1577 387 gene locus_tag LOCUS_14220 1577 387 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249496.1 protein_id gnl|my_center|LOCUS_14220 2094 1579 gene locus_tag LOCUS_14230 2094 1579 CDS product MogA/MoaB family molybdenum cofactor biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249499.1 protein_id gnl|my_center|LOCUS_14230 2193 2843 gene locus_tag LOCUS_14240 2193 2843 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249663.1 protein_id gnl|my_center|LOCUS_14240 3369 2830 gene locus_tag LOCUS_14250 3369 2830 CDS product DUF2250 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249672.1 protein_id gnl|my_center|LOCUS_14250 3745 3317 gene locus_tag LOCUS_14260 3745 3317 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249673.1 protein_id gnl|my_center|LOCUS_14260 4164 3748 gene locus_tag LOCUS_14270 4164 3748 CDS product NifB/NifX family molybdenum-iron cluster-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_088858713.1 protein_id gnl|my_center|LOCUS_14270 4694 4221 gene locus_tag LOCUS_14280 4694 4221 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 4807 5676 gene locus_tag LOCUS_14290 4807 5676 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053679.1 protein_id gnl|my_center|LOCUS_14290 >Feature sequence094 1338 262 gene locus_tag LOCUS_14300 1338 262 CDS product Xaa-Pro peptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146519.1 protein_id gnl|my_center|LOCUS_14300 2680 1340 gene locus_tag LOCUS_14310 2680 1340 CDS product DUF438 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146783.1 protein_id gnl|my_center|LOCUS_14310 2795 3271 gene locus_tag LOCUS_14320 2795 3271 CDS product DUF1858 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010877681.1 protein_id gnl|my_center|LOCUS_14320 4461 4976 gene locus_tag LOCUS_14330 4461 4976 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249478.1 protein_id gnl|my_center|LOCUS_14330 5056 5217 gene locus_tag LOCUS_14340 5056 5217 CDS product rubredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868015.1 protein_id gnl|my_center|LOCUS_14340 5228 5575 gene locus_tag LOCUS_14350 5228 5575 CDS product desulfoferrodoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146718.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence095 1846 845 gene locus_tag LOCUS_14360 1846 845 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867867.1 protein_id gnl|my_center|LOCUS_14360 4107 1903 gene locus_tag LOCUS_14370 4107 1903 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010867868.1 protein_id gnl|my_center|LOCUS_14370 4303 4545 gene locus_tag LOCUS_14380 4303 4545 CDS product Lrp/AsnC ligand binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250282.1 protein_id gnl|my_center|LOCUS_14380 4878 4546 gene locus_tag LOCUS_14390 4878 4546 CDS product signal recognition particle protein Srp19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250281.1 protein_id gnl|my_center|LOCUS_14390 4936 5556 gene locus_tag LOCUS_14400 4936 5556 CDS product DUF257 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250280.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence096 <1 987 gene locus_tag LOCUS_14410 <1 987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249990.1:2,3-phosphoglycerate synthetase 984 1841 gene locus_tag LOCUS_14420 984 1841 CDS product 2-phosphoglycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249989.1 protein_id gnl|my_center|LOCUS_14420 3327 1813 gene locus_tag LOCUS_14430 3327 1813 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254076.1 protein_id gnl|my_center|LOCUS_14430 3740 3333 gene locus_tag LOCUS_14440 3740 3333 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249987.1 protein_id gnl|my_center|LOCUS_14440 4530 3742 gene locus_tag LOCUS_14450 4530 3742 CDS product class II glutamine amidotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_156471206.1 protein_id gnl|my_center|LOCUS_14450 4608 5471 gene locus_tag LOCUS_14460 4608 5471 CDS product type I restriction endonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052273639.1 protein_id gnl|my_center|LOCUS_14460 >Feature sequence097 472 864 gene locus_tag LOCUS_14470 472 864 CDS product DUF1699 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249747.1 protein_id gnl|my_center|LOCUS_14470 905 1705 gene locus_tag LOCUS_14480 905 1705 CDS product GTP cyclohydrolase IV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249744.1 protein_id gnl|my_center|LOCUS_14480 1707 2783 gene locus_tag LOCUS_14490 1707 2783 CDS product HD domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249267.1 protein_id gnl|my_center|LOCUS_14490 4682 2835 gene locus_tag LOCUS_14500 4682 2835 CDS product prolyl oligopeptidase family serine peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249378.1 protein_id gnl|my_center|LOCUS_14500 5330 4728 gene locus_tag LOCUS_14510 5330 4728 CDS product IMP cyclohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249385.1 protein_id gnl|my_center|LOCUS_14510 >Feature sequence098 247 1083 gene locus_tag LOCUS_14520 gene nadC 247 1083 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249173.1 protein_id gnl|my_center|LOCUS_14520 1194 2201 gene locus_tag LOCUS_14530 gene pdxS 1194 2201 CDS product pyridoxal 5'-phosphate synthase lyase subunit PdxS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249172.1 protein_id gnl|my_center|LOCUS_14530 2232 2825 gene locus_tag LOCUS_14540 gene pdxT 2232 2825 CDS product pyridoxal 5'-phosphate synthase glutaminase subunit PdxT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249171.1 protein_id gnl|my_center|LOCUS_14540 2898 4880 gene locus_tag LOCUS_14550 gene fdhF 2898 4880 CDS product formate dehydrogenase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249169.1 protein_id gnl|my_center|LOCUS_14550 4920 5180 gene locus_tag LOCUS_14560 4920 5180 CDS product UPF0175 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249168.1 protein_id gnl|my_center|LOCUS_14560 >Feature sequence099 4213 677 gene locus_tag LOCUS_14570 4213 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14570 >Feature sequence100 1633 254 gene locus_tag LOCUS_14580 1633 254 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249879.1 protein_id gnl|my_center|LOCUS_14580 1707 2972 gene locus_tag LOCUS_14590 1707 2972 CDS product UbiD family decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249880.1 protein_id gnl|my_center|LOCUS_14590 3549 2962 gene