>Feature sequence001 489 1664 gene locus_tag LOCUS_00010 489 1664 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00010 1800 2726 gene locus_tag LOCUS_00020 1800 2726 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259324.1 protein_id gnl|my_center|LOCUS_00020 3080 2991 gene locus_tag LOCUS_t00010 3080 2991 tRNA product tRNA-Ser inference COORDINATES:profile:Aragorn:1.2.38 4208 3156 gene locus_tag LOCUS_00030 4208 3156 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_041937311.1 protein_id gnl|my_center|LOCUS_00030 4963 4217 gene locus_tag LOCUS_00040 4963 4217 CDS product SURF1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946158.1 protein_id gnl|my_center|LOCUS_00040 5189 4989 gene locus_tag LOCUS_00050 5189 4989 CDS product twin transmembrane helix small protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004200193.1 protein_id gnl|my_center|LOCUS_00050 6072 5200 gene locus_tag LOCUS_00060 6072 5200 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948580.1 protein_id gnl|my_center|LOCUS_00060 6687 6076 gene locus_tag LOCUS_00070 6687 6076 CDS product cytochrome c oxidase assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074204.1 protein_id gnl|my_center|LOCUS_00070 6850 6704 gene locus_tag LOCUS_00080 6850 6704 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00080 8529 6847 gene locus_tag LOCUS_00090 gene ctaD 8529 6847 CDS product cytochrome c oxidase subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003083723.1 protein_id gnl|my_center|LOCUS_00090 9534 8542 gene locus_tag LOCUS_00100 9534 8542 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00100 10003 11073 gene locus_tag LOCUS_00110 10003 11073 CDS product COX15/CtaA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074209.1 protein_id gnl|my_center|LOCUS_00110 11080 11682 gene locus_tag LOCUS_00120 11080 11682 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003815732.1 protein_id gnl|my_center|LOCUS_00120 11695 12642 gene locus_tag LOCUS_00130 gene cyoE 11695 12642 CDS product heme o synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768584.1 protein_id gnl|my_center|LOCUS_00130 12816 12998 gene locus_tag LOCUS_00140 12816 12998 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00140 13416 14288 gene locus_tag LOCUS_00150 13416 14288 CDS product DUF2189 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005461722.1 protein_id gnl|my_center|LOCUS_00150 15377 14361 gene locus_tag LOCUS_00160 15377 14361 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00160 15753 16343 gene locus_tag LOCUS_00170 15753 16343 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391107.1 protein_id gnl|my_center|LOCUS_00170 16643 17533 gene locus_tag LOCUS_00180 gene prfB 16643 17533 CDS product peptide chain release factor 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990626.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_00180 17595 19112 gene locus_tag LOCUS_00190 gene lysS 17595 19112 CDS product lysine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947503.1 protein_id gnl|my_center|LOCUS_00190 19783 19562 gene locus_tag LOCUS_00200 19783 19562 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00200 19689 19985 gene locus_tag LOCUS_00210 19689 19985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00210 21414 20008 gene locus_tag LOCUS_00220 21414 20008 CDS product Na+/H+ antiporter NhaC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011405481.1 protein_id gnl|my_center|LOCUS_00220 21974 21531 gene locus_tag LOCUS_00230 21974 21531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00230 22459 22013 gene locus_tag LOCUS_00240 gene lysM 22459 22013 CDS product peptidoglycan-binding protein LysM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528340.1 protein_id gnl|my_center|LOCUS_00240 22976 22623 gene locus_tag LOCUS_00250 22976 22623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00250 >Feature sequence002 38 943 gene locus_tag LOCUS_00260 38 943 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943285.1 protein_id gnl|my_center|LOCUS_00260 1090 1509 gene locus_tag LOCUS_00270 1090 1509 CDS product rubrerythrin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190903.1 protein_id gnl|my_center|LOCUS_00270 1674 3017 gene locus_tag LOCUS_00280 1674 3017 CDS product ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004548886.1 protein_id gnl|my_center|LOCUS_00280 3033 3620 gene locus_tag LOCUS_00290 3033 3620 CDS product DUF3501 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525080.1 protein_id gnl|my_center|LOCUS_00290 4253 3933 gene locus_tag LOCUS_00300 4253 3933 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00300 4788 4453 gene locus_tag LOCUS_00310 4788 4453 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00310 5838 4924 gene locus_tag LOCUS_00320 5838 4924 CDS product 5'-3' exonuclease H3TH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036075.1 protein_id gnl|my_center|LOCUS_00320 7024 5822 gene locus_tag LOCUS_00330 7024 5822 CDS product NnrS family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072738.1 protein_id gnl|my_center|LOCUS_00330 7297 8421 gene locus_tag LOCUS_00340 7297 8421 CDS product acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531646.1 protein_id gnl|my_center|LOCUS_00340 8665 9282 gene locus_tag LOCUS_00350 8665 9282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00350 9536 10516 gene locus_tag LOCUS_00360 9536 10516 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004552489.1 protein_id gnl|my_center|LOCUS_00360 10582 12381 gene locus_tag LOCUS_00370 10582 12381 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261885.1 protein_id gnl|my_center|LOCUS_00370 >Feature sequence003 1486 755 gene locus_tag LOCUS_00380 1486 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00380 1835 1987 gene locus_tag LOCUS_00390 1835 1987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00390 2028 2546 gene locus_tag LOCUS_00400 2028 2546 CDS product cytochrome c oxidase subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010102577.1 protein_id gnl|my_center|LOCUS_00400 2546 4168 gene locus_tag LOCUS_00410 2546 4168 CDS product b(o/a)3-type cytochrome-c oxidase subunit 1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004536008.1 protein_id gnl|my_center|LOCUS_00410 4171 4851 gene locus_tag LOCUS_00420 4171 4851 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000731839.1 protein_id gnl|my_center|LOCUS_00420 4887 7340 gene locus_tag LOCUS_00430 4887 7340 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_00430 7843 10437 gene locus_tag LOCUS_00440 7843 10437 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00440 10868 10626 gene locus_tag LOCUS_00450 gene napD 10868 10626 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000557384.1 protein_id gnl|my_center|LOCUS_00450 11383 10865 gene locus_tag LOCUS_00460 gene napF 11383 10865 CDS product ferredoxin-type protein NapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005172332.1 protein_id gnl|my_center|LOCUS_00460 12119 11517 gene locus_tag LOCUS_00470 12119 11517 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00470 >Feature sequence004 1772 204 gene locus_tag LOCUS_00480 1772 204 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000403632.1 protein_id gnl|my_center|LOCUS_00480 4014 1969 gene locus_tag LOCUS_00490 gene recG 4014 1969 CDS product ATP-dependent DNA helicase RecG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003425918.1 protein_id gnl|my_center|LOCUS_00490 4679 4095 gene locus_tag LOCUS_00500 gene plsY 4679 4095 CDS product glycerol-3-phosphate 1-O-acyltransferase PlsY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522633.1 protein_id gnl|my_center|LOCUS_00500 4718 5494 gene locus_tag LOCUS_00510 gene bioH 4718 5494 CDS product pimeloyl-ACP methyl ester esterase BioH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013099094.1 protein_id gnl|my_center|LOCUS_00510 5488 6321 gene locus_tag LOCUS_00520 gene bioC 5488 6321 CDS product malonyl-ACP O-methyltransferase BioC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035637.1 protein_id gnl|my_center|LOCUS_00520 6384 10826 gene locus_tag LOCUS_00530 6384 10826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00530 11252 11261 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence005 542 3565 gene locus_tag LOCUS_00540 542 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00540 4700 3804 gene locus_tag LOCUS_00550 4700 3804 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002857952.1 protein_id gnl|my_center|LOCUS_00550 5270 4794 gene locus_tag LOCUS_00560 5270 4794 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_00560 7088 5667 gene locus_tag LOCUS_00570 7088 5667 CDS product radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392350.1 protein_id gnl|my_center|LOCUS_00570 7271 7873 gene locus_tag LOCUS_00580 7271 7873 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063921379.1 protein_id gnl|my_center|LOCUS_00580 7978 8526 gene locus_tag LOCUS_00590 7978 8526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00590 9411 8806 gene locus_tag LOCUS_00600 9411 8806 CDS product TetR-like C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456899.1 protein_id gnl|my_center|LOCUS_00600 9643 11736 gene locus_tag LOCUS_00610 9643 11736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00610 >Feature sequence006 2680 158 gene locus_tag LOCUS_00620 gene mutS 2680 158 CDS product DNA mismatch repair protein MutS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113873.1 protein_id gnl|my_center|LOCUS_00620 3696 2863 gene locus_tag LOCUS_00630 3696 2863 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00630 5309 3921 gene locus_tag LOCUS_00640 5309 3921 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_00640 6824 5325 gene locus_tag LOCUS_00650 6824 5325 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106392.1 note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_00650 6953 7264 gene locus_tag LOCUS_00660 6953 7264 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00660 7479 7967 gene locus_tag LOCUS_00670 7479 7967 CDS product CinA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947530.1 protein_id gnl|my_center|LOCUS_00670 8120 9199 gene locus_tag LOCUS_00680 gene recA 8120 9199 CDS product recombinase RecA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947527.1 protein_id gnl|my_center|LOCUS_00680 9221 9685 gene locus_tag LOCUS_00690 9221 9685 CDS product regulatory protein RecX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068912.1 protein_id gnl|my_center|LOCUS_00690 >Feature sequence007 4458 178 gene locus_tag LOCUS_00700 gene rpoC 4458 178 CDS product DNA-directed RNA polymerase subunit beta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093745.1 protein_id gnl|my_center|LOCUS_00700 8648 4467 gene locus_tag LOCUS_00710 gene rpoB 8648 4467 CDS product DNA-directed RNA polymerase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115576597.1 protein_id gnl|my_center|LOCUS_00710 9278 8901 gene locus_tag LOCUS_00720 gene rplL 9278 8901 CDS product 50S ribosomal protein L7/L12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946072.1 protein_id gnl|my_center|LOCUS_00720 9949 9422 gene locus_tag LOCUS_00730 gene rplJ 9949 9422 CDS product 50S ribosomal protein L10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003023073.1 protein_id gnl|my_center|LOCUS_00730 10929 10234 gene locus_tag LOCUS_00740 gene rplA 10929 10234 CDS product 50S ribosomal protein L1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001096676.1 protein_id gnl|my_center|LOCUS_00740 11363 10929 gene locus_tag LOCUS_00750 gene rplK 11363 10929 CDS product 50S ribosomal protein L11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002218414.1 protein_id gnl|my_center|LOCUS_00750 >Feature sequence008 <1 845 gene locus_tag LOCUS_00760 <1 845 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011461874.1:heavy metal translocating P-type ATPase 3027 871 gene locus_tag LOCUS_00770 3027 871 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00770 4825 3134 gene locus_tag LOCUS_00780 4825 3134 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528251.1 protein_id gnl|my_center|LOCUS_00780 5675 4815 gene locus_tag LOCUS_00790 5675 4815 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528250.1 protein_id gnl|my_center|LOCUS_00790 6625 5672 gene locus_tag LOCUS_00800 6625 5672 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771075.1 protein_id gnl|my_center|LOCUS_00800 8322 6718 gene locus_tag LOCUS_00810 8322 6718 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003536654.1 protein_id gnl|my_center|LOCUS_00810 9125 8406 gene locus_tag LOCUS_00820 9125 8406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00820 11000 9513 gene locus_tag LOCUS_00830 11000 9513 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002485353.1 protein_id gnl|my_center|LOCUS_00830 >Feature sequence009 231 1232 gene locus_tag LOCUS_00840 231 1232 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00840 1235 1606 gene locus_tag LOCUS_00850 1235 1606 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00850 1838 3379 gene locus_tag LOCUS_00860 1838 3379 CDS product glutamate synthase-related protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106349.1 protein_id gnl|my_center|LOCUS_00860 4855 3617 gene locus_tag LOCUS_00870 4855 3617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011337357.1 protein_id gnl|my_center|LOCUS_00870 6033 4918 gene locus_tag LOCUS_00880 6033 4918 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_060486313.1 protein_id gnl|my_center|LOCUS_00880 7276 6083 gene locus_tag LOCUS_00890 7276 6083 CDS product toxic anion resistance protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013384880.1 protein_id gnl|my_center|LOCUS_00890 8184 7330 gene locus_tag LOCUS_00900 8184 7330 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00900 8961 8970 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 9932 9114 gene locus_tag LOCUS_00910 9932 9114 CDS product peptidoglycan DD-metalloendopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771007.1 protein_id gnl|my_center|LOCUS_00910 >Feature sequence010 1385 2239 gene locus_tag LOCUS_00920 1385 2239 CDS product inner membrane protein YpjD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092649.1 protein_id gnl|my_center|LOCUS_00920 2236 3501 gene locus_tag LOCUS_00930 2236 3501 CDS product CNNM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071563.1 protein_id gnl|my_center|LOCUS_00930 3494 4861 gene locus_tag LOCUS_00940 gene radA 3494 4861 CDS product DNA repair protein RadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770187.1 protein_id gnl|my_center|LOCUS_00940 4973 6367 gene locus_tag LOCUS_00950 4973 6367 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00950 6446 9049 gene locus_tag LOCUS_00960 6446 9049 CDS product [protein-PII] uridylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113862.1 protein_id gnl|my_center|LOCUS_00960 9665 9099 gene locus_tag LOCUS_00970 9665 9099 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00970 >Feature sequence011 433 442 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1078 3279 gene locus_tag LOCUS_00980 1078 3279 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006742214.1 protein_id gnl|my_center|LOCUS_00980 3435 4574 gene locus_tag LOCUS_00990 3435 4574 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_00990 4574 5068 gene locus_tag LOCUS_01000 4574 5068 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275420.1 protein_id gnl|my_center|LOCUS_01000 5551 5075 gene locus_tag LOCUS_01010 gene ispF 5551 5075 CDS product 2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266985.1 protein_id gnl|my_center|LOCUS_01010 6306 5551 gene locus_tag LOCUS_01020 gene ispD 6306 5551 CDS product 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478544.1 protein_id gnl|my_center|LOCUS_01020 6713 6303 gene locus_tag LOCUS_01030 6713 6303 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01030 8042 6741 gene locus_tag LOCUS_01040 gene eno 8042 6741 CDS product phosphopyruvate hydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092364.1 protein_id gnl|my_center|LOCUS_01040 8968 8135 gene locus_tag LOCUS_01050 gene kdsA 8968 8135 CDS product 3-deoxy-8-phosphooctulonate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036875.1 protein_id gnl|my_center|LOCUS_01050 >Feature sequence012 845 264 gene locus_tag LOCUS_01060 gene pilN 845 264 CDS product type 4a pilus biogenesis protein PilN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095839.1 protein_id gnl|my_center|LOCUS_01060 1897 845 gene locus_tag LOCUS_01070 1897 845 CDS product pilus assembly protein PilM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403040.1 protein_id gnl|my_center|LOCUS_01070 2263 4938 gene locus_tag LOCUS_01080 2263 4938 CDS product penicillin-binding protein 1A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946660.1 protein_id gnl|my_center|LOCUS_01080 6076 5021 gene locus_tag LOCUS_01090 gene hemE 6076 5021 CDS product uroporphyrinogen decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114569.1 protein_id gnl|my_center|LOCUS_01090 6622 6176 gene locus_tag LOCUS_01100 6622 6176 CDS product lpg2359 family Dot/Icm T4SS effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948065.1 protein_id gnl|my_center|LOCUS_01100 6865 6650 gene locus_tag LOCUS_01110 gene rpsU 6865 6650 CDS product 30S ribosomal protein S21 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005309452.1 protein_id gnl|my_center|LOCUS_01110 7108 7407 gene locus_tag LOCUS_01120 7108 7407 CDS product outer membrane protein assembly factor BamE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003689992.1 protein_id gnl|my_center|LOCUS_01120 7706 7434 gene locus_tag LOCUS_01130 7706 7434 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01130 8078 7707 gene locus_tag LOCUS_01140 8078 7707 CDS product RnfH family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262461.1 protein_id gnl|my_center|LOCUS_01140 8515 8084 gene locus_tag LOCUS_01150 8515 8084 CDS product type II toxin-antitoxin system RatA family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946119.1 protein_id gnl|my_center|LOCUS_01150 >Feature sequence013 1779 862 gene locus_tag LOCUS_01160 1779 862 CDS product glycoside hydrolase family 5 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035285.1 protein_id gnl|my_center|LOCUS_01160 2155 2700 gene locus_tag LOCUS_01170 2155 2700 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975511.1 protein_id gnl|my_center|LOCUS_01170 3964 2723 gene locus_tag LOCUS_01180 3964 2723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01180 4736 3954 gene locus_tag LOCUS_01190 4736 3954 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01190 5839 4736 gene locus_tag LOCUS_01200 5839 4736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01200 7374 5839 gene locus_tag LOCUS_01210 7374 5839 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01210 <8909 7499 gene locus_tag LOCUS_01220 <8909 7499 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013530230.1:GumC family protein >Feature sequence014 363 860 gene locus_tag LOCUS_01230 363 860 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01230 993 1436 gene locus_tag LOCUS_01240 993 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01240 1673 2371 gene locus_tag LOCUS_01250 1673 2371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01250 2374 3558 gene locus_tag LOCUS_01260 2374 3558 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01260 3579 8015 gene locus_tag LOCUS_01270 3579 8015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01270 8160 8489 gene locus_tag LOCUS_01280 8160 8489 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01280 >Feature sequence015 696 211 gene locus_tag LOCUS_01290 696 211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01290 1294 683 gene locus_tag LOCUS_01300 1294 683 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142702.1 protein_id gnl|my_center|LOCUS_01300 1618 3285 gene locus_tag LOCUS_01310 gene recN 1618 3285 CDS product DNA repair protein RecN inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003418848.1 protein_id gnl|my_center|LOCUS_01310 4772 3282 gene locus_tag LOCUS_01320 4772 3282 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01320 6224 5061 gene locus_tag LOCUS_01330 6224 5061 CDS product deoxyguanosinetriphosphate triphosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196750.1 protein_id gnl|my_center|LOCUS_01330 7290 6217 gene locus_tag LOCUS_01340 gene aroB 7290 6217 CDS product 3-dehydroquinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114574.1 protein_id gnl|my_center|LOCUS_01340 7830 7315 gene locus_tag LOCUS_01350 7830 7315 CDS product shikimate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535019.1 protein_id gnl|my_center|LOCUS_01350 <8690 7951 gene locus_tag LOCUS_01360 <8690 7951 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706966.1:type IV pilus secretin PilQ family protein >Feature sequence016 2272 518 gene locus_tag LOCUS_01370 2272 518 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_063173235.1 protein_id gnl|my_center|LOCUS_01370 3154 2351 gene locus_tag LOCUS_01380 3154 2351 CDS product lipid A biosynthesis lauroyl acyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114803.1 protein_id gnl|my_center|LOCUS_01380 3555 4088 gene locus_tag LOCUS_01390 gene xrtF 3555 4088 CDS product exosortase family protein XrtF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964136.1 protein_id gnl|my_center|LOCUS_01390 4090 4662 gene locus_tag LOCUS_01400 4090 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01400 5322 4663 gene locus_tag LOCUS_01410 5322 4663 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000101103.1 protein_id gnl|my_center|LOCUS_01410 6273 5332 gene locus_tag LOCUS_01420 6273 5332 CDS product phosphatidate cytidylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000932202.1 protein_id gnl|my_center|LOCUS_01420 6931 6266 gene locus_tag LOCUS_01430 6931 6266 CDS product CDP-alcohol phosphatidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000361855.1 protein_id gnl|my_center|LOCUS_01430 7316 6924 gene locus_tag LOCUS_01440 7316 6924 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01440 8125 7361 gene locus_tag LOCUS_01450 8125 7361 CDS product molybdopterin-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192990.1 protein_id gnl|my_center|LOCUS_01450 <8626 8126 gene locus_tag LOCUS_01460 <8626 8126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_023853055.1:ferrochelatase >Feature sequence017 2276 1986 gene locus_tag LOCUS_01470 2276 1986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01470 3078 2458 gene locus_tag LOCUS_01480 3078 2458 CDS product cytochrome c oxidase subunit 3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003118864.1 protein_id gnl|my_center|LOCUS_01480 3472 3071 gene locus_tag LOCUS_01490 3472 3071 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01490 4266 3472 gene locus_tag LOCUS_01500 gene nirQ 4266 3472 CDS product transcriptional regulator NirQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113240.1 protein_id gnl|my_center|LOCUS_01500 4733 4266 gene locus_tag LOCUS_01510 4733 4266 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01510 5031 4771 gene locus_tag LOCUS_01520 5031 4771 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01520 5630 5043 gene locus_tag LOCUS_01530 5630 5043 CDS product cytochrome c oxidase subunit 3 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011404826.1 protein_id gnl|my_center|LOCUS_01530 5719 5937 gene locus_tag LOCUS_01540 5719 5937 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01540 6294 5923 gene locus_tag LOCUS_01550 6294 5923 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01550 7823 6429 gene locus_tag LOCUS_01560 gene norB 7823 6429 CDS product nitric-oxide reductase subunit NorB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113237.1 protein_id gnl|my_center|LOCUS_01560 8264 7827 gene locus_tag LOCUS_01570 8264 7827 CDS product cytochrome c inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973802.1 protein_id gnl|my_center|LOCUS_01570 >Feature sequence018 435 19 gene locus_tag LOCUS_01580 435 19 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01580 1370 432 gene locus_tag LOCUS_01590 1370 432 CDS product DUF58 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948544.1 protein_id gnl|my_center|LOCUS_01590 2341 1370 gene locus_tag LOCUS_01600 2341 1370 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_01600 3891 2683 gene locus_tag LOCUS_01610 3891 2683 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01610 4930 4049 gene locus_tag LOCUS_01620 4930 4049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01620 6786 5338 gene locus_tag LOCUS_01630 gene gatB 6786 5338 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003313612.1 protein_id gnl|my_center|LOCUS_01630 8252 6789 gene locus_tag LOCUS_01640 gene gatA 8252 6789 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772005.1 protein_id gnl|my_center|LOCUS_01640 >Feature sequence019 <1 1034 gene locus_tag LOCUS_01650 <1 1034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013531232.1:cytochrome c peroxidase 2749 1040 gene locus_tag LOCUS_01660 2749 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01660 3124 4494 gene locus_tag LOCUS_01670 gene rhlB 3124 4494 CDS product ATP-dependent RNA helicase RhlB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458582.1 protein_id gnl|my_center|LOCUS_01670 4779 5891 gene locus_tag LOCUS_01680 4779 5891 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01680 6059 7177 gene locus_tag LOCUS_01690 6059 7177 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01690 7879 7574 gene locus_tag LOCUS_01700 gene bolA 7879 7574 CDS product transcriptional regulator BolA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261442.1 protein_id gnl|my_center|LOCUS_01700 8209 7925 gene locus_tag LOCUS_01710 8209 7925 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01710 >Feature sequence020 <1 654 gene locus_tag LOCUS_01720 <1 654 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011706898.1:PatB family C-S lyase 2199 655 gene locus_tag LOCUS_01730 2199 655 CDS product His-Xaa-Ser system-associated MauG-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457553.1 protein_id gnl|my_center|LOCUS_01730 2441 2875 gene locus_tag LOCUS_01740 2441 2875 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224933.1 protein_id gnl|my_center|LOCUS_01740 3597 2872 gene locus_tag LOCUS_01750 3597 2872 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01750 3674 5026 gene locus_tag LOCUS_01760 3674 5026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01760 5652 5023 gene locus_tag LOCUS_01770 5652 5023 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01770 6449 5757 gene locus_tag LOCUS_01780 6449 5757 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957920.1 protein_id gnl|my_center|LOCUS_01780 6602 7762 gene locus_tag LOCUS_01790 gene mnmH 6602 7762 CDS product tRNA 2-selenouridine(34) synthase MnmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266576.1 protein_id gnl|my_center|LOCUS_01790 8071 7817 gene locus_tag LOCUS_01800 8071 7817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01800 >Feature sequence021 <1 1937 gene locus_tag LOCUS_01810 <1 1937 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010980758.1:Rne/Rng family ribonuclease 1997 3544 gene locus_tag LOCUS_01820 gene glpD 1997 3544 CDS product glycerol-3-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067115.1 protein_id gnl|my_center|LOCUS_01820 3758 4069 gene locus_tag LOCUS_01830 3758 4069 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01830 >Feature sequence022 1030 482 gene locus_tag LOCUS_01840 1030 482 CDS product DsbE family thiol:disulfide interchange protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037370.1 protein_id gnl|my_center|LOCUS_01840 3012 1027 gene locus_tag LOCUS_01850 3012 1027 CDS product heme lyase CcmF/NrfE family subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268402.1 protein_id gnl|my_center|LOCUS_01850 3503 3009 gene locus_tag LOCUS_01860 gene ccmE 3503 3009 CDS product cytochrome c maturation protein CcmE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107323.1 protein_id gnl|my_center|LOCUS_01860 3747 3565 gene locus_tag LOCUS_01870 3747 3565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01870 4490 3744 gene locus_tag LOCUS_01880 gene ccmC 4490 3744 CDS product heme ABC transporter permease CcmC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063823.1 protein_id gnl|my_center|LOCUS_01880 5559 4888 gene locus_tag LOCUS_01890 gene ccmB 5559 4888 CDS product heme exporter protein CcmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070636.1 protein_id gnl|my_center|LOCUS_01890 6196 5552 gene locus_tag LOCUS_01900 gene ccmA 6196 5552 CDS product cytochrome c biogenesis heme-transporting ATPase CcmA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457758.1 protein_id gnl|my_center|LOCUS_01900 6769 6554 gene locus_tag LOCUS_01910 6769 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01910 7716 7087 gene locus_tag LOCUS_01920 7716 7087 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_01920 7992 7753 gene locus_tag LOCUS_01930 gene tusA 7992 7753 CDS product sulfurtransferase TusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024015099.1 protein_id gnl|my_center|LOCUS_01930 >Feature sequence023 790 1293 gene locus_tag LOCUS_01940 790 1293 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01940 1614 1300 gene locus_tag LOCUS_01950 1614 1300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_01950 1872 3161 gene locus_tag LOCUS_01960 1872 3161 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196631.1 protein_id gnl|my_center|LOCUS_01960 3187 4320 gene locus_tag LOCUS_01970 3187 4320 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004550279.1 protein_id gnl|my_center|LOCUS_01970 4424 5590 gene locus_tag LOCUS_01980 4424 5590 CDS product cellulase family glycosylhydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013094800.1 protein_id gnl|my_center|LOCUS_01980 6331 5543 gene locus_tag LOCUS_01990 gene znuB 6331 5543 CDS product zinc ABC transporter permease subunit ZnuB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455500.1 protein_id gnl|my_center|LOCUS_01990 7139 6324 gene locus_tag LOCUS_02000 gene znuC 7139 6324 CDS product zinc ABC transporter ATP-binding protein ZnuC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169189.1 protein_id gnl|my_center|LOCUS_02000 >Feature sequence024 554 174 gene locus_tag LOCUS_02010 554 174 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02010 716 1048 gene locus_tag LOCUS_02020 716 1048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02020 1484 1101 gene locus_tag LOCUS_02030 gene rplQ 1484 1101 CDS product 50S ribosomal protein L17 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648400.1 protein_id gnl|my_center|LOCUS_02030 2526 1528 gene locus_tag LOCUS_02040 gene rpoA 2526 1528 CDS product DNA-directed RNA polymerase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555464.1 protein_id gnl|my_center|LOCUS_02040 3194 2574 gene locus_tag LOCUS_02050 gene rpsD 3194 2574 CDS product 30S ribosomal protein S4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215455.1 protein_id gnl|my_center|LOCUS_02050 3638 3252 gene locus_tag LOCUS_02060 gene rpsK 3638 3252 CDS product 30S ribosomal protein S11 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555466.1 protein_id gnl|my_center|LOCUS_02060 4059 3703 gene locus_tag LOCUS_02070 gene rpsM 4059 3703 CDS product 30S ribosomal protein S13 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005648406.1 protein_id gnl|my_center|LOCUS_02070 5694 4333 gene locus_tag LOCUS_02080 gene secY 5694 4333 CDS product preprotein translocase subunit SecY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003806926.1 protein_id gnl|my_center|LOCUS_02080 6163 5729 gene locus_tag LOCUS_02090 gene rplO 6163 5729 CDS product 50S ribosomal protein L15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005450562.1 protein_id gnl|my_center|LOCUS_02090 6407 6210 gene locus_tag LOCUS_02100 gene rpmD 6407 6210 CDS product 50S ribosomal protein L30 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093696.1 protein_id gnl|my_center|LOCUS_02100 6919 6410 gene locus_tag LOCUS_02110 gene rpsE 6919 6410 CDS product 30S ribosomal protein S5 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940115.1 protein_id gnl|my_center|LOCUS_02110 7285 6932 gene locus_tag LOCUS_02120 gene rplR 7285 6932 CDS product 50S ribosomal protein L18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005625873.1 protein_id gnl|my_center|LOCUS_02120 7876 7340 gene locus_tag LOCUS_02130 gene rplF 7876 7340 CDS product 50S ribosomal protein L6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768939.1 protein_id gnl|my_center|LOCUS_02130 >Feature sequence025 534 277 gene locus_tag LOCUS_02140 534 277 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02140 283 292 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1814 885 gene locus_tag LOCUS_02150 gene hemC 1814 885 CDS product hydroxymethylbilane synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002211465.1 protein_id gnl|my_center|LOCUS_02150 2095 2610 gene locus_tag LOCUS_02160 2095 2610 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02160 3422 2679 gene locus_tag LOCUS_02170 3422 2679 CDS product LytTR family DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007247212.1 protein_id gnl|my_center|LOCUS_02170 4477 3425 gene locus_tag LOCUS_02180 gene algZ 4477 3425 CDS product alginate biosynthesis two-component system sensor histidine kinase AlgZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096404.1 protein_id gnl|my_center|LOCUS_02180 4700 6115 gene locus_tag LOCUS_02190 gene argH 4700 6115 CDS product argininosuccinate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103000.1 protein_id gnl|my_center|LOCUS_02190 6132 6773 gene locus_tag LOCUS_02200 gene queE 6132 6773 CDS product 7-carboxy-7-deazaguanine synthase QueE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769397.1 protein_id gnl|my_center|LOCUS_02200 7644 6775 gene locus_tag LOCUS_02210 7644 6775 CDS product DNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011262037.1 protein_id gnl|my_center|LOCUS_02210 >Feature sequence026 >Feature