locus_tag LOCUS_14600 3549 2962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14600 4549 3632 gene locus_tag LOCUS_14610 4549 3632 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251003.1 protein_id gnl|my_center|LOCUS_14610 <5144 4555 gene locus_tag LOCUS_14620 <5144 4555 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249892.1:ABC transporter permease subunit >Feature sequence101 835 1662 gene locus_tag LOCUS_14630 835 1662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 1649 2365 gene locus_tag LOCUS_14640 1649 2365 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14640 2391 2609 gene locus_tag LOCUS_14650 2391 2609 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14650 2599 3390 gene locus_tag LOCUS_14660 2599 3390 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147280.1 protein_id gnl|my_center|LOCUS_14660 3860 3408 gene locus_tag LOCUS_14670 3860 3408 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064520816.1 protein_id gnl|my_center|LOCUS_14670 4680 3850 gene locus_tag LOCUS_14680 4680 3850 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868314.1 protein_id gnl|my_center|LOCUS_14680 >Feature sequence102 1261 53 gene locus_tag LOCUS_14690 1261 53 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868675.1 protein_id gnl|my_center|LOCUS_14690 1495 2370 gene locus_tag LOCUS_14700 1495 2370 CDS product protein-glutamate O-methyltransferase CheR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868674.1 protein_id gnl|my_center|LOCUS_14700 2345 2707 gene locus_tag LOCUS_14710 2345 2707 CDS product response regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249583.1 protein_id gnl|my_center|LOCUS_14710 2720 3829 gene locus_tag LOCUS_14720 2720 3829 CDS product chemotaxis response regulator protein-glutamate methylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868672.1 protein_id gnl|my_center|LOCUS_14720 >Feature sequence103 304 648 gene locus_tag LOCUS_14730 304 648 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 639 1835 gene locus_tag LOCUS_14740 639 1835 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14740 1933 3330 gene locus_tag LOCUS_14750 1933 3330 CDS product L-aspartate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249252.1 protein_id gnl|my_center|LOCUS_14750 3378 3581 gene locus_tag LOCUS_14760 3378 3581 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14760 3565 3927 gene locus_tag LOCUS_14770 3565 3927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14770 3894 4034 gene locus_tag LOCUS_14780 3894 4034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14780 >Feature sequence104 277 444 gene locus_tag LOCUS_14790 277 444 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14790 488 1126 gene locus_tag LOCUS_14800 488 1126 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1123 1809 gene locus_tag LOCUS_14810 1123 1809 CDS product DUF2202 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870259.1 protein_id gnl|my_center|LOCUS_14810 1871 2164 gene locus_tag LOCUS_14820 1871 2164 CDS product winged helix-turn-helix domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146460.1 protein_id gnl|my_center|LOCUS_14820 2167 2376 gene locus_tag LOCUS_14830 2167 2376 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_193384982.1 protein_id gnl|my_center|LOCUS_14830 2634 2383 gene locus_tag LOCUS_14840 2634 2383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14840 3046 2753 gene locus_tag LOCUS_14850 3046 2753 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14850 3169 3996 gene locus_tag LOCUS_14860 3169 3996 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249796.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence105 <1 671 gene locus_tag LOCUS_14870 <1 671 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250429.1:pyridoxal-phosphate dependent enzyme 707 1582 gene locus_tag LOCUS_14880 707 1582 CDS product MEMO1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250428.1 protein_id gnl|my_center|LOCUS_14880 3772 1643 gene locus_tag LOCUS_14890 3772 1643 CDS product plasma-membrane proton-efflux P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_064496762.1 protein_id gnl|my_center|LOCUS_14890 4111 3797 gene locus_tag LOCUS_14900 4111 3797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_14900 >Feature sequence106 1006 266 gene locus_tag LOCUS_14910 gene thyX 1006 266 CDS product FAD-dependent thymidylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249821.1 protein_id gnl|my_center|LOCUS_14910 1278 2225 gene locus_tag LOCUS_14920 gene argF 1278 2225 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249822.1 protein_id gnl|my_center|LOCUS_14920 2716 3645 gene locus_tag LOCUS_14930 2716 3645 CDS product RsmB/NOP family class I SAM-dependent RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249823.1 protein_id gnl|my_center|LOCUS_14930 4618 3647 gene locus_tag LOCUS_14940 4618 3647 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249824.1 protein_id gnl|my_center|LOCUS_14940 >Feature sequence107 178 537 gene locus_tag LOCUS_14950 178 537 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1123 1563 gene locus_tag LOCUS_14960 1123 1563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14960 1574 2644 gene locus_tag LOCUS_14970 1574 2644 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14970 2641 3045 gene locus_tag LOCUS_14980 2641 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 3038 3673 gene locus_tag LOCUS_14990 3038 3673 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202319940.1 protein_id gnl|my_center|LOCUS_14990 4760 3651 gene locus_tag LOCUS_15000 4760 3651 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 >Feature sequence108 343 765 gene locus_tag LOCUS_15010 343 765 CDS product metal-dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249062.1 protein_id gnl|my_center|LOCUS_15010 2193 820 gene locus_tag LOCUS_15020 2193 820 CDS product NCS2 family permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249112.1 protein_id gnl|my_center|LOCUS_15020 3272 2268 gene locus_tag LOCUS_15030 3272 2268 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249113.1 protein_id gnl|my_center|LOCUS_15030 <4714 3266 gene locus_tag LOCUS_15040 <4714 3266 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053795.1:iron ABC transporter permease >Feature sequence109 830 618 gene locus_tag LOCUS_15050 830 618 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15050 