sequence027 638 1882 gene locus_tag LOCUS_02220 638 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02220 1908 3206 gene locus_tag LOCUS_02230 1908 3206 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02230 3559 3341 gene locus_tag LOCUS_02240 3559 3341 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02240 3717 5756 gene locus_tag LOCUS_02250 3717 5756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02250 6105 6554 gene locus_tag LOCUS_02260 6105 6554 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02260 >Feature sequence028 3100 1199 gene locus_tag LOCUS_02270 gene nuoL 3100 1199 CDS product NADH-quinone oxidoreductase subunit L inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001200192.1 protein_id gnl|my_center|LOCUS_02270 3402 3100 gene locus_tag LOCUS_02280 gene nuoK 3402 3100 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000579761.1 protein_id gnl|my_center|LOCUS_02280 3962 3399 gene locus_tag LOCUS_02290 3962 3399 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000464208.1 protein_id gnl|my_center|LOCUS_02290 4597 3974 gene locus_tag LOCUS_02300 gene nuoI 4597 3974 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002851456.1 protein_id gnl|my_center|LOCUS_02300 5638 4607 gene locus_tag LOCUS_02310 gene nuoH 5638 4607 CDS product NADH-quinone oxidoreductase subunit NuoH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001277308.1 protein_id gnl|my_center|LOCUS_02310 <7480 5640 gene locus_tag LOCUS_02320 <7480 5640 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010891945.1:NADH-quinone oxidoreductase subunit G >Feature sequence029 <1 620 gene locus_tag LOCUS_02330 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011088518.1:FAD/NAD(P)-binding oxidoreductase 775 1641 gene locus_tag LOCUS_02340 gene nadC 775 1641 CDS product carboxylating nicotinate-nucleotide diphosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957378.1 protein_id gnl|my_center|LOCUS_02340 1794 2741 gene locus_tag LOCUS_02350 1794 2741 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02350 3025 2837 gene locus_tag LOCUS_02360 3025 2837 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02360 3191 3015 gene locus_tag LOCUS_02370 3191 3015 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02370 5066 3216 gene locus_tag LOCUS_02380 gene ilvD 5066 3216 CDS product dihydroxy-acid dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105291.1 protein_id gnl|my_center|LOCUS_02380 5168 5443 gene locus_tag LOCUS_02390 5168 5443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02390 7025 5733 gene locus_tag LOCUS_02400 7025 5733 CDS product patatin-like phospholipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943221.1 protein_id gnl|my_center|LOCUS_02400 >Feature sequence030 42 1553 gene locus_tag LOCUS_02410 gene glpK 42 1553 CDS product glycerol kinase GlpK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531806.1 protein_id gnl|my_center|LOCUS_02410 2708 1617 gene locus_tag LOCUS_02420 gene apbC 2708 1617 CDS product iron-sulfur cluster carrier protein ApbC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193796.1 protein_id gnl|my_center|LOCUS_02420 2928 6872 gene locus_tag LOCUS_02430 gene purL 2928 6872 CDS product phosphoribosylformylglycinamidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819788.1 protein_id gnl|my_center|LOCUS_02430 >Feature sequence031 480 974 gene locus_tag LOCUS_02440 480 974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02440 2315 1344 gene locus_tag LOCUS_02450 2315 1344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02450 2817 2326 gene locus_tag LOCUS_02460 gene rppH 2817 2326 CDS product RNA pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417607.1 protein_id gnl|my_center|LOCUS_02460 6136 2987 gene locus_tag LOCUS_02470 6136 2987 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02470 6378 7031 gene locus_tag LOCUS_02480 6378 7031 CDS product HAD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105407.1 protein_id gnl|my_center|LOCUS_02480 >Feature sequence032 1236 607 gene locus_tag LOCUS_02490 1236 607 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02490 1844 1359 gene locus_tag LOCUS_02500 1844 1359 CDS product asparaginase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036092.1 protein_id gnl|my_center|LOCUS_02500 3581 1935 gene locus_tag LOCUS_02510 3581 1935 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013527943.1 protein_id gnl|my_center|LOCUS_02510 4624 3578 gene locus_tag LOCUS_02520 4624 3578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02520 6185 4806 gene locus_tag LOCUS_02530 6185 4806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02530 <6988 6211 gene locus_tag LOCUS_02540 <6988 6211 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012545811.1:peptide-binding protein >Feature sequence033 422 3076 gene locus_tag LOCUS_02550 gene leuS 422 3076 CDS product leucine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100324.1 protein_id gnl|my_center|LOCUS_02550 3077 3592 gene locus_tag LOCUS_02560 3077 3592 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02560 3650 4930 gene locus_tag LOCUS_02570 3650 4930 CDS product lytic murein transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114332.1 protein_id gnl|my_center|LOCUS_02570 <6933 4923 gene locus_tag LOCUS_02580 <6933 4923 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122758.1:TIGR03032 family protein >Feature sequence034 <1 700 gene locus_tag LOCUS_02590 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003147051.1:serine/threonine protein kinase PpkA 718 1410 gene locus_tag LOCUS_02600 718 1410 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_02600 1599 1808 gene locus_tag LOCUS_02610 1599 1808 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720124.1 protein_id gnl|my_center|LOCUS_02610 2051 2734 gene locus_tag LOCUS_02620 2051 2734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02620 2803 4347 gene locus_tag LOCUS_02630 2803 4347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02630 5575 4364 gene locus_tag LOCUS_02640 gene glcF 5575 4364 CDS product glycolate oxidase subunit GlcF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001194680.1 protein_id gnl|my_center|LOCUS_02640 6688 5579 gene locus_tag LOCUS_02650 gene glcE 6688 5579 CDS product glycolate oxidase subunit GlcE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000943100.1 protein_id gnl|my_center|LOCUS_02650 >Feature sequence035 567 337 gene locus_tag LOCUS_02660 567 337 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02660 775 1614 gene locus_tag LOCUS_02670 775 1614 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02670 2769 1867 gene locus_tag LOCUS_02680 2769 1867 CDS product ROK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390380.1 protein_id gnl|my_center|LOCUS_02680 1874 1883 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2888 3394 gene locus_tag LOCUS_02690 2888 3394 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02690 3840 4955 gene locus_tag LOCUS_02700 gene ald 3840 4955 CDS product alanine dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072305.1 protein_id gnl|my_center|LOCUS_02700 5066 5752 gene locus_tag LOCUS_02710 5066 5752 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02710 5933 6508 gene locus_tag LOCUS_02720 5933 6508 CDS product LemA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094011.1 protein_id gnl|my_center|LOCUS_02720 >Feature sequence036 4545 2323 gene locus_tag LOCUS_02730 4545 2323 CDS product zinc-dependent metalloprotease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_206819627.1 protein_id gnl|my_center|LOCUS_02730 4757 5335 gene locus_tag LOCUS_02740 4757 5335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02740 6632 5322 gene locus_tag LOCUS_02750 gene hflX 6632 5322 CDS product GTPase HflX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113930.1 protein_id gnl|my_center|LOCUS_02750 >Feature sequence037 594 166 gene locus_tag LOCUS_02760 594 166 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02760 921 2135 gene locus_tag LOCUS_02770 gene sat 921 2135 CDS product sulfate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932543.1 protein_id gnl|my_center|LOCUS_02770 2221 2688 gene locus_tag LOCUS_02780 gene aprB 2221 2688 CDS product adenylyl-sulfate reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932545.1 protein_id gnl|my_center|LOCUS_02780 2745 4760 gene locus_tag LOCUS_02790 gene aprA 2745 4760 CDS product adenylyl-sulfate reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932546.1 protein_id gnl|my_center|LOCUS_02790 4958 5926 gene locus_tag LOCUS_02800 4958 5926 CDS product YkgJ family cysteine cluster protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932553.1 protein_id gnl|my_center|LOCUS_02800 5948 6466 gene locus_tag LOCUS_02810 5948 6466 CDS product metallophosphoesterase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005762812.1 protein_id gnl|my_center|LOCUS_02810 >Feature sequence038 791 1354 gene locus_tag LOCUS_02820 791 1354 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02820 2165 1530 gene locus_tag LOCUS_02830 2165 1530 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029216900.1 protein_id gnl|my_center|LOCUS_02830 3432 2299 gene locus_tag LOCUS_02840 gene galE 3432 2299 CDS product UDP-glucose 4-epimerase GalE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003244356.1 protein_id gnl|my_center|LOCUS_02840 4266 3523 gene locus_tag LOCUS_02850 4266 3523 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02850 5542 4328 gene locus_tag LOCUS_02860 gene gspF 5542 4328 CDS product type II secretion system inner membrane protein GspF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070565.1 protein_id gnl|my_center|LOCUS_02860 <6574 5549 gene locus_tag LOCUS_02870 <6574 5549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091377.1:GspE family T2SS ATPase variant XcpR >Feature sequence039 781 161 gene locus_tag LOCUS_02880 781 161 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02880 1824 781 gene locus_tag LOCUS_02890 1824 781 CDS product inorganic phosphate transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000380272.1 protein_id gnl|my_center|LOCUS_02890 3132 1831 gene locus_tag LOCUS_02900 3132 1831 CDS product amino acid permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010879270.1 protein_id gnl|my_center|LOCUS_02900 3728 3495 gene locus_tag LOCUS_02910 3728 3495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02910 4542 3763 gene locus_tag LOCUS_02920 4542 3763 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02920 4763 6184 gene locus_tag LOCUS_02930 4763 6184 CDS product phospholipase D-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038211423.1 protein_id gnl|my_center|LOCUS_02930 >Feature sequence040 1744 125 gene locus_tag LOCUS_02940 gene merA 1744 125 CDS product mercury(II) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000105636.1 protein_id gnl|my_center|LOCUS_02940 2210 1827 gene locus_tag LOCUS_02950 gene merR 2210 1827 CDS product Hg(II)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000429836.1 protein_id gnl|my_center|LOCUS_02950 2923 2225 gene locus_tag LOCUS_02960 2923 2225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02960 3463 2990 gene locus_tag LOCUS_02970 3463 2990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02970 5330 3552 gene locus_tag LOCUS_02980 5330 3552 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_02980 5739 5356 gene locus_tag LOCUS_02990 5739 5356 CDS product DUF6394 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880147.1 protein_id gnl|my_center|LOCUS_02990 <6422 5867 gene locus_tag LOCUS_03000 <6422 5867 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003808382.1:dCTP deaminase >Feature sequence041 417 1757 gene locus_tag LOCUS_03010 417 1757 CDS product TRAP transporter large permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005483284.1 protein_id gnl|my_center|LOCUS_03010 2648 1791 gene locus_tag LOCUS_03020 2648 1791 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920959.1 protein_id gnl|my_center|LOCUS_03020 4216 2852 gene locus_tag LOCUS_03030 4216 2852 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03030 5525 4203 gene locus_tag LOCUS_03040 5525 4203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03040 <6413 5545 gene locus_tag LOCUS_03050 <6413 5545 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence042 447 920 gene locus_tag LOCUS_03060 447 920 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071580.1 protein_id gnl|my_center|LOCUS_03060 985 1689 gene locus_tag LOCUS_03070 985 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03070 2026 2760 gene locus_tag LOCUS_03080 2026 2760 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03080 3048 2972 gene locus_tag LOCUS_t00020 3048 2972 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 5047 3104 gene locus_tag LOCUS_03090 gene rpoD 5047 3104 CDS product RNA polymerase sigma factor RpoD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085035.1 protein_id gnl|my_center|LOCUS_03090 <6360 5221 gene locus_tag LOCUS_03100 <6360 5221 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262668.1:DNA primase >Feature sequence043 1243 5 gene locus_tag LOCUS_03110 1243 5 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03110 2526 1426 gene locus_tag LOCUS_03120 2526 1426 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03120 5173 2858 gene locus_tag LOCUS_03130 gene nosZ 5173 2858 CDS product Sec-dependent nitrous-oxide reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011458974.1 protein_id gnl|my_center|LOCUS_03130 5458 6183 gene locus_tag LOCUS_03140 gene ubiE 5458 6183 CDS product bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005165601.1 protein_id gnl|my_center|LOCUS_03140 >Feature sequence044 1555 2433 gene locus_tag LOCUS_03150 1555 2433 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03150 2844 3347 gene locus_tag LOCUS_03160 gene purE 2844 3347 CDS product 5-(carboxyamino)imidazole ribonucleotide mutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003688684.1 protein_id gnl|my_center|LOCUS_03160 3352 4503 gene locus_tag LOCUS_03170 3352 4503 CDS product 5-(carboxyamino)imidazole ribonucleotide synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522681.1 protein_id gnl|my_center|LOCUS_03170 4528 4893 gene locus_tag LOCUS_03180 4528 4893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03180 4914 5504 gene locus_tag LOCUS_03190 4914 5504 CDS product methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_052846295.1 protein_id gnl|my_center|LOCUS_03190 5501 5986 gene locus_tag LOCUS_03200 5501 5986 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03200 >Feature sequence045 990 148 gene locus_tag LOCUS_03210 990 148 CDS product SDR family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261481.1 protein_id gnl|my_center|LOCUS_03210 1135 1425 gene locus_tag LOCUS_03220 1135 1425 CDS product zinc ribbon domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772089.1 protein_id gnl|my_center|LOCUS_03220 1483 2142 gene locus_tag LOCUS_03230 1483 2142 CDS product DUF502 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947206.1 protein_id gnl|my_center|LOCUS_03230 2214 3980 gene locus_tag LOCUS_03240 2214 3980 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037772.1 protein_id gnl|my_center|LOCUS_03240 4519 4037 gene locus_tag LOCUS_03250 4519 4037 CDS product low molecular weight protein-tyrosine-phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812465.1 protein_id gnl|my_center|LOCUS_03250 5745 4708 gene locus_tag LOCUS_03260 5745 4708 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_03260 <6326 5700 gene locus_tag LOCUS_03270 <6326 5700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_041594898.1:HsdR family type I site-specific deoxyribonuclease note possible pseudo, frameshifted >Feature sequence046 229 723 gene locus_tag LOCUS_03280 229 723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03280 1889 1041 gene locus_tag LOCUS_03290 1889 1041 CDS product crotonase/enoyl-CoA hydratase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_026018353.1 protein_id gnl|my_center|LOCUS_03290 3314 2625 gene locus_tag LOCUS_03300 gene rsuA 3314 2625 CDS product 16S rRNA pseudouridine(516) synthase RsuA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706653.1 protein_id gnl|my_center|LOCUS_03300 4894 3599 gene locus_tag LOCUS_03310 4894 3599 CDS product adenylosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095642.1 protein_id gnl|my_center|LOCUS_03310 6130 4934 gene locus_tag LOCUS_03320 6130 4934 CDS product ATP phosphoribosyltransferase regulatory subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003402926.1 protein_id gnl|my_center|LOCUS_03320 >Feature sequence047 454 969 gene locus_tag LOCUS_03330 454 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03330 1655 1056 gene locus_tag LOCUS_03340 1655 1056 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03340 6011 1734 gene locus_tag LOCUS_03350 6011 1734 CDS product DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011122252.1 protein_id gnl|my_center|LOCUS_03350 6224 6300 gene locus_tag LOCUS_t00030 6224 6300 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence048 1574 264 gene locus_tag LOCUS_03360 gene aceF 1574 264 CDS product dihydrolipoyllysine-residue acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063727.1 protein_id gnl|my_center|LOCUS_03360 4262 1587 gene locus_tag LOCUS_03370 gene aceE 4262 1587 CDS product pyruvate dehydrogenase (acetyl-transferring), homodimeric type inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114556.1 protein_id gnl|my_center|LOCUS_03370 4519 5187 gene locus_tag LOCUS_03380 gene rnt 4519 5187 CDS product ribonuclease T inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092070.1 protein_id gnl|my_center|LOCUS_03380 5916 5278 gene locus_tag LOCUS_03390 gene hflD 5916 5278 CDS product high frequency lysogenization protein HflD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405097.1 protein_id gnl|my_center|LOCUS_03390 >Feature sequence049 725 1474 gene locus_tag LOCUS_03400 725 1474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03400 1801 2685 gene locus_tag LOCUS_03410 1801 2685 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03410 2682 3821 gene locus_tag LOCUS_03420 2682 3821 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03420 3851 5164 gene locus_tag LOCUS_03430 3851 5164 CDS product O-antigen ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010920287.1 protein_id gnl|my_center|LOCUS_03430 5578 5384 gene locus_tag LOCUS_03440 5578 5384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03440 >Feature sequence050 1410 853 gene locus_tag LOCUS_03450 gene frr 1410 853 CDS product ribosome recycling factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947438.1 protein_id gnl|my_center|LOCUS_03450 2160 1444 gene locus_tag LOCUS_03460 gene pyrH 2160 1444 CDS product UMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036563.1 protein_id gnl|my_center|LOCUS_03460 3166 2285 gene locus_tag LOCUS_03470 gene tsf 3166 2285 CDS product translation elongation factor Ts inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947440.1 protein_id gnl|my_center|LOCUS_03470 4368 3205 gene locus_tag LOCUS_03480 4368 3205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03480 4678 5463 gene locus_tag LOCUS_03490 gene map 4678 5463 CDS product type I methionyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947446.1 protein_id gnl|my_center|LOCUS_03490 >Feature sequence051 280 1161 gene locus_tag LOCUS_03500 280 1161 CDS product DUF4743 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011387967.1 protein_id gnl|my_center|LOCUS_03500 1196 2641 gene locus_tag LOCUS_03510 1196 2641 CDS product leucyl aminopeptidase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038979.1 protein_id gnl|my_center|LOCUS_03510 2973 2695 gene locus_tag LOCUS_03520 2973 2695 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03520 4181 3813 gene locus_tag LOCUS_03530 4181 3813 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03530 4377 5081 gene locus_tag LOCUS_03540 gene cmk 4377 5081 CDS product (d)CMP kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072382.1 protein_id gnl|my_center|LOCUS_03540 >Feature sequence052 2075 741 gene locus_tag LOCUS_03550 gene egtB 2075 741 CDS product ergothioneine biosynthesis protein EgtB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226793.1 protein_id gnl|my_center|LOCUS_03550 2947 2189 gene locus_tag LOCUS_03560 2947 2189 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011250964.1 protein_id gnl|my_center|LOCUS_03560 4215 3034 gene locus_tag LOCUS_03570 4215 3034 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002208500.1 protein_id gnl|my_center|LOCUS_03570 5809 4298 gene locus_tag LOCUS_03580 5809 4298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03580 >Feature sequence053 1606 200 gene locus_tag LOCUS_03590 gene ccoG 1606 200 CDS product cytochrome c oxidase accessory protein CcoG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011088522.1 protein_id gnl|my_center|LOCUS_03590 3081 2134 gene locus_tag LOCUS_03600 gene ccoP 3081 2134 CDS product cytochrome-c oxidase, cbb3-type subunit III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919280.1 protein_id gnl|my_center|LOCUS_03600 3286 3083 gene locus_tag LOCUS_03610 3286 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03610 4075 3320 gene locus_tag LOCUS_03620 gene ccoO 4075 3320 CDS product cytochrome-c oxidase, cbb3-type subunit II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010971696.1 protein_id gnl|my_center|LOCUS_03620 5584 4109 gene locus_tag LOCUS_03630 gene ccoN 5584 4109 CDS product cytochrome-c oxidase, cbb3-type subunit I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013525002.1 protein_id gnl|my_center|LOCUS_03630 >Feature sequence054 1117 167 gene locus_tag LOCUS_03640 gene pip 1117 167 CDS product prolyl aminopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095918.1 protein_id gnl|my_center|LOCUS_03640 1715 1140 gene locus_tag LOCUS_03650 1715 1140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03650 1841 4036 gene locus_tag LOCUS_03660 gene fadB 1841 4036 CDS product fatty acid oxidation complex subunit alpha FadB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091204.1 protein_id gnl|my_center|LOCUS_03660 4033 5211 gene locus_tag LOCUS_03670 gene fadA 4033 5211 CDS product acetyl-CoA C-acyltransferase FadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704164.1 protein_id gnl|my_center|LOCUS_03670 >Feature sequence055 12 932 gene locus_tag LOCUS_03680 12 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03680 2296 1040 gene locus_tag LOCUS_03690 2296 1040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03690 3915 2779 gene locus_tag LOCUS_03700 3915 2779 CDS product glycerate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010868664.1 protein_id gnl|my_center|LOCUS_03700 5144 3942 gene locus_tag LOCUS_03710 5144 3942 CDS product O-succinylhomoserine sulfhydrylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267161.1 protein_id gnl|my_center|LOCUS_03710 5643 5281 gene locus_tag LOCUS_03720 5643 5281 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03720 >Feature sequence056 1172 564 gene locus_tag LOCUS_03730 gene petA 1172 564 CDS product ubiquinol-cytochrome c reductase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215005.1 protein_id gnl|my_center|LOCUS_03730 4554 1363 gene locus_tag LOCUS_03740 gene sbcC 4554 1363 CDS product exonuclease subunit SbcC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000698903.1 protein_id gnl|my_center|LOCUS_03740 <5834 4551 gene locus_tag LOCUS_03750 <5834 4551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002208687.1:exonuclease subunit SbcD >Feature sequence057 1293 529 gene locus_tag LOCUS_03760 1293 529 CDS product SDR family NAD(P)-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811236.1 protein_id gnl|my_center|LOCUS_03760 2567 1290 gene locus_tag LOCUS_03770 2567 1290 CDS product capsular biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522170.1 protein_id gnl|my_center|LOCUS_03770 2957 4522 gene locus_tag LOCUS_03780 2957 4522 CDS product S41 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480646.1 protein_id gnl|my_center|LOCUS_03780 4916 4533 gene locus_tag LOCUS_03790 gene gloA 4916 4533 CDS product lactoylglutathione lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189937.1 protein_id gnl|my_center|LOCUS_03790 <5806 4949 gene locus_tag LOCUS_03800 <5806 4949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022640.1:tRNA 2-thiouridine(34) synthase MnmA >Feature sequence058 1072 2421 gene locus_tag LOCUS_03810 1072 2421 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03810 3203 2847 gene locus_tag LOCUS_03820 gene erpA 3203 2847 CDS product iron-sulfur cluster insertion protein ErpA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005304404.1 protein_id gnl|my_center|LOCUS_03820 3830 3441 gene locus_tag LOCUS_03830 3830 3441 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03830 4800 3853 gene locus_tag LOCUS_03840 4800 3853 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03840 <5792 4815 gene locus_tag LOCUS_03850 <5792 4815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005767875.1:N-acetyl-gamma-glutamyl-phosphate reductase >Feature sequence059 2023 734 gene locus_tag LOCUS_03860 2023 734 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03860 3387 2311 gene locus_tag LOCUS_03870 gene queG 3387 2311 CDS product tRNA epoxyqueuosine(34) reductase QueG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003110324.1 protein_id gnl|my_center|LOCUS_03870 3421 5022 gene locus_tag LOCUS_03880 3421 5022 CDS product bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105241.1 protein_id gnl|my_center|LOCUS_03880 5015 5479 gene locus_tag LOCUS_03890 gene tsaE 5015 5479 CDS product tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209146.1 protein_id gnl|my_center|LOCUS_03890 >Feature sequence060 949 755 gene locus_tag LOCUS_03900 949 755 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03900 1430 999 gene locus_tag LOCUS_03910 1430 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03910 2359 1490 gene locus_tag LOCUS_03920 2359 1490 CDS product DNA cytosine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_080803342.1 protein_id gnl|my_center|LOCUS_03920 2540 2346 gene locus_tag LOCUS_03930 2540 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03930 2837 2661 gene locus_tag LOCUS_03940 2837 2661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03940 3284 3045 gene locus_tag LOCUS_03950 3284 3045 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03950 3808 3284 gene locus_tag LOCUS_03960 3808 3284 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03960 4548 3808 gene locus_tag LOCUS_03970 4548 3808 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03970 4608 4961 gene locus_tag LOCUS_03980 4608 4961 CDS product DUF2513 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693956.1 protein_id gnl|my_center|LOCUS_03980 5129 4899 gene locus_tag LOCUS_03990 5129 4899 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_03990 >Feature sequence061 1046 66 gene locus_tag LOCUS_04000 gene ispB 1046 66 CDS product octaprenyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164925908.1 protein_id gnl|my_center|LOCUS_04000 1291 1548 gene locus_tag LOCUS_04010 gene rpmA 1291 1548 CDS product 50S ribosomal protein L27 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000940593.1 protein_id gnl|my_center|LOCUS_04010 1947 3008 gene locus_tag LOCUS_04020 gene cgtA 1947 3008 CDS product Obg family GTPase CgtA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094758.1 protein_id gnl|my_center|LOCUS_04020 3001 4125 gene locus_tag LOCUS_04030 gene proB 3001 4125 CDS product glutamate 5-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403542.1 protein_id gnl|my_center|LOCUS_04030 >Feature sequence062 737 399 gene locus_tag LOCUS_04040 737 399 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04040 2254 812 gene locus_tag LOCUS_04050 2254 812 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04050 857 866 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2454 2723 gene locus_tag LOCUS_04060 gene rpsO 2454 2723 CDS product 30S ribosomal protein S15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417682.1 protein_id gnl|my_center|LOCUS_04060 2898 4985 gene locus_tag LOCUS_04070 gene pnp 2898 4985 CDS product polyribonucleotide nucleotidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005456067.1 protein_id gnl|my_center|LOCUS_04070 >Feature sequence063 3381 2446 gene locus_tag LOCUS_04080 gene ylqF 3381 2446 CDS product ribosome biogenesis GTPase YlqF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000247909.1 protein_id gnl|my_center|LOCUS_04080 4673 3414 gene locus_tag LOCUS_04090 4673 3414 CDS product SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958470.1 protein_id gnl|my_center|LOCUS_04090 4609 5358 gene locus_tag LOCUS_04100 4609 5358 CDS product pteridine reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015443912.1 protein_id gnl|my_center|LOCUS_04100 >Feature sequence064 51 359 gene locus_tag LOCUS_04110 51 359 CDS product chaperone NapD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082422.1 protein_id gnl|my_center|LOCUS_04110 391 2970 gene locus_tag LOCUS_04120 gene napA 391 2970 CDS product nitrate reductase catalytic subunit NapA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705481.1 protein_id gnl|my_center|LOCUS_04120 3047 3991 gene locus_tag LOCUS_04130 gene napG 3047 3991 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705482.1 protein_id gnl|my_center|LOCUS_04130 3991 4905 gene locus_tag LOCUS_04140 gene napH 3991 4905 CDS product quinol dehydrogenase ferredoxin subunit NapH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705483.1 protein_id gnl|my_center|LOCUS_04140 4972 5451 gene locus_tag LOCUS_04150 4972 5451 CDS product nitrate reductase cytochrome c-type subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705484.1 protein_id gnl|my_center|LOCUS_04150 >Feature sequence065 327 3458 gene locus_tag LOCUS_04160 327 3458 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261108.1 protein_id gnl|my_center|LOCUS_04160 4676 3471 gene locus_tag LOCUS_04170 4676 3471 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04170 >Feature sequence066 <1 1367 gene locus_tag LOCUS_04180 <1 1367 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011106392.1:DUF1800 domain-containing protein 1378 3030 gene locus_tag LOCUS_04190 1378 3030 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_04190 3131 4687 gene locus_tag LOCUS_04200 gene murJ 3131 4687 CDS product murein biosynthesis integral membrane protein MurJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073367.1 protein_id gnl|my_center|LOCUS_04200 >Feature sequence067 264 1547 gene locus_tag LOCUS_04210 gene hisS 264 1547 CDS product histidine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417932.1 protein_id gnl|my_center|LOCUS_04210 1609 2274 gene locus_tag LOCUS_04220 1609 2274 CDS product tetratricopeptide repeat protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705647.1 protein_id gnl|my_center|LOCUS_04220 2280 3458 gene locus_tag LOCUS_04230 gene bamB 2280 3458 CDS product outer membrane protein assembly factor BamB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209814.1 protein_id gnl|my_center|LOCUS_04230 4487 3510 gene locus_tag LOCUS_04240 4487 3510 CDS product zinc-binding alcohol dehydrogenase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011729488.1 protein_id gnl|my_center|LOCUS_04240 4589 5458 gene locus_tag LOCUS_04250 4589 5458 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113260.1 protein_id gnl|my_center|LOCUS_04250 >Feature sequence068 1157 408 gene locus_tag LOCUS_04260 gene rsmE 1157 408 CDS product 16S rRNA (uracil(1498)-N(3))-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706913.1 protein_id gnl|my_center|LOCUS_04260 1300 1812 gene locus_tag LOCUS_04270 1300 1812 CDS product DsrE/DsrF/DrsH-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932542.1 protein_id gnl|my_center|LOCUS_04270 3053 2013 gene locus_tag LOCUS_04280 3053 2013 CDS product aldo/keto reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021005.1 protein_id gnl|my_center|LOCUS_04280 3248 3553 gene locus_tag LOCUS_04290 3248 3553 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04290 4275 4351 gene locus_tag LOCUS_t00040 4275 4351 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 5303 4662 gene locus_tag LOCUS_04300 5303 4662 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04300 >Feature sequence069 <1 563 gene locus_tag LOCUS_04310 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261379.1:LysR substrate-binding domain-containing protein 3821 750 gene locus_tag LOCUS_04320 3821 750 CDS product efflux RND transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393846.1 protein_id gnl|my_center|LOCUS_04320 5087 3834 gene locus_tag LOCUS_04330 5087 3834 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04330 >Feature sequence070 <1 782 gene locus_tag LOCUS_04340 <1 782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000403632.1:inorganic phosphate transporter 815 2179 gene locus_tag LOCUS_04350 815 2179 CDS product esterase-like activity of phytase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388984.1 protein_id gnl|my_center|LOCUS_04350 2902 4326 gene locus_tag LOCUS_04360 gene gnd 2902 4326 CDS product decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263332.1 protein_id gnl|my_center|LOCUS_04360 >Feature sequence071 <1 716 gene locus_tag LOCUS_04370 <1 716 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105332.1:primosomal protein N' 965 1639 gene locus_tag LOCUS_04380 965 1639 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04380 1787 3040 gene locus_tag LOCUS_04390 1787 3040 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04390 >Feature sequence072 768 196 gene locus_tag LOCUS_04400 768 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04400 945 1190 gene locus_tag LOCUS_04410 945 1190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04410 1187 2818 gene locus_tag LOCUS_04420 1187 2818 CDS product acetolactate synthase large subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920935.1 protein_id gnl|my_center|LOCUS_04420 2883 3176 gene locus_tag LOCUS_04430 2883 3176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04430 3173 4051 gene locus_tag LOCUS_04440 3173 4051 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990622.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04440 >Feature sequence073 <1 673 gene locus_tag LOCUS_04450 <1 673 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207969.1:thiamine-phosphate kinase 666 1163 gene locus_tag LOCUS_04460 666 1163 CDS product phosphatidylglycerophosphatase A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073310.1 protein_id gnl|my_center|LOCUS_04460 1248 3083 gene locus_tag LOCUS_04470 1248 3083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04470 3129 3461 gene locus_tag LOCUS_04480 3129 3461 CDS product YbaB/EbfC family nucleoid-associated protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000467098.1 protein_id gnl|my_center|LOCUS_04480 3480 4076 gene locus_tag LOCUS_04490 gene recR 3480 4076 CDS product recombination mediator RecR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072099.1 protein_id gnl|my_center|LOCUS_04490 4271 4615 gene locus_tag LOCUS_04500 4271 4615 CDS product histidine triad nucleotide-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012047999.1 protein_id gnl|my_center|LOCUS_04500 <5321 4635 gene locus_tag LOCUS_04510 <5321 4635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037833.1:EAL domain-containing protein >Feature sequence074 245 754 gene locus_tag LOCUS_04520 245 754 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04520 3799 1112 gene locus_tag LOCUS_04530 3799 1112 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04530 4568 3996 gene locus_tag LOCUS_04540 4568 3996 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04540 >Feature sequence075 4 1689 gene locus_tag LOCUS_04550 4 1689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04550 1727 2671 gene locus_tag LOCUS_04560 1727 2671 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04560 3173 2676 gene locus_tag LOCUS_04570 gene tpx 3173 2676 CDS product thiol peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_165439256.1 protein_id gnl|my_center|LOCUS_04570 3521 3258 gene locus_tag LOCUS_04580 gene minE 3521 3258 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002552653.1 protein_id gnl|my_center|LOCUS_04580 4364 3555 gene locus_tag LOCUS_04590 gene minD 4364 3555 CDS product septum site-determining protein MinD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002215463.1 protein_id gnl|my_center|LOCUS_04590 <5250 4560 gene locus_tag LOCUS_04600 <5250 4560 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705993.1:septum site-determining protein MinC >Feature sequence076 3 212 gene locus_tag LOCUS_04610 3 212 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04610 443 1654 gene locus_tag LOCUS_04620 gene lapB 443 1654 CDS product lipopolysaccharide assembly protein LapB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013096375.1 protein_id gnl|my_center|LOCUS_04620 1798 2487 gene locus_tag LOCUS_04630 gene pyrF 1798 2487 CDS product orotidine-5'-phosphate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005420156.1 protein_id gnl|my_center|LOCUS_04630 3888 2512 gene locus_tag LOCUS_04640 gene mgtE 3888 2512 CDS product magnesium transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478833.1 protein_id gnl|my_center|LOCUS_04640 4404 5153 gene locus_tag LOCUS_04650 4404 5153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04650 >Feature sequence077 1215 778 gene locus_tag LOCUS_04660 1215 778 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04660 1698 2843 gene locus_tag LOCUS_04670 1698 2843 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04670 2924 5065 gene locus_tag LOCUS_04680 2924 5065 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04680 >Feature sequence078 3144 2524 gene locus_tag LOCUS_04690 3144 2524 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04690 3782 3144 gene locus_tag LOCUS_04700 3782 3144 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04700 4205 3789 gene locus_tag LOCUS_04710 4205 3789 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04710 4703 4254 gene locus_tag LOCUS_04720 4703 4254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04720 >Feature sequence079 216 1619 gene locus_tag LOCUS_04730 216 1619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04730 2765 1821 gene locus_tag LOCUS_04740 gene folD 2765 1821 CDS product bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816853.1 protein_id gnl|my_center|LOCUS_04740 2926 3002 gene locus_tag LOCUS_t00050 2926 3002 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 3045 3121 gene locus_tag LOCUS_t00060 3045 3121 tRNA product tRNA-Arg inference COORDINATES:profile:Aragorn:1.2.38 3161 3236 gene locus_tag LOCUS_t00070 3161 3236 tRNA product tRNA-His inference COORDINATES:profile:Aragorn:1.2.38 3369 3453 gene locus_tag LOCUS_t00080 3369 3453 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 3559 5043 gene locus_tag LOCUS_04750 gene tig 3559 5043 CDS product trigger factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087920.1 protein_id gnl|my_center|LOCUS_04750 >Feature sequence080 153 344 gene locus_tag LOCUS_04760 153 344 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04760 1031 1477 gene locus_tag LOCUS_04770 1031 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04770 2559 1591 gene locus_tag LOCUS_04780 2559 1591 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112780.1 protein_id gnl|my_center|LOCUS_04780 3972 2617 gene locus_tag LOCUS_04790 3972 2617 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04790 4774 3965 gene locus_tag LOCUS_04800 4774 3965 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_04800 >Feature sequence081 886 218 gene locus_tag LOCUS_04810 886 218 CDS product Fe2+-dependent dioxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_150092553.1 protein_id gnl|my_center|LOCUS_04810 1051 1374 gene locus_tag LOCUS_04820 1051 1374 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04820 2107 1694 gene locus_tag LOCUS_04830 2107 1694 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04830 3190 2120 gene locus_tag LOCUS_04840 3190 2120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04840 4349 3180 gene locus_tag LOCUS_04850 4349 3180 CDS product cytochrome c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546373.1 protein_id gnl|my_center|LOCUS_04850 >Feature sequence082 903 37 gene locus_tag LOCUS_04860 gene pstB 903 37 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002118636.1 protein_id gnl|my_center|LOCUS_04860 2213 903 gene locus_tag LOCUS_04870 gene pstA 2213 903 CDS product phosphate ABC transporter permease PstA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388358.1 protein_id gnl|my_center|LOCUS_04870 3616 2225 gene locus_tag LOCUS_04880 gene pstC 3616 2225 CDS product phosphate ABC transporter permease subunit PstC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388357.1 protein_id gnl|my_center|LOCUS_04880 4782 3676 gene locus_tag LOCUS_04890 4782 3676 CDS product PstS family phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388356.1 protein_id gnl|my_center|LOCUS_04890 >Feature sequence083 <1 831 gene locus_tag LOCUS_04900 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005814882.1:molecular chaperone TorD family protein 854 1093 gene locus_tag LOCUS_04910 854 1093 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04910 1035 1343 gene locus_tag LOCUS_04920 1035 1343 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04920 1045 1054 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1365 2471 gene locus_tag LOCUS_04930 1365 2471 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011227902.1 protein_id gnl|my_center|LOCUS_04930 1929 1938 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 2738 3079 gene locus_tag LOCUS_04940 2738 3079 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04940 3534 3142 gene locus_tag LOCUS_04950 3534 3142 CDS product DUF302 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946746.1 protein_id gnl|my_center|LOCUS_04950 4123 3770 gene locus_tag LOCUS_04960 4123 3770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04960 <4952 4407 gene locus_tag LOCUS_04970 <4952 4407 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002210928.1:nucleoside triphosphate pyrophosphatase >Feature sequence084 608 2050 gene locus_tag LOCUS_04980 608 2050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04980 2171 4153 gene locus_tag LOCUS_04990 2171 4153 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_04990 4146 4766 gene locus_tag LOCUS_05000 4146 4766 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05000 >Feature sequence085 607 1872 gene locus_tag LOCUS_05010 gene tviB 607 1872 CDS product Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073077.1 protein_id gnl|my_center|LOCUS_05010 1968 2783 gene locus_tag LOCUS_05020 1968 2783 CDS product ELM1/GtrOC1 family putative glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207641.1 protein_id gnl|my_center|LOCUS_05020 2783 3913 gene locus_tag LOCUS_05030 2783 3913 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208294.1 protein_id gnl|my_center|LOCUS_05030 3910 4740 gene locus_tag LOCUS_05040 3910 4740 CDS product polysaccharide deacetylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207638.1 protein_id gnl|my_center|LOCUS_05040 >Feature sequence086 >Feature sequence087 53 2800 gene locus_tag LOCUS_05050 53 2800 CDS product amino acid adenylation domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121323.1 protein_id gnl|my_center|LOCUS_05050 2794 3624 gene locus_tag LOCUS_05060 2794 3624 CDS product alpha/beta hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011121324.1 protein_id gnl|my_center|LOCUS_05060 3635 4351 gene locus_tag LOCUS_05070 3635 4351 CDS product 4'-phosphopantetheinyl transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005168613.1 protein_id gnl|my_center|LOCUS_05070 4676 4368 gene locus_tag LOCUS_05080 4676 4368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05080 >Feature sequence088 <1 737 gene locus_tag LOCUS_05090 <1 737 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268858.1:histidinol-phosphate transaminase 864 1583 gene locus_tag LOCUS_05100 gene rph 864 1583 CDS product ribonuclease PH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038353.1 protein_id gnl|my_center|LOCUS_05100 1619 2221 gene locus_tag LOCUS_05110 1619 2221 CDS product XTP/dITP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482459.1 protein_id gnl|my_center|LOCUS_05110 2218 2961 gene locus_tag LOCUS_05120 2218 2961 CDS product lysophospholipid acyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004190040.1 protein_id gnl|my_center|LOCUS_05120 3869 3027 gene locus_tag LOCUS_05130 3869 3027 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05130 4565 4014 gene locus_tag LOCUS_05140 4565 4014 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05140 >Feature sequence089 775 125 gene locus_tag LOCUS_05150 775 125 CDS product c-type cytochrome inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003102831.1 protein_id gnl|my_center|LOCUS_05150 906 1526 gene locus_tag LOCUS_05160 gene yihA 906 1526 CDS product ribosome biogenesis GTP-binding protein YihA/YsxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000183344.1 protein_id gnl|my_center|LOCUS_05160 3285 2146 gene locus_tag LOCUS_05170 3285 2146 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162600451.1 protein_id gnl|my_center|LOCUS_05170 4340 3423 gene locus_tag LOCUS_05180 gene cbpA 4340 3423 CDS product curved DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763092.1 protein_id gnl|my_center|LOCUS_05180 4432 4827 gene locus_tag LOCUS_05190 4432 4827 CDS product DUF423 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005613956.1 protein_id gnl|my_center|LOCUS_05190 >Feature sequence090 >Feature sequence091 551 195 gene locus_tag LOCUS_05200 gene rplT 551 195 CDS product 50S ribosomal protein L20 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004393357.1 protein_id gnl|my_center|LOCUS_05200 792 595 gene locus_tag LOCUS_05210 gene rpmI 792 595 CDS product 50S ribosomal protein L35 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072303.1 protein_id gnl|my_center|LOCUS_05210 1363 881 gene locus_tag LOCUS_05220 gene infC 1363 881 CDS product translation initiation factor IF-3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072302.1 protein_id gnl|my_center|LOCUS_05220 3397 1487 gene locus_tag LOCUS_05230 gene thrS 3397 1487 CDS product threonine--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267470.1 protein_id gnl|my_center|LOCUS_05230 3569 3493 gene locus_tag LOCUS_t00090 3569 3493 tRNA product tRNA-Val inference COORDINATES:profile:Aragorn:1.2.38 4266 3745 gene locus_tag LOCUS_05240 4266 3745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05240 >Feature sequence092 410 1036 gene locus_tag LOCUS_05250 410 1036 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05250 1049 2680 gene locus_tag LOCUS_05260 1049 2680 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05260 2680 4488 gene locus_tag LOCUS_05270 2680 4488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05270 >Feature sequence093 550 1101 gene locus_tag LOCUS_05280 550 1101 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05280 2300 1179 gene locus_tag LOCUS_05290 gene arsB 2300 1179 CDS product ACR3 family arsenite efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_042440386.1 protein_id gnl|my_center|LOCUS_05290 2956 2501 gene locus_tag LOCUS_05300 2956 2501 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05300 3856 3095 gene locus_tag LOCUS_05310 3856 3095 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012545035.1 protein_id gnl|my_center|LOCUS_05310 4148 3861 gene locus_tag LOCUS_05320 4148 3861 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05320 >Feature sequence094 2562 640 gene locus_tag LOCUS_05330 2562 640 CDS product PrkA family serine protein kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085078.1 protein_id gnl|my_center|LOCUS_05330 4166 3396 gene locus_tag LOCUS_05340 4166 3396 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05340 >Feature sequence095 306 722 gene locus_tag LOCUS_05350 306 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05350 872 1030 gene locus_tag LOCUS_05360 872 1030 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05360 1054 1602 gene locus_tag LOCUS_05370 1054 1602 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013087169.1 protein_id gnl|my_center|LOCUS_05370 1730 2443 gene locus_tag LOCUS_05380 1730 2443 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05380 2588 3646 gene locus_tag LOCUS_05390 2588 3646 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933388.1 protein_id gnl|my_center|LOCUS_05390 3692 3976 gene locus_tag LOCUS_05400 3692 3976 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095205.1 protein_id gnl|my_center|LOCUS_05400 4007 4300 gene locus_tag LOCUS_05410 4007 4300 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05410 >Feature sequence096 3646 2303 gene locus_tag LOCUS_05420 3646 2303 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000646058.1 protein_id gnl|my_center|LOCUS_05420 3895 4410 gene locus_tag LOCUS_05430 3895 4410 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05430 >Feature sequence097 1362 298 gene locus_tag LOCUS_05440 1362 298 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05440 1550 3505 gene locus_tag LOCUS_05450 1550 3505 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707540.1 protein_id gnl|my_center|LOCUS_05450 3762 4151 gene locus_tag LOCUS_05460 3762 4151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05460 >Feature sequence098 540 4085 gene locus_tag LOCUS_05470 gene smc 540 4085 CDS product chromosome segregation protein SMC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114676.1 protein_id gnl|my_center|LOCUS_05470 >Feature sequence099 870 879 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 977 2350 gene locus_tag LOCUS_05480 977 2350 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05480 2423 3211 gene locus_tag LOCUS_05490 2423 3211 CDS product YciK family oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706896.1 protein_id gnl|my_center|LOCUS_05490 3302 4036 gene locus_tag LOCUS_05500 gene cmoA 3302 4036 CDS product carboxy-S-adenosyl-L-methionine synthase CmoA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005457217.1 protein_id gnl|my_center|LOCUS_05500 >Feature sequence100 <1 1628 gene locus_tag LOCUS_05510 <1 1628 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938554.1:glutamine synthetase III 3273 2011 gene locus_tag LOCUS_05520 3273 2011 CDS product 6-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947630.1 protein_id gnl|my_center|LOCUS_05520 3759 3313 gene locus_tag LOCUS_05530 3759 3313 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05530 4309 3770 gene locus_tag LOCUS_05540 4309 3770 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524740.1 protein_id gnl|my_center|LOCUS_05540 >Feature sequence101 131 4178 repeat_region inference COORDINATES:alignment:CRT:1.2 rpt_family CRISPR rpt_type direct rpt_unit_seq tttctaagctgcctgtacggcagtgaat >Feature sequence102 <4649 98 gene locus_tag LOCUS_05550 <4649 98 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_024431422.1:RICIN domain-containing protein >Feature sequence103 474 1703 gene locus_tag LOCUS_05560 474 1703 CDS product malic enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103278.1 protein_id gnl|my_center|LOCUS_05560 2005 3483 gene locus_tag LOCUS_05570 gene ubiD 2005 3483 CDS product 4-hydroxy-3-polyprenylbenzoate decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005768425.1 protein_id gnl|my_center|LOCUS_05570 3728 3573 gene locus_tag LOCUS_05580 3728 3573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05580 >Feature sequence104 1632 397 gene locus_tag LOCUS_05590 gene ftsW 1632 397 CDS product putative lipid II flippase FtsW inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957396.1 protein_id gnl|my_center|LOCUS_05590 3007 1625 gene locus_tag LOCUS_05600 gene murD 3007 1625 CDS product UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766566.1 protein_id gnl|my_center|LOCUS_05600 4103 3021 gene locus_tag LOCUS_05610 gene mraY 4103 3021 CDS product phospho-N-acetylmuramoyl-pentapeptide-transferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094129.1 protein_id gnl|my_center|LOCUS_05610 <4611 4103 gene locus_tag LOCUS_05620 <4611 4103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010358960.1:UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase >Feature sequence105 469 864 gene locus_tag LOCUS_05630 gene soxX 469 864 CDS product sulfur oxidation c-type cytochrome SoxX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164926970.1 protein_id gnl|my_center|LOCUS_05630 920 1384 gene locus_tag LOCUS_05640 gene soxY 920 1384 CDS product thiosulfate oxidation carrier protein SoxY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083833.1 protein_id gnl|my_center|LOCUS_05640 1405 1725 gene locus_tag LOCUS_05650 gene soxZ 1405 1725 CDS product thiosulfate oxidation carrier complex protein SoxZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083832.1 protein_id gnl|my_center|LOCUS_05650 1825 2673 gene locus_tag LOCUS_05660 gene soxA 1825 2673 CDS product sulfur oxidation c-type cytochrome SoxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932698.1 protein_id gnl|my_center|LOCUS_05660 2707 3000 gene locus_tag LOCUS_05670 2707 3000 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05670 4136 3138 gene locus_tag LOCUS_05680 4136 3138 CDS product adenosine kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206956.1 protein_id gnl|my_center|LOCUS_05680 >Feature sequence106 421 1653 gene locus_tag LOCUS_05690 421 1653 CDS product multifunctional CCA addition/repair protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005693619.1 protein_id gnl|my_center|LOCUS_05690 1749 2066 gene locus_tag LOCUS_05700 gene hspQ 1749 2066 CDS product heat shock protein HspQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003528052.1 protein_id gnl|my_center|LOCUS_05700 2086 2772 gene locus_tag LOCUS_05710 2086 2772 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072344.1 protein_id gnl|my_center|LOCUS_05710 3387 2794 gene locus_tag LOCUS_05720 gene rsmD 3387 2794 CDS product 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948373.1 protein_id gnl|my_center|LOCUS_05720 <4605 3359 gene locus_tag LOCUS_05730 <4605 3359 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005763632.1:pitrilysin family protein >Feature sequence107 1762 563 gene locus_tag LOCUS_05740 1762 563 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05740 2399 2887 gene locus_tag LOCUS_05750 2399 2887 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338279.1 protein_id gnl|my_center|LOCUS_05750 2903 3949 gene locus_tag LOCUS_05760 2903 3949 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941103.1 protein_id gnl|my_center|LOCUS_05760 4218 3967 gene locus_tag LOCUS_05770 4218 3967 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05770 >Feature sequence108 1646 327 gene locus_tag LOCUS_05780 1646 327 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947032.1 protein_id gnl|my_center|LOCUS_05780 2106 1663 gene locus_tag LOCUS_05790 2106 1663 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05790 2933 2103 gene locus_tag LOCUS_05800 2933 2103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05800 3318 2926 gene locus_tag LOCUS_05810 3318 2926 CDS product DUF393 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003014535.1 protein_id gnl|my_center|LOCUS_05810 3491 3847 gene locus_tag LOCUS_05820 3491 3847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05820 <4585 3826 gene locus_tag LOCUS_05830 <4585 3826 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479860.1:LysR family transcriptional regulator >Feature sequence109 132 1391 gene locus_tag LOCUS_05840 gene ftsA 132 1391 CDS product cell division protein FtsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377649.1 protein_id gnl|my_center|LOCUS_05840 1509 2672 gene locus_tag LOCUS_05850 gene ftsZ 1509 2672 CDS product cell division protein FtsZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948309.1 protein_id gnl|my_center|LOCUS_05850 4151 3696 gene locus_tag LOCUS_05860 4151 3696 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05860 >Feature sequence110 1750 893 gene locus_tag LOCUS_05870 1750 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05870 1831 2436 gene locus_tag LOCUS_05880 gene hisB 1831 2436 CDS product imidazoleglycerol-phosphate dehydratase HisB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096088.1 protein_id gnl|my_center|LOCUS_05880 2596 3237 gene locus_tag LOCUS_05890 gene hisH 2596 3237 CDS product imidazole glycerol phosphate synthase subunit HisH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767120.1 protein_id gnl|my_center|LOCUS_05890 3268 3999 gene locus_tag LOCUS_05900 gene hisA 3268 3999 CDS product 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207860.1 protein_id gnl|my_center|LOCUS_05900 >Feature sequence111 497 1933 gene locus_tag LOCUS_05910 497 1933 CDS product outer membrane protein transport protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003810111.1 protein_id gnl|my_center|LOCUS_05910 1946 3985 gene locus_tag LOCUS_05920 1946 3985 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05920 >Feature sequence112 1259 81 gene locus_tag LOCUS_05930 gene sucC 1259 81 CDS product ADP-forming succinate--CoA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087425.1 protein_id gnl|my_center|LOCUS_05930 1588 3294 gene locus_tag LOCUS_05940 1588 3294 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003403505.1 protein_id gnl|my_center|LOCUS_05940 >Feature sequence113 531 46 gene locus_tag LOCUS_05950 531 46 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05950 733 3561 gene locus_tag LOCUS_05960 733 3561 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05960 >Feature sequence114 2 454 gene locus_tag LOCUS_05970 2 454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05970 487 1044 gene locus_tag LOCUS_05980 487 1044 CDS product YggT family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073224.1 protein_id gnl|my_center|LOCUS_05980 1785 1222 gene locus_tag LOCUS_05990 1785 1222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_05990 2826 2179 gene locus_tag LOCUS_06000 gene fnr 2826 2179 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000611911.1 protein_id gnl|my_center|LOCUS_06000 4213 3314 gene locus_tag LOCUS_06010 4213 3314 CDS product CoB--CoM heterodisulfide reductase iron-sulfur subunit B family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011392331.1 protein_id gnl|my_center|LOCUS_06010 >Feature sequence115 1458 181 gene locus_tag LOCUS_06020 1458 181 CDS product aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071339.1 protein_id gnl|my_center|LOCUS_06020 1633 2886 gene locus_tag LOCUS_06030 1633 2886 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06030 3622 3098 gene locus_tag LOCUS_06040 3622 3098 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06040 >Feature sequence116 <1 561 gene locus_tag LOCUS_06050 <1 561 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261335.1:exodeoxyribonuclease V subunit beta 563 3490 gene locus_tag LOCUS_06060 gene recB 563 3490 CDS product exodeoxyribonuclease V subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261335.1 protein_id gnl|my_center|LOCUS_06060 >Feature sequence117 <1 1136 gene locus_tag LOCUS_06070 <1 1136 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003129241.1:peptidoglycan DD-metalloendopeptidase family protein 1200 2339 gene locus_tag LOCUS_06080 1200 2339 CDS product anhydro-N-acetylmuramic acid kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005770633.1 protein_id gnl|my_center|LOCUS_06080 2740 2360 gene locus_tag LOCUS_06090 2740 2360 CDS product aspartate 1-decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113912.1 protein_id gnl|my_center|LOCUS_06090 3603 2752 gene locus_tag LOCUS_06100 gene panC 3603 2752 CDS product pantoate--beta-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000905380.1 protein_id gnl|my_center|LOCUS_06100 4419 3622 gene locus_tag LOCUS_06110 gene panB 4419 3622 CDS product 3-methyl-2-oxobutanoate hydroxymethyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071160.1 protein_id gnl|my_center|LOCUS_06110 >Feature sequence118 1004 195 gene locus_tag LOCUS_06120 1004 195 CDS product phosphate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012868851.1 protein_id gnl|my_center|LOCUS_06120 2661 1369 gene locus_tag LOCUS_06130 gene aroA 2661 1369 CDS product 3-phosphoshikimate 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011031206.1 protein_id gnl|my_center|LOCUS_06130 <4425 3064 gene locus_tag LOCUS_06140 <4425 3064 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056504.1:heavy metal translocating P-type ATPase >Feature sequence119 1562 3187 gene locus_tag LOCUS_06150 1562 3187 CDS product NAD+ synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957853.1 protein_id gnl|my_center|LOCUS_06150 <4419 3198 gene locus_tag LOCUS_06160 <4419 3198 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000035612.1:DNA polymerase II >Feature sequence120 140 1846 gene locus_tag LOCUS_06170 140 1846 CDS product acetolactate synthase 3 catalytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185769.1 protein_id gnl|my_center|LOCUS_06170 1864 2361 gene locus_tag LOCUS_06180 gene ilvN 1864 2361 CDS product acetolactate synthase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814006.1 protein_id gnl|my_center|LOCUS_06180 2398 3414 gene locus_tag LOCUS_06190 gene ilvC 2398 3414 CDS product ketol-acid reductoisomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005614924.1 protein_id gnl|my_center|LOCUS_06190 >Feature sequence121 51 1082 gene locus_tag LOCUS_06200 51 1082 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705177.1 protein_id gnl|my_center|LOCUS_06200 2162 1149 gene locus_tag LOCUS_06210 2162 1149 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06210 2989 2336 gene locus_tag LOCUS_06220 gene msrQ 2989 2336 CDS product protein-methionine-sulfoxide reductase heme-binding subunit MsrQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036769.1 protein_id gnl|my_center|LOCUS_06220 3938 3003 gene locus_tag LOCUS_06230 gene msrP 3938 3003 CDS product protein-methionine-sulfoxide reductase catalytic subunit MsrP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036770.1 protein_id gnl|my_center|LOCUS_06230 >Feature sequence122 407 1885 gene locus_tag LOCUS_06240 407 1885 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06240 2108 3913 gene locus_tag LOCUS_06250 2108 3913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06250 >Feature sequence123 <1 1141 gene locus_tag LOCUS_06260 <1 1141 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001232919.1:DNA-binding transcriptional regulator RtcR 2805 1213 gene locus_tag LOCUS_06270 2805 1213 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528784.1 protein_id gnl|my_center|LOCUS_06270 3549 2809 gene locus_tag LOCUS_06280 3549 2809 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011090346.1 protein_id gnl|my_center|LOCUS_06280 <4387 3696 gene locus_tag LOCUS_06290 <4387 3696 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268569.1:EAL domain-containing protein >Feature sequence124 98 1393 gene locus_tag LOCUS_06300 98 1393 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06300 1700 1383 gene locus_tag LOCUS_06310 1700 1383 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06310 1758 2549 gene locus_tag LOCUS_06320 1758 2549 CDS product inositol monophosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002234194.1 protein_id gnl|my_center|LOCUS_06320 2627 3301 gene locus_tag LOCUS_06330 2627 3301 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06330 3294 4244 gene locus_tag LOCUS_06340 3294 4244 CDS product UDP-3-O-acyl N-acetylglycosamine deacetylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004527661.1 protein_id gnl|my_center|LOCUS_06340 >Feature sequence125 720 1565 gene locus_tag LOCUS_06350 720 1565 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_06350 1555 2151 gene locus_tag LOCUS_06360 1555 2151 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06360 3763 2159 gene locus_tag LOCUS_06370 3763 2159 CDS product thioredoxin-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_073595568.1 protein_id gnl|my_center|LOCUS_06370 >Feature sequence126 <1 1112 gene locus_tag LOCUS_06380 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011103493.1:valine--tRNA ligase 943 952 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1482 1012 gene locus_tag LOCUS_06390 1482 1012 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06390 4314 1882 gene locus_tag LOCUS_06400 4314 1882 CDS product heavy metal translocating P-type ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114668.1 protein_id gnl|my_center|LOCUS_06400 >Feature sequence127 2491 1028 gene locus_tag LOCUS_06410 gene der 2491 1028 CDS product ribosome biogenesis GTPase Der inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000249403.1 protein_id gnl|my_center|LOCUS_06410 2723 3397 gene locus_tag LOCUS_06420 2723 3397 CDS product spondin domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005478233.1 protein_id gnl|my_center|LOCUS_06420 3576 3409 gene locus_tag LOCUS_06430 3576 3409 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06430 >Feature sequence128 116 1312 gene locus_tag LOCUS_06440 116 1312 CDS product LysM domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948296.1 protein_id gnl|my_center|LOCUS_06440 1338 2492 gene locus_tag LOCUS_06450 gene dprA 1338 2492 CDS product DNA-processing protein DprA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015064703.1 protein_id gnl|my_center|LOCUS_06450 2657 3127 gene locus_tag LOCUS_06460 2657 3127 CDS product DUF494 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038834.1 protein_id gnl|my_center|LOCUS_06460 >Feature sequence129 <1 734 gene locus_tag LOCUS_06470 <1 734 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005068571.1:bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase 795 1118 gene locus_tag LOCUS_06480 795 1118 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06480 1164 1913 gene locus_tag LOCUS_06490 1164 1913 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06490 1979 2341 gene locus_tag LOCUS_06500 1979 2341 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057535.1 protein_id gnl|my_center|LOCUS_06500 2338 2820 gene locus_tag LOCUS_06510 2338 2820 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06510 3050 3718 gene locus_tag LOCUS_06520 3050 3718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06520 >Feature sequence130 853 635 gene locus_tag LOCUS_06530 853 635 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06530 1422 2549 gene locus_tag LOCUS_06540 1422 2549 CDS product FlxA-like family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164930692.1 protein_id gnl|my_center|LOCUS_06540 2571 3185 gene locus_tag LOCUS_06550 2571 3185 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06550 3194 4003 gene locus_tag LOCUS_06560 3194 4003 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06560 >Feature sequence131 111 560 gene locus_tag LOCUS_06570 111 560 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06570 607 1134 gene locus_tag LOCUS_06580 607 1134 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013531188.1 protein_id gnl|my_center|LOCUS_06580 1150 3297 gene locus_tag LOCUS_06590 1150 3297 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037395394.1 protein_id gnl|my_center|LOCUS_06590 3943 3329 gene locus_tag LOCUS_06600 gene elsL 3943 3329 CDS product cell wall-recycling L,D-carboxypeptidase ElsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207552.1 protein_id gnl|my_center|LOCUS_06600 >Feature sequence132 715 455 gene locus_tag LOCUS_06610 715 455 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06610 814 1479 gene locus_tag LOCUS_06620 814 1479 CDS product phosphoribosylanthranilate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005619689.1 protein_id gnl|my_center|LOCUS_06620 1460 2719 gene locus_tag LOCUS_06630 gene trpB 1460 2719 CDS product tryptophan