1409 915 gene locus_tag LOCUS_15060 1409 915 CDS product HIT domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249819.1 protein_id gnl|my_center|LOCUS_15060 2452 1451 gene locus_tag LOCUS_15070 2452 1451 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053827.1 protein_id gnl|my_center|LOCUS_15070 2475 3710 gene locus_tag LOCUS_15080 2475 3710 CDS product 2,3-bisphosphoglycerate-independent phosphoglycerate mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249817.1 protein_id gnl|my_center|LOCUS_15080 4293 3712 gene locus_tag LOCUS_15090 4293 3712 CDS product adenosylcobinamide amidohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249797.1 protein_id gnl|my_center|LOCUS_15090 >Feature sequence110 <1 897 gene locus_tag LOCUS_15100 <1 897 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005073522.1:bifunctional aspartate transaminase/aspartate 4-decarboxylase 884 1513 gene locus_tag LOCUS_15110 884 1513 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249655.1 protein_id gnl|my_center|LOCUS_15110 1631 2779 gene locus_tag LOCUS_15120 1631 2779 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_198480655.1 protein_id gnl|my_center|LOCUS_15120 >Feature sequence111 1409 489 gene locus_tag LOCUS_15130 1409 489 CDS product isoaspartyl peptidase/L-asparaginase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251196.1 protein_id gnl|my_center|LOCUS_15130 2380 1469 gene locus_tag LOCUS_15140 2380 1469 CDS product phosphate uptake regulator PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251195.1 protein_id gnl|my_center|LOCUS_15140 2464 3630 gene locus_tag LOCUS_15150 2464 3630 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249778.1 protein_id gnl|my_center|LOCUS_15150 4224 3640 gene locus_tag LOCUS_15160 4224 3640 CDS product indolepyruvate oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251194.1 protein_id gnl|my_center|LOCUS_15160 4640 4284 gene locus_tag LOCUS_15170 4640 4284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15170 >Feature sequence112 263 625 gene locus_tag LOCUS_15180 263 625 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15180 1373 669 gene locus_tag LOCUS_15190 1373 669 CDS product aspartate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249459.1 protein_id gnl|my_center|LOCUS_15190 1470 3140 gene locus_tag LOCUS_15200 1470 3140 CDS product oleate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_009931645.1 protein_id gnl|my_center|LOCUS_15200 3693 3154 gene locus_tag LOCUS_15210 3693 3154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15210 4162 3764 gene locus_tag LOCUS_15220 4162 3764 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15220 4525 4262 gene locus_tag LOCUS_15230 4525 4262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15230 >Feature sequence113 535 1419 gene locus_tag LOCUS_15240 535 1419 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010989559.1 protein_id gnl|my_center|LOCUS_15240 1477 2364 gene locus_tag LOCUS_15250 1477 2364 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 2709 2590 gene locus_tag LOCUS_15260 2709 2590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15260 3125 2763 gene locus_tag LOCUS_15270 3125 2763 CDS product DUF6516 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053649.1 protein_id gnl|my_center|LOCUS_15270 3372 3100 gene locus_tag LOCUS_15280 3372 3100 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249266.1 protein_id gnl|my_center|LOCUS_15280 <4549 3386 gene locus_tag LOCUS_15290 <4549 3386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249178.1:MFS transporter >Feature sequence114 411 1244 gene locus_tag LOCUS_15300 411 1244 CDS product geranylgeranylglycerol-phosphate geranylgeranyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250907.1 protein_id gnl|my_center|LOCUS_15300 1250 1630 gene locus_tag LOCUS_15310 1250 1630 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250908.1 protein_id gnl|my_center|LOCUS_15310 2474 1668 gene locus_tag LOCUS_15320 2474 1668 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250909.1 protein_id gnl|my_center|LOCUS_15320 2848 2471 gene locus_tag LOCUS_15330 2848 2471 CDS product replication factor A complex, RPA14 subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250910.1 protein_id gnl|my_center|LOCUS_15330 3920 2850 gene locus_tag LOCUS_15340 3920 2850 CDS product OB-fold nucleic acid binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250911.1 protein_id gnl|my_center|LOCUS_15340 >Feature sequence115 <1 504 gene locus_tag LOCUS_15350 <1 504 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249167.1:DUF3368 domain-containing protein 1843 479 gene locus_tag LOCUS_15360 gene purF 1843 479 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249166.1 protein_id gnl|my_center|LOCUS_15360 1998 2705 gene locus_tag LOCUS_15370 1998 2705 CDS product phosphoribosylaminoimidazolesuccinocarboxamide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249165.1 protein_id gnl|my_center|LOCUS_15370 2841 2677 gene locus_tag LOCUS_15380 2841 2677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15380 3914 2838 gene locus_tag LOCUS_15390 3914 2838 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251137.1 protein_id gnl|my_center|LOCUS_15390 >Feature sequence116 4237 68 gene locus_tag LOCUS_15400 4237 68 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249715.1 protein_id gnl|my_center|LOCUS_15400 >Feature sequence117 1282 458 gene locus_tag LOCUS_15410 1282 458 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 1416 1964 gene locus_tag LOCUS_15420 1416 1964 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 1961 2716 gene locus_tag LOCUS_15430 1961 2716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 2713 3261 gene locus_tag LOCUS_15440 2713 3261 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879683.