synthase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002116129.1 protein_id gnl|my_center|LOCUS_06630 2716 3522 gene locus_tag LOCUS_06640 gene trpA 2716 3522 CDS product tryptophan synthase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003694852.1 protein_id gnl|my_center|LOCUS_06640 >Feature sequence133 3 398 gene locus_tag LOCUS_06650 3 398 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06650 465 1844 gene locus_tag LOCUS_06660 gene ntrX 465 1844 CDS product nitrogen assimilation response regulator NtrX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010919611.1 protein_id gnl|my_center|LOCUS_06660 2005 3381 gene locus_tag LOCUS_06670 gene trkA 2005 3381 CDS product Trk system potassium transporter TrkA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003107053.1 protein_id gnl|my_center|LOCUS_06670 >Feature sequence134 1269 34 gene locus_tag LOCUS_06680 1269 34 CDS product argininosuccinate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092065.1 protein_id gnl|my_center|LOCUS_06680 1345 2376 gene locus_tag LOCUS_06690 gene murB 1345 2376 CDS product UDP-N-acetylmuramate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964097.1 protein_id gnl|my_center|LOCUS_06690 2997 2635 gene locus_tag LOCUS_06700 2997 2635 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932532.1 protein_id gnl|my_center|LOCUS_06700 3166 3420 gene locus_tag LOCUS_06710 3166 3420 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06710 >Feature sequence135 <1 1757 gene locus_tag LOCUS_06720 <1 1757 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011964323.1:MG2 domain-containing protein >Feature sequence136 1314 190 gene locus_tag LOCUS_06730 1314 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06730 3086 1311 gene locus_tag LOCUS_06740 3086 1311 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001331962.1 protein_id gnl|my_center|LOCUS_06740 4078 3086 gene locus_tag LOCUS_06750 4078 3086 CDS product HlyD family efflux transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003812256.1 protein_id gnl|my_center|LOCUS_06750 >Feature sequence137 913 23 gene locus_tag LOCUS_06760 gene rsmI 913 23 CDS product 16S rRNA (cytidine(1402)-2'-O)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000809258.1 protein_id gnl|my_center|LOCUS_06760 1139 2869 gene locus_tag LOCUS_06770 1139 2869 CDS product penicillin-binding protein activator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766553.1 protein_id gnl|my_center|LOCUS_06770 2892 3335 gene locus_tag LOCUS_06780 2892 3335 CDS product YraN family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958409.1 protein_id gnl|my_center|LOCUS_06780 >Feature sequence138 1502 1164 gene locus_tag LOCUS_06790 gene glnK 1502 1164 CDS product P-II family nitrogen regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000780326.1 protein_id gnl|my_center|LOCUS_06790 2013 3104 gene locus_tag LOCUS_06800 gene ntrB 2013 3104 CDS product two-component system sensor histidine kinase NtrB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096033.1 protein_id gnl|my_center|LOCUS_06800 >Feature sequence139 1597 191 gene locus_tag LOCUS_06810 1597 191 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06810 3352 2594 gene locus_tag LOCUS_06820 gene moeB 3352 2594 CDS product molybdopterin-synthase adenylyltransferase MoeB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015038762.1 protein_id gnl|my_center|LOCUS_06820 <4030 3389 gene locus_tag LOCUS_06830 <4030 3389 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072501.1:ATP-binding protein >Feature sequence140 >Feature sequence141 662 1477 gene locus_tag LOCUS_06840 gene mlaF 662 1477 CDS product phospholipid ABC transporter ATP-binding protein MlaF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012534228.1 protein_id gnl|my_center|LOCUS_06840 1483 2277 gene locus_tag LOCUS_06850 gene mlaE 1483 2277 CDS product lipid asymmetry maintenance ABC transporter permease subunit MlaE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000925792.1 protein_id gnl|my_center|LOCUS_06850 2314 2775 gene locus_tag LOCUS_06860 gene mlaD 2314 2775 CDS product outer membrane lipid asymmetry maintenance protein MlaD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094339.1 protein_id gnl|my_center|LOCUS_06860 2877 3566 gene locus_tag LOCUS_06870 2877 3566 CDS product ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004199924.1 protein_id gnl|my_center|LOCUS_06870 3563 3904 gene locus_tag LOCUS_06880 3563 3904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06880 >Feature sequence142 <1 1758 gene locus_tag LOCUS_06890 <1 1758 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003377107.1:DNA topoisomerase IV subunit B 1776 1988 gene locus_tag LOCUS_06900 1776 1988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06900 2053 2532 gene locus_tag LOCUS_06910 2053 2532 CDS product CDP-2,3-bis-(O-geranylgeranyl)-sn-glycerol synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010978442.1 protein_id gnl|my_center|LOCUS_06910 3497 2556 gene locus_tag LOCUS_06920 3497 2556 CDS product metallophosphoesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015909160.1 protein_id gnl|my_center|LOCUS_06920 >Feature sequence143 <1 1365 gene locus_tag LOCUS_06930 <1 1365 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003094386.1:ribonuclease G 1381 2223 gene locus_tag LOCUS_06940 1381 2223 CDS product carbon-nitrogen hydrolase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946685.1 protein_id gnl|my_center|LOCUS_06940 2253 3710 gene locus_tag LOCUS_06950 gene tldD 2253 3710 CDS product metalloprotease TldD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946686.1 protein_id gnl|my_center|LOCUS_06950 >Feature sequence144 3317 2346 gene locus_tag LOCUS_06960 3317 2346 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06960 >Feature sequence145 <1 714 gene locus_tag LOCUS_06970 <1 714 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164921980.1:trypsin-like peptidase domain-containing protein >Feature sequence146 3 1217 gene locus_tag LOCUS_06980 3 1217 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_06980 1218 2066 gene locus_tag LOCUS_06990 1218 2066 CDS product S1-like domain-containing RNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005796486.1 protein_id gnl|my_center|LOCUS_06990 3592 2108 gene locus_tag LOCUS_07000 gene thrC 3592 2108 CDS product threonine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852451.1 protein_id gnl|my_center|LOCUS_07000 >Feature sequence147 608 252 gene locus_tag LOCUS_07010 608 252 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002355066.1 protein_id gnl|my_center|LOCUS_07010 755 2215 gene locus_tag LOCUS_07020 755 2215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07020 2350 3030 gene locus_tag LOCUS_07030 2350 3030 CDS product protein-L-isoaspartate O-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038434.1 protein_id gnl|my_center|LOCUS_07030 >Feature sequence148 <1 1223 gene locus_tag LOCUS_07040 <1 1223 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958533.1:16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB 1232 1882 gene locus_tag LOCUS_07050 1232 1882 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07050 >Feature sequence149 207 464 gene locus_tag LOCUS_07060 gene xseB 207 464 CDS product exodeoxyribonuclease VII small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001124944.1 protein_id gnl|my_center|LOCUS_07060 475 1386 gene locus_tag LOCUS_07070 475 1386 CDS product (2E,6E)-farnesyl diphosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245492.1 protein_id gnl|my_center|LOCUS_07070 1429 3369 gene locus_tag LOCUS_07080 gene dxs 1429 3369 CDS product 1-deoxy-D-xylulose-5-phosphate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707088.1 protein_id gnl|my_center|LOCUS_07080 3413 3793 gene locus_tag LOCUS_07090 gene queD 3413 3793 CDS product 6-carboxytetrahydropterin synthase QueD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010942365.1 protein_id gnl|my_center|LOCUS_07090 >Feature sequence150 2441 1326 gene locus_tag LOCUS_07100 2441 1326 CDS product ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966542.1 protein_id gnl|my_center|LOCUS_07100 3386 2451 gene locus_tag LOCUS_07110 3386 2451 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010943451.1 protein_id gnl|my_center|LOCUS_07110 >Feature sequence151 988 620 gene locus_tag LOCUS_07120 988 620 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07120 2034 1138 gene locus_tag LOCUS_07130 2034 1138 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07130 2872 2111 gene locus_tag LOCUS_07140 2872 2111 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957888.1 protein_id gnl|my_center|LOCUS_07140 <3841 3146 gene locus_tag LOCUS_07150 <3841 3146 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090432.1:ATP-dependent Clp protease ATP-binding subunit ClpA >Feature sequence152 >Feature sequence153 20 619 gene locus_tag LOCUS_07160 20 619 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07160 628 1254 gene locus_tag LOCUS_07170 628 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07170 1457 2941 gene locus_tag LOCUS_07180 1457 2941 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07180 >Feature sequence154 6 1493 gene locus_tag LOCUS_07190 6 1493 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07190 2237 2656 gene locus_tag LOCUS_07200 2237 2656 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07200 >Feature sequence155 1622 993 gene locus_tag LOCUS_07210 1622 993 CDS product uracil-DNA glycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011087828.1 protein_id gnl|my_center|LOCUS_07210 2608 1634 gene locus_tag LOCUS_07220 2608 1634 CDS product ketoacyl-ACP synthase III inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036218.1 protein_id gnl|my_center|LOCUS_07220 <3771 2711 gene locus_tag LOCUS_07230 <3771 2711 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947122.1:phosphate acyltransferase PlsX >Feature sequence156 <1 1112 gene locus_tag LOCUS_07240 <1 1112 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011948029.1:2,3-bisphosphoglycerate-independent phosphoglycerate mutase 1218 1766 gene locus_tag LOCUS_07250 1218 1766 CDS product CAP domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546171.1 protein_id gnl|my_center|LOCUS_07250 2563 1847 gene locus_tag LOCUS_07260 2563 1847 CDS product peptidylprolyl isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_019248574.1 protein_id gnl|my_center|LOCUS_07260 >Feature sequence157 1759 1073 gene locus_tag LOCUS_07270 1759 1073 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07270 2462 1884 gene locus_tag LOCUS_07280 gene rpoE 2462 1884 CDS product RNA polymerase sigma factor RpoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085543.1 protein_id gnl|my_center|LOCUS_07280 >Feature sequence158 732 307 gene locus_tag LOCUS_07290 732 307 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07290 1050 745 gene locus_tag LOCUS_07300 1050 745 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07300 1563 1063 gene locus_tag LOCUS_07310 1563 1063 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07310 2435 1560 gene locus_tag LOCUS_07320 gene apaH 2435 1560 CDS product bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480531.1 protein_id gnl|my_center|LOCUS_07320 >Feature sequence159 704 495 gene locus_tag LOCUS_07330 704 495 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07330 515 524 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1237 3048 gene locus_tag LOCUS_07340 1237 3048 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07340 >Feature sequence160 <1 520 gene locus_tag LOCUS_07350 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390063.1:DUF3365 domain-containing protein 1179 757 gene locus_tag LOCUS_07360 1179 757 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07360 1305 1961 gene locus_tag LOCUS_07370 1305 1961 CDS product riboflavin synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003317049.1 protein_id gnl|my_center|LOCUS_07370 1986 3089 gene locus_tag LOCUS_07380 gene ribBA 1986 3089 CDS product bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707098.1 protein_id gnl|my_center|LOCUS_07380 3116 3589 gene locus_tag LOCUS_07390 gene ribE 3116 3589 CDS product 6,7-dimethyl-8-ribityllumazine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963913.1 protein_id gnl|my_center|LOCUS_07390 >Feature sequence161 141 776 gene locus_tag LOCUS_07400 141 776 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07400 896 1990 gene locus_tag LOCUS_07410 896 1990 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07410 2103 3047 gene locus_tag LOCUS_07420 2103 3047 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07420 >Feature sequence162 913 3153 gene locus_tag LOCUS_07430 913 3153 CDS product polysaccharide biosynthesis tyrosine autokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389244.1 protein_id gnl|my_center|LOCUS_07430 >Feature sequence163 2404 929 gene locus_tag LOCUS_07440 2404 929 CDS product UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2,6-diaminopimelate ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112751.1 protein_id gnl|my_center|LOCUS_07440 <3720 2404 gene locus_tag LOCUS_07450 <3720 2404 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957390.1:penicillin-binding protein 2 >Feature sequence164 2540 390 gene locus_tag LOCUS_07460 gene spoT 2540 390 CDS product bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005459012.1 protein_id gnl|my_center|LOCUS_07460 2830 2570 gene locus_tag LOCUS_07470 gene rpoZ 2830 2570 CDS product DNA-directed RNA polymerase subunit omega inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771414.1 protein_id gnl|my_center|LOCUS_07470 >Feature sequence165 885 1454 gene locus_tag LOCUS_07480 885 1454 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07480 >Feature sequence166 32 154 gene locus_tag LOCUS_07490 32 154 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07490 144 1100 gene locus_tag LOCUS_07500 gene ppk2 144 1100 CDS product polyphosphate kinase 2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852184.1 protein_id gnl|my_center|LOCUS_07500 1680 1141 gene locus_tag LOCUS_07510 1680 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07510 2925 1783 gene locus_tag LOCUS_07520 2925 1783 CDS product PilT/PilU family type 4a pilus ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948029.1 protein_id gnl|my_center|LOCUS_07520 <3702 2987 gene locus_tag LOCUS_07530 <3702 2987 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003704392.1:PilT/PilU family type 4a pilus ATPase >Feature sequence167 737 1477 gene locus_tag LOCUS_07540 737 1477 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07540 3202 2054 gene locus_tag LOCUS_07550 3202 2054 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07550 3495 3199 gene locus_tag LOCUS_07560 3495 3199 CDS product accessory factor UbiK family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038948.1 protein_id gnl|my_center|LOCUS_07560 >Feature sequence168 254 628 gene locus_tag LOCUS_07570 gene rpsL 254 628 CDS product 30S ribosomal protein S12 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070612.1 protein_id gnl|my_center|LOCUS_07570 698 1168 gene locus_tag LOCUS_07580 gene rpsG 698 1168 CDS product 30S ribosomal protein S7 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070613.1 protein_id gnl|my_center|LOCUS_07580 1234 3336 gene locus_tag LOCUS_07590 gene fusA 1234 3336 CDS product elongation factor G inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010957451.1 protein_id gnl|my_center|LOCUS_07590 >Feature sequence169 1108 1488 gene locus_tag LOCUS_07600 1108 1488 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07600 2694 1594 gene locus_tag LOCUS_07610 gene pyrC 2694 1594 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194429.1 protein_id gnl|my_center|LOCUS_07610 >Feature sequence170 381 37 gene locus_tag LOCUS_07620 381 37 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000895407.1 protein_id gnl|my_center|LOCUS_07620 815 2638 gene locus_tag LOCUS_07630 815 2638 CDS product nuclease-related domain-containing DEAD/DEAH box helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263035.1 protein_id gnl|my_center|LOCUS_07630 >Feature sequence171 81 500 gene locus_tag LOCUS_07640 81 500 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07640 1095 1439 gene locus_tag LOCUS_07650 1095 1439 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07650 3034 1553 gene locus_tag LOCUS_07660 gene mqo 3034 1553 CDS product malate dehydrogenase (quinone) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000758086.1 protein_id gnl|my_center|LOCUS_07660 >Feature sequence172 1048 116 gene locus_tag LOCUS_07670 gene fabD 1048 116 CDS product ACP S-malonyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011106014.1 protein_id gnl|my_center|LOCUS_07670 1218 1481 gene locus_tag LOCUS_07680 gene infA 1218 1481 CDS product translation initiation factor IF-1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001040187.1 protein_id gnl|my_center|LOCUS_07680 1775 1497 gene locus_tag LOCUS_07690 1775 1497 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07690 <3673 1782 gene locus_tag LOCUS_07700 <3673 1782 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095687.1:DNA topoisomerase IV subunit A >Feature sequence173 1883 705 gene locus_tag LOCUS_07710 1883 705 CDS product phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007246215.1 protein_id gnl|my_center|LOCUS_07710 1924 2895 gene locus_tag LOCUS_07720 gene rssA 1924 2895 CDS product patatin-like phospholipase RssA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005169303.1 protein_id gnl|my_center|LOCUS_07720 2895 3299 gene locus_tag LOCUS_07730 2895 3299 CDS product YchJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011027912.1 protein_id gnl|my_center|LOCUS_07730 >Feature sequence174 <1 802 gene locus_tag LOCUS_07740 <1 802 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003103524.1:GspK family T2SS minor pseudopilin variant XcpX 842 2137 gene locus_tag LOCUS_07750 gene lspL 842 2137 CDS product GspL family type II secretion system protein LspL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947594.1 protein_id gnl|my_center|LOCUS_07750 2134 2616 gene locus_tag LOCUS_07760 2134 2616 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07760 >Feature sequence175 1014 1991 gene locus_tag LOCUS_07770 1014 1991 CDS product calcium/sodium antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705183.1 protein_id gnl|my_center|LOCUS_07770 2017 3006 gene locus_tag LOCUS_07780 gene kdsD 2017 3006 CDS product arabinose-5-phosphate isomerase KdsD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002210119.1 protein_id gnl|my_center|LOCUS_07780 3025 3564 gene locus_tag LOCUS_07790 gene kdsC 3025 3564 CDS product 3-deoxy-manno-octulosonate-8-phosphatase KdsC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098938.1 protein_id gnl|my_center|LOCUS_07790 >Feature sequence176 1191 304 gene locus_tag LOCUS_07800 1191 304 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038965715.1 protein_id gnl|my_center|LOCUS_07800 2699 1194 gene locus_tag LOCUS_07810 2699 1194 CDS product thymidine phosphorylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085901.1 protein_id gnl|my_center|LOCUS_07810 >Feature sequence177 680 2041 gene locus_tag LOCUS_07820 680 2041 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07820 2948 1959 gene locus_tag LOCUS_07830 2948 1959 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07830 >Feature sequence178 >Feature sequence179 785 273 gene locus_tag LOCUS_07840 gene dut 785 273 CDS product dUTP diphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073925.1 protein_id gnl|my_center|LOCUS_07840 2010 778 gene locus_tag LOCUS_07850 gene coaBC 2010 778 CDS product bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704180.1 protein_id gnl|my_center|LOCUS_07850 2046 2717 gene locus_tag LOCUS_07860 gene radC 2046 2717 CDS product DNA repair protein RadC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704181.1 protein_id gnl|my_center|LOCUS_07860 <3614 2848 gene locus_tag LOCUS_07870 <3614 2848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002244053.1:outer membrane protein assembly factor BamD >Feature sequence180 2890 800 gene locus_tag LOCUS_07880 gene glyS 2890 800 CDS product glycine--tRNA ligase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704155.1 protein_id gnl|my_center|LOCUS_07880 <3612 2890 gene locus_tag LOCUS_07890 <3612 2890 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011039156.1:glycine--tRNA ligase subunit alpha >Feature sequence181 60 593 gene locus_tag LOCUS_07900 60 593 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07900 680 1024 gene locus_tag LOCUS_07910 gene grxD 680 1024 CDS product Grx4 family monothiol glutaredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092082.1 protein_id gnl|my_center|LOCUS_07910 2685 1414 gene locus_tag LOCUS_07920 gene ltrA 2685 1414 CDS product group II intron reverse transcriptase/maturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010966780.1 protein_id gnl|my_center|LOCUS_07920 >Feature sequence182 <1 680 gene locus_tag LOCUS_07930 <1 680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707498.1:A/G-specific adenine glycosylase 693 959 gene locus_tag LOCUS_07940 693 959 CDS product oxidative damage protection protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004193961.1 protein_id gnl|my_center|LOCUS_07940 978 1748 gene locus_tag LOCUS_07950 gene fpr 978 1748 CDS product ferredoxin--NADP(+) reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000796330.1 protein_id gnl|my_center|LOCUS_07950 2358 1783 gene locus_tag LOCUS_07960 2358 1783 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07960 2464 2823 gene locus_tag LOCUS_07970 2464 2823 CDS product DUF4870 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096590.1 protein_id gnl|my_center|LOCUS_07970 3329 2931 gene locus_tag LOCUS_07980 3329 2931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_07980 >Feature sequence183 624 633 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 651 2492 gene locus_tag LOCUS_07990 651 2492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_07990 2449 3009 gene locus_tag LOCUS_08000 2449 3009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08000 2453 2462 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence184 1741 824 gene locus_tag LOCUS_08010 1741 824 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08010 2115 3143 gene locus_tag LOCUS_08020 2115 3143 CDS product porin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_115105549.1 protein_id gnl|my_center|LOCUS_08020 >Feature sequence185 99 578 gene locus_tag LOCUS_08030 99 578 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08030 642 2150 gene locus_tag LOCUS_08040 642 2150 CDS product DegQ family serine endoprotease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005764764.1 protein_id gnl|my_center|LOCUS_08040 2175 2450 gene locus_tag LOCUS_08050 2175 2450 CDS product glutaredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004524616.1 protein_id gnl|my_center|LOCUS_08050 >Feature sequence186 1329 2513 gene locus_tag LOCUS_08060 1329 2513 CDS product pyridoxal phosphate-dependent aminotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010945831.1 protein_id gnl|my_center|LOCUS_08060 >Feature sequence187 515 135 gene locus_tag LOCUS_08070 gene iscU 515 135 CDS product Fe-S cluster assembly scaffold IscU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000331707.1 protein_id gnl|my_center|LOCUS_08070 1796 573 gene locus_tag LOCUS_08080 1796 573 CDS product IscS subfamily cysteine desulfurase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460179.1 protein_id gnl|my_center|LOCUS_08080 2342 1833 gene locus_tag LOCUS_08090 gene iscR 2342 1833 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496331.1 protein_id gnl|my_center|LOCUS_08090 3398 2619 gene locus_tag LOCUS_08100 gene cysE 3398 2619 CDS product serine O-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266905.1 protein_id gnl|my_center|LOCUS_08100 >Feature sequence188 1722 961 gene locus_tag LOCUS_08110 1722 961 CDS product WecB/TagA/CpsF family glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257381.1 protein_id gnl|my_center|LOCUS_08110 2911 1664 gene locus_tag LOCUS_08120 2911 1664 CDS product glycosyltransferase family 4 protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012803855.1 protein_id gnl|my_center|LOCUS_08120 >Feature sequence189 <1 536 gene locus_tag LOCUS_08130 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405880.1:decarboxylating 6-phosphogluconate dehydrogenase 549 2108 gene locus_tag LOCUS_08140 gene zwf 549 2108 CDS product glucose-6-phosphate dehydrogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141170.1 protein_id gnl|my_center|LOCUS_08140 2147 3133 gene locus_tag LOCUS_08150 2147 3133 CDS product transaldolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011141596.1 protein_id gnl|my_center|LOCUS_08150 >Feature sequence190 2873 2034 gene locus_tag LOCUS_08160 2873 2034 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08160 >Feature sequence191 656 342 gene locus_tag LOCUS_08170 gene nirD 656 342 CDS product nitrite reductase small subunit NirD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087853.1 protein_id gnl|my_center|LOCUS_08170 3228 799 gene locus_tag LOCUS_08180 gene nirB 3228 799 CDS product nitrite reductase large subunit NirB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004530942.1 protein_id gnl|my_center|LOCUS_08180 >Feature sequence192 175 1611 gene locus_tag LOCUS_08190 175 1611 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08190 1699 2979 gene locus_tag LOCUS_08200 gene hemL 1699 2979 CDS product glutamate-1-semialdehyde 2,1-aminomutase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093150.1 protein_id gnl|my_center|LOCUS_08200 >Feature sequence193 <1 1086 gene locus_tag LOCUS_08210 <1 1086 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004193086.1:beta-ketoacyl-ACP synthase II 1115 1948 gene locus_tag LOCUS_08220 gene pabC 1115 1948 CDS product aminodeoxychorismate lyase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_020799938.1 protein_id gnl|my_center|LOCUS_08220 1951 2988 gene locus_tag LOCUS_08230 gene mltG 1951 2988 CDS product endolytic transglycosylase MltG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930596.1 protein_id gnl|my_center|LOCUS_08230 >Feature sequence194 25 378 gene locus_tag LOCUS_08240 25 378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08240 799 1494 gene locus_tag LOCUS_08250 799 1494 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08250 >Feature sequence195 3244 614 gene locus_tag LOCUS_08260 gene pepN 3244 614 CDS product aminopeptidase N inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267176.1 protein_id gnl|my_center|LOCUS_08260 >Feature sequence196 <1 2650 gene locus_tag LOCUS_08270 <1 2650 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004550042.1:type I polyketide synthase note possible pseudo, frameshifted 2616 2625 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence197 <1 899 gene locus_tag LOCUS_08280 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263886.1:AI-2E family transporter 1005 1718 gene locus_tag LOCUS_08290 1005 1718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08290 1984 2865 gene locus_tag LOCUS_08300 1984 2865 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08300 >Feature sequence198 914 1390 gene locus_tag LOCUS_08310 914 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08310 1402 2817 gene locus_tag LOCUS_08320 1402 2817 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08320 >Feature sequence199 <1 859 gene locus_tag LOCUS_08330 <1 859 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012311849.1:type I DNA topoisomerase 859 1419 gene locus_tag LOCUS_08340 gene tsaC 859 1419 CDS product L-threonylcarbamoyladenylate synthase type 1 TsaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703634.1 protein_id gnl|my_center|LOCUS_08340 1428 3344 gene locus_tag LOCUS_08350 1428 3344 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_038019873.1 protein_id gnl|my_center|LOCUS_08350 >Feature sequence200 250 498 gene locus_tag LOCUS_08360 250 498 CDS product DUF2164 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816269.1 protein_id gnl|my_center|LOCUS_08360 495 1016 gene locus_tag LOCUS_08370 495 1016 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08370 1547 3388 gene locus_tag LOCUS_08380 1547 3388 CDS product RNB domain-containing ribonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011228742.1 protein_id gnl|my_center|LOCUS_08380 >Feature sequence201 2708 1818 gene locus_tag LOCUS_08390 2708 1818 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08390 >Feature sequence202 2620 1883 gene locus_tag LOCUS_08400 gene ttcA 2620 1883 CDS product tRNA 2-thiocytidine(32) synthetase TtcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940803.1 protein_id gnl|my_center|LOCUS_08400 2565 2574 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <3367 2643 gene locus_tag LOCUS_08410 <3367 2643 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004185343.1:CDP-6-deoxy-delta-3,4-glucoseen reductase >Feature sequence203 1603 566 gene locus_tag LOCUS_08420 gene moaA 1603 566 CDS product GTP 3',8-cyclase MoaA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_059643243.1 protein_id gnl|my_center|LOCUS_08420 <3365 1680 gene locus_tag LOCUS_08430 <3365 1680 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003100681.1:single-stranded-DNA-specific exonuclease RecJ >Feature sequence204 <1 2261 gene locus_tag LOCUS_08440 <1 2261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011022627.1:phosphoenolpyruvate synthase <3362 2376 gene locus_tag LOCUS_08450 <3362 2376 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938822.1:MBL fold metallo-hydrolase >Feature sequence205 2567 2974 gene locus_tag LOCUS_08460 2567 2974 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08460 >Feature sequence206 2767 299 gene locus_tag LOCUS_08470 2767 299 CDS product FtsX-like permease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015039500.1 protein_id gnl|my_center|LOCUS_08470 <3348 2764 gene locus_tag LOCUS_08480 <3348 2764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406778.1:ABC transporter ATP-binding protein >Feature sequence207 626 207 gene locus_tag LOCUS_08490 626 207 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08490 >Feature sequence208 <1 1875 gene locus_tag LOCUS_08500 <1 1875 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011402897.1:heavy metal translocating P-type ATPase 2864 2325 gene locus_tag LOCUS_08510 2864 2325 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08510 3113 2943 gene locus_tag LOCUS_08520 3113 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08520 >Feature sequence209 <1 1815 gene locus_tag LOCUS_08530 <1 1815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480716.1:MMPL family transporter 1884 2687 gene locus_tag LOCUS_08540 1884 2687 CDS product outer membrane lipoprotein-sorting protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005462638.1 protein_id gnl|my_center|LOCUS_08540 2695 3039 gene locus_tag LOCUS_08550 2695 3039 CDS product TfoX/Sxy family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194611.1 protein_id gnl|my_center|LOCUS_08550 >Feature sequence210 >Feature sequence211 <1 626 gene locus_tag LOCUS_08560 <1 626 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113871.1:RNA polymerase sigma factor RpoS 1018 647 gene locus_tag LOCUS_08570 1018 647 CDS product Mth938-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036887.1 protein_id gnl|my_center|LOCUS_08570 1137 2798 gene locus_tag LOCUS_08580 1137 2798 CDS product glutamine--tRNA ligase/YqeY domain fusion protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267206.1 protein_id gnl|my_center|LOCUS_08580 3059 2856 gene locus_tag LOCUS_08590 3059 2856 CDS product cold-shock protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187926.1 protein_id gnl|my_center|LOCUS_08590 >Feature sequence212 945 127 gene locus_tag LOCUS_08600 945 127 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08600 1200 1781 gene locus_tag LOCUS_08610 1200 1781 CDS product carbonic anhydrase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000214742.1 protein_id gnl|my_center|LOCUS_08610 1947 2597 gene locus_tag LOCUS_08620 1947 2597 CDS product peroxiredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880523.1 protein_id gnl|my_center|LOCUS_08620 <3275 2746 gene locus_tag LOCUS_08630 <3275 2746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002377949.1:thermonuclease family protein >Feature sequence213 1963 1658 gene locus_tag LOCUS_08640 gene nuoK 1963 1658 CDS product NADH-quinone oxidoreductase subunit NuoK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004185739.1 protein_id gnl|my_center|LOCUS_08640 2559 1960 gene locus_tag LOCUS_08650 2559 1960 CDS product NADH-quinone oxidoreductase subunit J inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016944316.1 protein_id gnl|my_center|LOCUS_08650 3095 2604 gene locus_tag LOCUS_08660 gene nuoI 3095 2604 CDS product NADH-quinone oxidoreductase subunit NuoI inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003813924.1 protein_id gnl|my_center|LOCUS_08660 >Feature sequence214 1735 350 gene locus_tag LOCUS_08670 gene vpsL 1735 350 CDS product exopolysaccharide biosynthesis glycosyltransferase VpsL inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001889848.1 protein_id gnl|my_center|LOCUS_08670 2736 1894 gene locus_tag LOCUS_08680 2736 1894 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_043607342.1 protein_id gnl|my_center|LOCUS_08680 3260 2736 gene locus_tag LOCUS_08690 3260 2736 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08690 >Feature sequence215 1306 2829 gene locus_tag LOCUS_08700 1306 2829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08700 >Feature sequence216 2014 770 gene locus_tag LOCUS_08710 2014 770 CDS product cation:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011101927.1 protein_id gnl|my_center|LOCUS_08710 2172 2459 gene locus_tag LOCUS_08720 2172 2459 CDS product pyrimidine/purine nucleoside phosphorylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087375.1 protein_id gnl|my_center|LOCUS_08720 >Feature sequence217 1798 851 gene locus_tag LOCUS_08730 gene cbiB 1798 851 CDS product adenosylcobinamide-phosphate synthase CbiB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112351.1 protein_id gnl|my_center|LOCUS_08730 2547 1795 gene locus_tag LOCUS_08740 2547 1795 CDS product adenosylcobinamide-GDP ribazoletransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103682.1 protein_id gnl|my_center|LOCUS_08740 <3215 2554 gene locus_tag LOCUS_08750 <3215 2554 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014206640.1:nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase >Feature sequence218 1568 93 gene locus_tag LOCUS_08760 1568 93 CDS product polysaccharide biosynthesis/export family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940398.1 protein_id gnl|my_center|LOCUS_08760 2838 1723 gene locus_tag LOCUS_08770 2838 1723 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08770 >Feature sequence219 1849 857 gene locus_tag LOCUS_08780 1849 857 CDS product TAXI family TRAP transporter solute-binding subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005464586.1 protein_id gnl|my_center|LOCUS_08780 >Feature sequence220 1 225 gene locus_tag LOCUS_08790 1 225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08790 >Feature sequence221 1 384 gene locus_tag LOCUS_08800 1 384 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08800 552 1340 gene locus_tag LOCUS_08810 552 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08810 >Feature sequence222 64 972 gene locus_tag LOCUS_08820 gene secF 64 972 CDS product protein translocase subunit SecF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000486403.1 protein_id gnl|my_center|LOCUS_08820 1008 2090 gene locus_tag LOCUS_08830 1008 2090 CDS product TRAP transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001918468.1 protein_id gnl|my_center|LOCUS_08830 2140 2943 gene locus_tag LOCUS_08840 2140 2943 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08840 >Feature sequence223 376 38 gene locus_tag LOCUS_08850 gene fdx 376 38 CDS product ISC system 2Fe-2S type ferredoxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092818.1 protein_id gnl|my_center|LOCUS_08850 2256 400 gene locus_tag LOCUS_08860 gene hscA 2256 400 CDS product Fe-S protein assembly chaperone HscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015703171.1 protein_id gnl|my_center|LOCUS_08860 2806 2267 gene locus_tag LOCUS_08870 gene hscB 2806 2267 CDS product co-chaperone HscB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000384391.1 protein_id gnl|my_center|LOCUS_08870 3147 2824 gene locus_tag LOCUS_08880 gene iscA 3147 2824 CDS product iron-sulfur cluster assembly protein IscA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417916.1 protein_id gnl|my_center|LOCUS_08880 >Feature sequence224 1470 1039 gene locus_tag LOCUS_08890 gene ndk 1470 1039 CDS product nucleoside-diphosphate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002213338.1 protein_id gnl|my_center|LOCUS_08890 3017 1599 gene locus_tag LOCUS_08900 3017 1599 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880700.1 protein_id gnl|my_center|LOCUS_08900 >Feature sequence225 170 1231 gene locus_tag LOCUS_08910 170 1231 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08910 1252 2571 gene locus_tag LOCUS_08920 1252 2571 CDS product efflux RND transporter periplasmic adaptor subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263308.1 protein_id gnl|my_center|LOCUS_08920 2581 2874 gene locus_tag LOCUS_08930 2581 2874 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_08930 2841 2850 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence226 1202 918 gene locus_tag LOCUS_08940 1202 918 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08940 1893 1591 gene locus_tag LOCUS_08950 1893 1591 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_08950 <3154 2034 gene locus_tag LOCUS_08960 <3154 2034 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095019.1:phosphoribosylamine--glycine ligase >Feature sequence227 1915 974 gene locus_tag LOCUS_08970 gene argF 1915 974 CDS product ornithine carbamoyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014206994.1 protein_id gnl|my_center|LOCUS_08970 3136 1946 gene locus_tag LOCUS_08980 3136 1946 CDS product aspartate aminotransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121101.1 protein_id gnl|my_center|LOCUS_08980 >Feature sequence228 >Feature sequence229 <1 971 gene locus_tag LOCUS_08990 <1 971 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011962267.1:T9SS type A sorting domain-containing protein 1130 1663 gene locus_tag LOCUS_09000 gene hslV 1130 1663 CDS product ATP-dependent protease subunit HslV inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946377.1 protein_id gnl|my_center|LOCUS_09000 1684 3024 gene locus_tag LOCUS_09010 gene hslU 1684 3024 CDS product HslU--HslV peptidase ATPase subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707776.1 protein_id gnl|my_center|LOCUS_09010 >Feature sequence230 2018 489 gene locus_tag LOCUS_09020 gene nusA 2018 489 CDS product transcription termination factor NusA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095192.1 protein_id gnl|my_center|LOCUS_09020 2476 2033 gene locus_tag LOCUS_09030 gene rimP 2476 2033 CDS product ribosome maturation factor RimP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004411704.1 protein_id gnl|my_center|LOCUS_09030 2680 2604 gene locus_tag LOCUS_t00100 2680 2604 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence231 1784 636 gene locus_tag LOCUS_09040 gene mrdB 1784 636 CDS product peptidoglycan glycosyltransferase MrdB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000781440.1 protein_id gnl|my_center|LOCUS_09040 <3099 1952 gene locus_tag LOCUS_09050 <3099 1952 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003093191.1:penicillin-binding protein 2 >Feature sequence232 2719 1910 gene locus_tag LOCUS_09060 2719 1910 CDS product AAA family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970966.1 protein_id gnl|my_center|LOCUS_09060 >Feature sequence233 158 934 gene locus_tag LOCUS_09070 158 934 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09070 1371 988 gene locus_tag LOCUS_09080 1371 988 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09080 1842 1438 gene locus_tag LOCUS_09090 1842 1438 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09090 2721 2927 gene locus_tag LOCUS_09100 2721 2927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09100 >Feature sequence234 1657 197 gene locus_tag LOCUS_09110 gene trkH 1657 197 CDS product Trk system potassium transporter TrkH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005176271.1 protein_id gnl|my_center|LOCUS_09110 2609 1980 gene locus_tag LOCUS_09120 2609 1980 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09120 >Feature sequence235 693 130 gene locus_tag LOCUS_09130 693 130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09130 1268 702 gene locus_tag LOCUS_09140 1268 702 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09140 <3055 1229 gene locus_tag LOCUS_09150 <3055 1229 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073774.1:thiosulfate reductase PhsA 1477 1486 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence236 690 424 gene locus_tag LOCUS_09160 690 424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09160 1659 706 gene locus_tag LOCUS_09170 gene accA 1659 706 CDS product acetyl-CoA carboxylase carboxyl transferase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212147.1 protein_id gnl|my_center|LOCUS_09170 2067 1693 gene locus_tag LOCUS_09180 2067 1693 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003811007.1 protein_id gnl|my_center|LOCUS_09180 2792 2172 gene locus_tag LOCUS_09190 gene ubiX 2792 2172 CDS product flavin prenyltransferase UbiX inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003379089.1 protein_id gnl|my_center|LOCUS_09190 >Feature sequence237 1201 689 gene locus_tag LOCUS_09200 1201 689 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09200 <3047 1299 gene locus_tag LOCUS_09210 <3047 1299 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932535.1:NAD(P)-binding protein >Feature sequence238 >Feature sequence239 2996 1746 gene locus_tag LOCUS_09220 2996 1746 CDS product molybdopterin molybdotransferase MoeA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389877.1 protein_id gnl|my_center|LOCUS_09220 2359 2368 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence240 >Feature sequence241 306 911 gene locus_tag LOCUS_09230 306 911 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073963.1 protein_id gnl|my_center|LOCUS_09230 1328 1038 gene locus_tag LOCUS_09240 1328 1038 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09240 2988 1315 gene locus_tag LOCUS_09250 2988 1315 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09250 >Feature sequence242 <1 1028 gene locus_tag LOCUS_09260 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015705973.1:YecA family protein 1047 2036 gene locus_tag LOCUS_09270 1047 2036 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338262.1 protein_id gnl|my_center|LOCUS_09270 >Feature sequence243 248 595 gene locus_tag LOCUS_09280 248 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09280 1061 864 gene locus_tag LOCUS_09290 1061 864 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09290 1492 1049 gene locus_tag LOCUS_09300 1492 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_09300 >Feature sequence244 775 1194 gene locus_tag LOCUS_09310 775 1194 CDS product Hsp20/alpha crystallin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192748.1 protein_id gnl|my_center|LOCUS_09310 1207 1608 gene locus_tag LOCUS_09320 1207 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09320 1628 2104 gene locus_tag LOCUS_09330 1628 2104 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09330 2480 2914 gene locus_tag LOCUS_09340 gene trxC 2480 2914 CDS product thioredoxin TrxC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036377.1 protein_id gnl|my_center|LOCUS_09340 >Feature sequence245 663 205 gene locus_tag LOCUS_09350 663 205 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09350 1103 1390 gene locus_tag LOCUS_09360 1103 1390 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09360 1584 2852 gene locus_tag LOCUS_09370 gene murA 1584 2852 CDS product UDP-N-acetylglucosamine 1-carboxyvinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003094332.1 protein_id gnl|my_center|LOCUS_09370 >Feature sequence246 1907 369 gene locus_tag LOCUS_09380 1907 369 CDS product B12-binding domain-containing radical SAM protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011986940.1 protein_id gnl|my_center|LOCUS_09380 2095 1904 gene locus_tag LOCUS_09390 2095 1904 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09390 <2954 2088 gene locus_tag LOCUS_09400 <2954 2088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011122637.1:SulP family inorganic anion transporter >Feature sequence247 1926 1633 gene locus_tag LOCUS_09410 1926 1633 CDS product co-chaperone GroES inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003650103.1 protein_id gnl|my_center|LOCUS_09410 2633 2106 gene locus_tag LOCUS_09420 gene fxsA 2633 2106 CDS product membrane protein FxsA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005460455.1 protein_id gnl|my_center|LOCUS_09420 >Feature sequence248 <1 2624 gene locus_tag LOCUS_09430 <1 2624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_181711674.1:efflux RND transporter permease subunit >Feature sequence249 509 1129 gene locus_tag LOCUS_09440 509 1129 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011393403.1 protein_id gnl|my_center|LOCUS_09440 1140 1604 gene locus_tag LOCUS_09450 1140 1604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09450 >Feature sequence250 >Feature sequence251 >Feature sequence252 1789 773 gene locus_tag LOCUS_09460 gene epmB 1789 773 CDS product EF-P beta-lysylation protein EpmB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037417.1 protein_id gnl|my_center|LOCUS_09460 1842 2405 gene locus_tag LOCUS_09470 gene efp 1842 2405 CDS product elongation factor P inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005772139.1 protein_id gnl|my_center|LOCUS_09470 >Feature sequence253 1949 1371 gene locus_tag LOCUS_09480 1949 1371 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142106.1 protein_id gnl|my_center|LOCUS_09480 >Feature sequence254 1270 836 gene locus_tag LOCUS_09490 1270 836 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09490 1496 1717 gene locus_tag LOCUS_09500 1496 1717 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09500 2621 1743 gene locus_tag LOCUS_09510 2621 1743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09510 >Feature sequence255 1359 226 gene locus_tag LOCUS_09520 1359 226 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09520 1433 2140 gene locus_tag LOCUS_09530 1433 2140 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09530 >Feature sequence256 12 1400 gene locus_tag LOCUS_09540 gene hemN 12 1400 CDS product oxygen-independent coproporphyrinogen III oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103794.1 protein_id gnl|my_center|LOCUS_09540 1578 2414 gene locus_tag LOCUS_09550 gene nei 1578 2414 CDS product endonuclease VIII inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001114002.1 protein_id gnl|my_center|LOCUS_09550 >Feature sequence257 30 623 gene locus_tag LOCUS_09560 30 623 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004542749.1 protein_id gnl|my_center|LOCUS_09560 620 2035 gene locus_tag LOCUS_09570 620 2035 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09570 >Feature sequence258 519 70 gene locus_tag LOCUS_09580 gene exbB 519 70 CDS product TonB-system energizer ExbB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001862479.1 protein_id gnl|my_center|LOCUS_09580 720 2840 gene locus_tag LOCUS_09590 720 2840 CDS product TonB-dependent receptor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391199.1 protein_id gnl|my_center|LOCUS_09590 >Feature sequence259 133 1440 gene locus_tag LOCUS_09600 gene chrA 133 1440 CDS product chromate efflux transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528002.1 protein_id gnl|my_center|LOCUS_09600 1445 2089 gene locus_tag LOCUS_09610 1445 2089 CDS product LysE family translocator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105916.1 protein_id gnl|my_center|LOCUS_09610 2447 2094 gene locus_tag LOCUS_09620 2447 2094 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09620 2820 2461 gene locus_tag LOCUS_09630 2820 2461 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09630 >Feature sequence260 1060 2076 gene locus_tag LOCUS_09640 1060 2076 CDS product ribonuclease T(2) inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013530922.1 protein_id gnl|my_center|LOCUS_09640 2183 2827 gene locus_tag LOCUS_09650 2183 2827 CDS product DUF3365 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390063.1 protein_id gnl|my_center|LOCUS_09650 >Feature sequence261 1687 752 gene locus_tag LOCUS_09660 gene prmB 1687 752 CDS product 50S ribosomal protein L3 N(5)-glutamine methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087648.1 protein_id gnl|my_center|LOCUS_09660 1761 2606 gene locus_tag LOCUS_09670 gene asd 1761 2606 CDS product archaetidylserine decarboxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005482194.1 protein_id gnl|my_center|LOCUS_09670 >Feature sequence262 1191 223 gene locus_tag LOCUS_09680 1191 223 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09680 2859 1378 gene locus_tag LOCUS_09690 2859 1378 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09690 >Feature sequence263 54 1355 gene locus_tag LOCUS_09700 54 1355 CDS product DUF1800 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205128.1 protein_id gnl|my_center|LOCUS_09700 2420 1434 gene locus_tag LOCUS_09710 gene cmoB 2420 1434 CDS product tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015365980.1 protein_id gnl|my_center|LOCUS_09710 >Feature sequence264 1465 368 gene locus_tag LOCUS_09720 1465 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09720 >Feature sequence265 >Feature sequence266 >Feature sequence267 765 1421 gene locus_tag LOCUS_09730 765 1421 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011263525.1 protein_id gnl|my_center|LOCUS_09730 1461 2009 gene locus_tag LOCUS_09740 1461 2009 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021035.1 protein_id gnl|my_center|LOCUS_09740 <2845 2101 gene locus_tag LOCUS_09750 <2845 2101 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010947156.1:SDR family oxidoreductase >Feature sequence268 149 595 gene locus_tag LOCUS_09760 149 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09760 685 906 gene locus_tag LOCUS_09770 685 906 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09770 906 1199 gene locus_tag LOCUS_09780 906 1199 CDS product type II toxin-antitoxin system RelE/ParE family toxin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010940733.1 protein_id gnl|my_center|LOCUS_09780 1292 2653 gene locus_tag LOCUS_09790 1292 2653 CDS product P-loop NTPase fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391484.1 protein_id gnl|my_center|LOCUS_09790 >Feature sequence269 1967 2605 gene locus_tag LOCUS_09800 gene ampD 1967 2605 CDS product 1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_046051592.1 protein_id gnl|my_center|LOCUS_09800 >Feature sequence270 2761 1946 gene locus_tag LOCUS_09810 2761 1946 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09810 >Feature sequence271 380 1141 gene locus_tag LOCUS_09820 380 1141 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09820 1149 2519 gene locus_tag LOCUS_09830 1149 2519 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09830 >Feature sequence272 678 1856 gene locus_tag LOCUS_09840 678 1856 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09840 >Feature sequence273 1409 1795 gene locus_tag LOCUS_09850 1409 1795 CDS product group II truncated hemoglobin inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004526443.1 protein_id gnl|my_center|LOCUS_09850 2036 2638 gene locus_tag LOCUS_09860 2036 2638 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002122041.1 protein_id gnl|my_center|LOCUS_09860 >Feature sequence274 >Feature sequence275 <1 534 gene locus_tag LOCUS_09870 <1 534 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037657.1:NADH-quinone oxidoreductase subunit C 547 1800 gene locus_tag LOCUS_09880 547 1800 CDS product NADH-quinone oxidoreductase subunit D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_078068422.1 protein_id gnl|my_center|LOCUS_09880 1801 2361 gene locus_tag LOCUS_09890 gene nuoE 1801 2361 CDS product NADH-quinone oxidoreductase subunit NuoE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948474.1 protein_id gnl|my_center|LOCUS_09890 >Feature sequence276 1992 1360 gene locus_tag LOCUS_09900 1992 1360 CDS product SCP2 sterol-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958604.1 protein_id gnl|my_center|LOCUS_09900 <2799 2252 gene locus_tag LOCUS_09910 <2799 2252 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703994.1:bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE >Feature sequence277 1466 621 gene locus_tag LOCUS_09920 1466 621 CDS product NAD(P)H-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013226532.1 protein_id gnl|my_center|LOCUS_09920 1637 2611 gene locus_tag LOCUS_09930 1637 2611 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003529403.1 protein_id gnl|my_center|LOCUS_09930 >Feature sequence278 433 65 gene locus_tag LOCUS_09940 433 65 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09940 629 2347 gene locus_tag LOCUS_09950 629 2347 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09950 >Feature sequence279 1123 932 gene locus_tag LOCUS_09960 1123 932 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_09960 <2772 1257 gene locus_tag LOCUS_09970 <2772 1257 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence280 120 710 gene locus_tag LOCUS_09980 120 710 CDS product NAD(P)H-dependent oxidoreductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012067696.1 protein_id gnl|my_center|LOCUS_09980 2458 731 gene locus_tag LOCUS_09990 2458 731 CDS product proline--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207562.1 protein_id gnl|my_center|LOCUS_09990 2771 2571 gene locus_tag LOCUS_10000 2771 2571 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10000 >Feature sequence281 1172 297 gene locus_tag LOCUS_10010 1172 297 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10010 <2770 1295 gene locus_tag LOCUS_10020 <2770 1295 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003114236.1:EAL domain-containing protein >Feature sequence282 <1 969 gene locus_tag LOCUS_10030 <1 969 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015443944.1:NADH-quinone oxidoreductase subunit NuoF >Feature sequence283 >Feature sequence284 1712 591 gene locus_tag LOCUS_10040 1712 591 CDS product MFS transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477066.1 protein_id gnl|my_center|LOCUS_10040 >Feature sequence285 958 56 gene locus_tag LOCUS_10050 gene hflC 958 56 CDS product protease modulator HflC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003106429.1 protein_id gnl|my_center|LOCUS_10050 2130 955 gene locus_tag LOCUS_10060 gene hflK 2130 955 CDS product FtsH protease activity modulator HflK inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000312460.1 protein_id gnl|my_center|LOCUS_10060 >Feature sequence286 370 978 gene locus_tag LOCUS_10070 370 978 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10070 990 1742 gene locus_tag LOCUS_10080 990 1742 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10080 1548 1557 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1718 2152 gene locus_tag LOCUS_10090 1718 2152 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10090 >Feature sequence287 <1 1589 gene locus_tag LOCUS_10100 <1 1589 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010881407.1:thioredoxin domain-containing protein 497 506 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <2733 1830 gene locus_tag LOCUS_10110 <2733 1830 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein >Feature sequence288 970 1545 gene locus_tag LOCUS_10120 970 1545 CDS product YecA family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209953.1 protein_id gnl|my_center|LOCUS_10120 >Feature sequence289 <1 638 gene locus_tag LOCUS_10130 <1 638 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405081.1:leucyl/phenylalanyl-tRNA--protein transferase 631 1227 gene locus_tag LOCUS_10140 631 1227 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10140 <2727 1235 gene locus_tag LOCUS_10150 <2727 1235 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011056504.1:heavy metal translocating P-type ATPase >Feature sequence290 2715 190 gene locus_tag LOCUS_10160 2715 190 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10160 >Feature sequence291 1022 2377 gene locus_tag LOCUS_10170 1022 2377 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10170 >Feature sequence292 <2696 635 gene locus_tag LOCUS_10180 <2696 635 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004194140.1:type I polyketide synthase >Feature sequence293 1693 212 gene locus_tag LOCUS_10190 1693 212 CDS product sigma-54 dependent transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011970749.1 protein_id gnl|my_center|LOCUS_10190 <2696 1698 gene locus_tag LOCUS_10200 <2696 1698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012257267.1:response regulator note possible pseudo, frameshifted >Feature sequence294 <2682 1501 gene locus_tag LOCUS_10210 <2682 1501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000045131.1:glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit >Feature sequence295 813 289 gene locus_tag LOCUS_10220 813 289 CDS product DUF1269 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_202950645.1 protein_id gnl|my_center|LOCUS_10220 >Feature sequence296 486 1013 gene locus_tag LOCUS_10230 486 1013 CDS product pilus assembly protein PilP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946665.1 protein_id gnl|my_center|LOCUS_10230 >Feature sequence297 <1 1166 gene locus_tag LOCUS_10240 <1 1166 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003090436.1:NADP-dependent isocitrate dehydrogenase 1183 1605 gene locus_tag LOCUS_10250 gene clpS 1183 1605 CDS product ATP-dependent Clp protease adapter ClpS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003405085.1 protein_id gnl|my_center|LOCUS_10250 >Feature sequence298 254 931 gene locus_tag LOCUS_10260 254 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10260 >Feature sequence299 145 972 gene locus_tag LOCUS_10270 gene rplB 145 972 CDS product 50S ribosomal protein L2 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005417230.1 protein_id gnl|my_center|LOCUS_10270 978 1247 gene locus_tag LOCUS_10280 gene rpsS 978 1247 CDS product 30S ribosomal protein S19 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083596.1 protein_id gnl|my_center|LOCUS_10280 1269 1607 gene locus_tag LOCUS_10290 gene rplV 1269 1607 CDS product 50S ribosomal protein L22 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_006083595.1 protein_id gnl|my_center|LOCUS_10290 1618 2307 gene locus_tag LOCUS_10300 gene rpsC 1618 2307 CDS product 30S ribosomal protein S3 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003176422.1 protein_id gnl|my_center|LOCUS_10300 >Feature sequence300 <1 1022 gene locus_tag LOCUS_10310 <1 1022 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010937438.1:ABC transporter permease 1542 2570 gene locus_tag LOCUS_10320 1542 2570 CDS product cytochrome-c peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880031.1 protein_id gnl|my_center|LOCUS_10320 >Feature sequence301 263 1498 gene locus_tag LOCUS_10330 gene ubiH 263 1498 CDS product 2-octaprenyl-6-methoxyphenyl hydroxylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099190.1 protein_id gnl|my_center|LOCUS_10330 >Feature sequence302 2009 798 gene locus_tag LOCUS_10340 2009 798 CDS product tryptophan--tRNA ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_016356903.1 protein_id gnl|my_center|LOCUS_10340 <2648 2024 gene locus_tag LOCUS_10350 <2648 2024 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010958411.1:site-2 protease family protein >Feature sequence303 1217 618 gene locus_tag LOCUS_10360 gene ruvA 1217 618 CDS product Holliday junction branch migration protein RuvA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072405.1 protein_id gnl|my_center|LOCUS_10360 1738 1235 gene locus_tag LOCUS_10370 gene ruvC 1738 1235 CDS product crossover junction endodeoxyribonuclease RuvC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038141.1 protein_id gnl|my_center|LOCUS_10370 2506 1748 gene locus_tag LOCUS_10380 2506 1748 CDS product YebC/PmpR family DNA-binding transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011104813.1 protein_id gnl|my_center|LOCUS_10380 >Feature sequence304 927 661 gene locus_tag LOCUS_10390 927 661 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10390 2432 939 gene locus_tag LOCUS_10400 2432 939 CDS product DUF4331 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164929156.1 protein_id gnl|my_center|LOCUS_10400 >Feature sequence305 2571 1429 gene locus_tag LOCUS_10410 gene rnd 2571 1429 CDS product ribonuclease D inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389826.1 protein_id gnl|my_center|LOCUS_10410 >Feature sequence306 >Feature sequence307 694 1023 gene locus_tag LOCUS_10420 gene trxA 694 1023 CDS product thioredoxin TrxA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096336.1 protein_id gnl|my_center|LOCUS_10420 1367 2623 gene locus_tag LOCUS_10430 gene rho 1367 2623 CDS product transcription termination factor Rho inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005378757.1 protein_id gnl|my_center|LOCUS_10430 >Feature sequence308 1081 50 gene locus_tag LOCUS_10440 gene hrcA 1081 50 CDS product heat-inducible transcriptional repressor HrcA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_029628994.1 protein_id gnl|my_center|LOCUS_10440 1518 2384 gene locus_tag LOCUS_10450 1518 2384 CDS product NAD(+) kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409651.1 protein_id gnl|my_center|LOCUS_10450 >Feature sequence309 673 1368 gene locus_tag LOCUS_10460 673 1368 CDS product energy-coupling factor ABC transporter permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010975415.1 protein_id gnl|my_center|LOCUS_10460 >Feature sequence310 1801 74 gene locus_tag LOCUS_10470 gene nirS 1801 74 CDS product nitrite reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003111532.1 protein_id gnl|my_center|LOCUS_10470 2145 2501 gene locus_tag LOCUS_10480 gene nirC 2145 2501 CDS product cytochrome c55X inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084870.1 protein_id gnl|my_center|LOCUS_10480 >Feature sequence311 884 177 gene locus_tag LOCUS_10490 884 177 CDS product endonuclease/exonuclease/phosphatase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011389774.1 protein_id gnl|my_center|LOCUS_10490 2365 881 gene locus_tag LOCUS_10500 2365 881 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10500 >Feature sequence312 1038 169 gene locus_tag LOCUS_10510 gene napG 1038 169 CDS product ferredoxin-type protein NapG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000091291.1 protein_id gnl|my_center|LOCUS_10510 2478 1051 gene locus_tag LOCUS_10520 2478 1051 CDS product right-handed parallel beta-helix repeat-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005808197.1 protein_id gnl|my_center|LOCUS_10520 >Feature sequence313 1106 1228 gene locus_tag LOCUS_10530 1106 1228 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10530 >Feature sequence314 287 778 gene locus_tag LOCUS_10540 287 778 CDS product DUF1801 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000034818.1 protein_id gnl|my_center|LOCUS_10540 778 1464 gene locus_tag LOCUS_10550 778 1464 CDS product YafY family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071887.1 protein_id gnl|my_center|LOCUS_10550 >Feature sequence315 <1 581 gene locus_tag LOCUS_10560 <1 581 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948544.1:DUF58 domain-containing protein 578 1099 gene locus_tag LOCUS_10570 578 1099 CDS product DUF4381 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003021659.1 protein_id gnl|my_center|LOCUS_10570 1110 2210 gene locus_tag LOCUS_10580 1110 2210 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113946.1 protein_id gnl|my_center|LOCUS_10580 >Feature sequence316 <1 1188 gene locus_tag LOCUS_10590 <1 1188 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091724.1:DNA helicase RecQ 1769 1254 gene locus_tag LOCUS_10600 1769 1254 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10600 <2610 1988 gene locus_tag LOCUS_10610 <2610 1988 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222142.1:tRNA 5-hydroxyuridine modification protein YegQ >Feature sequence317 <1 1011 gene locus_tag LOCUS_10620 <1 1011 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002679065.1:glycosyltransferase 1271 2110 gene locus_tag LOCUS_10630 1271 2110 CDS product class I SAM-dependent methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528258.1 protein_id gnl|my_center|LOCUS_10630 >Feature sequence318 863 249 gene locus_tag LOCUS_10640 863 249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10640 <2604 908 gene locus_tag LOCUS_10650 <2604 908 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011266976.1:outer membrane protein assembly factor BamA >Feature sequence319 1182 724 gene locus_tag LOCUS_10660 1182 724 CDS product NfeD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010888773.1 protein_id gnl|my_center|LOCUS_10660 2108 1185 gene locus_tag LOCUS_10670 2108 1185 CDS product SPFH domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012066920.1 protein_id gnl|my_center|LOCUS_10670 >Feature sequence320 2079 901 gene locus_tag LOCUS_10680 2079 901 CDS product M20 aminoacylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011390621.1 protein_id gnl|my_center|LOCUS_10680 >Feature sequence321 972 553 gene locus_tag LOCUS_10690 972 553 CDS product secondary thiamine-phosphate synthase enzyme YjbQ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477375.1 protein_id gnl|my_center|LOCUS_10690 1643 1008 gene locus_tag LOCUS_10700 1643 1008 CDS product trimeric intracellular cation channel family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948424.1 protein_id gnl|my_center|LOCUS_10700 <2596 1911 gene locus_tag LOCUS_10710 <2596 1911 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112396.1:4-phosphoerythronate dehydrogenase PdxB >Feature sequence322 60 935 gene locus_tag LOCUS_10720 60 935 CDS product A24 family peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011266634.1 protein_id gnl|my_center|LOCUS_10720 1839 1225 gene locus_tag LOCUS_10730 1839 1225 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10730 <2593 1853 gene locus_tag LOCUS_10740 <2593 1853 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405788.1:chorismate synthase >Feature sequence323 681 1610 gene locus_tag LOCUS_10750 gene oppB 681 1610 CDS product oligopeptide ABC transporter permease OppB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000911088.1 protein_id gnl|my_center|LOCUS_10750 1607 2479 gene locus_tag LOCUS_10760 1607 2479 CDS product ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011388348.1 protein_id gnl|my_center|LOCUS_10760 >Feature sequence324 583 185 gene locus_tag LOCUS_10770 gene crcB 583 185 CDS product fluoride efflux transporter CrcB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946260.1 protein_id gnl|my_center|LOCUS_10770 655 2127 gene locus_tag LOCUS_10780 gene glcD 655 2127 CDS product glycolate oxidase subunit GlcD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268365.1 protein_id gnl|my_center|LOCUS_10780 >Feature sequence325 >Feature sequence326 372 785 gene locus_tag LOCUS_10790 372 785 CDS product CopD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010930898.1 protein_id gnl|my_center|LOCUS_10790 >Feature sequence327 <1 780 gene locus_tag LOCUS_10800 <1 780 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010942986.1:plasma-membrane proton-efflux P-type ATPase 983 1981 gene locus_tag LOCUS_10810 983 1981 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091294.1 