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence118 177 1223 gene locus_tag LOCUS_15450 177 1223 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249610.1 protein_id gnl|my_center|LOCUS_15450 1220 2131 gene locus_tag LOCUS_15460 1220 2131 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249611.1 protein_id gnl|my_center|LOCUS_15460 3120 2137 gene locus_tag LOCUS_15470 3120 2137 CDS product zinc ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249612.1 protein_id gnl|my_center|LOCUS_15470 3230 3511 gene locus_tag LOCUS_15480 3230 3511 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15480 3508 4182 gene locus_tag LOCUS_15490 3508 4182 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15490 >Feature sequence119 <1 1326 gene locus_tag LOCUS_15500 <1 1326 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250412.1:leucine--tRNA ligase 1617 1336 gene locus_tag LOCUS_15510 1617 1336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 2508 1957 gene locus_tag LOCUS_15520 2508 1957 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000108060.1 protein_id gnl|my_center|LOCUS_15520 2768 3613 gene locus_tag LOCUS_15530 2768 3613 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250415.1 protein_id gnl|my_center|LOCUS_15530 4174 3569 gene locus_tag LOCUS_15540 4174 3569 CDS product DUF3267 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_209476139.1 protein_id gnl|my_center|LOCUS_15540 >Feature sequence120 204 497 gene locus_tag LOCUS_15550 204 497 CDS product transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249855.1 protein_id gnl|my_center|LOCUS_15550 561 1880 gene locus_tag LOCUS_15560 gene gatD 561 1880 CDS product Glu-tRNA(Gln) amidotransferase subunit GatD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249859.1 protein_id gnl|my_center|LOCUS_15560 1886 3778 gene locus_tag LOCUS_15570 gene gatE 1886 3778 CDS product Glu-tRNA(Gln) amidotransferase subunit GatE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249862.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence121 93 716 gene locus_tag LOCUS_15580 93 716 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251141.1 protein_id gnl|my_center|LOCUS_15580 3243 1894 gene locus_tag LOCUS_15590 gene glmM 3243 1894 CDS product phosphoglucosamine mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251135.1 protein_id gnl|my_center|LOCUS_15590 3684 3301 gene locus_tag LOCUS_15600 3684 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053781.1 protein_id gnl|my_center|LOCUS_15600 >Feature sequence122 1616 336 gene locus_tag LOCUS_15610 1616 336 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15610 1734 2786 gene locus_tag LOCUS_15620 1734 2786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15620 2773 3867 gene locus_tag LOCUS_15630 2773 3867 CDS product DUF835 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868651.1 protein_id gnl|my_center|LOCUS_15630 >Feature sequence123 <1 621 gene locus_tag LOCUS_15640 <1 621 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250425.1:mevalonate kinase 618 1415 gene locus_tag LOCUS_15650 618 1415 CDS product isopentenyl phosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250424.1 protein_id gnl|my_center|LOCUS_15650 1498 2199 gene locus_tag LOCUS_15660 1498 2199 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15660 2232 3350 gene locus_tag LOCUS_15670 gene fni 2232 3350 CDS product type 2 isopentenyl-diphosphate Delta-isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250421.1 protein_id gnl|my_center|LOCUS_15670 3407 3712 gene locus_tag LOCUS_15680 3407 3712 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15680 >Feature sequence124 571 152 gene locus_tag LOCUS_15690 571 152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 978 1065 gene locus_tag LOCUS_t00280 978 1065 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1702 1626 gene locus_tag LOCUS_t00290 1702 1626 tRNA product tRNA-Thr inference COORDINATES:profile:Aragorn:1.2.38 2327 1728 gene locus_tag LOCUS_15700 2327 1728 CDS product RNA ligase partner protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250376.1 protein_id gnl|my_center|LOCUS_15700 2380 3588 gene locus_tag LOCUS_15710 2380 3588 CDS product L-fucose/L-arabinose isomerase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250375.1 protein_id gnl|my_center|LOCUS_15710 3661 3834 gene locus_tag LOCUS_15720 3661 3834 CDS product class III signal peptide-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053729.1 protein_id gnl|my_center|LOCUS_15720 >Feature sequence125 1165 281 gene locus_tag LOCUS_15730 1165 281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 2388 1162 gene locus_tag LOCUS_15740 2388 1162 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868749.1 protein_id gnl|my_center|LOCUS_15740 3194 2394 gene locus_tag LOCUS_15750 3194 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15750 >Feature sequence126 <1 1262 gene locus_tag LOCUS_15760 <1 1262 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249331.1:ADP-specific phosphofructokinase 2120 1278 gene locus_tag LOCUS_15770 gene xerA 2120 1278 CDS product tyrosine recombinase XerA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249728.1 protein_id gnl|my_center|LOCUS_15770 3024 2131 gene locus_tag LOCUS_15780 3024 2131 CDS product toprim domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249729.1 protein_id gnl|my_center|LOCUS_15780 3781 3068 gene locus_tag LOCUS_15790 gene sfsA 3781 3068 CDS product DNA/RNA nuclease SfsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249730.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence127 1689 1384 gene locus_tag LOCUS_15800 1689 1384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15800 1757 2242 gene locus_tag LOCUS_15810 1757 2242 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249970.1 protein_id gnl|my_center|LOCUS_15810 2850 2188 gene locus_tag LOCUS_15820 2850 2188 CDS product ScpA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249969.1 protein_id gnl|my_center|LOCUS_15820 <4037 2853 gene locus_tag LOCUS_15830 <4037 2853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048053701.1:chromosome segregation protein SMC >Feature sequence128 <1 749 gene locus_tag LOCUS_15840 <1 749 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250513.1:histidine--tRNA ligase 865 746 gene locus_tag LOCUS_15850 865 746 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15850 965 1258 gene locus_tag LOCUS_15860 965 1258 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250516.