protein_id gnl|my_center|LOCUS_10810 >Feature sequence328 696 2168 gene locus_tag LOCUS_10820 696 2168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10820 >Feature sequence329 1085 357 gene locus_tag LOCUS_10830 1085 357 CDS product bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005766737.1 protein_id gnl|my_center|LOCUS_10830 1181 1744 gene locus_tag LOCUS_10840 1181 1744 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10840 >Feature sequence330 2140 1295 gene locus_tag LOCUS_10850 gene pstB 2140 1295 CDS product phosphate ABC transporter ATP-binding protein PstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010891867.1 protein_id gnl|my_center|LOCUS_10850 2552 2145 gene locus_tag LOCUS_10860 2552 2145 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10860 >Feature sequence331 1229 258 gene locus_tag LOCUS_10870 gene pfkB 1229 258 CDS product 1-phosphofructokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010963555.1 protein_id gnl|my_center|LOCUS_10870 <2551 1239 gene locus_tag LOCUS_10880 <2551 1239 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011949165.1:dihydrolipoyl dehydrogenase >Feature sequence332 <2543 403 gene locus_tag LOCUS_10890 <2543 403 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_207161458.1:phosphoenolpyruvate carboxylase >Feature sequence333 822 1622 gene locus_tag LOCUS_10900 822 1622 CDS product sialate O-acetylesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164921816.1 protein_id gnl|my_center|LOCUS_10900 1782 2531 gene locus_tag LOCUS_10910 1782 2531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10910 >Feature sequence334 <1 1097 gene locus_tag LOCUS_10920 <1 1097 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071212.1:phosphoglycerate kinase >Feature sequence335 <2531 117 gene locus_tag LOCUS_10930 <2531 117 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263534.1:aminomethyl-transferring glycine dehydrogenase >Feature sequence336 1264 512 gene locus_tag LOCUS_10940 gene lepB 1264 512 CDS product signal peptidase I inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072829.1 protein_id gnl|my_center|LOCUS_10940 <2529 1297 gene locus_tag LOCUS_10950 <2529 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003109990.1:glutamate--cysteine ligase >Feature sequence337 1137 523 gene locus_tag LOCUS_10960 gene umuD 1137 523 CDS product translesion error-prone DNA polymerase V autoproteolytic subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011946663.1 protein_id gnl|my_center|LOCUS_10960 1279 1743 gene locus_tag LOCUS_10970 1279 1743 CDS product nuclear transport factor 2 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814197.1 protein_id gnl|my_center|LOCUS_10970 >Feature sequence338 <2516 528 gene locus_tag LOCUS_10980 <2516 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480716.1:MMPL family transporter >Feature sequence339 500 1120 gene locus_tag LOCUS_10990 500 1120 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_10990 >Feature sequence340 >Feature sequence341 977 678 gene locus_tag LOCUS_11000 977 678 CDS product YciI family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005767703.1 protein_id gnl|my_center|LOCUS_11000 1656 1009 gene locus_tag LOCUS_11010 1656 1009 CDS product septation protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091488.1 protein_id gnl|my_center|LOCUS_11010 1704 2330 gene locus_tag LOCUS_11020 1704 2330 CDS product L-threonylcarbamoyladenylate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002229052.1 protein_id gnl|my_center|LOCUS_11020 >Feature sequence342 516 851 gene locus_tag LOCUS_11030 gene hpf 516 851 CDS product ribosome hibernation promoting factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005305957.1 protein_id gnl|my_center|LOCUS_11030 1001 1540 gene locus_tag LOCUS_11040 1001 1540 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11040 1540 2400 gene locus_tag LOCUS_11050 gene rapZ 1540 2400 CDS product RNase adapter RapZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003377550.1 protein_id gnl|my_center|LOCUS_11050 >Feature sequence343 877 302 gene locus_tag LOCUS_11060 877 302 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11060 >Feature sequence344 <1 839 gene locus_tag LOCUS_11070 <1 839 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001250141.1:alpha/beta hydrolase 891 1451 gene locus_tag LOCUS_11080 891 1451 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11080 <2496 1483 gene locus_tag LOCUS_11090 <2496 1483 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073558.1:DEAD/DEAH box helicase >Feature sequence345 1158 1928 gene locus_tag LOCUS_11100 gene minC 1158 1928 CDS product septum site-determining protein MinC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705993.1 protein_id gnl|my_center|LOCUS_11100 >Feature sequence346 863 2227 gene locus_tag LOCUS_11110 863 2227 CDS product pitrilysin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958525.1 protein_id gnl|my_center|LOCUS_11110 >Feature sequence347 <1 598 gene locus_tag LOCUS_11120 <1 598 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010975341.1:N-acetylglutaminylglutamine amidotransferase 617 940 gene locus_tag LOCUS_11130 617 940 CDS product DUF2007 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004189573.1 protein_id gnl|my_center|LOCUS_11130 1014 1826 gene locus_tag LOCUS_11140 1014 1826 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010973800.1 protein_id gnl|my_center|LOCUS_11140 >Feature sequence348 6 248 gene locus_tag LOCUS_11150 6 248 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11150 588 2153 gene locus_tag LOCUS_11160 588 2153 CDS product 2-isopropylmalate synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004522419.1 protein_id gnl|my_center|LOCUS_11160 >Feature sequence349 400 729 gene locus_tag LOCUS_11170 400 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11170 746 1549 gene locus_tag LOCUS_11180 746 1549 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11180 1549 2265 gene locus_tag LOCUS_11190 1549 2265 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11190 >Feature sequence350 1013 297 gene locus_tag LOCUS_11200 1013 297 CDS product Bax inhibitor-1 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007327344.1 protein_id gnl|my_center|LOCUS_11200 1314 1108 gene locus_tag LOCUS_11210 1314 1108 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11210 <2471 1316 gene locus_tag LOCUS_11220 <2471 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005174650.1:ABC transporter ATP-binding protein >Feature sequence351 45 743 gene locus_tag LOCUS_11230 45 743 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11230 1688 747 gene locus_tag LOCUS_11240 1688 747 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_164920971.1 protein_id gnl|my_center|LOCUS_11240 >Feature sequence352 311 547 gene locus_tag LOCUS_11250 gene rpmB 311 547 CDS product 50S ribosomal protein L28 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005542826.1 protein_id gnl|my_center|LOCUS_11250 559 714 gene locus_tag LOCUS_11260 gene rpmG 559 714 CDS product 50S ribosomal protein L33 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001205031.1 protein_id gnl|my_center|LOCUS_11260 858 1832 gene locus_tag LOCUS_11270 858 1832 CDS product ATP-binding cassette domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_118838671.1 protein_id gnl|my_center|LOCUS_11270 >Feature sequence353 <1 651 gene locus_tag LOCUS_11280 <1 651 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943073.1:alpha-ketoacid dehydrogenase subunit beta 641 1105 gene locus_tag LOCUS_11290 641 1105 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11290 1189 1884 gene locus_tag LOCUS_11300 1189 1884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11300 1509 1518 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence354 >Feature sequence355 149 304 gene locus_tag LOCUS_11310 149 304 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11310 328 1689 gene locus_tag LOCUS_11320 328 1689 CDS product NAD(P)-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011085876.1 protein_id gnl|my_center|LOCUS_11320 >Feature sequence356 <1 1700 gene locus_tag LOCUS_11330 <1 1700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033447544.1:SulP family inorganic anion transporter >Feature sequence357 315 2267 gene locus_tag LOCUS_11340 315 2267 CDS product ATP-dependent DNA helicase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001881716.1 protein_id gnl|my_center|LOCUS_11340 >Feature sequence358 <2422 1047 gene locus_tag LOCUS_11350 <2422 1047 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482527.1:peptidylprolyl isomerase >Feature sequence359 1160 162 gene locus_tag LOCUS_11360 1160 162 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11360 1410 1180 gene locus_tag LOCUS_11370 1410 1180 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11370 1673 1521 gene locus_tag LOCUS_11380 1673 1521 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11380 >Feature sequence360 913 590 gene locus_tag LOCUS_11390 913 590 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11390 >Feature sequence361 >Feature sequence362 1403 948 gene locus_tag LOCUS_11400 1403 948 CDS product GNAT family N-acetyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012259680.1 protein_id gnl|my_center|LOCUS_11400 1538 2320 gene locus_tag LOCUS_11410 1538 2320 CDS product carbonic anhydrase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707169.1 protein_id gnl|my_center|LOCUS_11410 >Feature sequence363 171 674 gene locus_tag LOCUS_11420 171 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11420 >Feature sequence364 <1 1297 gene locus_tag LOCUS_11430 <1 1297 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072999.1:efflux RND transporter permease subunit <2402 1732 gene locus_tag LOCUS_11440 <2402 1732 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003405338.1:L-aspartate oxidase >Feature sequence365 811 32 gene locus_tag LOCUS_11450 811 32 CDS product TatD family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011036616.1 protein_id gnl|my_center|LOCUS_11450 <2395 852 gene locus_tag LOCUS_11460 <2395 852 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011459174.1:4Fe-4S dicluster domain-containing protein >Feature sequence366 1718 984 gene locus_tag LOCUS_11470 1718 984 CDS product 4Fe-4S dicluster domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004187972.1 protein_id gnl|my_center|LOCUS_11470 <2388 1729 gene locus_tag LOCUS_11480 <2388 1729 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004187995.1:molybdopterin oxidoreductase family protein >Feature sequence367 2385 649 gene locus_tag LOCUS_11490 2385 649 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11490 >Feature sequence368 <2387 1261 gene locus_tag LOCUS_11500 <2387 1261 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766568.1:undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase >Feature sequence369 1124 1255 gene locus_tag LOCUS_11510 1124 1255 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11510 <2380 1503 gene locus_tag LOCUS_11520 <2380 1503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011339170.1:ribulose-bisphosphate carboxylase >Feature sequence370 >Feature sequence371 1269 847 gene locus_tag LOCUS_11530 1269 847 CDS product F0F1 ATP synthase subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004195832.1 protein_id gnl|my_center|LOCUS_11530 <2364 1316 gene locus_tag LOCUS_11540 <2364 1316 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011074330.1:F0F1 ATP synthase subunit beta >Feature sequence372 >Feature sequence373 <1 580 gene locus_tag LOCUS_11550 <1 580 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003022763.1:ATP-dependent chaperone ClpB 722 1423 gene locus_tag LOCUS_11560 722 1423 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014626211.1 protein_id gnl|my_center|LOCUS_11560 1845 1492 gene locus_tag LOCUS_11570 1845 1492 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11570 >Feature sequence374 <1 1000 gene locus_tag LOCUS_11580 <1 1000 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010957983.1:SLC13 family permease 1460 1338 gene locus_tag LOCUS_11590 1460 1338 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11590 >Feature sequence375 725 1903 gene locus_tag LOCUS_11600 725 1903 CDS product ISAs1-like element ISSod22 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011072192.1 protein_id gnl|my_center|LOCUS_11600 1946 1955 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence376 2008 1052 gene locus_tag LOCUS_11610 2008 1052 CDS product sulfurtransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010876261.1 protein_id gnl|my_center|LOCUS_11610 >Feature sequence377 391 864 gene locus_tag LOCUS_11620 gene rlmH 391 864 CDS product 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000701620.1 protein_id gnl|my_center|LOCUS_11620 876 1448 gene locus_tag LOCUS_11630 876 1448 CDS product Maf family nucleotide pyrophosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222850.1 protein_id gnl|my_center|LOCUS_11630 >Feature sequence378 <2326 462 gene locus_tag LOCUS_11640 <2326 462 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011037013.1:carbamoyl-phosphate synthase large subunit >Feature sequence379 897 1853 gene locus_tag LOCUS_11650 897 1853 CDS product MBL fold metallo-hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_176994121.1 protein_id gnl|my_center|LOCUS_11650 >Feature sequence380 <1 770 gene locus_tag LOCUS_11660 <1 770 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940694.1:peptidylprolyl isomerase 767 1447 gene locus_tag LOCUS_11670 767 1447 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11670 <2318 1494 gene locus_tag LOCUS_11680 <2318 1494 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010940694.1:peptidylprolyl isomerase >Feature sequence381 246 1331 gene locus_tag LOCUS_11690 246 1331 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11690 >Feature sequence382 <1 1558 gene locus_tag LOCUS_11700 <1 1558 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004196462.1:LTA synthase family protein <2307 1572 gene locus_tag LOCUS_11710 <2307 1572 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207107.1:ion transporter >Feature sequence383 1606 344 gene locus_tag LOCUS_11720 1606 344 CDS product isoprenylcysteine carboxylmethyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004188709.1 protein_id gnl|my_center|LOCUS_11720 <2304 1681 gene locus_tag LOCUS_11730 <2304 1681 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005770277.1:class I SAM-dependent methyltransferase >Feature sequence384 885 595 gene locus_tag LOCUS_11740 885 595 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11740 1679 897 gene locus_tag LOCUS_11750 1679 897 CDS product succinate dehydrogenase iron-sulfur subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528877.1 protein_id gnl|my_center|LOCUS_11750 <2304 1691 gene locus_tag LOCUS_11760 <2304 1691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388959.1:succinate dehydrogenase flavoprotein subunit >Feature sequence385 1494 373 gene locus_tag LOCUS_11770 1494 373 CDS product HupE/UreJ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011142975.1 protein_id gnl|my_center|LOCUS_11770 >Feature sequence386 1297 413 gene locus_tag LOCUS_11780 1297 413 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11780 <2287 1683 gene locus_tag LOCUS_11790 <2287 1683 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011387714.1:AAA family ATPase >Feature sequence387 <1 1447 gene locus_tag LOCUS_11800 <1 1447 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_110170977.1:VWA domain-containing protein 1630 2175 gene locus_tag LOCUS_11810 1630 2175 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11810 >Feature sequence388 >Feature sequence389 1005 334 gene locus_tag LOCUS_11820 1005 334 CDS product 50S ribosomal protein L25/general stress protein Ctc inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099279.1 protein_id gnl|my_center|LOCUS_11820 2097 1126 gene locus_tag LOCUS_11830 2097 1126 CDS product ribose-phosphate pyrophosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003687900.1 protein_id gnl|my_center|LOCUS_11830 2249 2175 gene locus_tag LOCUS_t00110 2249 2175 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence390 97 23 gene locus_tag LOCUS_t00120 97 23 tRNA product tRNA-Gln inference COORDINATES:profile:Aragorn:1.2.38 1039 113 gene locus_tag LOCUS_11840 gene ispE 1039 113 CDS product 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001260323.1 protein_id gnl|my_center|LOCUS_11840 1680 1024 gene locus_tag LOCUS_11850 gene lolB 1680 1024 CDS product lipoprotein insertase outer membrane protein LolB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958471.1 protein_id gnl|my_center|LOCUS_11850 <2273 1746 gene locus_tag LOCUS_11860 <2273 1746 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_074907579.1:tetratricopeptide repeat protein >Feature sequence391 <1 1406 gene locus_tag LOCUS_11870 <1 1406 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011262905.1:tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG 1541 2173 gene locus_tag LOCUS_11880 gene rsmG 1541 2173 CDS product 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011707917.1 protein_id gnl|my_center|LOCUS_11880 >Feature sequence392 239 1450 gene locus_tag LOCUS_11890 gene argJ 239 1450 CDS product bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268841.1 protein_id gnl|my_center|LOCUS_11890 >Feature sequence393 <1 1308 gene locus_tag LOCUS_11900 <1 1308 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038134.1:Tol-Pal system beta propeller repeat protein TolB 1341 1991 gene locus_tag LOCUS_11910 1341 1991 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11910 >Feature sequence394 >Feature sequence395 <2250 669 gene locus_tag LOCUS_11920 <2250 669 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013097618.1:inverse autotransporter beta-barrel domain-containing protein >Feature sequence396 1101 427 gene locus_tag LOCUS_11930 gene yrfG 1101 427 CDS product GMP/IMP nucleotidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003114065.1 protein_id gnl|my_center|LOCUS_11930 1123 1662 gene locus_tag LOCUS_11940 gene nudE 1123 1662 CDS product ADP compounds hydrolase NudE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070586.1 protein_id gnl|my_center|LOCUS_11940 1931 1659 gene locus_tag LOCUS_11950 1931 1659 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11950 >Feature sequence397 229 2130 gene locus_tag LOCUS_11960 229 2130 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11960 >Feature sequence398 1080 190 gene locus_tag LOCUS_11970 gene xerD 1080 190 CDS product site-specific tyrosine recombinase XerD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092629.1 protein_id gnl|my_center|LOCUS_11970 1879 1103 gene locus_tag LOCUS_11980 1879 1103 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_11980 >Feature sequence399 1587 151 gene locus_tag LOCUS_11990 1587 151 CDS product DUF697 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011057130.1 protein_id gnl|my_center|LOCUS_11990 >Feature sequence400 <1 620 gene locus_tag LOCUS_12000 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036460.1:3-hydroxyacyl-CoA dehydrogenase NAD-binding domain-containing protein 1742 648 gene locus_tag LOCUS_12010 1742 648 CDS product M28 family metallopeptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000719999.1 protein_id gnl|my_center|LOCUS_12010 >Feature sequence401 <2234 495 gene locus_tag LOCUS_12020 <2234 495 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477759.1:tandem-95 repeat protein >Feature sequence402 38 1189 gene locus_tag LOCUS_12030 38 1189 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12030 <2222 1150 gene locus_tag LOCUS_12040 <2222 1150 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003128930.1:signal recognition particle-docking protein FtsY >Feature sequence403 1899 817 gene locus_tag LOCUS_12050 1899 817 CDS product hydrogenase small subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011338265.1 protein_id gnl|my_center|LOCUS_12050 >Feature sequence404 604 1146 gene locus_tag LOCUS_12060 604 1146 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12060 1166 1666 gene locus_tag LOCUS_12070 1166 1666 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12070 >Feature sequence405 506 135 gene locus_tag LOCUS_12080 506 135 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12080 778 1452 gene locus_tag LOCUS_12090 778 1452 CDS product TIGR00153 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001911782.1 protein_id gnl|my_center|LOCUS_12090 >Feature sequence406 >Feature sequence407 1905 1033 gene locus_tag LOCUS_12100 1905 1033 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12100 >Feature sequence408 1124 810 gene locus_tag LOCUS_12110 1124 810 CDS product chaperone modulator CbpM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947973.1 protein_id gnl|my_center|LOCUS_12110 2099 1140 gene locus_tag LOCUS_12120 2099 1140 CDS product DnaJ C-terminal domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012220518.1 protein_id gnl|my_center|LOCUS_12120 >Feature sequence409 <1 995 gene locus_tag LOCUS_12130 <1 995 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766543.1:cell division protein ZapE 1096 1959 gene locus_tag LOCUS_12140 1096 1959 CDS product pyruvate, water dikinase regulatory protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015063753.1 protein_id gnl|my_center|LOCUS_12140 >Feature sequence410 >Feature sequence411 >Feature sequence412 >Feature sequence413 >Feature sequence414 1387 2103 gene locus_tag LOCUS_12150 1387 2103 CDS product DUF2238 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010931060.1 protein_id gnl|my_center|LOCUS_12150 >Feature sequence415 >Feature sequence416 >Feature sequence417 1029 172 gene locus_tag LOCUS_12160 gene purU 1029 172 CDS product formyltetrahydrofolate deformylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003101174.1 protein_id gnl|my_center|LOCUS_12160 1936 1037 gene locus_tag LOCUS_12170 1936 1037 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003345646.1 protein_id gnl|my_center|LOCUS_12170 >Feature sequence418 1989 115 gene locus_tag LOCUS_12180 gene secD 1989 115 CDS product protein translocase subunit SecD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705625.1 protein_id gnl|my_center|LOCUS_12180 >Feature sequence419 206 970 gene locus_tag LOCUS_12190 gene dsrM 206 970 CDS product sulfate reduction electron transfer complex DsrMKJOP subunit DsrM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012544992.1 protein_id gnl|my_center|LOCUS_12190 >Feature sequence420 >Feature sequence421 >Feature sequence422 >Feature sequence423 1183 674 gene locus_tag LOCUS_12200 1183 674 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12200 <2112 1225 gene locus_tag LOCUS_12210 <2112 1225 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073976.1:retention module-containing protein >Feature sequence424 414 121 gene locus_tag LOCUS_12220 414 121 CDS product thioredoxin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011331460.1 protein_id gnl|my_center|LOCUS_12220 1414 461 gene locus_tag LOCUS_12230 1414 461 CDS product permease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070875.1 protein_id gnl|my_center|LOCUS_12230 1716 1725 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence425 >Feature sequence426 <2103 1126 gene locus_tag LOCUS_12240 <2103 1126 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113911.1:acetate--CoA ligase >Feature sequence427 1167 322 gene locus_tag LOCUS_12250 1167 322 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12250 1415 1236 gene locus_tag LOCUS_12260 1415 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12260 1699 1526 gene locus_tag LOCUS_12270 1699 1526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12270 >Feature sequence428 >Feature sequence429 <1 1111 gene locus_tag LOCUS_12280 <1 1111 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772589.1:peptide chain release factor 3 1648 1211 gene locus_tag LOCUS_12290 1648 1211 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12290 >Feature sequence430 1614 103 gene locus_tag LOCUS_12300 1614 103 CDS product NADH-quinone oxidoreductase subunit M inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011037648.1 protein_id gnl|my_center|LOCUS_12300 >Feature sequence431 203 1207 gene locus_tag LOCUS_12310 gene hemB 203 1207 CDS product porphobilinogen synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073891.1 protein_id gnl|my_center|LOCUS_12310 1836 1249 gene locus_tag LOCUS_12320 1836 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12320 >Feature sequence432 249 1247 gene locus_tag LOCUS_12330 249 1247 CDS product DNA polymerase III subunit delta' inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003104126.1 protein_id gnl|my_center|LOCUS_12330 1282 1686 gene locus_tag LOCUS_12340 1282 1686 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12340 >Feature sequence433 1144 275 gene locus_tag LOCUS_12350 gene ilvE 1144 275 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007336792.1 protein_id gnl|my_center|LOCUS_12350 1937 1137 gene locus_tag LOCUS_12360 1937 1137 CDS product PhzF family phenazine biosynthesis protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_095645285.1 protein_id gnl|my_center|LOCUS_12360 >Feature sequence434 <2045 1207 gene locus_tag LOCUS_12370 <2045 1207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005694198.1:small ribosomal subunit biogenesis GTPase RsgA >Feature sequence435 625 11 gene locus_tag LOCUS_12380 625 11 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011105558.1 protein_id gnl|my_center|LOCUS_12380 <2042 622 gene locus_tag LOCUS_12390 <2042 622 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013525377.1:PAS domain S-box protein >Feature sequence436 777 232 gene locus_tag LOCUS_12400 777 232 CDS product cytochrome b inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073239.1 protein_id gnl|my_center|LOCUS_12400 1524 826 gene locus_tag LOCUS_12410 1524 826 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12410 >Feature sequence437 1459 581 gene locus_tag LOCUS_12420 1459 581 CDS product putative selenate ABC transporter substrate-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011125171.1 protein_id gnl|my_center|LOCUS_12420 >Feature sequence438 <2027 75 gene locus_tag LOCUS_12430 <2027 75 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990677.1:PKD domain-containing protein >Feature sequence439 >Feature sequence440 >Feature sequence441 409 418 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1014 1274 gene locus_tag LOCUS_12440 1014 1274 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12440 1271 1939 gene locus_tag LOCUS_12450 1271 1939 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12450 >Feature sequence442 <1 949 gene locus_tag LOCUS_12460 <1 949 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011261114.1:tRNA dihydrouridine(20/20a) synthase DusA 1104 1179 gene locus_tag LOCUS_t00130 1104 1179 tRNA product tRNA-Asn inference COORDINATES:profile:Aragorn:1.2.38 1843 1538 gene locus_tag LOCUS_12470 1843 1538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12470 >Feature sequence443 <1 747 gene locus_tag LOCUS_12480 <1 747 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_150678942.1:WYL domain-containing protein 834 956 gene locus_tag LOCUS_12490 834 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12490 1205 1975 gene locus_tag LOCUS_12500 1205 1975 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12500 >Feature sequence444 1322 693 gene locus_tag LOCUS_12510 1322 693 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_035668135.1 protein_id gnl|my_center|LOCUS_12510 <2001 1410 gene locus_tag LOCUS_12520 <2001 1410 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072542.1:quinone-dependent dihydroorotate dehydrogenase >Feature sequence445 204 371 gene locus_tag LOCUS_12530 204 371 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12530 214 223 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1990 368 gene locus_tag LOCUS_12540 <1990 368 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003406749.1:phosphoenolpyruvate synthase >Feature sequence446 1839 841 gene locus_tag LOCUS_12550 1839 841 CDS product MoxR family ATPase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010948545.1 protein_id gnl|my_center|LOCUS_12550 >Feature sequence447 <1981 798 gene locus_tag LOCUS_12560 <1981 798 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015703926.1:DNA polymerase I 1643 1652 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence448 99 1370 gene locus_tag LOCUS_12570 99 1370 CDS product lipoprotein-releasing ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091170.1 protein_id gnl|my_center|LOCUS_12570 >Feature sequence449 40 531 gene locus_tag LOCUS_12580 40 531 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon protein_id gnl|my_center|LOCUS_12580 516 525 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence450 >Feature sequence451 >Feature sequence452 834 538 gene locus_tag LOCUS_12590 834 538 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12590 1242 847 gene locus_tag LOCUS_12600 1242 847 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12600 1441 1851 gene locus_tag LOCUS_12610 gene cueR 1441 1851 CDS product Cu(I)-responsive transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037391497.1 protein_id gnl|my_center|LOCUS_12610 >Feature sequence453 121 1641 gene locus_tag LOCUS_12620 121 1641 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12620 >Feature sequence454 258 662 gene locus_tag LOCUS_12630 258 662 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004196360.1 protein_id gnl|my_center|LOCUS_12630 845 1432 gene locus_tag LOCUS_12640 845 1432 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12640 >Feature sequence455 1674 619 gene locus_tag LOCUS_12650 1674 619 CDS product replication initiator protein A inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002724803.1 protein_id gnl|my_center|LOCUS_12650 >Feature sequence456 >Feature sequence457 688 1524 gene locus_tag LOCUS_12660 gene murI 688 1524 CDS product glutamate racemase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003099300.1 protein_id gnl|my_center|LOCUS_12660 >Feature sequence458 <1934 624 gene locus_tag LOCUS_12670 <1934 624 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_027479885.1:4-alpha-glucanotransferase >Feature sequence459 1399 155 gene locus_tag LOCUS_12680 1399 155 CDS product sodium:proton antiporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763524.1 protein_id gnl|my_center|LOCUS_12680 >Feature sequence460 <1 778 gene locus_tag LOCUS_12690 <1 778 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010920196.1:SDR family oxidoreductase 753 1712 gene locus_tag LOCUS_12700 753 1712 CDS product haloalkane dehalogenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003409254.1 protein_id gnl|my_center|LOCUS_12700 >Feature sequence461 296 1408 gene locus_tag LOCUS_12710 gene dndB 296 1408 CDS product DNA sulfur modification protein DndB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005134924.1 protein_id gnl|my_center|LOCUS_12710 >Feature sequence462 <1914 1162 gene locus_tag LOCUS_12720 <1914 1162 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011817040.1:methionine adenosyltransferase >Feature sequence463 514 122 gene locus_tag LOCUS_12730 gene tusD 514 122 CDS product sulfurtransferase complex subunit TusD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011268263.1 protein_id gnl|my_center|LOCUS_12730 1605 529 gene locus_tag LOCUS_12740 gene dsrB 1605 529 CDS product dissimilatory-type sulfite reductase subunit beta inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932534.1 protein_id gnl|my_center|LOCUS_12740 >Feature sequence464 1624 158 gene locus_tag LOCUS_12750 1624 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12750 >Feature sequence465 829 446 gene locus_tag LOCUS_12760 829 446 CDS product VOC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208236.1 protein_id gnl|my_center|LOCUS_12760 1169 819 gene locus_tag LOCUS_12770 1169 819 CDS product ArsC family reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532857.1 protein_id gnl|my_center|LOCUS_12770 >Feature sequence466 1137 145 gene locus_tag LOCUS_12780 1137 145 CDS product phosphotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007244442.1 protein_id gnl|my_center|LOCUS_12780 1843 1634 gene locus_tag LOCUS_12790 1843 1634 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 protein_id gnl|my_center|LOCUS_12790 >Feature sequence467 1494 136 gene locus_tag LOCUS_12800 1494 136 CDS product dihydroorotase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706420.1 protein_id gnl|my_center|LOCUS_12800 >Feature sequence468 >Feature sequence469 1736 144 gene locus_tag LOCUS_12810 gene pgi 1736 144 CDS product glucose-6-phosphate isomerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005455828.1 protein_id gnl|my_center|LOCUS_12810 >Feature sequence470 110 1249 gene locus_tag LOCUS_12820 110 1249 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12820 >Feature sequence471 >Feature sequence472 <1 1675 gene locus_tag LOCUS_12830 <1 1675 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207185.1:MlaD family protein >Feature sequence473 <1881 1372 gene locus_tag LOCUS_12840 <1881 1372 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071065.1:ammonium transporter >Feature sequence474 229 723 gene locus_tag LOCUS_12850 gene mreD 229 723 CDS product rod shape-determining protein MreD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958247.1 protein_id gnl|my_center|LOCUS_12850 1504 779 gene locus_tag LOCUS_12860 1504 779 CDS product glycerophosphodiester phosphodiesterase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000042772.1 protein_id gnl|my_center|LOCUS_12860 >Feature sequence475 188 802 gene locus_tag LOCUS_12870 188 802 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12870 899 1567 gene locus_tag LOCUS_12880 899 1567 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074115.1 protein_id gnl|my_center|LOCUS_12880 >Feature sequence476 <1 848 gene locus_tag LOCUS_12890 <1 848 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007651015.1:rod shape-determining protein 964 1842 gene locus_tag LOCUS_12900 964 1842 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12900 >Feature sequence477 <1 1032 gene locus_tag LOCUS_12910 <1 1032 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003106701.1:3-phosphoserine/phosphohydroxythreonine transaminase >Feature sequence478 >Feature sequence479 586 999 gene locus_tag LOCUS_12920 586 999 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_12920 972 981 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1017 1424 gene locus_tag LOCUS_12930 1017 1424 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12930 >Feature sequence480 <1 684 gene locus_tag LOCUS_12940 <1 684 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011141614.1:mechanosensitive ion channel 1188 688 gene locus_tag LOCUS_12950 1188 688 CDS product pilus assembly protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011704650.1 protein_id gnl|my_center|LOCUS_12950 >Feature sequence481 134 1039 gene locus_tag LOCUS_12960 134 1039 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_12960 <1853 1294 gene locus_tag LOCUS_12970 <1853 1294 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_038967207.1:L-histidine N(alpha)-methyltransferase >Feature sequence482 >Feature sequence483 1081 422 gene locus_tag LOCUS_12980 1081 422 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002224750.1 protein_id gnl|my_center|LOCUS_12980 <1843 1078 gene locus_tag LOCUS_12990 <1843 1078 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003811217.1:ABC transporter permease >Feature sequence484 1178 693 gene locus_tag LOCUS_13000 1178 693 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084858.1 protein_id gnl|my_center|LOCUS_13000 1633 1175 gene locus_tag LOCUS_13010 1633 1175 CDS product Lrp/AsnC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003084860.1 protein_id gnl|my_center|LOCUS_13010 >Feature sequence485 937 1446 gene locus_tag LOCUS_13020 gene rraA 937 1446 CDS product ribonuclease E activity regulator RraA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003087823.1 protein_id gnl|my_center|LOCUS_13020 >Feature sequence486 1524 601 gene locus_tag LOCUS_13030 1524 601 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13030 >Feature sequence487 1320 256 gene locus_tag LOCUS_13040 gene nagZ 1320 256 CDS product beta-N-acetylhexosaminidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000529320.1 protein_id gnl|my_center|LOCUS_13040 >Feature sequence488 1196 705 gene locus_tag LOCUS_13050 1196 705 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13050 <1830 1327 gene locus_tag LOCUS_13060 <1830 1327 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011084136.1:DUF924 family protein >Feature sequence489 207 809 gene locus_tag LOCUS_13070 207 809 CDS product sigma-70 family RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013229712.1 protein_id gnl|my_center|LOCUS_13070 806 1657 gene locus_tag LOCUS_13080 806 1657 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13080 >Feature sequence490 892 77 gene locus_tag LOCUS_13090 892 77 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13090 <1819 920 gene locus_tag LOCUS_13100 <1819 920 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_033447772.1:aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme >Feature sequence491 853 1806 gene locus_tag LOCUS_13110 853 1806 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13110 >Feature sequence492 >Feature sequence493 270 1187 gene locus_tag LOCUS_13120 270 1187 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13120 1191 1388 gene locus_tag LOCUS_13130 1191 1388 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13130 >Feature sequence494 547 314 gene locus_tag LOCUS_13140 547 314 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13140 >Feature sequence495 382 1713 gene locus_tag LOCUS_13150 382 1713 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13150 >Feature sequence496 <1 1115 gene locus_tag LOCUS_13160 <1 1115 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113354.1:excinuclease ABC subunit UvrC 1245 1781 gene locus_tag LOCUS_13170 gene pgsA 1245 1781 CDS product CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005694415.1 protein_id gnl|my_center|LOCUS_13170 >Feature sequence497 393 902 gene locus_tag LOCUS_13180 gene coaD 393 902 CDS product pantetheine-phosphate adenylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005737440.1 protein_id gnl|my_center|LOCUS_13180 1591 956 gene locus_tag LOCUS_13190 1591 956 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13190 >Feature sequence498 869 6 gene locus_tag LOCUS_13200 869 6 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13200 1734 847 gene locus_tag LOCUS_13210 1734 847 CDS product bile acid:sodium symporter family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000445511.1 protein_id gnl|my_center|LOCUS_13210 >Feature sequence499 1000 1788 gene locus_tag LOCUS_13220 1000 1788 CDS product ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002852748.1 protein_id gnl|my_center|LOCUS_13220 >Feature sequence500 365 129 gene locus_tag LOCUS_13230 365 129 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13230 736 362 gene locus_tag LOCUS_13240 736 362 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13240 1259 717 gene locus_tag LOCUS_13250 1259 717 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010941382.1 protein_id gnl|my_center|LOCUS_13250 >Feature sequence501 1582 902 gene locus_tag LOCUS_13260 gene modB 1582 902 CDS product molybdate ABC transporter permease subunit inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003088068.1 protein_id gnl|my_center|LOCUS_13260 >Feature sequence502 15 1106 gene locus_tag LOCUS_13270 gene ychF 15 1106 CDS product redox-regulated ATPase YchF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005496175.1 protein_id gnl|my_center|LOCUS_13270 >Feature sequence503 325 80 gene locus_tag LOCUS_13280 325 80 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13280 533 1009 gene locus_tag LOCUS_13290 533 1009 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13290 1006 1632 gene locus_tag LOCUS_13300 1006 1632 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13300 >Feature sequence504 1113 382 gene locus_tag LOCUS_13310 1113 382 CDS product glutathione peroxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000495223.1 protein_id gnl|my_center|LOCUS_13310 >Feature sequence505 <1 691 gene locus_tag LOCUS_13320 <1 691 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_206817443.1:tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB 1783 698 gene locus_tag LOCUS_13330 1783 698 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13330 >Feature sequence506 27 1145 gene locus_tag LOCUS_13340 27 1145 CDS product DUF1501 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005480302.1 protein_id gnl|my_center|LOCUS_13340 >Feature sequence507 908 1756 gene locus_tag LOCUS_13350 908 1756 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880491.1 protein_id gnl|my_center|LOCUS_13350 >Feature sequence508 <1 1040 gene locus_tag LOCUS_13360 <1 1040 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011268982.1:DNA polymerase III subunit delta >Feature sequence509 <1 520 gene locus_tag LOCUS_13370 <1 520 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014626248.1:Crp/Fnr family transcriptional regulator >Feature sequence510 <1 536 gene locus_tag LOCUS_13380 <1 536 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010946769.1:DUF2231 domain-containing protein >Feature sequence511 <1 1028 gene locus_tag LOCUS_13390 <1 1028 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000961458.1:ABC-F family ATPase <1765 1025 gene locus_tag LOCUS_13400 <1765 1025 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002836742.1:undecaprenyl-diphosphate phosphatase >Feature sequence512 <1 868 gene locus_tag LOCUS_13410 <1 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113864.1:1-deoxy-D-xylulose-5-phosphate reductoisomerase >Feature sequence513 1307 330 gene locus_tag LOCUS_13420 gene egtD 1307 330 CDS product L-histidine N(alpha)-methyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011205453.1 protein_id gnl|my_center|LOCUS_13420 >Feature sequence514 1756 1436 gene locus_tag LOCUS_13430 1756 1436 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13430 >Feature sequence515 242 1060 gene locus_tag LOCUS_13440 242 1060 CDS product alpha/beta fold hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011964187.1 protein_id gnl|my_center|LOCUS_13440 >Feature sequence516 915 511 gene locus_tag LOCUS_13450 gene queF 915 511 CDS product preQ(1) synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010933302.1 protein_id gnl|my_center|LOCUS_13450 1453 980 gene locus_tag LOCUS_13460 gene ssb 1453 980 CDS product single-stranded DNA-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771486.1 protein_id gnl|my_center|LOCUS_13460 >Feature sequence517 1673 804 gene locus_tag LOCUS_13470 1673 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13470 >Feature sequence518 1331 150 gene locus_tag LOCUS_13480 gene macA 1331 150 CDS product macrolide transporter subunit MacA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013097327.1 protein_id gnl|my_center|LOCUS_13480 >Feature sequence519 575 1498 gene locus_tag LOCUS_13490 gene hslO 575 1498 CDS product Hsp33 family molecular chaperone HslO inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096245.1 protein_id gnl|my_center|LOCUS_13490 >Feature sequence520 604 1488 gene locus_tag LOCUS_13500 604 1488 CDS product lipase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_047815565.1 protein_id gnl|my_center|LOCUS_13500 >Feature sequence521 367 1083 gene locus_tag LOCUS_13510 367 1083 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13510 1002 1011 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence522 <1 1079 gene locus_tag LOCUS_13520 <1 1079 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012546373.1:cytochrome c peroxidase 1076 1684 gene locus_tag LOCUS_13530 1076 1684 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13530 >Feature sequence523 <1 801 gene locus_tag LOCUS_13540 <1 801 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189150.1:D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase >Feature sequence524 <1 840 gene locus_tag LOCUS_13550 <1 840 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004192799.1:RIP metalloprotease RseP >Feature sequence525 473 1138 gene locus_tag LOCUS_13560 gene fnr 473 1138 CDS product fumarate/nitrate reduction transcriptional regulator Fnr inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005662331.1 protein_id gnl|my_center|LOCUS_13560 1269 1592 gene locus_tag LOCUS_13570 1269 1592 CDS product YbjQ family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014207495.1 protein_id gnl|my_center|LOCUS_13570 >Feature sequence526 353 478 gene locus_tag LOCUS_13580 353 478 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13580 <1721 878 gene locus_tag LOCUS_13590 <1721 878 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein >Feature sequence527 385 996 gene locus_tag LOCUS_13600 gene gmk 385 996 CDS product guanylate kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001301691.1 protein_id gnl|my_center|LOCUS_13600 1637 999 gene locus_tag LOCUS_13610 gene pdxH 1637 999 CDS product pyridoxamine 5'-phosphate oxidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_001282834.1 protein_id gnl|my_center|LOCUS_13610 >Feature sequence528 >Feature sequence529 <1 503 gene locus_tag LOCUS_13620 <1 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207474.1:2-oxoglutarate dehydrogenase E1 component 500 1696 gene locus_tag LOCUS_13630 gene odhB 500 1696 CDS product 2-oxoglutarate dehydrogenase complex dihydrolipoyllysine-residue succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010946280.1 protein_id gnl|my_center|LOCUS_13630 >Feature sequence530 >Feature sequence531 378 1178 gene locus_tag LOCUS_13640 378 1178 CDS product 3'-5' exonuclease inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947138.1 protein_id gnl|my_center|LOCUS_13640 >Feature sequence532 >Feature sequence533 >Feature sequence534 119 1231 gene locus_tag LOCUS_13650 119 1231 CDS product DUF3549 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261355.1 protein_id gnl|my_center|LOCUS_13650 1666 1286 gene locus_tag LOCUS_13660 1666 1286 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13660 >Feature sequence535 <1700 990 gene locus_tag LOCUS_13670 <1700 990 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003118821.1:methylenetetrahydrofolate reductase [NAD(P)H] >Feature sequence536 1080 532 gene locus_tag LOCUS_13680 gene rfbC 1080 532 CDS product dTDP-4-dehydrorhamnose 3,5-epimerase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771397.1 protein_id gnl|my_center|LOCUS_13680 >Feature sequence537 750 268 gene locus_tag LOCUS_13690 750 268 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13690 1646 810 gene locus_tag LOCUS_13700 1646 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13700 >Feature sequence538 >Feature sequence539 685 329 gene locus_tag LOCUS_13710 685 329 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13710 <1694 1037 gene locus_tag LOCUS_13720 <1694 1037 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000647907.1:DUF1287 domain-containing protein >Feature sequence540 324 1301 gene locus_tag LOCUS_13730 gene rluD 324 1301 CDS product 23S rRNA pseudouridine(1911/1915/1917) synthase RluD inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011038203.1 protein_id gnl|my_center|LOCUS_13730 >Feature sequence541 582 1235 gene locus_tag LOCUS_13740 582 1235 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13740 1245 1574 gene locus_tag LOCUS_13750 1245 1574 CDS product DHCW motif cupin fold protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011816257.1 protein_id gnl|my_center|LOCUS_13750 >Feature sequence542 429 262 gene locus_tag LOCUS_13760 429 262 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13760 1375 668 gene locus_tag LOCUS_13770 1375 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13770 >Feature sequence543 585 848 gene locus_tag LOCUS_13780 585 848 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13780 >Feature sequence544 >Feature sequence545 320 604 gene locus_tag LOCUS_13790 320 604 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13790 670 1140 gene locus_tag LOCUS_13800 gene atpF 670 1140 CDS product F0F1 ATP synthase subunit B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011074334.1 protein_id gnl|my_center|LOCUS_13800 >Feature sequence546 259 1518 gene locus_tag LOCUS_13810 259 1518 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13810 >Feature sequence547 >Feature sequence548 753 1025 gene locus_tag LOCUS_13820 gene yccX 753 1025 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414772.1 protein_id gnl|my_center|LOCUS_13820 <1682 1057 gene locus_tag LOCUS_13830 <1682 1057 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000189743.1:ribose-5-phosphate isomerase RpiA >Feature sequence549 <1 721 gene locus_tag LOCUS_13840 <1 721 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011036651.1:S8 family serine peptidase <1680 797 gene locus_tag LOCUS_13850 <1680 797 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011104818.1:DNA polymerase IV >Feature sequence550 >Feature sequence551 1094 705 gene locus_tag LOCUS_13860 gene gcvH 1094 705 CDS product glycine cleavage system protein GcvH inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002222872.1 protein_id gnl|my_center|LOCUS_13860 <1671 1134 gene locus_tag LOCUS_13870 <1671 1134 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011705608.1:glycine cleavage system aminomethyltransferase GcvT >Feature sequence552 1651 344 gene locus_tag LOCUS_13880 gene carS 1651 344 CDS product two-component system sensor histidine kinase CarS inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003090493.1 protein_id gnl|my_center|LOCUS_13880 >Feature sequence553 <1666 873 gene locus_tag LOCUS_13890 <1666 873 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_235044973.1:formylglycine-generating enzyme family protein >Feature sequence554 >Feature sequence555 480 1457 gene locus_tag LOCUS_13900 480 1457 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_13900 >Feature sequence556 >Feature sequence557 >Feature sequence558 <1655 103 gene locus_tag LOCUS_13910 <1655 103 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073993.1:cell envelope integrity protein CreD >Feature sequence559 188 799 gene locus_tag LOCUS_13920 188 799 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13920 826 1608 gene locus_tag LOCUS_13930 826 1608 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_13930 >Feature sequence560 <1651 142 gene locus_tag LOCUS_13940 <1651 142 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393678.1:hydrogenase 4 subunit B >Feature sequence561 1246 935 gene locus_tag LOCUS_13950 gene rpsJ 1246 935 CDS product 30S ribosomal protein S10 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005307944.1 protein_id gnl|my_center|LOCUS_13950 >Feature sequence562 755 180 gene locus_tag LOCUS_13960 755 180 CDS product RNA polymerase sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010967076.1 protein_id gnl|my_center|LOCUS_13960 960 1403 gene locus_tag LOCUS_13970 960 1403 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011083828.1 protein_id gnl|my_center|LOCUS_13970 >Feature sequence563 >Feature sequence564 764 1126 gene locus_tag LOCUS_13980 gene rpsF 764 1126 CDS product 30S ribosomal protein S6 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119610.1 protein_id gnl|my_center|LOCUS_13980 1148 1375 gene locus_tag LOCUS_13990 gene rpsR 1148 1375 CDS product 30S ribosomal protein S18 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095634.1 protein_id gnl|my_center|LOCUS_13990 >Feature sequence565 977 204 gene locus_tag LOCUS_14000 gene tapF 977 204 CDS product PilW family type IVa pilus biogenesis/stability lipoprotein TapF inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705643.1 protein_id gnl|my_center|LOCUS_14000 <1647 1107 gene locus_tag LOCUS_14010 <1647 1107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002219171.1:23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN >Feature sequence566 <1 850 gene locus_tag LOCUS_14020 <1 850 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011105345.1:DUF2339 domain-containing protein 856 1167 gene locus_tag LOCUS_14030 856 1167 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14030 1150 1159 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence567 <1645 384 gene locus_tag LOCUS_14040 <1645 384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948668.1:F0F1 ATP synthase subunit alpha >Feature sequence568 >Feature sequence569 >Feature sequence570 >Feature sequence571 <1 1623 gene locus_tag LOCUS_14050 <1 1623 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010970236.1:alpha-D-glucose phosphate-specific phosphoglucomutase >Feature sequence572 >Feature sequence573 1107 304 gene locus_tag LOCUS_14060 1107 304 CDS product cytochrome c1 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070940.1 protein_id gnl|my_center|LOCUS_14060 <1631 1104 gene locus_tag LOCUS_14070 <1631 1104 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011070939.1:cytochrome bc complex cytochrome b subunit >Feature sequence574 241 1143 gene locus_tag LOCUS_14080 241 1143 CDS product cation transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004574643.1 protein_id gnl|my_center|LOCUS_14080 >Feature sequence575 >Feature sequence576 487 125 gene locus_tag LOCUS_14090 487 125 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14090 <1626 698 gene locus_tag LOCUS_14100 <1626 698 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003112812.1:slipin family protein >Feature sequence577 <1624 503 gene locus_tag LOCUS_14110 <1624 503 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002222867.1:electron transfer flavoprotein-ubiquinone oxidoreductase >Feature sequence578 185 907 gene locus_tag LOCUS_14120 185 907 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14120 1602 1072 gene locus_tag LOCUS_14130 1602 1072 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14130 >Feature sequence579 <1 1330 gene locus_tag LOCUS_14140 <1 1330 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011038259.1:SLC13 family permease >Feature sequence580 302 868 gene locus_tag LOCUS_14150 gene yeiP 302 868 CDS product elongation factor P-like protein YeiP inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011261881.1 protein_id gnl|my_center|LOCUS_14150 >Feature sequence581 <1 972 gene locus_tag LOCUS_14160 <1 972 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003095142.1:polynucleotide adenylyltransferase PcnB 965 1498 gene locus_tag LOCUS_14170 gene folK 965 1498 CDS product 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014208398.1 protein_id gnl|my_center|LOCUS_14170 >Feature sequence582 >Feature sequence583 210 1 gene locus_tag LOCUS_14180 210 1 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002720756.1 protein_id gnl|my_center|LOCUS_14180 <1603 432 gene locus_tag LOCUS_14190 <1603 432 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005455487.1:citrate synthase >Feature sequence584 <1603 535 gene locus_tag LOCUS_14200 <1603 535 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013222269.1:SCO0930 family lipoprotein >Feature sequence585 <1602 588 gene locus_tag LOCUS_14210 <1602 588 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011707291.1:UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase >Feature sequence586 <1 1088 gene locus_tag LOCUS_14220 <1 1088 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072042.1:sensor histidine kinase >Feature sequence587 <1 831 gene locus_tag LOCUS_14230 <1 831 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011390560.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence588 <1 899 gene locus_tag LOCUS_14240 <1 899 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011242253.1:23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD >Feature sequence589 >Feature sequence590 1251 469 gene locus_tag LOCUS_14250 1251 469 CDS product DNA-binding domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947962.1 protein_id gnl|my_center|LOCUS_14250 >Feature sequence591 >Feature sequence592 196 1158 gene locus_tag LOCUS_14260 196 1158 CDS product hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071169.1 protein_id gnl|my_center|LOCUS_14260 >Feature sequence593 518 201 gene locus_tag LOCUS_14270 518 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14270 818 582 gene locus_tag LOCUS_14280 818 582 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14280 <1580 1029 gene locus_tag LOCUS_14290 <1580 1029 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012061737.1:dTDP-glucose 4,6-dehydratase >Feature sequence594 <1578 612 gene locus_tag LOCUS_14300 <1578 612 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011963143.1:oleate hydratase >Feature sequence595 550 870 gene locus_tag LOCUS_14310 550 870 CDS product CBU_2076 family Dot/Icm type IV secretion system effector inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005769887.1 protein_id gnl|my_center|LOCUS_14310 1327 878 gene locus_tag LOCUS_14320 1327 878 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14320 >Feature sequence596 151 20 gene locus_tag LOCUS_14330 151 20 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14330 >Feature sequence597 <1 992 gene locus_tag LOCUS_14340 <1 992 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013095220.1:phosphopyruvate hydratase >Feature sequence598 1140 514 gene locus_tag LOCUS_14350 1140 514 CDS product TetR/AcrR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013532404.1 protein_id gnl|my_center|LOCUS_14350 >Feature sequence599 1195 173 gene locus_tag LOCUS_14360 1195 173 CDS product pteridine-dependent deoxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_162275502.1 protein_id gnl|my_center|LOCUS_14360 >Feature sequence600 3 176 gene locus_tag LOCUS_14370 3 176 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14370 176 379 gene locus_tag LOCUS_14380 176 379 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14380 340 349 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 352 1101 gene locus_tag LOCUS_14390 352 1101 CDS product slipin family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958256.1 protein_id gnl|my_center|LOCUS_14390 >Feature sequence601 1314 811 gene locus_tag LOCUS_14400 1314 811 CDS product glycosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143700.1 protein_id gnl|my_center|LOCUS_14400 >Feature sequence602 >Feature sequence603 419 1147 gene locus_tag LOCUS_14410 419 1147 CDS product spermidine synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011030151.1 protein_id gnl|my_center|LOCUS_14410 >Feature sequence604 681 1109 gene locus_tag LOCUS_14420 681 1109 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14420 1496 1026 gene locus_tag LOCUS_14430 1496 1026 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14430 >Feature sequence605 275 1210 gene locus_tag LOCUS_14440 275 1210 CDS product D-alanine--D-alanine ligase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003103113.1 protein_id gnl|my_center|LOCUS_14440 >Feature sequence606 >Feature sequence607 >Feature sequence608 280 1137 gene locus_tag LOCUS_14450 280 1137 CDS product ParB/RepB/Spo0J family partition protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003100240.1 protein_id gnl|my_center|LOCUS_14450 >Feature sequence609 1023 736 gene locus_tag LOCUS_14460 gene gatC 1023 736 CDS product Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555109.1 protein_id gnl|my_center|LOCUS_14460 1193 1202 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence610 >Feature sequence611 1486 335 gene locus_tag LOCUS_14470 1486 335 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14470 >Feature sequence612 489 722 gene locus_tag LOCUS_14480 489 722 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14480 >Feature sequence613 >Feature sequence614 <1 788 gene locus_tag LOCUS_14490 <1 788 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005647969.1:50S ribosomal protein L11 methyltransferase >Feature sequence615 1285 23 gene locus_tag LOCUS_14500 gene dsrA 1285 23 CDS product dissimilatory-type sulfite reductase subunit alpha inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932533.1 protein_id gnl|my_center|LOCUS_14500 >Feature sequence616 610 897 gene locus_tag LOCUS_14510 610 897 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14510 >Feature sequence617 <1 883 gene locus_tag LOCUS_14520 <1 883 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005480972.1:UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase 940 1410 gene locus_tag LOCUS_14530 gene fabZ 940 1410 CDS product 3-hydroxyacyl-ACP dehydratase FabZ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002554719.1 protein_id gnl|my_center|LOCUS_14530 >Feature sequence618 653 1252 gene locus_tag LOCUS_14540 653 1252 CDS product DUF4142 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004525579.1 protein_id gnl|my_center|LOCUS_14540 >Feature sequence619 378 16 gene locus_tag LOCUS_14550 378 16 CDS product roadblock/LC7 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002212575.1 protein_id gnl|my_center|LOCUS_14550 1100 564 gene locus_tag LOCUS_14560 1100 564 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14560 >Feature sequence620 >Feature sequence621 1526 219 gene locus_tag LOCUS_14570 gene purF 1526 219 CDS product amidophosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005068333.1 protein_id gnl|my_center|LOCUS_14570 >Feature sequence622 195 728 gene locus_tag LOCUS_14580 195 728 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14580 822 1304 gene locus_tag LOCUS_14590 gene iscR 822 1304 CDS product Fe-S cluster assembly transcriptional regulator IscR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004707916.1 protein_id gnl|my_center|LOCUS_14590 >Feature sequence623 80 1144 gene locus_tag LOCUS_14600 gene cax 80 1144 CDS product calcium/proton exchanger inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010887018.1 protein_id gnl|my_center|LOCUS_14600 1165 1174 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence624 >Feature sequence625 257 916 gene locus_tag LOCUS_14610 257 916 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003113991.1 protein_id gnl|my_center|LOCUS_14610 >Feature sequence626 <1 1122 gene locus_tag LOCUS_14620 <1 1122 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004527159.1:flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase >Feature sequence627 1086 406 gene locus_tag LOCUS_14630 1086 406 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14630 >Feature sequence628 730 203 gene locus_tag LOCUS_14640 730 203 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14640 <1512 796 gene locus_tag LOCUS_14650 <1512 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000476820.1:lytic murein transglycosylase B >Feature sequence629 >Feature sequence630 190 1113 gene locus_tag LOCUS_14660 190 1113 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_14660 1085 1276 gene locus_tag LOCUS_14670 1085 1276 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14670 1101 1110 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence631 1184 486 gene locus_tag LOCUS_14680 1184 486 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14680 >Feature sequence632 81 953 gene locus_tag LOCUS_14690 81 953 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14690 >Feature sequence633 >Feature sequence634 <1 1035 gene locus_tag LOCUS_14700 <1 1035 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010882798.1:SUMF1/EgtB/PvdO family nonheme iron enzyme >Feature sequence635 <1494 83 gene locus_tag LOCUS_14710 <1494 83 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_137607921.1:Ig-like domain-containing protein >Feature sequence636 <1 857 gene locus_tag LOCUS_14720 <1 857 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011969784.1:saccharopine dehydrogenase family protein >Feature sequence637 1315 797 gene locus_tag LOCUS_14730 1315 797 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14730 >Feature sequence638 289 762 gene locus_tag LOCUS_14740 289 762 CDS product rhodanese-like domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932524.1 protein_id gnl|my_center|LOCUS_14740 1484 786 gene locus_tag LOCUS_14750 1484 786 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14750 >Feature sequence639 452 1108 gene locus_tag LOCUS_14760 452 1108 CDS product HAD-IA family hydrolase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706174.1 protein_id gnl|my_center|LOCUS_14760 >Feature sequence640 239 991 gene locus_tag LOCUS_14770 gene mtgA 239 991 CDS product monofunctional biosynthetic peptidoglycan transglycosylase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098946.1 protein_id gnl|my_center|LOCUS_14770 >Feature sequence641 349 77 gene locus_tag LOCUS_14780 gene yccX 349 77 CDS product acylphosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000414772.1 protein_id gnl|my_center|LOCUS_14780 521 1408 gene locus_tag LOCUS_14790 521 1408 CDS product ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705176.1 protein_id gnl|my_center|LOCUS_14790 >Feature sequence642 >Feature sequence643 >Feature sequence644 >Feature sequence645 310 158 gene locus_tag LOCUS_14800 310 158 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14800 1103 621 gene locus_tag LOCUS_14810 1103 621 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14810 >Feature sequence646 228 1271 gene locus_tag LOCUS_14820 228 1271 CDS product VWA domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005477545.1 protein_id gnl|my_center|LOCUS_14820 >Feature sequence647 1056 364 gene locus_tag LOCUS_14830 1056 364 CDS product nucleotidyltransferase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002121402.1 protein_id gnl|my_center|LOCUS_14830 >Feature sequence648 888 286 gene locus_tag LOCUS_14840 gene rplD 888 286 CDS product 50S ribosomal protein L4 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555489.1 protein_id gnl|my_center|LOCUS_14840 <1472 910 gene locus_tag LOCUS_14850 <1472 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005456132.1:50S ribosomal protein L3 >Feature sequence649 >Feature sequence650 90 1325 gene locus_tag LOCUS_14860 90 1325 CDS product type II secretion system F family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011103349.1 protein_id gnl|my_center|LOCUS_14860 >Feature sequence651 307 804 gene locus_tag LOCUS_14870 307 804 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14870 <1467 794 gene locus_tag LOCUS_14880 <1467 794 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005479898.1:efflux RND transporter permease subunit >Feature sequence652 >Feature sequence653 <1459 502 gene locus_tag LOCUS_14890 <1459 502 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_013528466.1:cation diffusion facilitator family transporter >Feature sequence654 >Feature sequence655 <1 803 gene locus_tag LOCUS_14900 <1 803 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005070853.1:type IV pilus twitching motility protein PilT >Feature sequence656 1318 695 gene locus_tag LOCUS_14910 1318 695 CDS product SCO family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_235044988.1 protein_id gnl|my_center|LOCUS_14910 >Feature sequence657 <1 950 gene locus_tag LOCUS_14920 <1 950 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164926971.1:thiosulfohydrolase SoxB >Feature sequence658 118 1236 gene locus_tag LOCUS_14930 118 1236 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14930 >Feature sequence659 102 1049 gene locus_tag LOCUS_14940 102 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14940 >Feature sequence660 >Feature sequence661 >Feature sequence662 >Feature sequence663 413 1291 gene locus_tag LOCUS_14950 413 1291 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14950 1270 1279 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence664 412 1341 gene locus_tag LOCUS_14960 gene ilvE 412 1341 CDS product branched-chain-amino-acid transaminase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003095783.1 protein_id gnl|my_center|LOCUS_14960 >Feature sequence665 <1 637 gene locus_tag LOCUS_14970 <1 637 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011267592.1:RHS repeat-associated