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence129 1411 548 gene locus_tag LOCUS_15870 1411 548 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250352.1 protein_id gnl|my_center|LOCUS_15870 2741 1416 gene locus_tag LOCUS_15880 2741 1416 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250351.1 protein_id gnl|my_center|LOCUS_15880 2892 3641 gene locus_tag LOCUS_15890 2892 3641 CDS product glycerophosphodiester phosphodiesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053726.1 protein_id gnl|my_center|LOCUS_15890 >Feature sequence130 129 560 gene locus_tag LOCUS_15900 129 560 CDS product ferritin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250686.1 protein_id gnl|my_center|LOCUS_15900 >Feature sequence131 1311 985 gene locus_tag LOCUS_15910 1311 985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147066.1 protein_id gnl|my_center|LOCUS_15910 2294 1311 gene locus_tag LOCUS_15920 2294 1311 CDS product bifunctional oligoribonuclease/PAP phosphatase NrnA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249596.1 protein_id gnl|my_center|LOCUS_15920 2674 2291 gene locus_tag LOCUS_15930 2674 2291 CDS product HEPN domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250023.1 protein_id gnl|my_center|LOCUS_15930 2987 2664 gene locus_tag LOCUS_15940 2987 2664 CDS product nucleotidyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012582526.1 protein_id gnl|my_center|LOCUS_15940 3329 3021 gene locus_tag LOCUS_15950 3329 3021 CDS product DUF3194 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249595.1 protein_id gnl|my_center|LOCUS_15950 3708 3358 gene locus_tag LOCUS_15960 3708 3358 CDS product prefoldin subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249594.1 protein_id gnl|my_center|LOCUS_15960 >Feature sequence132 491 105 gene locus_tag LOCUS_15970 491 105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15970 2176 719 gene locus_tag LOCUS_15980 gene guaB 2176 719 CDS product IMP dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249149.1 protein_id gnl|my_center|LOCUS_15980 3146 3487 gene locus_tag LOCUS_15990 3146 3487 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_15990 >Feature sequence133 <1 879 gene locus_tag LOCUS_16000 <1 879 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010867864.1:ABC transporter ATP-binding protein 1493 864 gene locus_tag LOCUS_16010 1493 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868216.1 protein_id gnl|my_center|LOCUS_16010 1544 3706 gene locus_tag LOCUS_16020 1544 3706 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868004.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence134 494 964 gene locus_tag LOCUS_16030 494 964 CDS product CBS domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010885912.1 protein_id gnl|my_center|LOCUS_16030 971 2098 gene locus_tag LOCUS_16040 971 2098 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250511.1 protein_id gnl|my_center|LOCUS_16040 2289 2095 gene locus_tag LOCUS_16050 2289 2095 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 2382 2714 gene locus_tag LOCUS_16060 2382 2714 CDS product nascent polypeptide-associated complex protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250923.1 protein_id gnl|my_center|LOCUS_16060 3062 2715 gene locus_tag LOCUS_16070 3062 2715 CDS product carboxymuconolactone decarboxylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250924.1 protein_id gnl|my_center|LOCUS_16070 >Feature sequence135 80 520 gene locus_tag LOCUS_16080 80 520 CDS product chemotaxis protein CheW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249580.1 protein_id gnl|my_center|LOCUS_16080 1563 517 gene locus_tag LOCUS_16090 1563 517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053673.1 protein_id gnl|my_center|LOCUS_16090 1854 2183 gene locus_tag LOCUS_16100 1854 2183 CDS product archaellum operon transcriptional activator EarA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248991.1 protein_id gnl|my_center|LOCUS_16100 2193 3146 gene locus_tag LOCUS_16110 2193 3146 CDS product methyltransferase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248992.1 protein_id gnl|my_center|LOCUS_16110 >Feature sequence136 349 1224 gene locus_tag LOCUS_16120 349 1224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16120 1221 2156 gene locus_tag LOCUS_16130 1221 2156 CDS product iron ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761989.1 protein_id gnl|my_center|LOCUS_16130 2147 2767 gene locus_tag LOCUS_16140 2147 2767 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16140 2748 3518 gene locus_tag LOCUS_16150 2748 3518 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011761990.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence137 <1 1268 gene locus_tag LOCUS_16160 <1 1268 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250356.1:phosphoenolpyruvate carboxykinase (GTP) >Feature sequence138 1584 502 gene locus_tag LOCUS_16170 1584 502 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16170 1769 2842 gene locus_tag LOCUS_16180 1769 2842 CDS product saccharopine dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249826.1 protein_id gnl|my_center|LOCUS_16180 2820 3482 gene locus_tag LOCUS_16190 2820 3482 CDS product 16S rRNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249827.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence139 <1 771 gene locus_tag LOCUS_16200 <1 771 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250747.1:type I glutamate--ammonia ligase 1613 762 gene locus_tag LOCUS_16210 1613 762 CDS product DMT family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250748.1 protein_id gnl|my_center|LOCUS_16210 2387 1623 gene locus_tag LOCUS_16220 2387 1623 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250749.1 protein_id gnl|my_center|LOCUS_16220 2857 2384 gene locus_tag LOCUS_16230 2857 2384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_143598713.1 protein_id gnl|my_center|LOCUS_16230 <3574 2885 gene locus_tag LOCUS_16240 <3574 2885 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250751.1:ABC transporter ATP-binding protein >Feature sequence140 176 1465 gene locus_tag LOCUS_16250 gene purT 176 1465 CDS product phosphoribosylglycinamide formyltransferase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249162.1 protein_id gnl|my_center|LOCUS_16250 2200 1769 gene locus_tag LOCUS_16260 gene purE 2200 1769 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010870121.1 protein_id gnl|my_center|LOCUS_16260 3029 2268 gene locus_tag LOCUS_16270 3029 2268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868757.1 protein_id gnl|my_center|LOCUS_16270 >Feature sequence141 398 874 gene locus_tag LOCUS_16280 398 874 CDS product magnesium-dependent phosphatase-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251186.1 protein_id gnl|my_center|LOCUS_16280 880 1446 gene locus_tag LOCUS_16290 880 1446 CDS product DUF366 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251187.1 protein_id gnl|my_center|LOCUS_16290 2060 1440 gene locus_tag LOCUS_16300 2060 1440 CDS product membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251188.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence142 223 1659 gene locus_tag LOCUS_16310 gene pyk 223 1659 CDS product pyruvate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249466.1 protein_id gnl|my_center|LOCUS_16310 2465 1668 gene locus_tag LOCUS_16320 2465 1668 CDS product diadenylate cyclase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249465.1 protein_id gnl|my_center|LOCUS_16320 2532 3083 gene locus_tag LOCUS_16330 2532 3083 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249464.1 protein_id gnl|my_center|LOCUS_16330 >Feature sequence143 <1 1208 gene locus_tag LOCUS_16340 <1 1208 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_048146523.1:DEAD/DEAH box helicase 1875 2576 gene locus_tag LOCUS_16350 1875 2576 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16350 2627 3127 gene locus_tag LOCUS_16360 2627 3127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250147.1 protein_id gnl|my_center|LOCUS_16360 >Feature sequence144 1405 1136 gene locus_tag LOCUS_16370 1405 1136 CDS product ferredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250082.1 protein_id gnl|my_center|LOCUS_16370 2525 1551 gene locus_tag LOCUS_16380 2525 1551 CDS product archaeosine biosynthesis radical SAM protein RaSEA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250086.1 protein_id gnl|my_center|LOCUS_16380 >Feature sequence145 1 237 gene locus_tag LOCUS_16390 1 237 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251115.1 protein_id gnl|my_center|LOCUS_16390 329 1456 gene locus_tag LOCUS_16400 gene fbp 329 1456 CDS product fructose-1,6-bisphosphate aldolase/phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251114.1 protein_id gnl|my_center|LOCUS_16400 >Feature sequence146 2385 577 gene locus_tag LOCUS_16410 2385 577 CDS product PINc/VapC family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249904.1 protein_id gnl|my_center|LOCUS_16410 2454 3191 gene locus_tag LOCUS_16420 gene minD 2454 3191 CDS product cell division ATPase MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249903.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence147 <1 596 gene locus_tag LOCUS_16430 <1 596 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250643.1:ATPase 657 1190 gene locus_tag LOCUS_16440 657 1190 CDS product metal-sulfur cluster assembly factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250644.1 protein_id gnl|my_center|LOCUS_16440 1322 1525 gene locus_tag LOCUS_16450 1322 1525 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868845.1 protein_id gnl|my_center|LOCUS_16450 2766 1594 gene locus_tag LOCUS_16460 2766 1594 CDS product nicotinate phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250627.1 protein_id gnl|my_center|LOCUS_16460 >Feature sequence148 1108 1587 gene locus_tag LOCUS_16470 1108 1587 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249607.1 protein_id gnl|my_center|LOCUS_16470 1650 2636 gene locus_tag LOCUS_16480 gene ftsY 1650 2636 CDS product signal recognition particle-docking protein FtsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249604.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence149 1183 497 gene locus_tag LOCUS_16490 1183 497 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251191.1 protein_id gnl|my_center|LOCUS_16490 1242 2192 gene locus_tag LOCUS_16500 1242 2192 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251192.1 protein_id gnl|my_center|LOCUS_16500 >Feature sequence150 94 291 gene locus_tag LOCUS_16510 94 291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16510 1544 363 gene locus_tag LOCUS_16520 gene thrC 1544 363 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011021620.1 protein_id gnl|my_center|LOCUS_16520 1654 2247 gene locus_tag LOCUS_16530 1654 2247 CDS product ArsR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251241.1 protein_id gnl|my_center|LOCUS_16530 2478 2275 gene locus_tag LOCUS_16540 2478 2275 CDS product 30S ribosomal protein S17e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251242.1 protein_id gnl|my_center|LOCUS_16540 2605 3033 gene locus_tag LOCUS_16550 2605 3033 CDS product DUF371 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251243.1 protein_id gnl|my_center|LOCUS_16550 >Feature sequence151 1413 2012 gene locus_tag LOCUS_16560 1413 2012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249088.1 protein_id gnl|my_center|LOCUS_16560 >Feature sequence152 1089 202 gene locus_tag LOCUS_16570 1089 202 CDS product cation diffusion facilitator family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053764.1 protein_id gnl|my_center|LOCUS_16570 1481 1155 gene locus_tag LOCUS_16580 1481 1155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16580 1543 1956 gene locus_tag LOCUS_16590 1543 1956 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250967.1 protein_id gnl|my_center|LOCUS_16590 2689 1949 gene locus_tag LOCUS_16600 2689 1949 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048065164.1 protein_id gnl|my_center|LOCUS_16600 >Feature sequence153 489 812 gene locus_tag LOCUS_16610 489 812 CDS product Gar1/Naf1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251236.1 protein_id gnl|my_center|LOCUS_16610 809 1729 gene locus_tag LOCUS_16620 809 1729 CDS product transcription initiation factor IIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053897.1 protein_id gnl|my_center|LOCUS_16620 1732 2220 gene locus_tag LOCUS_16630 1732 2220 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251238.1 protein_id gnl|my_center|LOCUS_16630 2438 2235 gene locus_tag LOCUS_16640 gene hpkB 2438 2235 CDS product archaeal histone HpkB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251239.1 protein_id gnl|my_center|LOCUS_16640 >Feature sequence154 193 507 gene locus_tag LOCUS_16650 193 507 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16650 689 859 gene locus_tag LOCUS_16660 689 859 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16660 1155 841 gene locus_tag LOCUS_16670 1155 841 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048053674.1 protein_id gnl|my_center|LOCUS_16670 1812 1165 gene locus_tag LOCUS_16680 1812 1165 CDS product phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249615.1 protein_id gnl|my_center|LOCUS_16680 >Feature sequence155 529 732 gene locus_tag LOCUS_16690 529 732 CDS product MoaD/ThiS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250044.1 protein_id gnl|my_center|LOCUS_16690 1935 739 gene locus_tag LOCUS_16700 1935 739 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250045.1 protein_id gnl|my_center|LOCUS_16700 2158 2394 gene locus_tag LOCUS_16710 2158 2394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250046.