core domain-containing protein 1111 893 gene locus_tag LOCUS_14980 1111 893 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14980 >Feature sequence666 226 71 gene locus_tag LOCUS_14990 226 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_14990 291 854 gene locus_tag LOCUS_15000 291 854 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15000 <1421 868 gene locus_tag LOCUS_15010 <1421 868 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_226990809.1:IS630-like element ISMac18 family transposase >Feature sequence667 992 186 gene locus_tag LOCUS_15020 gene suhB 992 186 CDS product inositol-phosphate phosphatase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003092845.1 protein_id gnl|my_center|LOCUS_15020 >Feature sequence668 2 1306 gene locus_tag LOCUS_15030 2 1306 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15030 >Feature sequence669 420 160 gene locus_tag LOCUS_15040 420 160 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15040 >Feature sequence670 368 1321 gene locus_tag LOCUS_15050 gene ispH 368 1321 CDS product 4-hydroxy-3-methylbut-2-enyl diphosphate reductase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112824.1 protein_id gnl|my_center|LOCUS_15050 >Feature sequence671 1273 224 gene locus_tag LOCUS_15060 1273 224 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15060 >Feature sequence672 951 196 gene locus_tag LOCUS_15070 951 196 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15070 1373 1116 gene locus_tag LOCUS_15080 gene minE 1373 1116 CDS product cell division topological specificity factor MinE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005458079.1 protein_id gnl|my_center|LOCUS_15080 >Feature sequence673 <1411 175 gene locus_tag LOCUS_15090 <1411 175 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011073358.1:PilC/PilY family type IV pilus protein >Feature sequence674 <1 641 gene locus_tag LOCUS_15100 <1 641 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772336.1:alanine racemase 825 1340 gene locus_tag LOCUS_15110 825 1340 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15110 >Feature sequence675 <1402 487 gene locus_tag LOCUS_15120 <1402 487 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071797.1:lipid-A-disaccharide synthase >Feature sequence676 >Feature sequence677 71 349 gene locus_tag LOCUS_15130 71 349 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15130 778 1215 gene locus_tag LOCUS_15140 778 1215 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15140 >Feature sequence678 >Feature sequence679 1064 327 gene locus_tag LOCUS_15150 gene lptB 1064 327 CDS product LPS export ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005620338.1 protein_id gnl|my_center|LOCUS_15150 >Feature sequence680 >Feature sequence681 >Feature sequence682 >Feature sequence683 >Feature sequence684 1241 228 gene locus_tag LOCUS_15160 1241 228 CDS product rod shape-determining protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010880512.1 protein_id gnl|my_center|LOCUS_15160 >Feature sequence685 993 160 gene locus_tag LOCUS_15170 993 160 CDS product BPSS1780 family membrane protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011706977.1 protein_id gnl|my_center|LOCUS_15170 >Feature sequence686 990 346 gene locus_tag LOCUS_15180 gene phnC 990 346 CDS product phosphonate ABC transporter ATP-binding protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_024311734.1 protein_id gnl|my_center|LOCUS_15180 >Feature sequence687 >Feature sequence688 >Feature sequence689 543 1226 gene locus_tag LOCUS_15190 543 1226 CDS product YggS family pyridoxal phosphate-dependent enzyme inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004194162.1 protein_id gnl|my_center|LOCUS_15190 >Feature sequence690 1148 204 gene locus_tag LOCUS_15200 1148 204 CDS product copper resistance protein B inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003109652.1 protein_id gnl|my_center|LOCUS_15200 >Feature sequence691 413 210 gene locus_tag LOCUS_15210 gene rpmF 413 210 CDS product 50S ribosomal protein L32 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771287.1 protein_id gnl|my_center|LOCUS_15210 1051 479 gene locus_tag LOCUS_15220 1051 479 CDS product YceD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003390869.1 protein_id gnl|my_center|LOCUS_15220 >Feature sequence692 691 53 gene locus_tag LOCUS_15230 691 53 CDS product glutathione binding-like protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000565042.1 protein_id gnl|my_center|LOCUS_15230 >Feature sequence693 >Feature sequence694 963 634 gene locus_tag LOCUS_15240 963 634 CDS product SMR family transporter inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814037.1 protein_id gnl|my_center|LOCUS_15240 1364 969 gene locus_tag LOCUS_15250 1364 969 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15250 >Feature sequence695 473 1201 gene locus_tag LOCUS_15260 473 1201 CDS product arginyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108766.1 protein_id gnl|my_center|LOCUS_15260 >Feature sequence696 207 7 gene locus_tag LOCUS_15270 gene csrA 207 7 CDS product carbon storage regulator CsrA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003085981.1 protein_id gnl|my_center|LOCUS_15270 <1364 357 gene locus_tag LOCUS_15280 <1364 357 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003369901.1:aspartate kinase >Feature sequence697 >Feature sequence698 <1 1249 gene locus_tag LOCUS_15290 <1 1249 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011391322.1:acetate--CoA ligase >Feature sequence699 >Feature sequence700 908 1285 gene locus_tag LOCUS_15300 908 1285 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15300 >Feature sequence701 >Feature sequence702 199 756 gene locus_tag LOCUS_15310 gene rimM 199 756 CDS product ribosome maturation factor RimM inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071567.1 protein_id gnl|my_center|LOCUS_15310 >Feature sequence703 578 159 gene locus_tag LOCUS_15320 578 159 CDS product RDD family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_094122848.1 protein_id gnl|my_center|LOCUS_15320 1128 691 gene locus_tag LOCUS_15330 1128 691 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15330 >Feature sequence704 653 474 gene locus_tag LOCUS_15340 653 474 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15340 890 1090 gene locus_tag LOCUS_15350 890 1090 CDS product DUF2892 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011073000.1 protein_id gnl|my_center|LOCUS_15350 >Feature sequence705 <1 562 gene locus_tag LOCUS_15360 <1 562 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002853196.1:response regulator transcription factor >Feature sequence706 <1 910 gene locus_tag LOCUS_15370 <1 910 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011192505.1:two-component system sensor histidine kinase RstB >Feature sequence707 >Feature sequence708 830 69 gene locus_tag LOCUS_15380 830 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15380 1021 1239 gene locus_tag LOCUS_15390 1021 1239 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15390 >Feature sequence709 <1349 350 gene locus_tag LOCUS_15400 <1349 350 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_064987376.1:IS1380 family transposase >Feature sequence710 685 71 gene locus_tag LOCUS_15410 685 71 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15410 254 263 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence711 611 159 gene locus_tag LOCUS_15420 611 159 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15420 >Feature sequence712 476 222 gene locus_tag LOCUS_15430 476 222 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15430 232 241 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 1226 486 gene locus_tag LOCUS_15440 gene phoU 1226 486 CDS product phosphate signaling complex protein PhoU inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005334097.1 protein_id gnl|my_center|LOCUS_15440 >Feature sequence713 >Feature sequence714 >Feature sequence715 <1339 479 gene locus_tag LOCUS_15450 <1339 479 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_007245851.1:VWA domain-containing protein >Feature sequence716 147 530 gene locus_tag LOCUS_15460 gene mutT 147 530 CDS product 8-oxo-dGTP diphosphatase MutT inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070770.1 protein_id gnl|my_center|LOCUS_15460 <1338 796 gene locus_tag LOCUS_15470 <1338 796 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003091003.1:PLP-dependent aminotransferase family protein >Feature sequence717 <1336 549 gene locus_tag LOCUS_15480 <1336 549 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004343881.1:autotransporter assembly complex family protein >Feature sequence718 225 1124 gene locus_tag LOCUS_15490 gene dapD 225 1124 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003976903.1 protein_id gnl|my_center|LOCUS_15490 >Feature sequence719 1267 41 gene locus_tag LOCUS_15500 1267 41 CDS product IS256 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002209743.1 protein_id gnl|my_center|LOCUS_15500 >Feature sequence720 293 805 gene locus_tag LOCUS_15510 293 805 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15510 >Feature sequence721 58 279 gene locus_tag LOCUS_15520 58 279 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15520 >Feature sequence722 >Feature sequence723 >Feature sequence724 >Feature sequence725 1275 718 gene locus_tag LOCUS_15530 1275 718 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15530 >Feature sequence726 >Feature sequence727 <1315 790 gene locus_tag LOCUS_15540 <1315 790 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_012256391.1:ABC transporter ATP-binding protein >Feature sequence728 >Feature sequence729 >Feature sequence730 >Feature sequence731 >Feature sequence732 131 1297 gene locus_tag LOCUS_15550 gene dnaJ 131 1297 CDS product molecular chaperone DnaJ inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_015368350.1 protein_id gnl|my_center|LOCUS_15550 >Feature sequence733 <1309 551 gene locus_tag LOCUS_15560 <1309 551 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010932547.1:CoB--CoM heterodisulfide reductase iron-sulfur subunit A family protein >Feature sequence734 >Feature sequence735 193 1278 gene locus_tag LOCUS_15570 193 1278 CDS product beta-N-acetylglucosaminidase domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011705374.1 protein_id gnl|my_center|LOCUS_15570 >Feature sequence736 >Feature sequence737 >Feature sequence738 >Feature sequence739 <1 665 gene locus_tag LOCUS_15580 <1 665 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003815301.1:copper resistance system multicopper oxidase >Feature sequence740 >Feature sequence741 <1 764 gene locus_tag LOCUS_15590 <1 764 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010948436.1:heme biosynthesis HemY N-terminal domain-containing protein >Feature sequence742 >Feature sequence743 >Feature sequence744 <1291 254 gene locus_tag LOCUS_15600 <1291 254 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010943867.1:glycoside hydrolase family 57 protein >Feature sequence745 >Feature sequence746 <1290 401 gene locus_tag LOCUS_15610 <1290 401 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099665.1:GTP cyclohydrolase FolE2 >Feature sequence747 >Feature sequence748 <1 700 gene locus_tag LOCUS_15620 <1 700 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388348.1:ABC transporter permease subunit >Feature sequence749 930 52 gene locus_tag LOCUS_15630 930 52 CDS product IS3 family transposase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_102990622.1 note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15630 1220 927 gene locus_tag LOCUS_15640 1220 927 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_15640 >Feature sequence750 422 1237 gene locus_tag LOCUS_15650 422 1237 CDS product cell division protein FtsQ/DivIB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011035965.1 protein_id gnl|my_center|LOCUS_15650 >Feature sequence751 >Feature sequence752 372 1250 gene locus_tag LOCUS_15660 372 1250 CDS product sulfotransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011403760.1 protein_id gnl|my_center|LOCUS_15660 >Feature sequence753 <1 1264 gene locus_tag LOCUS_15670 <1 1264 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011393130.1:hydrogenobyrinic acid a,c-diamide synthase (glutamine-hydrolyzing) >Feature sequence754 1158 1234 gene locus_tag LOCUS_t00140 1158 1234 tRNA product tRNA-Pro inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence755 301 936 gene locus_tag LOCUS_15680 301 936 CDS product Crp/Fnr family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012257162.1 protein_id gnl|my_center|LOCUS_15680 >Feature sequence756 >Feature sequence757 >Feature sequence758 458 201 gene locus_tag LOCUS_15690 458 201 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15690 >Feature sequence759 <1275 485 gene locus_tag LOCUS_15700 <1275 485 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704183.1:bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase >Feature sequence760 112 1071 gene locus_tag LOCUS_15710 gene lipA 112 1071 CDS product lipoyl synthase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555327.1 protein_id gnl|my_center|LOCUS_15710 >Feature sequence761 1063 5 gene locus_tag LOCUS_15720 gene lpxK 1063 5 CDS product tetraacyldisaccharide 4'-kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010947544.1 protein_id gnl|my_center|LOCUS_15720 1270 1148 gene locus_tag LOCUS_15730 1270 1148 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15730 >Feature sequence762 361 1248 gene locus_tag LOCUS_15740 361 1248 CDS product fructosamine kinase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011143165.1 protein_id gnl|my_center|LOCUS_15740 >Feature sequence763 640 167 gene locus_tag LOCUS_15750 gene tadA 640 167 CDS product tRNA adenosine(34) deaminase TadA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013098309.1 protein_id gnl|my_center|LOCUS_15750 <1265 723 gene locus_tag LOCUS_15760 <1265 723 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003105901.1:glutamine-hydrolyzing GMP synthase >Feature sequence764 1129 233 gene locus_tag LOCUS_15770 1129 233 CDS product LysR family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_007245106.1 protein_id gnl|my_center|LOCUS_15770 >Feature sequence765 502 807 gene locus_tag LOCUS_15780 gene rpsN 502 807 CDS product 30S ribosomal protein S14 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003093701.1 protein_id gnl|my_center|LOCUS_15780 824 1216 gene locus_tag LOCUS_15790 gene rpsH 824 1216 CDS product 30S ribosomal protein S8 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005174622.1 protein_id gnl|my_center|LOCUS_15790 >Feature sequence766 63 698 gene locus_tag LOCUS_15800 63 698 CDS product uracil-DNA glycosylase family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002761477.1 protein_id gnl|my_center|LOCUS_15800 >Feature sequence767 >Feature sequence768 1106 234 gene locus_tag LOCUS_15810 1106 234 CDS product AraC family transcriptional regulator inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037394087.1 protein_id gnl|my_center|LOCUS_15810 >Feature sequence769 >Feature sequence770 120 368 gene locus_tag LOCUS_15820 120 368 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15820 280 289 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends <1244 393 gene locus_tag LOCUS_15830 <1244 393 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000427574.1:SLC13 family permease >Feature sequence771 <1 620 gene locus_tag LOCUS_15840 <1 620 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005772032.1:DNA repair protein RecO >Feature sequence772 <1 888 gene locus_tag LOCUS_15850 <1 888 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164920818.1:MotA/TolQ/ExbB proton channel family protein >Feature sequence773 230 970 gene locus_tag LOCUS_15860 gene istB 230 970 CDS product IS21-like element helper ATPase IstB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011391832.1 protein_id gnl|my_center|LOCUS_15860 >Feature sequence774 142 1062 gene locus_tag LOCUS_15870 142 1062 CDS product NAD(+)/NADH kinase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963224.1 protein_id gnl|my_center|LOCUS_15870 >Feature sequence775 >Feature sequence776 <1230 528 gene locus_tag LOCUS_15880 <1230 528 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005614914.1:penicillin-binding protein 1B >Feature sequence777 <1 743 gene locus_tag LOCUS_15890 <1 743 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010973612.1:saccharopine dehydrogenase family protein >Feature sequence778 1201 677 gene locus_tag LOCUS_15900 1201 677 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15900 >Feature sequence779 >Feature sequence780 42 863 gene locus_tag LOCUS_15910 gene dapD 42 863 CDS product 2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013095650.1 protein_id gnl|my_center|LOCUS_15910 >Feature sequence781 >Feature sequence782 <1215 7 gene locus_tag LOCUS_15920 <1215 7 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_072721720.1:DUF2330 domain-containing protein >Feature sequence783 >Feature sequence784 >Feature sequence785 <1211 609 gene locus_tag LOCUS_15930 <1211 609 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011071681.1:glucose-1-phosphate adenylyltransferase >Feature sequence786 <1 529 gene locus_tag LOCUS_15940 <1 529 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_001093087.1:dicarboxylate/amino acid:cation symporter >Feature sequence787 725 30 gene locus_tag LOCUS_15950 725 30 CDS product response regulator transcription factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_037401395.1 protein_id gnl|my_center|LOCUS_15950 >Feature sequence788 389 398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence789 >Feature sequence790 <1202 453 gene locus_tag LOCUS_15960 <1202 453 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011704449.1:tyrosine recombinase XerC >Feature sequence791 >Feature sequence792 >Feature sequence793 35 847 gene locus_tag LOCUS_15970 35 847 CDS product fatty acid desaturase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003818344.1 protein_id gnl|my_center|LOCUS_15970 1146 829 gene locus_tag LOCUS_15980 1146 829 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_15980 >Feature sequence794 >Feature sequence795 <1196 107 gene locus_tag LOCUS_15990 <1196 107 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011121322.1:diaminobutyrate--2-oxoglutarate transaminase >Feature sequence796 <1196 384 gene locus_tag LOCUS_16000 <1196 384 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880808.1:SulP family inorganic anion transporter >Feature sequence797 >Feature sequence798 367 855 gene locus_tag LOCUS_16010 gene moaC 367 855 CDS product cyclic pyranopterin monophosphate synthase MoaC inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004535462.1 protein_id gnl|my_center|LOCUS_16010 >Feature sequence799 1179 469 gene locus_tag LOCUS_16020 gene dnaQ 1179 469 CDS product DNA polymerase III subunit epsilon inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011267225.1 protein_id gnl|my_center|LOCUS_16020 >Feature sequence800 434 820 gene locus_tag LOCUS_16030 gene sdhD 434 820 CDS product succinate dehydrogenase, hydrophobic membrane anchor protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013528875.1 protein_id gnl|my_center|LOCUS_16030 >Feature sequence801 <1192 490 gene locus_tag LOCUS_16040 <1192 490 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704857.1:response regulator transcription factor >Feature sequence802 1117 947 gene locus_tag LOCUS_16050 1117 947 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16050 >Feature sequence803 >Feature sequence804 <1 563 gene locus_tag LOCUS_16060 <1 563 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011263885.1:acetyltransferase <1188 550 gene locus_tag LOCUS_16070 <1188 550 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_162992427.1:phosphoethanolamine--lipid A transferase >Feature sequence805 >Feature sequence806 >Feature sequence807 <1185 346 gene locus_tag LOCUS_16080 <1185 346 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004204967.1:alanine--tRNA ligase >Feature sequence808 164 931 gene locus_tag LOCUS_16090 164 931 CDS product zinc-dependent peptidase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_004192554.1 protein_id gnl|my_center|LOCUS_16090 >Feature sequence809 >Feature sequence810 782 132 gene locus_tag LOCUS_16100 gene coq7 782 132 CDS product 2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002119684.1 protein_id gnl|my_center|LOCUS_16100 >Feature sequence811 >Feature sequence812 >Feature sequence813 163 1005 gene locus_tag LOCUS_16110 163 1005 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16110 >Feature sequence814 >Feature sequence815 >Feature sequence816 1 573 gene locus_tag LOCUS_16120 1 573 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16120 476 485 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends 593 931 gene locus_tag LOCUS_16130 593 931 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16130 >Feature sequence817 >Feature sequence818 228 971 gene locus_tag LOCUS_16140 228 971 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, internal stop codon, frameshifted protein_id gnl|my_center|LOCUS_16140 >Feature sequence819 >Feature sequence820 >Feature sequence821 >Feature sequence822 885 88 gene locus_tag LOCUS_16150 885 88 CDS product sulfite exporter TauE/SafE family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011963923.1 protein_id gnl|my_center|LOCUS_16150 >Feature sequence823 >Feature sequence824 724 146 gene locus_tag LOCUS_16160 gene sodB 724 146 CDS product superoxide dismutase [Fe] inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000007283.1 protein_id gnl|my_center|LOCUS_16160 >Feature sequence825 >Feature sequence826 <1151 386 gene locus_tag LOCUS_16170 <1151 386 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072827.1:TIGR01777 family oxidoreductase >Feature sequence827 106 810 gene locus_tag LOCUS_16180 106 810 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16180 >Feature sequence828 68 646 gene locus_tag LOCUS_16190 68 646 CDS product DUF2062 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091165.1 protein_id gnl|my_center|LOCUS_16190 >Feature sequence829 <1 733 gene locus_tag LOCUS_16200 <1 733 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003111201.1:shikimate dehydrogenase >Feature sequence830 418 1146 gene locus_tag LOCUS_16210 418 1146 CDS product ComF family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005763760.1 protein_id gnl|my_center|LOCUS_16210 >Feature sequence831 <1146 501 gene locus_tag LOCUS_16220 <1146 501 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002808458.1:response regulator transcription factor >Feature sequence832 >Feature sequence833 <1144 247 gene locus_tag LOCUS_16230 <1144 247 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011027439.1:ergothioneine biosynthesis protein EgtB >Feature sequence834 <1143 566 gene locus_tag LOCUS_16240 <1143 566 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113932.1:CvpA family protein >Feature sequence835 >Feature sequence836 726 962 gene locus_tag LOCUS_16250 726 962 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16250 >Feature sequence837 179 526 gene locus_tag LOCUS_16260 179 526 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16260 >Feature sequence838 309 884 gene locus_tag LOCUS_16270 309 884 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16270 >Feature sequence839 >Feature sequence840 399 408 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence841 <1137 422 gene locus_tag LOCUS_16280 <1137 422 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_002225189.1:nitrate/nitrite sensor histidine kinase >Feature sequence842 >Feature sequence843 >Feature sequence844 767 462 gene locus_tag LOCUS_16290 767 462 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16290 >Feature sequence845 380 814 gene locus_tag LOCUS_16300 380 814 CDS product DUF1841 family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003814061.1 protein_id gnl|my_center|LOCUS_16300 >Feature sequence846 >Feature sequence847 >Feature sequence848 559 473 gene locus_tag LOCUS_t00150 559 473 tRNA product tRNA-Leu inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence849 >Feature sequence850 >Feature sequence851 >Feature sequence852 707 168 gene locus_tag LOCUS_16310 707 168 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16310 >Feature sequence853 >Feature sequence854 480 100 gene locus_tag LOCUS_16320 gene secE 480 100 CDS product preprotein translocase subunit SecE inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003108030.1 protein_id gnl|my_center|LOCUS_16320 637 561 gene locus_tag LOCUS_t00160 637 561 tRNA product tRNA-Trp inference COORDINATES:profile:Aragorn:1.2.38 >Feature sequence855 >Feature sequence856 <1115 387 gene locus_tag LOCUS_16330 <1115 387 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003099579.1:YeaH/YhbH family protein >Feature sequence857 99 809 gene locus_tag LOCUS_16340 99 809 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16340 >Feature sequence858 895 119 gene locus_tag LOCUS_16350 895 119 CDS product anti-sigma factor inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_014328893.1 protein_id gnl|my_center|LOCUS_16350 >Feature sequence859 765 250 gene locus_tag LOCUS_16360 gene secB 765 250 CDS product protein-export chaperone SecB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003096050.1 protein_id gnl|my_center|LOCUS_16360 1111 770 gene locus_tag LOCUS_16370 1111 770 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16370 >Feature sequence860 <1 1100 gene locus_tag LOCUS_16380 <1 1100 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011986138.1:ArsB/NhaD family transporter >Feature sequence861 >Feature sequence862 484 412 gene locus_tag LOCUS_t00170 484 412 tRNA product tRNA-Met inference COORDINATES:profile:Aragorn:1.2.38 737 546 gene locus_tag LOCUS_16390 737 546 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16390 >Feature sequence863 <1109 468 gene locus_tag LOCUS_16400 <1109 468 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011403251.1:efflux RND transporter permease subunit note possible pseudo, frameshifted 475 484 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence864 >Feature sequence865 >Feature sequence866 1067 534 gene locus_tag LOCUS_16410 gene cobU 1067 534 CDS product bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003082599.1 protein_id gnl|my_center|LOCUS_16410 >Feature sequence867 >Feature sequence868 >Feature sequence869 476 784 gene locus_tag LOCUS_16420 476 784 CDS product DUF1244 domain-containing protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003091898.1 protein_id gnl|my_center|LOCUS_16420 >Feature sequence870 >Feature sequence871 <1099 446 gene locus_tag LOCUS_16430 <1099 446 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010938585.1:[DsrC]-trisulfide reductase DsrK >Feature sequence872 <1099 86 gene locus_tag LOCUS_16440 <1099 86 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_000140318.1:30S ribosomal protein S1 >Feature sequence873 >Feature sequence874 924 388 gene locus_tag LOCUS_16450 924 388 CDS product adenine phosphoribosyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000029425.1 protein_id gnl|my_center|LOCUS_16450 >Feature sequence875 <1095 210 gene locus_tag LOCUS_16460 <1095 210 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010880142.1:efflux RND transporter periplasmic adaptor subunit >Feature sequence876 >Feature sequence877 282 575 gene locus_tag LOCUS_16470 282 575 CDS product GIY-YIG nuclease family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010958388.1 protein_id gnl|my_center|LOCUS_16470 >Feature sequence878 >Feature sequence879 706 266 gene locus_tag LOCUS_16480 gene aroQ 706 266 CDS product type II 3-dehydroquinate dehydratase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_002555369.1 protein_id gnl|my_center|LOCUS_16480 >Feature sequence880 >Feature sequence881 >Feature sequence882 >Feature sequence883 >Feature sequence884 >Feature sequence885 <1 861 gene locus_tag LOCUS_16490 <1 861 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005477226.1:nodulation protein NfeD 861 1001 gene locus_tag LOCUS_16500 861 1001 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16500 >Feature sequence886 559 960 gene locus_tag LOCUS_16510 559 960 CDS product OsmC family protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_013227914.1 protein_id gnl|my_center|LOCUS_16510 >Feature sequence887 >Feature sequence888 823 128 gene locus_tag LOCUS_16520 823 128 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16520 >Feature sequence889 >Feature sequence890 >Feature sequence891 463 762 gene locus_tag LOCUS_16530 463 762 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16530 856 1050 gene locus_tag LOCUS_16540 856 1050 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16540 >Feature sequence892 <1072 132 gene locus_tag LOCUS_16550 <1072 132 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011072968.1:aspartate-semialdehyde dehydrogenase >Feature sequence893 >Feature sequence894 >Feature sequence895 180 1049 gene locus_tag LOCUS_16560 180 1049 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16560 >Feature sequence896 214 522 gene locus_tag LOCUS_16570 gene tusB 214 522 CDS product sulfurtransferase complex subunit TusB inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_010932538.1 protein_id gnl|my_center|LOCUS_16570 650 982 gene locus_tag LOCUS_16580 650 982 CDS product TusE/DsrC/DsvC family sulfur relay protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_012546467.1 protein_id gnl|my_center|LOCUS_16580 >Feature sequence897 >Feature sequence898 347 751 gene locus_tag LOCUS_16590 gene hslR 347 751 CDS product ribosome-associated heat shock protein Hsp15 inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_000660485.1 protein_id gnl|my_center|LOCUS_16590 >Feature sequence899 <1060 292 gene locus_tag LOCUS_16600 <1060 292 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189156.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence900 616 110 gene locus_tag LOCUS_16610 gene ybeY 616 110 CDS product rRNA maturation RNase YbeY inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011071410.1 protein_id gnl|my_center|LOCUS_16610 >Feature sequence901 <1058 469 gene locus_tag LOCUS_16620 <1058 469 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_015704836.1:molybdopterin molybdotransferase MoeA >Feature sequence902 <1049 238 gene locus_tag LOCUS_16630 <1049 238 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_014207442.1:lytic transglycosylase domain-containing protein >Feature sequence903 <1048 329 gene locus_tag LOCUS_16640 <1048 329 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_004189366.1:transporter associated domain-containing protein >Feature sequence904 >Feature sequence905 >Feature sequence906 899 270 gene locus_tag LOCUS_16650 gene sspA 899 270 CDS product stringent starvation protein SspA inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011070941.1 protein_id gnl|my_center|LOCUS_16650 >Feature sequence907 >Feature sequence908 693 175 gene locus_tag LOCUS_16660 693 175 CDS product glycine cleavage system protein R inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_011269179.1 protein_id gnl|my_center|LOCUS_16660 1040 729 gene locus_tag LOCUS_16670 1040 729 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16670 >Feature sequence909 >Feature sequence910 >Feature sequence911 >Feature sequence912 <1 815 gene locus_tag LOCUS_16680 <1 815 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_010941915.1:FtsX-like permease family protein 396 405 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence913 >Feature sequence914 >Feature sequence915 <1031 116 gene locus_tag LOCUS_16690 <1031 116 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005766682.1:cobyric acid synthase >Feature sequence916 3 668 gene locus_tag LOCUS_16700 3 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16700 >Feature sequence917 >Feature sequence918 599 87 gene locus_tag LOCUS_16710 gene nrdR 599 87 CDS product transcriptional regulator NrdR inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_005771735.1 protein_id gnl|my_center|LOCUS_16710 >Feature sequence919 >Feature sequence920 <1 625 gene locus_tag LOCUS_16720 <1 625 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_011388350.1:peptide ABC transporter substrate-binding protein >Feature sequence921 384 668 gene locus_tag LOCUS_16730 384 668 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator note possible pseudo, frameshifted protein_id gnl|my_center|LOCUS_16730 389 398 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence922 <1023 157 gene locus_tag LOCUS_16740 <1023 157 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_003113366.1:siroheme synthase CysG >Feature sequence923 >Feature sequence924 <1 933 gene locus_tag LOCUS_16750 <1 933 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_164924829.1:sigma-54 dependent transcriptional regulator >Feature sequence925 >Feature sequence926 1013 102 gene locus_tag LOCUS_16760 1013 102 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16760 >Feature sequence927 >Feature sequence928 <1 984 gene locus_tag LOCUS_16770 <1 984 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_068497115.1:cytochrome D1 domain-containing protein >Feature sequence929 546 555 assembly_gap estimated_length known gap_type within scaffold linkage_evidence paired-ends >Feature sequence930 >Feature sequence931 >Feature sequence932 810 172 gene locus_tag LOCUS_16780 gene purN 810 172 CDS product phosphoribosylglycinamide formyltransferase inference COORDINATES:ab initio prediction:MetaGeneAnnotator inference similar to AA sequence:RefSeq:WP_003112584.1 protein_id gnl|my_center|LOCUS_16780 >Feature sequence933 >Feature sequence934 >Feature sequence935 >Feature sequence936 >Feature sequence937 >Feature sequence938 749 69 gene locus_tag LOCUS_16790 749 69 CDS product hypothetical protein inference COORDINATES:ab initio prediction:MetaGeneAnnotator protein_id gnl|my_center|LOCUS_16790 >Feature sequence939 <1000 207 gene locus_tag LOCUS_16800 <1000 207 misc_feature inference COORDINATES:ab initio prediction:MetaGeneAnnotator note partial CDS similar to WP_005482627.1:CusA/CzcA family heavy metal efflux RND transporter >Feature sequence940