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence156 1202 1507 gene locus_tag LOCUS_16720 1202 1507 CDS product DUF5748 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250737.1 protein_id gnl|my_center|LOCUS_16720 <2623 1508 gene locus_tag LOCUS_16730 <2623 1508 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250738.1:tripartite tricarboxylate transporter permease >Feature sequence157 1284 493 gene locus_tag LOCUS_16740 1284 493 CDS product N-glycosylase/DNA lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249891.1 protein_id gnl|my_center|LOCUS_16740 2249 1281 gene locus_tag LOCUS_16750 2249 1281 CDS product GHMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249890.1 protein_id gnl|my_center|LOCUS_16750 >Feature sequence158 757 293 gene locus_tag LOCUS_16760 757 293 CDS product Na(+)/H(+) antiporter subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251035.1 protein_id gnl|my_center|LOCUS_16760 1050 754 gene locus_tag LOCUS_16770 1050 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251034.1 protein_id gnl|my_center|LOCUS_16770 1310 1047 gene locus_tag LOCUS_16780 1310 1047 CDS product DUF4040 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251033.1 protein_id gnl|my_center|LOCUS_16780 1672 1307 gene locus_tag LOCUS_16790 gene mnhG 1672 1307 CDS product monovalent cation/H(+) antiporter subunit G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251032.1 protein_id gnl|my_center|LOCUS_16790 1932 1669 gene locus_tag LOCUS_16800 1932 1669 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251031.1 protein_id gnl|my_center|LOCUS_16800 2432 1929 gene locus_tag LOCUS_16810 2432 1929 CDS product monovalent cation/H+ antiporter subunit E inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251030.1 protein_id gnl|my_center|LOCUS_16810 >Feature sequence159 >Feature sequence160 <1 1517 gene locus_tag LOCUS_16820 <1 1517 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250186.1:arginine--tRNA ligase 1649 1449 gene locus_tag LOCUS_16830 1649 1449 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16830 <2467 1814 gene locus_tag LOCUS_16840 <2467 1814 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250190.1:peptide chain release factor aRF-1 >Feature sequence161 1491 127 gene locus_tag LOCUS_16850 1491 127 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250495.1 protein_id gnl|my_center|LOCUS_16850 2344 1571 gene locus_tag LOCUS_16860 2344 1571 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250829.1 protein_id gnl|my_center|LOCUS_16860 >Feature sequence162 1254 730 gene locus_tag LOCUS_16870 gene otg 1254 730 CDS product methylated-DNA--protein-cysteine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250921.1 protein_id gnl|my_center|LOCUS_16870 1953 1255 gene locus_tag LOCUS_16880 1953 1255 CDS product RNA methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250920.1 protein_id gnl|my_center|LOCUS_16880 >Feature sequence163 88 1980 gene locus_tag LOCUS_16890 88 1980 CDS product S9 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249703.1 protein_id gnl|my_center|LOCUS_16890 >Feature sequence164 171 833 gene locus_tag LOCUS_16900 171 833 CDS product protein-L-isoaspartate(D-aspartate) O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147186.1 protein_id gnl|my_center|LOCUS_16900 873 1493 gene locus_tag LOCUS_16910 873 1493 CDS product HAD-IB family phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249007.1 protein_id gnl|my_center|LOCUS_16910 <2362 1630 gene locus_tag LOCUS_16920 <2362 1630 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249008.1:A24 family peptidase C-terminal domain-containing protein >Feature sequence165 <1 659 gene locus_tag LOCUS_16930 <1 659 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249203.1:imidazole glycerol phosphate synthase subunit HisF 669 1298 gene locus_tag LOCUS_16940 gene hisIE 669 1298 CDS product bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249204.1 protein_id gnl|my_center|LOCUS_16940 >Feature sequence166 122 790 gene locus_tag LOCUS_16950 122 790 CDS product TIGR00703 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251244.1 protein_id gnl|my_center|LOCUS_16950 821 2125 gene locus_tag LOCUS_16960 821 2125 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004069588.1 protein_id gnl|my_center|LOCUS_16960 >Feature sequence167 334 155 gene locus_tag LOCUS_16970 334 155 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249433.1 protein_id gnl|my_center|LOCUS_16970 975 331 gene locus_tag LOCUS_16980 975 331 CDS product TIGR02253 family HAD-type hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_173254069.1 protein_id gnl|my_center|LOCUS_16980 1720 956 gene locus_tag LOCUS_16990 1720 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249431.1 protein_id gnl|my_center|LOCUS_16990 >Feature sequence168 1045 122 gene locus_tag LOCUS_17000 gene guaA 1045 122 CDS product glutamine-hydrolyzing GMP synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249148.1 protein_id gnl|my_center|LOCUS_17000 2103 1108 gene locus_tag LOCUS_17010 2103 1108 CDS product formate--phosphoribosylaminoimidazolecarboxamide ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249151.1 protein_id gnl|my_center|LOCUS_17010 >Feature sequence169 1146 1361 gene locus_tag LOCUS_17020 1146 1361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011251086.1 protein_id gnl|my_center|LOCUS_17020 >Feature sequence170 <1 584 gene locus_tag LOCUS_17030 <1 584 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249630.1:Kae1-associated kinase Bud32 1833 574 gene locus_tag LOCUS_17040 1833 574 CDS product methyl-accepting chemotaxis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048147095.1 protein_id gnl|my_center|LOCUS_17040 2139 1939 gene locus_tag LOCUS_17050 2139 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17050 >Feature sequence171 724 95 gene locus_tag LOCUS_17060 724 95 CDS product ribonucleotide-diphosphate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249568.1 protein_id gnl|my_center|LOCUS_17060 927 778 gene locus_tag LOCUS_17070 927 778 CDS product DNA-directed RNA polymerase subunit P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249567.1 protein_id gnl|my_center|LOCUS_17070 1212 952 gene locus_tag LOCUS_17080 1212 952 CDS product 50S ribosomal protein L37ae inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249566.1 protein_id gnl|my_center|LOCUS_17080 1468 1381 gene locus_tag LOCUS_t00300 1468 1381 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 1649 1506 gene locus_tag LOCUS_17090 1649 1506 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17090 >Feature sequence172 634 437 gene locus_tag LOCUS_17100 634 437 CDS product 30S ribosomal protein S27e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250050.1 protein_id gnl|my_center|LOCUS_17100 922 638 gene locus_tag LOCUS_17110 922 638 CDS product 50S ribosomal protein L44e inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250049.1 protein_id gnl|my_center|LOCUS_17110 1090 1653 gene locus_tag LOCUS_17120 1090 1653 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868229.1 protein_id gnl|my_center|LOCUS_17120 1996 1643 gene locus_tag LOCUS_17130 1996 1643 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17130 >Feature sequence173 175 1089 gene locus_tag LOCUS_17140 175 1089 CDS product 2-dehydropantoate 2-reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250918.1 protein_id gnl|my_center|LOCUS_17140 1103 1750 gene locus_tag LOCUS_17150 1103 1750 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250917.1 protein_id gnl|my_center|LOCUS_17150 >Feature sequence174 1970 1197 gene locus_tag LOCUS_17160 1970 1197 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010980257.1 protein_id gnl|my_center|LOCUS_17160 >Feature sequence175 221 589 gene locus_tag LOCUS_17170 221 589 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250521.1 protein_id gnl|my_center|LOCUS_17170 1025 561 gene locus_tag LOCUS_17180 1025 561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250522.1 protein_id gnl|my_center|LOCUS_17180 1890 1102 gene locus_tag LOCUS_17190 1890 1102 CDS product Nif3-like dinuclear metal center hexameric protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250523.1 protein_id gnl|my_center|LOCUS_17190 >Feature sequence176 >Feature sequence177 925 413 gene locus_tag LOCUS_17200 925 413 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit gamma inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250077.1 protein_id gnl|my_center|LOCUS_17200 1780 929 gene locus_tag LOCUS_17210 1780 929 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_048146567.1 protein_id gnl|my_center|LOCUS_17210 >Feature sequence178 <1 766 gene locus_tag LOCUS_17220 <1 766 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249911.1:7-cyano-7-deazaguanine synthase 772 1770 gene locus_tag LOCUS_17230 772 1770 CDS product AIR synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249912.1 protein_id gnl|my_center|LOCUS_17230 >Feature sequence179 1878 808 gene locus_tag LOCUS_17240 1878 808 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250510.1 protein_id gnl|my_center|LOCUS_17240 >Feature sequence180 289 594 gene locus_tag LOCUS_17250 289 594 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17250 1245 547 gene locus_tag LOCUS_17260 1245 547 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17260 <1850 1347 gene locus_tag LOCUS_17270 <1850 1347 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249732.1:M42 family metallopeptidase >Feature sequence181 955 107 gene locus_tag LOCUS_17280 955 107 CDS product 2-oxoacid:ferredoxin oxidoreductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250075.1 protein_id gnl|my_center|LOCUS_17280 <1811 952 gene locus_tag LOCUS_17290 <1811 952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250076.1:2-oxoacid:acceptor oxidoreductase subunit alpha >Feature sequence182 421 624 gene locus_tag LOCUS_17300 421 624 CDS product DUF2281 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868295.1 protein_id gnl|my_center|LOCUS_17300 624 1058 gene locus_tag LOCUS_17310 624 1058 CDS product type II toxin-antitoxin system VapC family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868296.1 protein_id gnl|my_center|LOCUS_17310 >Feature sequence183 1599 112 gene locus_tag LOCUS_17320 1599 112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011248987.1 protein_id gnl|my_center|LOCUS_17320 1656 1761 gene locus_tag LOCUS_r00010 1656 1761 rRNA product 5S ribosomal RNA inference COORDINATES:profile:Barrnap:0.8 >Feature sequence184 850 317 gene locus_tag LOCUS_17330 850 317 CDS product adenylate kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249293.1 protein_id gnl|my_center|LOCUS_17330 >Feature sequence185 633 797 gene locus_tag LOCUS_17340 633 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17340 757 1245 gene locus_tag LOCUS_17350 757 1245 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17350 <1758 1242 gene locus_tag LOCUS_17360 <1758 1242 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011249129.1:TIGR00296 family protein >Feature sequence186 297 1043 gene locus_tag LOCUS_17370 297 1043 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17370 >Feature sequence187 <1 912 gene locus_tag LOCUS_17380 <1 912 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250225.1:valine--tRNA ligase 961 1149 gene locus_tag LOCUS_17390 961 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17390 1118 1348 gene locus_tag LOCUS_17400 1118 1348 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17400 >Feature sequence188 <1 758 gene locus_tag LOCUS_17410 <1 758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010978064.1:TIGR04053 family radical SAM/SPASM domain-containing protein >Feature sequence189 913 782 gene locus_tag LOCUS_17420 913 782 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_17420 >Feature sequence190 915 565 gene locus_tag LOCUS_17430 915 565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_17430 <1554 995 gene locus_tag LOCUS_17440 <1554 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011250829.1:MBL fold metallo-hydrolase >Feature sequence191 1293 157 gene locus_tag LOCUS_17450 1293 157 CDS product iron-containing alcohol dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011249959.1 protein_id gnl|my_center|LOCUS_17450